Contribution of Galactofuranose to the Virulence of the Opportunistic Pathogen Aspergillus fumigatus

Abstract

The filamentous fungus Aspergillus fumigatus is responsible for a lethal disease called invasive aspergillosis that affects immunocompromised patients. This disease,
like other human fungal diseases, is generally treated by compounds targeting the primary fungal cell membrane sterol. Recently,
glucan synthesis inhibitors were added to the limited antifungal arsenal and encouraged the search for novel targets in cell
wall biosynthesis. Although galactomannan is a major component of the A. fumigatus cell wall and extracellular matrix, the biosynthesis and role of galactomannan are currently unknown. By a targeted gene
deletion approach, we demonstrate that UDP-galactopyranose mutase, a key enzyme of galactofuranose metabolism, controls the
biosynthesis of galactomannan and galactofuranose containing glycoconjugates. The glfA deletion mutant generated in this study is devoid of galactofuranose and displays attenuated virulence in a low-dose mouse
model of invasive aspergillosis that likely reflects the impaired growth of the mutant at mammalian body temperature. Furthermore,
the absence of galactofuranose results in a thinner cell wall that correlates with an increased susceptibility to several
antifungal agents. The UDP-galactopyranose mutase thus appears to be an appealing adjunct therapeutic target in combination
with other drugs against A. fumigatus. Its absence from mammalian cells indeed offers a considerable advantage to achieve therapeutic selectivity.

Full text

EUKARYOTIC CELL, Aug. 2008, p. 1268–1277 Vol. 7, No. 8
1535-9778/08/$08.00⫹0 doi:10.1128/EC.00109-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Contribution of Galactofuranose to the Virulence of the Opportunistic
Pathogen Aspergillus fumigatus
䌤
Philipp S. Schmalhorst,
1
Sven Krappmann,
2
† Wouter Vervecken,
3
Manfred Rohde,
4
Meike Mu¨ller,
5
Gerhard H. Braus,
2
Roland Contreras,
3
Armin Braun,
5
Hans Bakker,
1
and Franc¸oise H. Routier
1
*
Department of Cellular Chemistry, Hannover Medical School, Hannover, Germany
1
; Department of Molecular Microbiology and
Genetics, Georg August University, Go¨ttingen, Germany
2
; Department of Molecular Biology, Ghent University, and
Department for Molecular Biomedical Research, VIB, Ghent, Belgium
3
; Department of Microbial Pathogenicity,
Helmholtz Centre for Infection Research, Braunschweig, Germany
4
; and Department of
Immunology, Allergology and Immunotoxicology, Fraunhofer Institute of Toxicology
and Experimental Medicine, Hannover, Germany
5
Received 27 March 2008/Accepted 9 June 2008
The filamentous fungus Aspergillus fumigatus is responsible for a lethal disease called invasive aspergillosis
that affects immunocompromised patients. This disease, like other human fungal diseases, is generally treated
by compounds targeting the primary fungal cell membrane sterol. Recently, glucan synthesis inhibitors were
added to the limited antifungal arsenal and encouraged the search for novel targets in cell wall biosynthesis.
Although galactomannan is a major component of the A. fumigatus cell wall and extracellular matrix, the
biosynthesis and role of galactomannan are currently unknown. By a targeted gene deletion approach, we
demonstrate that UDP-galactopyranose mutase, a key enzyme of galactofuranose metabolism, controls the
biosynthesis of galactomannan and galactofuranose containing glycoconjugates. The glfA deletion mutant
generated in this study is devoid of galactofuranose and displays attenuated virulence in a low-dose mouse
model of invasive aspergillosis that likely reflects the impaired growth of the mutant at mammalian body
temperature. Furthermore, the absence of galactofuranose results in a thinner cell wall that correlates with an
increased susceptibility to several antifungal agents. The UDP-galactopyranose mutase thus appears to be an
appealing adjunct therapeutic target in combination with other drugs against A. fumigatus. Its absence from
mammalian cells indeed offers a considerable advantage to achieve therapeutic selectivity.
