Saccharomyces cerevisiae Yta7 Regulates Histone Gene Expression

Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA.
Genetics (Impact Factor: 5.96). 06/2008; 179(1):291-304. DOI: 10.1534/genetics.107.086520
Source: PubMed
ABSTRACT
The Saccharomyces cerevisiae Yta7 protein is a component of a nucleosome bound protein complex that maintains distinct transcriptional zones of chromatin. We previously found that one protein copurifying with Yta7 is the yFACT member Spt16. Epistasis analyses revealed a link between Yta7, Spt16, and other previously identified members of the histone regulatory pathway. In concurrence, Yta7 was found to regulate histone gene transcription in a cell-cycle-dependent manner. Association at the histone gene loci appeared to occur through binding of the bromodomain-like region of Yta7 with the N-terminal tail of histone H3. Our work suggests a mechanism in which Yta7 is localized to chromatin to establish regions of transcriptional silencing, and that one facet of this cellular mechanism is to modulate transcription of histone genes.

Full-text

Available from: Richard Scott Rogers, Jun 15, 2015
Copyright Ó 2008 by the Genetics Society of America
DOI: 10.1534/genetics.107.086520
Saccharomyces cerevisiae Yta7 Regulates Histone Gene Expression
Angeline Gradolatto,* Richard S. Rogers,
Heather Lavender,* Sean D. Taverna,
C. David Allis,
John D. Aitchison
and Alan J. Tackett*
,1
*Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205,
Institute for Systems Biology, Seattle, Washington 98103 and
The Rockefeller University, New York, New York 10065
Manuscript received December 28, 2007
Accepted for publication February 22, 2008
ABSTRACT
The Saccharomyces cerevisiae Yta7 protein is a component of a nucleosome bound protein complex that
maintains distinct transcriptional zones of chromatin. We previously found that one protein copurifying
with Yta7 is the yFACT member Spt16. Epistasis analyses revealed a link between Yta7, Spt16, and other
previously identified members of the histone regulatory pathway. In concurrence, Yta7 was found to reg-
ulate histone gene transcription in a cell-cycle-dependent manner. Association at the histone gene loci
appeared to occur through binding of the bromodomain-like region of Yta7 with the N-terminal tail of
histone H3. Our work suggests a mechanism in which Yta7 is localized to chromatin to establish regions
of transcriptional silencing, and that one facet of this cellular mechanism is to modulate transcription of
histone genes.
D
IFFERENT regulatory mechanisms are involved in
the cell cycle control of gene transcription. Many
of these pathways are centered around the regulation
of chromatin and the histone epigenetic status (Berger
2007; Li et al. 2007). ATP-dependent and -independent
chromatin remodeling provides for the physical rear-
rangement of nucleosomes and accessibility to un-
derlying DNA (Cairns 2005). Furthermore, histones
can be dynamically cycled out of chromatin to define
chromosomal features such as active promoters and
chromatin boundary elements (Dion et al. 2007; Jamai
et al. 2007; Rufiange et al. 2007). They can even be
replaced by histone variants to regulate transcription
(Li et al. 2007). A more combinatorial process of tran-
scriptional regulation is the post-translational modifica-
tion (PTM) of histones (Goldberg et al. 2007; Kouzarides
2007). Certain histone PTMs serve as binding sites
for recruitment of ‘effector’ protein complexes that
modulate gene transcription. For example, the Yng1
component from the NuA3 histone acetyltransferase
binds to lysine 4 trimethylated histone H3 to provide
for histone H3 lysine 14 acetylation and transcriptional
activation (Taverna et al. 2006). Transcriptional regu-
lation through chromatin is undoubtedly a complex
system of events that remain to be fully explored.
In previous work, we described a novel transcriptional
role for the yeast tat-binding analog 7 (Yta7) (Tackett
et al. 2005). We found that Yta7 maintains the transition
region (or barrier) between heterochromatin and eu-
chromatin upstream of the silent HMR locus (Tackett
et al. 2005). Deletion of the YTA7 gene results in spread-
ing of the silent state from HMR and silencing of sur-
rounding genes, demonstrating that Yta7 can regulate
distinct transcriptional states. Additional work has shown
that Yta7 functions in a similar manner downstream of
the silent region at HMR (Jambunathan et al. 2005).
Yta7 contains both an AAA ATPase domain and a
bromodomain-like region (Yta7bd). An affinity-tagged
version of Yta7 shows avid copurification of all core
histones, suggesting that activity may be propagated
through nucleosome association (Tackett et al. 2005).
Yta7bd can mediate the association with histones; how-
ever, the precise region of histone interaction and post-
translational modification status has not been established
(Jambunathan et al. 2005). Yta7 also appears to be
needed for transcription of repetitive DNA sequences in
Caenorhabditis elegans, where its deletion leads to embry-
onic lethality (Tseng et al. 2007). Additionally, Yta7 has
been linked to telomere maintenance and has shown
an interaction with Rad53 upon DNA damage (Askree
et al. 2004; Smolka et al. 2005). These studies suggest
that Yta7 may be associating with chromatin to modu-
late transcription and to function in numerous cellular
pathways.
In previous work, we observed that Yta7 copurifies
with transcriptional and chromatin modifying proteins
(Tackett et al. 2005). Intriguingly, we noted that Spt16
is one of many proteins that copurified with Yta7
(Tackett et al. 2005). The Spt16 protein is involved in
transcription and nucleosome regulation via its role
with the yFACT complex (Formosa et al. 2002). Spt16
appears to be essential for displacement of histones to
1
Corresponding author: University of Arkansas for Medical Sciences, 4301
W. Markham St., Slot 516, Little Rock, AR 72205.
E-mail: ajtackett@uams.edu
Genetics 179: 291–304 (May 2008)
Page 1
promote initiation of transcription (providing for pas-
sage of RNA polymerase) and for reassembly of nucle-
osomes after elongation (Formosa et al. 2002; Biswas
et al. 2005). Since Yta7 regulates zones of transcription
and Spt16 plays a crucial role in transcription, we sought
to explore the functional significance of the observed
Yta7/Spt16 copurification.
MATERIALS AND METHODS
Yeast strains: Yeast strains are listed in Table 1. Gene
replacements of YTA7 with LEU2 were done by PCR amplifi-
cation of LEU2 from the pUG73 plasmid with 45 bp of
sequence upstream and downstream of the YTA7 gene,
genomic incorporation by homologous recombination and
conformation by PCR. Gene replacements of YTA7 with KAN
were done by PCR amplification of KAN from yta7
T
KAN
BY4742 (Open Biosystems) genomic DNA with 100 bp of
sequence upstream and downstream of the YTA7 gene,
incorporation into the genome by homologous recombina-
tion and confirmation by PCR. To make strain ATY146, we
used marker swap plasmid M4755 to change the KAN marker
from a bar1
T
KAN BY4741 strain (Open Biosystems) to a LEU2
marker (Voth et al. 2003). For strains ATY223 and ATY232,
YTA7 was internally tagged by insertion of PrA or Myc
9
as
described (Gauss et al. 2005).
Epistasis analysis: Temperature sensitivity: cells were grown
to saturation at 25°, 10-fold serially diluted, spotted on YEPD
plates and incubated at various temperatures (25°,30°,32°,
34°, and 37°). Damage assays: cells were grown to saturation at
25°, 10-fold serially diluted and spotted on YEPD plates
containing methyl methanesulfonate (MMS, 0.01, 0.03, 0.1,
TABLE 1
S. cerevisiae strains used in this study
Strain Genotype Background Source
WT (BY4742) MATa his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystems
WT (BY4741) MATa his3D1 leu2D 0 met15D0 ura3D0 BY4741 Open Biosystems
rtt109D MATa rtt109
T
KAN his3D1 leu2D0 met15D 0 ura3D0 BY4741 Open Biosystems
yta7D MATa yta7
T
KAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystems
sas3D MATa sas3
T
KAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystems
HLY21 MATa sas3
T
KAN yta7
T
LEU2 his3D1 leu2D0 lys2D ura3D0 sas3D This study
hir1D MATa hir1
T
KAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystems
AGY11 MATa hir1
T
KAN yta7
T
LEU2 his3D1 leu2D0 lys2D ura3D0 hir1D This study
hir2D MATa hir2
T
KAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystems
AGY14 MATa hir2
T
KAN yta7
T
LEU2 his3D1 leu2D0 lys2D ura3D0 hir2D This study
asf1D MATa asf1
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
ATY246 MATa asf1
T
KAN yta7
T
LEU2 his3D1 leu2D0 met15 D0 ura3D0 asf1D This study
WT (W303) MATa ade2-1 ura3-1 his3-11,15 trp1-1 leu2-3,112 can1-100 W303 Frederick Cross
(Rockefeller
University)
ATY223 MATa YTA7
T
1200-PrA ade2 LYS URA3-HMR ppr1
T
HIS3 ROY508 (Isogenic
to W303)
a
This study
ATY232 MATa YTA7
T
1200-Myc
9
ade2-1 ura3-1 his3-11,15 trp1-1
leu2-3,112 can1-100
W303 This study
HLY26 MATa rtt109
T
KAN ade2-1 ura3-1 his3-11,15 trp1-1
leu2-3,112 can1-100
W303 This study
HLY29 MATa yta7
T
KAN ade2-1 ura3-1 his3-11,15 trp1-1
leu2-3,112 can1-100
W303 This study
spt16-11
8315-8-1
MATa spt16-11 trp1 leu2 ura3 his7 W303 Tim Formosa
(University
of Utah)
HLY34 MATa spt16-11 yta7
T
KAN ade2-1 ura3-1 his3-11,15 trp1-1
leu2-3,112 can1-100
W303 This study
H3K56R
b
MATa D(hht1-hhf1) D(hht2-hhf2) leu2-3,112 ura3-62 trp1 his3
(plasmid TRP1, CEN, hht2(K56R)-HHF2)
MSY421 from M. M.