The filamentous fungus Aspergillus fumigatus is the primary
cause of invasive aspergillosis, an often fatal condition affecting
people with a weakened immune system. Along with the im-
munocompromised population, the incidence of invasive as-
pergillosis is constantly growing, but therapy remains problem-
atic. The sterol binding polyene amphotericin B and the
ergosterol biosynthesis inhibitor itraconazole have long been
the drugs of choice for treatment of this infection, but because
of their higher efficacy and lower toxicity, new triazoles, such as
voriconazole or posaconazole, are supplanting these drugs (28,
33). Additionally, a novel class of antifungal agents called the
echinocandins provides further options for treatment. These
compounds inhibit the synthesis of ␤1,3-glucan, a major cell
wall component, with resultant osmotic instability and lysis
(12). Their minimal toxicity and synergistic activity with vori-
conazole and amphotericin B make them particularly attractive
for combination therapy, although clinical validation is still
awaited (33, 35). Despite these advances in therapy, invasive
aspergillosis is often associated with significant morbidity and
mortality, emphasizing the need for novel therapeutic strate-
gies based on the fundamental knowledge of A. fumigatus
pathogenesis.
The development of echinocandins illustrates the viability of
targeting enzymes involved in cell wall biosynthesis and en-
courages the development of chitin synthesis inhibitors. Like
glucan and chitin, galactomannan is an abundant component
of the A. fumigatus cell wall (4). This polysaccharide, composed
of a linear mannan core branched with short ␤1,5-linked ga-
lactofuranose (Galf) chains (22), is bound covalently to the cell
wall ␤1,3-glucan, anchored to the lipid membrane by a glyco-
sylphosphatidylinositol, or released in the environment during
tissue invasion or growth in culture (3, 9, 14). Besides being an
abundant component of the extracellular matrix, secreted ga-
lactomannans are used for serological diagnostic of invasive
aspergillosis (1). The monosaccharide Galf has also been
found in the N- and O-glycans of some glycoproteins as well as
the glycosphingolipids of A. fumigatus (23, 29, 41, 47) and thus
represents an important constituent of the cell wall of this
fungus. Galf is otherwise infrequent in natural compounds but
prevalent in pathogens. Moreover, since Galf is absent from
higher eukaryotes and involved in the survival or virulence of
various bacteria, the enzymes involved in the biosynthesis of
Galf are considered attractive drug targets (32, 34).
Our understanding of Galf metabolism in eukaryotes is lim-
ited. Galf is most likely incorporated into cell surface compo-
nents by specific galactofuranosyltransferases that use UDP-
Galf as a donor. The work of Trejo and colleagues in the early
1970s already suggested the existence of an enzyme converting
UDP-galactopyranose into UDP-galactofuranose involved in
* Corresponding author. Mailing address: Department of Cellular
Chemistry (OE 4330), Hannover Medical School, 30625 Hannover,
Germany. Phone: 49 (511) 532-9807. Fax: 49 (511) 532-3956. E-mail:
Routier.Francoise@mh-hannover.de.
† Present address: Research Center for Infectious Diseases, Wu¨rz-
burg, Germany.
䌤
Published ahead of print on 13 June 2008.
1268

the biosynthesis of the fungal cell wall (48). This enzyme,
named UDP-galactopyranose mutase (UGM) and encoded by
the glf gene, was described first for bacteria (17, 30, 50) and
lately for several eukaryotic pathogens, including A. fumigatus
(2, 5). UGM is to date the only characterized enzyme involved
in the biosynthesis of galactofuranose-containing molecules in
eukaryotes, whereas several galactofuranosyltransferases have
been described for bacteria (15, 19, 27, 51). The identification
of this enzyme, highly conserved among lower eukaryotes and
present in many fungi, enables studies of the biological role of
galactofuranose in these organisms. The present report high-
lights the role of galactofuranose in A. fumigatus growth and
virulence.