Smith (University
of Virginia)
Judith Recht
(Rockefeller
University)
ATY146 MATa bar1
T
LEU2 his3D1 leu2D0 met15 D0 ura3D0 BY4741 This study
HLY53 MATa bar1
T
LEU2 yta7D
T
KAN his3D1 leu2D0
met15D0 ura3D0
ATY146 This study
hta1D MATa hta1
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
hta2D MATa hta2
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
htb2D MATa htb2
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
hht1D MATa hht1
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
hht2D MATa hht2
T
KAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems
a
Donze et al. (1999).
b
Recht et al. (2006).
292 A. Gradolatto et al.
Page 2
and 0.3%), hydroxyurea (0.1 and 0.2 m) or 6-azauracil (6-AU,
75, 100, and 200 mg/ml). All serial dilutions were performed
in triplicate.
Transcriptional assays: Cells were grown to mid-log phase
and blocked with either 50 nm a-factor (bar1D and yta7D
bar1D)or15mg/ml nocodazole ½wild-type (BY4742), yta7D,
and hir2D for 2.5–3 hr at 30°. a-Factor showed .90% blocking
efficiency, while nocodazole showed .80%. To release the
cell cycle block, cells were washed twice in ice cold water and
resuspended in 30° prewarmed YEPD media. Time point
samples were taken for budding index counting, RNA extrac-
tion and flow cytometer analysis.
Percent new buds was calculated as the percentage of cells
forming new buds relative to the total population. Cell shape
was classified as unbudded single cells, newly formed small
buds or large buds. Cells arrested in nocodazole were con-
sidered large budded, while those arrested in a-factor were
classified as unbudded single cells. We plotted the formation
of newly formed small buds as this is a rough visual represen-
tation of the onset of histone gene transcription and S phase
(Driscoll et al. 2007).
Hot acidic phenol extraction of RNA was performed as
previously described (Tackett et al. 2005). Reverse transcrip-
tion was conducted with the Invitrogen SuperScript first
strand kit according to the providers’ protocol. Transcription
levels of the histone genes were determined by real-time PCR.
ACT1 was chosen as a housekeeping gene. CLN1 mRNA was
used as a marker of the cell cycle. Primer sequences are listed
in Table 2. Primers to differentiate HHF1 and HHF2 tran-
scripts could not be designed due to sequence similarity, thus
both transcripts were simultaneously monitored with a single
primer set. Specificity of primers for HTA1, HTA2, HTB2,
HHT1, and HHT2 transcripts was determined by real-time
PCR. To measure primer specificity, cDNA was prepared from
genomic deletion strains (hta1D, hta2D, htb2D, hht1D, and
hht2D) and analyzed by real-time PCR with the primers cor-
responding to the deleted gene. Nonspecific amplification
with each primer set was measured relative to ACT1 mRNA.
Relative mRNA levels in Figures 3 and 4 were corrected for
primer specificity. We did not determine the specificity of
HTB1 transcript primers because systematic deletion of the
HTB1 gene produces inviable cells (Giaever et al. 2002).
Flow cytometer samples were fixed in 70% ethanol and
stored at 4°. After sonication in 200 mm sodium citrate, cells
were treated with RNase A at 37°. SYTOX green (Molecular
Probes/Invitrogen) was added to a final concentration of
2 mm. Samples were analyzed with a Beckman Coulter EPICS
XL-MCL flow cytometer.
Chromatin immunoprecipitation: Chromatin immuno-
precipitation (ChIP) was performed as previously reported
using an anti-H3K56ac antibody (Upstate/Millipore 07-677)
(Taverna et al. 2006). ChIP to general histone H3 (Abcam
Ab1791) was performed to control for nucleosome occupancy
(Taverna et al. 2006). Real-time PCR was used to compare the
enriched levels of the intergenic region between the HTA1
and HTB1 gene pair relative to ACT1.
High resolution ChIP-chip analysis of Yta7: ChIP-chip
analysis of Yta7-Myc was performed in triplicate with dye-
swapping as reported (Ren et al. 2000; Taverna et al. 2006).
Tiled microarrays covering the entire Saccharomyces cerevisiae
genome were utilized (50 bp resolution, NimbleGen Systems).
Microarray data were independently analyzed with both
SignalMap (NimbleGen Systems) and Mpeak version 2.0
software (http://www.stat.ucla.edu/zmdl/mpeak/). Binding
regions were considered relevant if .2 SD from the mean.
We utilized a strain containing an internal Myc
9
tag that was
inserted at amino acid position 1200 of Yta7 (Gauss et al.
2005). The location of the tag was determined via two different
approaches analyzing four different positions: N-terminal,
insertion at position 106 (prior to the AAA ATPase and
bromodomains), insertion at position 1200 (near the C ter-
minus), and C-terminal. Each tagged strain was tested for
maintenance of barrier activity at HMR and for immuno-
purification of histones (Tackett et al. 2005). The results
showed that only the insertion of the tag at amino acid 1200
preserved barrier maintenance and provided for histone
immunopurification (A. J. Tackett and B. T. Chait, un-
published observations).
Yta7bd binding to histones and histone H3 peptide mimics:
Amino acids 999–1101 composing the Yta7 bromodomain-like
region (Yta7bd) with a N-terminal GST fusion were expressed,
purified, and confirmed by mass spectrometry (Taverna et al.
2006).
For histone binding studies, 40 mg of GST-Yta7bd (or GST
control) was incubated with 5 mg of acid-extracted T. thermo-
phila histones (purified as described in Taverna et al. 2007)
and 50 mg of BSA (5 ml from a 10 mg/ml New England BioLabs
stock) in binding buffer (20 mm HEPES, pH 7.9, 25% glycerol,
150 mm NaCl, 1.5 mm MgCl
2
, 0.2 mm EDTA, 1% Triton X-100,
10 mm sodium butyrate, 1:100 Sigma yeast protease inhibitor
cocktail) in a final volume of 500 ml for 1 hr at room
temperature. GST-Yta7bd or GST alone was collected for 1 hr
at room temperature with EZview red glutathione affinity gel
(Sigma), washed three times in binding buffer with 300 mm
NaCl, washed once with low salt buffer (4 mm HEPES, pH 7.9,
10 mm NaCl), and copurifying histones were released by
TABLE 2
Sequences of the primers used for real-time PCR
Gene Forward Reverse
ACT1 GAAAAGATCTGGCATCATACCTTC AAAACGGCTTGGATGGAAAC
CLN1 GAAAACTGGGTTAATTGTCACTGC GTTTGATGAGGATTCATCTCCG
HTB1 GGTAAGAAGAGAAGCAAGGCTAGAA GACTTCTTGTTATACGCAGCCA
HTA1 TGTCTTGGAATATTTGGCCG TGGATGTTTGGCAAAACACC
HTB2 GTCGATGGTAAGAAGAGATCTAAGG GTGGATTTCTTGTTATAAGCGGC
HTA2 GCTGTCTTAGAATATTTGGCTGC GGCAACAAGTTTTGGTGAATG
HHT1 GCTTTGAGAGAAATCAGAAGATTCC GCAGCCAAGTTGGTATCTTCAA
HHT2 CTGTTGCCTTGAGAGAAATTAGAAG GCAGCCAGATTAGTGTCTTCAAAC
HHF1 and HHF2 TAAAGGTCTAGGAAAAGGTGGTGC TAACAGAGTCCCTGATGACGGATT
Intergenic between
HTB1 and HTA1
TTTGCCACTACTAAGGCCAA AGCTCGGCGAGTTCAAATTT
Yta7 Regulates Histone Gene Transcription 293
Page 3
heating to 95° in SDS–PAGE sample buffer. Bound histones
were resolved with 4–20% SDS–PAGE and individually visual-
ized by immunoblotting.
For histone H3 peptide mimic binding studies, streptavidin-
coated Dynabeads M280 (250 mg) were incubated with 1.2 mg
of biotinylated histone H3 peptide mimics (Upstate/Millipore
or in-house synthesized). Peptide amounts were standard-
ized by dot-blotting and visualization with streptavidin-HRP.
Binding assays were performed by incubation of Yta7bd with
the peptide coated beads for 1 hr at room temperature in
20 mm HEPES, pH 7.4, 150 mm NaCl, 0.2% Triton X-100.
Beads were washed three times with 20 mm HEPES, pH 7.4,
300 mm NaCl, 0.2% Triton X-100. Proteins were resolved by
4–12% SDS–PAGE and visualized by Coomassie staining.
Binding was quantified with ImageJ software (http://rsb.info.
nih.gov/ij/).
Full-length Yta7 binding to histone H3 peptides: Yta7-PrA
was immunopurified on IgG-coated Dynabeads as previously
described except that the concentration of NaCl was raised
from 0.3 to 1.5 m such that cellular histones no longer
copurified (Tackett et al. 2005). Yta7-PrA was released from
the resin with a nondenaturing elution peptide (Strambio-
De-Castillia et al. 2005; Tackett et al. 2005). Binding studies
of Yta7-PrA were performed following the same protocol as for
Yta7bd binding experiments with the following biotinylated
peptides: H3 1-20, H3 48-63, and H3 48-63 K56ac. Bound Yta7-
PrA was visualized by immunoblotting for the PrA tag.
Immunopurification of Yta7-PrA and associated histones:
Purification of Yta7-PrA with in vivo associated histones on
IgG-coated Dynabeads was done as previously reported
(Gauss et al. 2005; Tackett et al. 2005). Sodium butyrate
(50 mm) was included during immunopurifications to inhibit
histone deacetylases.
Mass spectrometric analysis of H3K56ac: The gel band
containing histone H3 (that purified with Yta7-PrA) was
chemically treated with d6-acetic anhydride and digested with
trypsin as previously reported (Dilworth et al. 2005; Tackett
et al. 2005). The d6-acetic anhydride treatment converts all
unmodified lysines to triply deuterated acetyl-lysines (Tackett
et al. 2005); thus allowing one to differentiate unmodified
lysines (145 Da) from in vivo acetylated lysines (142 Da) for a
quantitative measurement of histone acetylation (Tackett
et al. 2005). A mass spectrum of the histone H3 peptides
was collected with a MALDI-prOTOF mass spectrometer
(PerkinElmerSciex). Peptides were confirmed by tandem
mass analysis with a vMALDI-LTQ ion trap mass spectrometer
(Thermo). To quantify the level of acetylation for H3K56,
m-over-z software was used to extract the monoisotopic peak
areas for the heavy and light versions of the histone H3 53-63
peptide. Percent acetylated was the percentage of light area
relative to the total percentage of light and heavy areas.
Peptides identified are listed in Table 3.
RESULTS
Yta7 activities overlaps with the activities of other
known histone regulators: Spt16, a subunit of the yFACT
complex, was found to coenrich with Yta7 (Tackett et al.
2005). The yFACT complex plays an important role dur-
ing the cell cycle, helping the passage of polymerases
through chromatin and nucleosome reassembly (Formosa
et al. 2002). When subunits of the yFACT are mutated
the reassembly of nucleosomes can still be handled by
the Hir/Hpc complex, but simultaneous mutation of
proteins from each complex leads to strong synthetic
defects (Formosa et al. 2002). For instance, a combina-
tion of hir1D spt16-11(T8281I P859S) caused synthetic
temperature sensitivity of the cells, demonstrating de-
pendence of the yFACT pathway with the Hir pathway
(Sutton et al. 2001; Formosa et al. 2002). In conse-
quence, we decided to investigate the effect of double
deletions of the YTA7 gene with the point mutation
spt16-11 on cell growth, as well as with complete deletion
of two genes encoding proteins in the Hir/Hpc com-
plex: HIR1 and HIR2. The spt16-11 mutant was chosen
because cells carrying the genomic deletion of SPT16
are inviable.
Additionally, the genes encoding Asf1 and Sas3
were deleted in WT and yta7D strains and cells were
subjected to restrictive growth conditions. Asf1 is a
histone chaperone protein that is widely involved in
replication-coupled nucleosome assembly, response to
DNA damage, repression of histone gene transcription
and heterochromatic silencing (reviewed in Mousson
et al. 2007). Asf1 mediates its activity through interac-
tions with proteins including the Hirs (Sutton et al.
2001). The protein Sas3 is a component of the NuA3
histone acetyltransferase complex and interacts with
Spt16, suggesting a role in transcription and/or repli-
cation (John et al. 2000; Taverna et al. 2006). Sas3 also
copurifies with Yta7 (Tackett et al. 2005).
Cells were plated in serial dilutions and subjected to
increasing temperatures or damaging agents: hydroxy-
urea (stalls DNA replication), methyl methanesulfonate
(DNA damaging agent) or 6-azauracil (inhibits tran-
scriptional elongation) (Figure 1). The 6-AU screen did
not show any synthetic defects (data not shown). Cells
containing a deletion of the RTT109 gene served as a
sensitive control for the DNA damage agents (Driscoll
et al. 2007; Han et al. 2007).
Cells harboring the spt16-11 mutation exhibited sen-
sitivity to both temperature and HU treatments as pre-
viously described (Formosa et al. 2002) (Figure 1, A and
B). Additional deletion of the YTA7 gene increased the
growth defect observed for both treatments. This result
suggests that both Yta7 and Spt16 are acting in two func-
tionally overlapping pathways. No effect was observed
for sas3D and sas3D yta7D mutants under any stress con-
dition (data not shown). However, deletion of the ASF1
gene showed a cell growth defect under temperature
TABLE 3
Peptides from histone H3 copurifying with Yta7-PrA that
were identified by MALDI mass spectrometry
Observed histone
H3 peptide
Extent of lysine
acetylation (%)
9-KSTGGKAPR-17 0
18-KQLASKAAR-26 0
41-YKPGTVALREIR-52 0
53-RFQKSTELLIR-63 33
117-VTIQKKDIKLAR-128 0
294 A. Gradolatto et al.
Page 4
and HU conditions. Further deletion of the YTA7 gene
increased the HU effect only, indicating that Yta7 and
Asf1 have overlapping function during times of DNA
synthesis. Furthermore, deletion of the YTA7 gene in-
duced growth defects in hir1D and hir2D cells in response
to temperature increase, HU and MMS—suggesting that
Hir and Yta7 pathways are functionally overlapping. Our
results imply (1) a role of Yta7 in DNA damage response
and (2) that Yta7 operates through a functionally over-
lapping pathway with the Asf1/Hir and Spt16-yFACT
complexes.
Yta7 is a repressor of histone gene transcription:
Since we observed a genetic interaction with known
histone gene transcriptional regulators (Hirs, Asf1, and
Spt16) and since Yta7 is known to regulate transcrip-
tional zones of chromatin via barrier activity, we in-
vestigated whether Yta7 played a role in transcriptional
regulation of the histone genes. To assay for cell-cycle-
dependent transcriptional defects, we synchronized
wild-type and yta7D cells with a-factor (G
1
-phase arrest)
or nocodazole (M-phase arrest) and cultures were
sampled at various times throughout a full cell cycle.
We first verified that the cells were growing in syn-
chrony. Measurement of the late G
1
cyclin CLN1 tran-
script levels revealed that after release from each block,
the cells progressed in a similar manner (Figure 2, A and
C). However, cells containing the YTA7 gene deletion
showed a defect in CLN1 transcription at the 90 and 100
min time points post-nocodazole release, which could
indicate a lost of synchrony toward the end of the first
cell cycle (Figure 2C). Following the cell cycle through
the formation of new buds also showed a similar pro-
gression of the cells after release from the blocking
agents (Figure 2, B and D), with a slight delay in the
accumulation of buds at 80 min post-release from no-
codazole for yta7D cells (Figure 2D). Thus, the cells
appeared to be synchronized relative to expression of
aG
1
cyclin and formation of buds. However, release of
yta7D cells from the nocodazole block did show CLN1
transcription and budding defects at times consistent
with M phase (90 min post-release).