MATERIALS AND METHODS
Strains, media, and growth conditions. A. fumigatus clinical isolate D141 (38)
was used as the wild-type (wt) strain in this study. All strains were grown at 37°C
on Aspergillus minimal medium (AMM) containing 1%
D-glucose as the carbon
source and 70 mM NaNO
3
as the nitrogen source (36), unless otherwise stated.
Phleomycin or 5-fluoro-2⬘-deoxyuridine (FUDR) was added at 30 ␮g/ml or 100
␮M, respectively, for selection purposes.
Generation of A. fumigatus mutant strains. The 5⬘ and 3⬘ flanking regions (1.5
and 2 kb, respectively) of the A. fumigatus glfA coding sequence were amplified
from genomic DNA by PCR with primers PS12/PS1 and PS3/PS4 (Table 1),
respectively, and cloned into the pBluescript II SK(⫺) vector (Stratagene) by use
of the restriction sites SacII/NotI and EcoRV/ClaI. A SpeI/NotI fragment re-
leased from pSK269 containing the phleo/tk blaster (18) was then inserted
between the two fragments to obtain the disruption plasmid p⌬glfA. For recon-
stitution of the glfA gene locus, the plasmid pglfA* was constructed as follows.
The phleo/tk blaster of p⌬glfA was first replaced with the original A. fumigatus
glfA gene by homologous recombination in Escherichia coli strain YZ2000 (Gene
Bridges, Leimen, Germany). A single point mutation was introduced by site-
directed mutagenesis. Briefly, nonmethylated plasmid DNA was generated from
a methylated parent plasmid by Phusion DNA polymerase (NEB) using com-
plementary primers that both carried the desired mutation (PS23s/PS23r [Table
1]). Prior to transformation, the parental, methylated DNA strand was specifi-
cally cleaved by DpnI to selectively obtain transformants that harbored the
mutated plasmid. Thus, codon 130 of the glfA coding sequence (GenBank ac-
cession number AJ871145) was changed from CTT to CTC, which generated a
new XhoI restriction site. Since gene reconstitution by homologous recombina-
tion could not be obtained with this construct, 5⬘ and 3⬘ flanking regions were
extended to 5 kb by replacement with recloned PCR fragments (primer pairs
PS28/PS1 and PS3/PS31) to obtain the final pglfA* construct.
The p⌬glfA and pglfA* plasmids were linearized (KpnI/SacII) before poly-
ethylene glycol-mediated fusion of protoplasts, as described previously (37).
Transformants were grown on AMM plates containing 1.2 M sorbitol as the
osmotic stabilizer under appropriate selection conditions and singled out twice
before further analysis. Accurate gene deletion and reconstitution were con-
firmed by Southern hybridization. Southern probes were amplified from genomic
DNA by using primer pairs PS66A/PS67A, PS68A/PS69A, and PS20/PS21. All
primer sequences are provided in Table 1.
Western blot analysis. Cell wall glycoproteins and soluble polysaccharides
were extracted from 30 mg ground A. fumigatus mycelium by incubation in 1 ml
sample buffer (15% glycerol, 100 mM Tris-HCl, pH 6.8, 1.5% sodium dodecyl
sulfate, 0.25% ␤-mercaptoethanol, 0.025% bromophenol blue) for 12 min at
95°C. A portion (20 ␮l) of the supernatant was separated on a 10% sodium
dodecyl sulfate-polyacrylamide gel and transferred to nitrocellulose membranes.
The monoclonal antibody (MAb) EB-A2 (42) conjugated to horseradish perox-
idase (HRP) from a Platelia Aspergillus test (Bio-Rad, Hercules, CA) or HRP-
coupled lectin concanavalin A (ConA) (Sigma-Aldrich) was used in a 1:50 dilu-
tion or at 0.2 ␮g/ml, respectively. HRP activity was visualized by an enhanced
chemiluminescence system (Pierce, Rockford, IL).
N-glycan analysis. N-glycans of secreted glycoproteins in the supernatant of an
A. fumigatus liquid culture were analyzed after peptide N-glycosidase F (PNGase
F)-mediated release and 8-amino-1,3,6-pyrenetrisulfonic acid (APTS) labeling
by capillary electrophoresis, as recently described (20). Separation was carried
out on a four-capillary electrophoresis DNA sequencer (3130 genetic analyzer;
Applied Biosystems, Foster City, CA). Oligomaltose and bovine RNase B N-
glycans (Prozyme, San Leandro, CA) served as reference oligosaccharides.
Purification and analysis of GIPCs. Mycelia (0.5 g) ground in liquid nitrogen
with a mortar and pestle were disrupted by sonication in 6 ml of CHCl
3
-methanol
(MeOH), 1:1. After addition of 3 ml CHCl
3
(to obtain a CHCl
3
/MeOH ratio of
2:1), glycosylinositolphosphoceramides (GIPCs) were extracted at room temper-
ature for at least 15 min on a rotating shaker. MeOH (3 ml) was then added to
lower the density, and the mixture was centrifuged for 10 min at 2,000 ⫻ g to
remove insoluble material. Chloroform and H
2
O were then added to the super
-
natant to obtain a biphasic system with an 8:4:3 ratio of CHCl
3
/MeOH/H
2
O.
After centrifugation for 10 min at 2,000 ⫻ g, GIPCs contained in the upper phase
were collected and applied to a C
18
SepPak cartridge (Waters, Eschborn, Ger
-
many) preequilibrated with 5 ml CHCl
3
/MeOH/H
2
O at a ratio of 3:48:47. After
washing of the column with 20 ml CHCl
3
/MeOH/H
2
O at a ratio of 3:48:47,
glycolipids were eluted with 5 ml MeOH and dried under a stream of nitrogen.
High-performance thin-layer chromatography and immunostaining with the
MAb MEST-1 were carried out as previously described (47).
Growth assay. For radial growth measurement, a 10-␮l drop containing 10,000
A. fumigatus conidia was placed in the center of an agar plate containing either
minimal (AMM) or complete (potato dextrose agar; Becton Dickinson Difco,
Heidelberg, Germany) medium. Plates were incubated at various temperatures,
and colony diameters were measured twice daily.
Antifungal susceptibility testing. The reference broth microdilution test was
applied for A. fumigatus antifungal susceptibility testing (21). Each antifungal
stock was diluted in 200 ␮l double-strength RPMI 2%G (RPMI 1640 liquid
medium buffered with 165 mM 4-morpholinepropanesulfonic acid [MOPS] to
TABLE 1. DNA oligonucleotides used in this study
Oligonucleotide Sequence (5⬘33⬘)
a
Description (restriction site)
PS1 ATAAGCGGCCGCAAGCTGGGAACGCGATTCAA 5⬘ Flanking region p⌬glfA reverse (NotI)
PS12 TATACCGCGGCTGCCAAGCTATCAGTTTCC 5⬘ Flanking region p⌬glfA sense (SacII)
PS3 ATCCGGTGCTCAGGTATTCGCCA 3⬘ Flanking region p⌬glfA sense (EcoRV)
PS4 ATCCATCGATCATATCCTATGCGGTCTCAG 3⬘ Flanking region p⌬glfA reverse (ClaI)
PS66A TTACGCATTCCCAGCAGTTG Southern blot probe 1 sense
PS67A TGCGCTGTGATGAATGGTGT Southern blot probe 1 reverse
PS68A TCCACAATACGTCCCCTACA Southern blot probe 2 sense
PS69A GTATGAACCCTCTCCCAATG Southern blot probe 2 reverse
PS20 AAGGTCGTTGCGTCAGTCCA Southern blot probe 3 sense
PS21 TCGATGTGTCTGTCCTCC Southern blot probe 3 reverse
PS23s ATGCCGCTCTCGAGGCTCGT Site-directed mutagenesis glfA* sense (XhoI)
PS23r CACGAGCCTCGAGAGCGGCA Site-directed mutagenesis glfA* reverse (XhoI)
PS28 ATATGCGGCCGCAAACAGGAGCGAAGTAGT 5⬘ Flanking region pglfA* sense (NotI)
PS31 ATATCCCGGGAGTTTGGTGCTGTGGTAGGT 3⬘ Flanking region pglfA* reverse (XmaI)
PS78 CGTGTCTATCGTACCTTGTTGCTT 18S rRNA gene fragment sense
PS79 AACTCAGACTGCATACTTTCAGAACAG 18S rRNA gene fragment reverse
Probe FAM-CCCGCCGAAGACCCCAACATG-TAMRA qPCR hybridization probe
a
Restriction sites are underlined. TAMRA, 6-carboxytetramethylrhodamine.