For the time course transcriptional analyses of yta7D
cells with either a nocodazole or an a-factor block, the
peak of histone transcription appeared as expected,
after the peak of CLN1 gene transcription in accordance
with previous studies (Figure 2, A and C; Figure 3;
Figure 4A) (Hereford et al. 1981). However, the tran-
scriptional analysis of all the histone genes revealed
strikingly different effects of YTA7 gene deletion with
the different cell cycle blocks (Figures 3 and 4A). After
a-factor block and release, yta7D cells revealed a signif-
icant higher activation of transcription for all the his-
tone genes at the 20 and 30 min time points (Figure 3).
Even though gene transcription seemed to start at sim-
ilar times (20 min post-release), there was an apparent
20-min window where gene transcription in yta7D cells
was higher than in wild-type, but then gene transcrip-
tion decreased in a similar manner to the control strain
(50 and 60 min time points). This a-factor blocking
experiment was repeated three times with identical
results. We also varied which culture (yta7D or wild-type
cells) was sampled first at each time point, avoiding
sampling discrepancies. One explanation of the appar-
ent early transcription of each histone gene in yta7D
Figure 1.—Yta7 activity overlaps with the activities of other described histone regulators. (A) Temperature sensitivity. Indicated
cells were 10-fold serially diluted and incubated at 25° or 34° for the indicated days (d). (B) Hydroxyurea (HU) sensitivity. Cells
were 10-fold serially diluted and incubated at 25° for the indicated days. (C) Methyl methanesulfonate (MMS) sensitivity. Cells
were 10-fold serially diluted and incubated at 25° for the indicated days.
Yta7 Regulates Histone Gene Transcription 295
Page 5
cells is that Yta7 serves as a cell-cycle-dependent tran-
scriptional repressor of the histone genes.
The nocodazole block and release experiment re-
vealed a different trend (Figure 4A). For each histone
gene, a prolonged transcription in yta7 D cells was ap-
parent after the peak (80–90 min post-release). This
defect in transcription was of similar magnitude to that
observed upon the gene deletion of the known histone
repressor Hir2 at 80 min post-release (Figure 4B).
Unlike the a-factor blocking experiment, a uniform
Figure 3.—Yta7 regulates histone gene transcription. bar1D (solid circles) and yta7D bar1D (open squares) cells were blocked
with a-factor, released, and samples were taken at the indicated times. For each time point, cDNA was prepared and the amount of
indicated transcript (relative to ACT1 transcript) was determined by real-time PCR. Darkly shaded regions emphasize the in-
creased histone gene transcription upon gene deletion of YTA7. Error bars are the standard deviation. Asterisks show significant
differences determined by one-tailed t-testing (P , 0.05).
Figure 2.—Timing of CLN1 gene transcription
and new bud formation in a-factor synchronized
bar1D and yta7D bar1D cells and in nocodazole
synchronized wild-type and yta7D cells. Cells were
blocked with a-factor (A and B) or nocodazole (C
and D), released, and samples were taken at the
indicated times. For each time point, the amount
of late G
1
-cyclin CLN1 transcript relative to ACT1
transcript was determined by real-time PCR (A
and C). Error bars are the standard deviation.
The formation of new buds was also monitored
(B and D).
296 A. Gradolatto et al.
Page 6
defect in transcriptional regulation was not evident. For
example, the HTA1 and HTB1 and HTA2 and HTB2
gene pairs are known to be regulated in a similar man-
ner (Hereford et al. 1981). In our nocodazole blocking
experiment, the defect observed upon deletion of YTA7
showed a similar defect for HTA1 and HTA2 and HTB1
and HTB2 (Figure 4A). Since we observed prolonged
histone gene transcription and a differential histone
gene transcriptional regulation (relative to the a-factor
blocking experiment), we decided to take a more de-
tailed look into possible cell cycle defects in each of the
blocking experiments.
In Figure 2, we showed that wild-type and yta7D cells
had similar CLN1 transcript levels and new bud forma-
tion, indicative of synchronous growth. To investigate
cell synchrony in a more detailed manner, we moni-
tored DNA content by flow cytometry (Figure 5).
Following a-factor block, cells were released and grew
in synchrony (Figure 5, A and B). This indicated that the
observed early transcriptional effect is likely not a
consequence of a cell cycle progression defect (Figure
3). However, the nocodazole block and release ex-
hibited slightly different results. YTA7 gene deletion
impaired the ability of the cells to exit from M phase or
recover from the nocodazole block (Figure 5, C and D).
In Figure 5D, the yta7D cells showed a delay in the
transition from 2N to 1N content relative to wild-type.
This led to two important conclusions. First, the pro-
longed and variable histone gene transcription ob-
served in Figure 4A is likely a product of asynchrony,
and that the true effect of YTA7 deletion on histone
gene transcription is observed in the highly synchro-
nized a-factor blocking experiment in Figure 3. Second,
the Yta7 protein could have an undefined role during M
Figure 4.—Nocodazole blocking alters the observed yta7D transcriptional defect in histone gene regulation. (A) Wild-type
(solid circles) and yta7D (open squares) cells were blocked with nocodazole and released. Samples were taken at the indicated
times and analyzed as in Figure 3. Darkly shaded regions emphasize the increased histone gene transcription upon gene deletion
of YTA7. Error bars are the standard deviation. (B) HTB1 gene transcription is upregulated upon deletion of HIR2. Wild-type
(solid circles) and hir2D (open squares) cells were blocked with nocodazole and released. Samples were taken at the indicated
times and analyzed as in Figure 3. Error bars are the standard deviation. Asterisks show significant differences determined by one-
tailed t-testing (P , 0.05).
Yta7 Regulates Histone Gene Transcription 297
Page 7
phase. This could be consistent with Yta7 playing some
chromosome specific role as it is a member of a histone
bound protein complex during this time of the cell cycle
(Tackett et al. 2005). However, a previous study showed
that Yta7 is not involved in chromosome segregation
during M phase (Dubey and Gartenberg 2007).
Altogether, we believe that the data presented in Figures
3–5 support Yta7 functioning as a histone gene tran-
scriptional repressor.
Yta7 associates with histone loci: In order to better
understand the mechanism by which Yta7 regulates
histone gene transcription, we utilized a chromatin
immunopurification with high resolution DNA micro-
array readout strategy (ChIP-chip) to determine whether
the Yta7 protein associates with these loci (Ren et al.
2000; Tavernaet al. 2006). We chose this technique over
conventional ChIP because we were interested in ob-
serving the distribution profile of Yta7 across the loci at
high resolution, and because uncovering additional
binding sites could provide further information for
defining the mechanism of Yta7 activity. The ChIP-chip
analysis of Yta7-Myc showed significant binding at 177
discrete regions (supplementary Table S1). We did not
observe any obvious trend toward the type of genes Yta7
was associating with.
We show the array data as a composite profile of the
Yta7-associated DNA occupancy (relative occupancy)
plotted as a function of relative coordinates on an
average gene flanked with intergenic regions as was
previously done in Taverna et al. (2006) (Figure 6A).
Figure 6A revealed that on average the Yta7 protein had
preferential association with intergenic regions of chro-
matin as well as with the extreme 59- and 39-ends of an
ORF. In contrast, a component of the NuA3 histone
acetyltransferase complex, Yng1, was recently showed to
be preferentially enriched at the 59 half of an ORF, while
minimal association is observed in the intergenic re-
gions (Taverna et al. 2006). The averaged localization
of Yng1 is consistent with the role of NuA3 in stimu-
lating transcription via H3K14 acetylation, which is a
PTM localized to 59-ends of actively transcribing genes
(Pokholok et al. 2005). Our data in Figure 6A suggest
that the mechanism of Yta7 activity may be mediated
through non ORF associations and that Yta7 binding to
intergenic regions could be a mechanism for transcrip-
tional silencing.
Six of the top 10 binding sites from the ChIP-chip
analysis were pairings of histone genes (HTB1 and
HTA1, HHF1 and HHT1, HHT2 and HHF2) (Figure
6B, supplemental Table S1). In addition to these histone
Figure 5.—FACS analysis of DNA content for bar1D and bar1Dyta7D or wild-type and yta7D cells. (A) bar1D and bar1Dyta7D cells
were blocked with a-factor, released, and samples were taken at the indicated times for FACS analysis. (B) Histograms of FACS data
from A showing 1N and 2N DNA contents as a percentage of gated cells. (C) Wild-type and yta7D cells were blocked with nocodazole,
released, and samples were taken at the indicated times for FACS analysis. The asterisks highlight the key differences between the
WT and yta7D cells. (D) Histograms of FACS data from C showing 1N and 2N DNA contents as a percentage of gated cells.
298 A. Gradolatto et al.
Page 8
loci, the other genomic pair of histone genes (HTA2
and HTB2) was also a significant Yta7 binding site
(Figure 6B and supplemental Table S1). Consistent with
the average plot (Figure 6A), the HTB1 and HTA1
histone locus showed peak Yta7 association at the inter-
genic region, even though the Yta7 protein was also
binding to the genes themselves (Figure 6B). Yta7
bound the other histone loci HHF1 and HHT1, HHT2
and HHF2, and HTA2 and HTB2 with a similar profile
except that peak association occurred within the ORFs.
Since the transcription of all histone genes is similarly
modified in yta7D cells (Figure 3), the exact nature of
this slightly different binding profile among the loci
remains to be elucidated. Our observed interaction of
the Yta7 protein with the histone loci is suggestive of a
direct transcriptional regulatory mechanism.
Yta7 interacts with chromatin via the N-terminal tail
of histone H3: The above results show that Yta7 asso-
ciated with and transcriptionally regulated histone
genes. Yta7 has also been shown to immunopurify with
Figure 6.—The Yta7 protein localizes to histone gene loci. ChIP-chip analysis of Yta7-Myc from asynchronous cells using 50-bp
resolution tiled arrays (NimbleGen Systems). (A) Yta7 associated DNA occupancy is plotted as a function of relative coordinates on
an average gene flanked with intergenic regions. (B) Shown is Yta7-Myc binding at the four histone loci: HTB1 and HTA1, HHF1
and HHT1, HHT2 and HHF2, and HTA2 and HTB2. The log
2
intensity ratio of immunoprecipitated to control DNA is plotted as a
function of genomic position. Error bars are the standard deviation of triplicate array analyses.
Yta7 Regulates Histone Gene Transcription 299
Page 9
histone proteins (Tackett et al. 2005). One chromatin-
based regulative pathway that precedes histone gene
transcription is the acetylation of histone H3 Lys56
(H3K56ac) at histone loci (Xu et a l. 2005). The Yta7
protein also contains a bromodomain-like region that
shows histone association, but the PTM specificity has
not been determined (Jambunathan et al. 2005).
Therefore, we sought to investigate if the Yta7 protein
association with histones was PTM dependent, and
particularly H3K56ac dependent.
We purified a recombinant version of the Yta7 bromo-
domain-like region (Yta7bd). We first investigated
whether the recombinant version of Yta7bd specifically
bound to a particular histone. An Yta7bd-GST fusion or
GST alone was incubated with acid-extracted histones,
and interacting proteins were isolated on glutathione
resin. Histones associated with Yta7bd were visualized by
immunoblotting (Figure 7A). GST alone showed mini-
mal nonspecific affinity for the histones when compar-
ing the input (I) and bound (B) samples. However, the
Figure 7.—Yta7bd interacts with histone H3. (A) Yta7 protein preferentially interacts with histone H3. Yta7bd-GST fusion, or
GST alone, was incubated with purified histones and isolated on glutathione resin. Histones associated with Yta7 were visualized by
immunoblotting. Input (I) and bound (B) lanes are shown. (B) Yta7bd interacts with the N-terminal tail of histone H3. Recombi-
nant Yta7bd, or GST alone, was incubated with streptavidin Dynabeads coated with biotinylated peptides representing different
regions and modification states of histone H3 (methylation and acetylation). Bound Yta7bd was resolved by SDS–PAGE and vi-
sualized by Coomassie staining. (C) Quantification of Yta7bd binding from B. Yta7bd binding is shown as a percentage relative to
H3 1-20 binding. (D) Full-length Yta7 protein interacts with the N-terminal tail of histone H3. Purified Yta7-PrA was incubated with
streptavidin Dynabeads coated with biotinylated peptides representing different regions and modification states of histone H3.
Bound Yta7-PrA was resolved by SDS–PAGE and visualized by immunoblotting for the PrA tag. (E) Yta7 associated histone H3 was
acetylated at Lys56. Yta7-PrA was immunopurified and coenriching proteins were resolved by SDS–PAGE/Coomassie staining.
Copurifying histone H3 was treated in-gel with d6-acetic anhydride to isotopically mark unmodified lysines and then digested
with trypsin. Shown is a section of a mass spectrum containing the H3K56 peptide as either acetylated (K56ac) or unacetylated
(K56). In accordance to the monoisotopic peak areas, H3K56 was 33% acetylated.
300 A. Gradolatto et al.
Page 10
GST-Yta7bd fusion protein showed significant binding
of histone H3 as well as minor affinity for H2B.
We then investigated if the Yta7bd interaction with
histone H3 was directed by H3K56ac (or another his-
tone H3 PTM). Binding of Yta7bd to a series of dif-
ferentially modified histone H3 peptide mimics was
performed (Figure 7B). We observed that Yta7bd did
not associate with a peptide corresponding to the region
of histone H3 containing H3K56 or H3K56ac (Figure
7B, lanes 13–16). However, Yta7bd showed a preferen-
tial interaction with the N-terminal 20-amino-acid tail of
histone H3 (Figure 7B, lanes 3 and 4). The interaction
of Yta7bd with the N-terminal tail was favored for the
unmodified or singly modified peptide as demonstrated
by the decreased association observed with the addition
of two or three PTMs (Figure 7B, lanes 5–6 and 17–20 vs.
lanes 7–12). Addition of H3K4me3 reduced the binding
capacity .30%, and further acetylation reduced it 50–
70%, while single acetylation caused a binding reduc-
tion of 20–40% (Figure 7C). The ability of Yta7bd to
preferentially bind the unmodified histone H3 tail and
to tolerate various single PTMs suggests that the Yta7
protein interaction with chromatin is mediated by a
general interaction with the N-terminal tail of histone
H3. This is not surprising because the bromodomain-
like region of Yta7 is missing amino acids that are required
for acetyl-lysine specificity in other bromodomains, but
does retain many of the amino acids needed for bind-
ing to the histone peptide backbone (Jambunathan
et al. 2005). These results suggest that the Yta7 protein
associates with chromatin through an interaction with
the N-terminal tail of histone H3. It is possible that Yta7
binding could be stimulated by combinations of differ-
ent PTMs. A similar analysis with full-length Yta7 also
showed enrichment for the N-terminal tail of histone
H3 and no stimulated binding with an H3K56ac peptide
(Figure 7D).
Our findings in Figure 7 revealed that Yta7 association
with histones was H3K56ac independent. However,
we hypothesized that these two histone gene transcrip-
tional regulation signals could simultaneously coexist
on chromatin to provide for independent, overlapping
transcriptional regulation. To test whether H3K56ac
and Yta7 could be found simultaneously on chromatin,
we isolated an ex viv o complex of full-length Yta7 with
copurifying histones as previously reported (Tackett
et al. 2005). We performed a quantitative PTM analysis
of histone H3 using isotope labeling and MALDI-mass
spectrometry (Tackett et al. 2005). The analysis of
the H3 peptides mass spectrum revealed peptides that
corresponded to 41% sequence coverage of histone
H3 (Table 3). Of particular interest, we observed pep-
tide 53-63, which contained Lys56 (Figure 7E). We
observed two peaks that corresponded to the unacety-
lated and the acetylated peptide. These peptides were
confirmed by tandem MS. The peak areas from the
mass spectrum were used to determine that the popu-
lation of histone copurifying with Yta7 was 33% acety-
lated at H3K56, thus demonstrating that Yta7 could
associate with both H3K56 acetylated or unmodified
chromatin. Other detected histone H3 peptides did not
show significant acetylation (Table 3). These data sug-
gest that Yta7 and H3K56ac can coexist on a given piece
of chromatin.
The data in Figure 7 show that Yta7 binding to
chromatin is not stimulated by H3K56ac, but the two
entities can coexist. We wanted to test whether acetyla-
tion of H3K56 was dependent on Yta7. To monitor for
this dependence, we utilized ChIP to H3K56ac at the
intergenic region between HTA1 and HTB1 (Figure 8A)
(Xu et al. 2005). H3K56ac ChIP on wild-type and yta7D
cells showed no significant difference (P-value ¼ 0.19).