VOL. 7, 2008 A. FUMIGATUS UDP-GALACTOPYRANOSE MUTASE 1269

pH 7.0 and supplemented with 2% glucose) to obtain the highest concentration
to be tested. Nine serial 1:2 dilutions in double-strength RPMI 2%G were made,
and to each dilution a volume of 100 ␮lofanA. fumigatus spore solution
(2.5 䡠 10
5
/ml in water) was added. Microtiter plates were incubated at 35°C, and
fungal growth in each well was read out visually after 3 days and compared to
growth in control wells that contained no antifungal.
Field emission scanning electron microscopy. For morphological studies and
measurements of the cell wall thickness, A. fumigatus wt and ⌬glfA mutant
mycelia were fixed in 5% formaldehyde and 2% glutaraldehyde in cacodylate
buffer (0.1 M cacodylate, 0.01 M CaCl
2
, 0.01 M MgCl
2
, 0.09 M sucrose, pH 6.9)
for1honice. Samples were washed several times with cacodylate buffer and
subsequently with TE buffer (20 mM Tris-HCl, 1 mM EDTA, pH 6.9) before
dehydration in a graded series of acetone (10, 30, 50, 70, 90, and 100%) on ice
for 15 min per step. Samples at the 100% acetone step were allowed to reach
room temperature before another change in 100% acetone. Samples were then
subjected to critical-point drying with liquid CO
2
(CPD 30; Balzers Union,
Liechtenstein). Dried samples were then mounted onto conductive carbon ad-
hesive tabs on an aluminum stub and sputter coated with a thin gold film (SCD
40; Balzers Union, Liechtenstein). For cell wall thickness measurements, myce-
lium was fractured by pressing another conductive carbon adhesive tab-covered
stub onto the sample and separating both stubs immediately thereafter. Frac-
tured hyphae were also made conductive by sputter coating with a gold film
before examination with a field emission scanning electron microscope (Zeiss
DSM 982 Gemini) using an Everhart Thornley SE detector and an in-lens SE
detector at a 50:50 ratio at an acceleration voltage of 5 kV and at calibrated
magnifications.
Mouse infection model. A low-dose mouse infection model of invasive as-
pergillosis for BALB/c mice which had been established previously (25) was
essentially used. The immunosuppressive state was established by intraperitoneal
injections of 100 mg cyclophosphamide (Endoxan; Baxter Chemicals)/kg of body
weight on days ⫺4, ⫺1, 0, 2, 5, 8, and 11 and a single subcutaneous dose (200
mg/kg) of a cortisone acetate suspension (Sigma) on day ⫺1. Groups of 20 mice
were infected intranasally with 20,000 conidia of the wt strain, the ⌬glfA strain,
or the reconstituted glfA* strain on day 0. The control group received phosphate-
buffered saline (PBS) only. Survival was monitored for 13 days after infection,
and moribund animals were sacrificed. Coincidence of severely reduced mobility,
low body temperature, and breathing problems was defined as the moribundity
criterion. Statistical analysis of survival data was carried out using a log rank test
implemented in Prism 4 (GraphPad Software, San Diego, CA). For quantifica-
tion experiments, groups of three to five animals were killed 2, 4, and 6 days after
infection and lungs were removed for further analysis.