Cells harboring a H3K56R mutation were used as a
control (Recht et al. 2006). In addition to performing
ChIP to this one region of known H3K56ac, we cor-
related our genomewide Yta7 ChIP-chip data to the
reported sites of H3K56ac, using only enrichments $2
SD from the mean (Xu et al. 2005). Only 6.8% of the 177
Yta7-binding sites correlated to sites of H3K56ac (Figure
8B). This low correlation is in agreement with results
from Figure 7B that showed no direct affinity of Yta7bd
for H3K56ac. The results in Figures 7 and 8 suggest that
Figure 8.—Yta7 does not direct or
correlate with general H3K56 acetyla-
tion. (A) H3K56ac is not dependent
on Yta7. ChIP to histone H3K56ac was
performed in wild-type, yta7D, and
H3K56R cells. Real-time PCR was used
to measure enrichment at the inter-
genic region between HTA1 and HTB1
relative to ACT1. ChIP to unmodified
H3 was used to control for nucleosome
occupancy. Error bars are the standard
deviation of the mean. The asterisk
shows the significant difference deter-
mined by t-testing (P , 0.01). (B) Ge-
nomewide Yta7 binding does not
correlate with H3K56ac. Over the 177 sites identified from ChIP-chip analysis of Yta7, only 6.8% were overlapping with previously
reported H3K56ac-binding sites (Xu et al. 2005).
Yta7 Regulates Histone Gene Transcription 301
Page 11
Yta7- and H3K56ac-mediated regulation of histone gene
expression are independent.
DISCUSSION
Chromatin remodeling and epigenetic regulation are
tightly linked to histone gene expression. Maintaining
the proper dosage level of histone transcripts is a crucial
cellular mechanism that is protected through multiple
pathways. These histone gene regulatory pathways ex-
hibit various levels of redundancy and crosstalk of
protein interactions. Our work describes how Yta7, a
protein initially identified as a component of a barrier
chromatin complex, is also involved in histone gene
expression and is connected to other histone regulatory
pathways.
S. cerevisiae contains two copies of the four core his-
tones, which are transcribed during S phase. These
copies exist as pairs on chromosomes 2, 4, and 14.
Preceding transcriptional activation of the histone
genes is a rapid cycle of acetylation on histone H3 lysine
56 (H3K56ac) (Xu et al. 2005). H3K56ac coats the
promoter and extends into the open-reading frame
regions of these genes in a Spt10-dependent manner,
and is needed for proper histone gene transcription
(Xu et al. 2005). In addition to H3K56ac, histone gene
transcription is regulated by the Asf1/Hir complex and
Spt16 containing yFACTcomplex pathways (Sherwood
et al. 1993; Spector et al. 1997; Sutton et al. 2001;
Formosa et al. 2002; Recht et al. 2006; Mousson et al.
2007). Asf1/Hir and yFACT complexes appear to func-
tion through separate pathways to regulate histone gene
transcription, with both being needed for proper S-
phase transcription of histone genes. The Asf1/Hir
complex functions to maintain cell-cycle-dependent
and hydroxyurea-induced repression of histone gene
transcription (Sutton et al. 2001). The Spt16 yFACT
complex aids in transcriptional initiation and provides
for the proper reassembly of chromatin after polymer-
ase passage (Formosa et al. 2002). Mutations of the
Asf1/Hir and yFACT transcriptional regulators alter,
but do not abolish S-phase histone gene transcription,
suggesting that other mechanisms of gene regulation
exist. Our work links the Yta7 protein to one of these
novel mechanisms of histone gene transcriptional regu-
lation. We favor the hypothesis that Yta7 functions in
concurrence with a multi-pathway cellular program that
regulates histone gene transcription during the cell
cycle. Evidence for our hypothesis is demonstrated at
the level of cellular pathway crosstalk, transcriptional
control and chromatin association.
An epistasis analysis provided evidence that Yta7 ac-
tivity genetically interacts with other known cellular
pathways that regulate histone gene transcription,
namely the Asf1/Hir and Spt16/yFACT pathways (Fig-
ure 1). The synthetic nature of the observed growth
defects indicated that Yta7, Asf1/Hir, and Spt16/yFACT
have overlapping cellular functions. Thus, we identified
a functional significance for our observed copurifica-
tion of Yta7 and Spt16 proteins (Tackett et al. 2005).
The synthetic growth defects with yta7D cells were de-
tectable only under stressful growing conditions (tem-
perature, DNA synthesis inhibition, and DNA damage),
suggesting that Yta7 is linked to mechanisms of DNA
repair. Under stress conditions, such as hydroxyurea
treatment, cells shut down histone gene transcription
(Sutton et al. 2001). Deletions in histone transcrip-
tional regulators, such as Hir1 and Asf1, prevent the
proper deactivation of histone gene transcription in
the presence of hydroxyurea, thus highlighting the sig-
nificance of the observed synthetic growth defects with
yta7D cells under stress (Figure 1) (Sutton et al. 2001).
Our MMS studies are in accordance with previous
studies showing that Yta7 interacted with Rad53 under
DNA damage conditions (Smolka et al. 2005). More-
over, the Yta7 human homolog ATAD2 was down-
regulated in a colon cancer cell line arrested in S phase
after 5-fluorouracil treatment, suggesting a role in DNA
damage and repair (De Angelis et al. 2006). The epis-
tasis analysis revealed that the cellular pathway(s) con-
taining Yta7 were overlapping with known pathways that
can modulate histone transcript levels, thereby linking
Yta7 to a possible role in histone gene transcription.
A direct test of the involvement of Yta7 in the tran-
scriptional regulation of histone gene expression dem-
onstrated that Yta7 functioned as a transcriptional
repressor (Figure 3). Deletion of the YTA7 gene led to
elevated transcript levels for all histone genes prior to
peak transcription. Histone gene transcription was then
downregulated in a similar manner relative to wild-type
cells. In this experiment, we observed a similar mis-
regulation of transcription at each gene, which was
consistent with Yta7 serving a similar repressive role at
each locus (Figure 3). The areas under the peaks of
histone gene transcription showed that deletion of the
YTA7 gene produced more histone transcripts; however,
the peak level was not higher—rather the peak was
broader. With the decline of both peaks overlapping,
Yta7 appeared to be involved in some early step of
transcriptional regulation. The evidence in Figure 3
showing that Yta7 served as a repressor of histone gene
transcription is in agreement with the epistasis analysis
that linked Yta7 to the histone gene transcriptional
regulatory network (Figure 1). As may be expected,
double deletion of the repressor Yta7 with hydroxyurea-
dependent histone gene repressors (namely Hir1 and
Asf1) caused a synthetic growth defect in cells (Figure
1B). This growth defect could be the consequence of
potentially toxic levels of free histone proteins as pre-
viously suggested (Gunjan and V
erreault 2003; Sharp
et al. 2005). Our time course transcriptional data did
not indicate whether this repressive effect was direct or
indirect. It is possible that Yta7 acts in an indirect
302 A. Gradolatto et al.
Page 12
manner to modulate histone transcript levels. Rather
than acting as a direct repressor of gene transcription,
Yta7 could play a role in the post-transcriptional turn-
over of histone mRNA (Hereford et al. 1982). However,
since Yta7 has a putative bromodomain, transcriptional
gene regulatory activity, and associates with chromatin,
we favor a direct mechanism that would involve the
Yta7 protein binding to the histone loci (Tackett et al.
2005).
To determine if the Yta7 protein indeed directly
associated with the histone loci, we performed a series
of in vivo and in vitro binding studies. Genomewide
ChIP-chip of Yta7 revealed direct chromatin association
at 177 novel sites (Figure 6). Six of the top 10 binding
sites were the histone loci (Figure 6B). Yta7 binding was
observed across each ORF and intergenic region at the
histone loci. It is possible that such a binding profile
could provide for formation of a chromatin state that
represses transcription. Binding of Yta7 to the histone
loci further strengthens the hypothesis that Yta7 is di-
rectly regulating histone gene transcription. Since Yta7
contains a histone H3 binding bromodomain-like region
(Figure 7A), we investigated whether there was a partic-
ular histone H3 PTM code that promoted Yta7 associa-
tion. Full-length Yta7 and Yta7bd were found to engage
histone H3 at the N terminus with a preferential asso-
ciation in the absence of tested PTMs (Figure 7, B–D).
Purification of in vivo associated histone H3, revealed
significant levels of H3K56ac, but this PTM did not
stimulate Yta7 protein association nor was H3K56ac
dependent upon Yta7 (Figure 7, C and E; Figure 8).
The in vivo purification of H3K56ac with Yta7 would be
predicted because both are associated with the intergenic
regions at histone loci (Figure 6; Xu et al. 2005). Our
chromatin association studies are consistent with the
hypothesis that Yta7 mediated transcriptional repression
occurs through direct association at the histone loci.
The results presented shed light on the cellular pro-
gram needed for transcriptional regulation of the his-
tone genes. There appear to be multiple levels of
regulation that provide for proper histone dosage,
which is not surprising for a key cellular process. We
find that Yta7 serves a key role in a previously unchar-
acterized branch of the histone gene transcriptional
regulatory pathway. Our findings also provide for a
broader understanding of the function of Yta7, which
seems to regulate transcription not only at transition
zones between silent and active chromatin, but also via a
dynamic mechanism at other chromosomal regions.
We thank Lauren Blair and Cagdas Tazearslan for critical reading,
Piotr Zimniak for access to real-time PCR instrumentation, Andrew
Krutchinsky and Markus Kalkum for assistance with mass spectromet-
ric hardware/software development, Cecile Artaud and Anastas
Pashov for flow cytometry analysis, Tim Formosa for the spt16-11
strain, and Judith Recht for the H3K56R strain. The following National
Institutes of Health (NIH) grants supported this work: P20RR015569
(A.J.T., co-investigator), GM63959 (C.D.A.), RR022220 and
GM076547 (J.D.A.). A.J.T. acknowledges support from the Arkansas
Biosciences Institute and recognizes mass spectrometric support from
Sam Mackintosh and Chris Warthen funded through an NIH IDeA
Network of Biomedical Research Excellence grant (P20RR016460).
LITERATURE CITED
Askree, S. H., T. Yehuda,S.Smolikov,R.Gurevich,J.Hawk et al.,
2004 A genome-wide screen for Saccharomyces cerevisiae dele-
tion mutants that affect telomere length. Proc. Natl. Acad. Sci.
USA 101: 8658–8663.
Berger, S. L., 2007 The complex language of chromatin regulation
during transcription. Nature 447: 407–412.
Biswas, D., Y. Yu,M.Prall,T.Formosa and D. J. Stillman,
2005 The yeast FACT complex has a role in transcriptional ini-
tiation. Mol. Cell. Biol. 25: 5812–5822.
Cairns, B. R., 2005 Chromatin remodeling complexes: strength in
diversity, precision through specialization. Curr. Opin. Genet.
Dev. 15: 185–190.
De Angelis, P. M., D. H. Svendsrud,K.L.Kravik and T. Stokke,
2006 Cellular response to 5-fluorouracil (5-FU) in 5-FU-resis-
tant colon cancer cell lines during treatment and recovery.
Mol. Cancer 5: 20.
Dilworth, D. J., A. J. Tackett,R.S.Rogers,E.C.Yi,R.H.Christmas
et al., 2005 The mobile nucleoporin Nup2p and chromatin-
bound Prp20p function in endogenous NPC-mediated transcrip-
tional control. J. Cell Biol. 171: 955–965.
Dion, M. F., T. Kaplan,M.Kim,S.Buratowski,N.Friedman et al.,
2007 Dynamics of replication-independent histone turnover in
budding yeast. Science 315: 1405–1408.
Donze, D., C. R. Adams,J.Rine and R. T. Kamakaka, 1999 The
boundaries of the silenced HMR
domain in Saccharomyces cerevi-
siae. Genes Dev. 13: 698–708.
Driscoll, R., A. Hudson and S. P. Jackson, 2007 Yeast Rtt109 pro-
motes genome stability by acetylating histone H3 on lysine 56.
Science 315: 649–652.
Dubey, R. N., and M. R. Gartenberg, 2007 A tDNA establishes co-
hesion of a neighboring silent chromatin domain. Genes Dev. 21:
2150–2160.
Formosa, T., S. Ruone,M.D.Adams,A.E.Olsen,P.Eriksson et al.,
2002 Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevi-
siae cause dependence on the Hir/Hpc pathway: polymerase pas-
sage may degrade chromatin structure. Genetics 162: 1557–1571.
Gauss, R., M. Trautwein,T.Sommer and A. Spang, 2005 New mod-
ules for the repeated internal and N-terminal epitope tagging of
genes in Saccharomyces cerevisiae. Yeast 22: 1–12.
Giaever, G., A. M. Chu,L.Ni,C.Connelly,L.Riles et al.,
2002 Functional profiling of the Saccharomyces cerevisiae ge-
nome. Nature 418: 387–391.
Goldberg, A. D., C. D. Allis and E. Bernstein, 2007 Epigenetics: a
landscape takes shape. Cell 128: 635–638.
Gunjan, A., and A. Verreault, 2003 A Rad53 kinase-dependent
surveillance mechanism that regulates histone protein levels in
S. cerevisiae. Cell 115: 537–549.
Han, J., H. Zhou,B.Horazdovsky,K.Zhang,R.M.Xu et al.
,
2007 Rtt109 acetylates histone H3 lysine 56 and functions in
DNA replication. Science 315: 653–655.
Here ford,L.M.,M.A.Osley,T.R.Ludwig,IIandC.S.McLaughlin,
1981 Cell-cycle regulation of yeast histone mRNA. Cell 24: 367–
375.
Hereford, L., S. Bromley and M. A. Osley, 1982 Periodic tran-
scription of yeast histone genes. Cell 30: 305–310.
Jamai, A., R. M. Imoberdorf and M. Strubin, 2007 Continuous his-
tone H2B and transcription-dependent histone H3 exchange in
yeast cells outside of replication. Mol. Cell 25: 345–355.
Jambunathan, N., A. W. Martinez,E.C.Robert,N.B.Agochukwu,
M. E. Ibos et al., 2005 Multiple bromodomain genes are involved
in restricting the spread of heterochromatic silencing at the Saccha-
romyces cerevisiae HMR-tRNA boundary. Genetics 171: 913–922.
John, S., L. Howe,S.T.Tafrov,P.A.Grant,R.Sternglanz et al.,
2000 The something about silencing protein, Sas3, is the cata-
lytic subunit of NuA3, a yTAF(II)30-containing HAT complex
that interacts with the Spt16 subunit of the yeast CP (Cdc68/
Pob3)-FACT complex. Genes Dev. 14: 1196–1208.
Yta7 Regulates Histone Gene Transcription 303
Page 13
Kouzarides, T., 2007 Chromatin modifications and their function.
Cell 128: 693–705.
Li, B., M. Carey and J. L. Workman, 2007 The role of chromatin
during transcription. Cell 128: 707–719.
Mousson, F., F. Ochsenbein and C. Mann, 2007 The histone chap-
erone Asf1 at the crossroads of chromatin and DNA checkpoint
pathways. Chromosoma 116: 79–93.
Pokholok, D. K., C. T. Harbison,S.Levine,M.Cole,N.M.Hannett
et al., 2005 Genome-wide map of nucleosome acetylation and
methylation in yeast. Cell 122: 517–527.
Recht, J., T. Tsubota,J.C.Tanny,R.L.Diaz,J.M.Berger et al.,
2006 Histone chaperone Asf1 is required for histone H3 lysine
56 acetylation, a modification associated with S phase in mitosis
and meiosis. Proc. Natl. Acad. Sci. USA 103: 6988–6993.
Ren, B., F. Robert,J.J.Wyrick,O.Aparicio,E.G.Jennings et al.,
2000 Genome-wide location and function of DNA binding pro-
teins. Science 290: 2306–2309.
Rufiange, A., P. E. Jacques,W.Bhat,F.Robert and A. Nourani,
2007 Genome-wide replication-independent histone h3 ex-
change occurs predominantly at promoters and implicates h3
k56 acetylation and asf1. Mol. Cell 27: 393–405.
Sharp, J. A., G. Rizki and P. D. Kaufman, 2005 Regulation of histone
deposition proteins Asf1/Hir1 by multiple DNA damage check-
point kinases in Saccharomyces cerevisiae. Genetics 171: 885–899.
Sherwood, P. W., S. V.-M. T
sang and M. A. Osley, 1993 Char-
acterization of HIR1 and HIR2, two genes required for regulation
of histone gene transcription in Saccharomyces cerevisiae. Mol. Cell.
Biol. 13: 28–38.
Smolka, M. B., C. P. Albuquerque,S.H.Chen,K.H.Schmidt,X.X.
Wei et al., 2005 Dynamic changes in protein-protein interaction
and protein phosphorylation probed with amine-reactive isotope
tag. Mol. Cell. Proteomics 4: 1358–1369.
Spector, M. S., A. Raff,H.DeSilva,K.Lee and M. A. Osley,
1997 Hir1p and Hir2p function as transcriptional corepressors
to regulate histone gene transcription in the Saccharomyces cer-
evisiae cell cycle. Mol. Cell. Biol. 17: 545–552.
Strambio-de-Castillia, C., J. Tetenbaum-Novatt,B.S.Imai,B.T.
Chait and M. P. Rout, 2005 A method for the rapid and effi-
cient elution of native affinity-purified protein A tagged com-
plexes. J. Proteome Res. 4: 2250–2256.
Sutton, A., J. Bucaria,M.A.Osley and R. Sternglanz, 2001 Yeast
ASF1 protein is required for cell cycle regulation of histone gene
transcription. Genetics 158: 587–596.
Tackett, A. J., D. J. Dilworth,M.J.Davey, M. O’Donnell,J.D.
Aitchison et al., 2005 Proteomic and genomic characterization
of chromatin complexes at a boundary. J. Cell Biol. 169: 35–47.
T
averna, S. D., S. Ilin,R.S.Rogers,J.C.Tanny,H.Lavender et al.,
2006 Yng1 PHD finger binding to histone H3 trimethylated at
lysine 4 promotes NuA3 HAT activity at lysine 14 of H3 and tran-
scription at a subset of targeted ORFs. Mol. Cell 24: 785–796.
Taverna, S. D., B. M. Ueberheide,Y.Liu,A.J.Tackett,R.L.Diaz
et al., 2007 Long-distance combinatorial linkage between meth-
ylation and acetylation on histone H3 N termini. Proc. Natl.
Acad. Sci. USA 104: 2086–2091.
Tseng, R. J., K. R. Armstrong,X.Wang and H. M. Chamberlin,
2007 The bromodomain protein LEX-1 acts with TAM-1 to
modulate gene expression in C. elegans. Mol. Genet. Genomics
278: 507–518.
Voth, W. P., Y. W. Jiang and D. J. Stillman, 2003 New ‘marker swap’
plasmids for converting selectable markers on budding yeast
gene disruptions and plasmids. Yeast 20: 985–993.
Xu, F., K. Zhang and M. Grunstein, 2005 Acetylation in histone H3
globular domain regulates gene expression in yeast. Cell 121:
375–385.
Communicating editor: F. Winston
304 A. Gradolatto et al.
Page 14
  • Source
    • "Our study provides a detailed analysis of regulation of cell cycle-dependent histone gene transcription through phosphorylation of the chromatin boundary element Yta7 by S forms of Cdk1 and CK2. As overexpression of a yta7 phosphomutant is highly toxic and Yta7 localizes also to numerous other loci (Gradolatto et al. 2008), we propose that S-phase-specific regulation of Yta7 by Cdk1 and CK2 may be a mechanism that is broadly applied throughout the genome to regulate gene transcription. Interestingly, the human homolog of Yta7, ATAD2, is involved in chromatin dynamics and transcriptional activities and is up-regulated predominantly in G1/S- phase cells, consistent with a possible role in DNA replication and histone synthesis (Ciro et al. 2009; Caron et al. 2010). "
    [Show abstract] [Hide abstract] ABSTRACT: The cell cycle-regulated expression of core histone genes is required for DNA replication and proper cell cycle progression in eukaryotic cells. Although some factors involved in histone gene transcription are known, the molecular mechanisms that ensure proper induction of histone gene expression during S phase remain enigmatic. Here we demonstrate that S-phase transcription of the model histone gene HTA1 in yeast is regulated by a novel attach-release mechanism involving phosphorylation of the conserved chromatin boundary protein Yta7 by both cyclin-dependent kinase 1 (Cdk1) and casein kinase 2 (CK2). Outside S phase, integrity of the AAA-ATPase domain is required for Yta7 boundary function, as defined by correct positioning of the histone chaperone Rtt106 and the chromatin remodeling complex RSC. Conversely, in S phase, Yta7 is hyperphosphorylated, causing its release from HTA1 chromatin and productive transcription. Most importantly, abrogation of Yta7 phosphorylation results in constitutive attachment of Yta7 to HTA1 chromatin, preventing efficient transcription post-recruitment of RNA polymerase II (RNAPII). Our study identified the chromatin boundary protein Yta7 as a key regulator that links S-phase kinases with RNAPII function at cell cycle-regulated histone gene promoters.
    Full-text · Article · Dec 2011 · Genes & development
  • Source
    • "Indeed, qRT-PCR and microarray analyses showed that RITE strains containing tagged H3 express very similar H3 mRNA levels as wild-type cells containing untagged H3 at different phases of the cell cycle [7] (Figure S7). Interestingly, although histone mRNAs are cell cycle regulated and peak in S-phase when the demand for new histones is highest [64,65], histone H3 mRNA expression is still relatively high outside S-phase, providing an explanation for the abundant synthesis of new histones outside S-phase [7]. To investigate the biological function of histone turnover and its consequences for chromatin structure and function, we developed the Epi-ID barcode screen for chromatin regulators and combined it with RITE. "
    [Show abstract] [Hide abstract] ABSTRACT: Author Summary Packaging of eukaryotic genomes by the histone proteins influences many processes that use the DNA, such as transcription, repair, and replication. One well-known mechanism of regulation of histone function is the covalent modification of histone proteins. Replacement of modified histones by new histones has recently emerged as an additional layer of regulation (hereafter referred to as histone turnover). Although histone replacement can affect substantial parts of eukaryotic genomes, the mechanisms that control histone exchange are largely unknown. Here, we report a screening method for epigenetic regulators that we applied to search for histone exchange factors. The screening method is based on our finding that global chromatin changes in mutant cells can be inferred from chromatin states on short DNA barcodes. By analyzing the chromatin status of DNA barcodes of many yeast mutants in parallel, we identified positive and negative regulators of histone exchange. In particular, we find that the HAT-B complex promotes histone turnover. HAT-B is known to acetylate the tails of newly synthesized histones, but its role in chromatin assembly has been unclear. Hif1, the nuclear binding partner of HAT-B in the NuB4 complex, also promotes histone exchange but by non-overlapping mechanisms. These results provide a new perspective on pathways of histone exchange.
    Full-text · Article · Oct 2011 · PLoS Genetics
  • Source
    • "In humans, ATAD2 is an E2F target gene that binds to the MYC oncogene (Ciró et al. 2009). High ATAD2 levels correlate with a higher risk of distant recurrence in breast cancer, and mutation of the bromodomain in ATAD2 impairs the binding between ATAD2 and histone H3 (Ciró et al. 2009; see also Gradolatto et al. 2008). Additionally, knocking down ATAD2 expression inhibits estrogen-mediated induction of cyclin D1, c-myc and E2F1 mRNA, and mutating the AAA ATPase domain reduces estrogen-mediated induction of cyclin D1 and E2F1 (Zou et al. 2007). "
    [Show abstract] [Hide abstract] ABSTRACT: ATAD2 is an E2F target gene that is highly expressed in gastrointestinal and breast carcinomas. Here we characterize a related gene product, ATAD2B. Both genes are evolutionarily conserved, with orthologues present in all eukaryotic genomes examined. Human ATAD2B shows a high degree of similarity to ATAD2. Both contain an AAA domain and a bromodomain with amino acid sequences sharing 97% and 74% identity, respectively. The expression of ATAD2B was studied in the chicken embryo using a polyclonal antibody raised against a recombinant fragment of human ATAD2B. Immunohistochemistry revealed transient nuclear expression in subpopulations of developing neurons. The transient nature of the expression was confirmed by immunoblotting homogenates of the developing telencephalon. Cell fractionation was used to confirm the nuclear localization of ATAD2B in the developing nervous system: anti-ATAD2B recognizes a smaller band (approximately 160 kDa) in the nuclear fraction and a larger band (approximately 300 kDa) in the membrane fraction, suggesting that posttranslational processing of ATAD2B may regulate its transport to the nucleus. The expression of ATAD2B was also studied in human tumors. Oncomine and immunohistochemistry reveal ATAD2B expression in glioblastoma and oligodendroglioma; ATAD2B immunostaining was also elevated in human breast carcinoma. In tumors ATAD2B appears to be cytoplasmic or membrane bound, and not nuclear. Our observations suggest that ATAD2B may play a role in neuronal differentiation and tumor progression.
    Preview · Article · Dec 2010 · Development Growth and Regeneration
Show more