Lung histology. Female BALB/c mice were immunosuppressed and infected as
described above. The animals were killed after 5 days and their lungs removed
and fixed in 4% PBS-buffered paraformaldehyde overnight. Tissue samples were
dehydrated through a series of graded alcohols, cleared with xylene, and embed-
ded in paraffin. Tissue sections (5 ␮m) were stained either with hematoxylin/
eosin or by the periodic acid-Schiff method for visualization of fungal cell walls.
Photomicrographs were taken with an Axiovert 200M microscope (Zeiss, Ger-
many) at ⫻10 and ⫻20 magnifications.
Preparation of genomic DNA from mouse lungs. Tissue homogenization was
essentially as described previously (7). Immediately after removal, mouse lungs
were transferred to a 2-ml screw cap containing 1.4-mm ceramic beads (lysing
matrix D; Qbiogene, Irvine, CA) and 20% glycerol-PBS. Tissue was disrupted
using a FastPrep FP120 instrument (Qbiogene) three times for 30 s each at speed
5, with intermediate cooling on ice. The disrupted tissues were further homog-
enized with approximately 250 mg acid-washed glass beads (0.45 to 0.5 mm;
Sigma-Aldrich) by vortexing three times for 30 s each, with intermediate cooling
on ice. A DNeasy blood and tissue kit (Qiagen, Hilden, Germany) was used to
extract genomic DNA from an equivalent of 8% of the starting tissue material of
this homogenate. DNA was finally recovered in 200 ␮l elution buffer.
qPCR. Quantitative PCR (qPCR) was carried out essentially as described
previously (7). Primers for amplification of an 18S rRNA gene (GenBank ac-
cession number AB008401) fragment specific for A. fumigatus and a hybridiza-
tion probe labeled with 6-carboxyfluorescein (FAM) (5⬘ end) and 6-carboxytet-
ramethylrhodamine (3⬘ end) were designed using Primer Express software,
version 3.0 (Applied Biosystems) (Table 1). qPCR reactions were performed
with a 7500 Fast real-time PCR system instrument (Applied Biosystems) loaded
with MicroAmp optical 96-well plates sealed with an optical adhesive cover
(Applied Biosystems). Each qPCR reaction mixture (20 ␮l) contained 5 ␮l
sample DNA, 250 nM dual-labeled hybridization probe, 500 nM primers, 250
␮g/ml bovine serum albumin, and TaqMan Fast universal PCR master mix
(Applied Biosystems). The latter contains hot-start DNA polymerase, de-
oxynucleoside triphosphates, and the fluorescent dye carboxyrhodamine (ROX)
as a passive reference. Real-time PCR data were acquired using Sequence
Detection software, v1.3.1. The FAM/ROX fluorescence ratio was recorded at
every cycle, and a threshold cycle (C
T
) value was assigned to each reaction
product, defining the cycle number at which the FAM/ROX signal surpassed an
automatically defined threshold. C
T
values were corrected for differences in
yield of genomic DNA by normalization to the DNA concentration of a control
sample by using the formula C
T,norm
⫽ C
T,measured
⫹ log
2
(DNA
sample
/DNA
control
)
(7). Translation of sample C
T,norm
values into rRNA gene copy numbers was
done as follows. C
T
values of serial 1:10 dilutions containing 300 to 300,000
molecules (n) (calculated from M
w
and DNA concentration determined by
measurement of optical density at 260 nm) of a plasmid bearing the cloned A.
fumigatus 18S rRNA gene were plotted against n to generate a calibration curve
which was then used to assign an rRNA gene copy number to a given sample
C
T,norm
value. Conidial equivalents were calculated from gene copy numbers by
means of uninfected tissue samples that were spiked with defined numbers of
conidia before tissue homogenization (7). Samples, controls, and standards were
analyzed in triplicate.
RESULTS
Deletion and reconstitution of the glfA gene in A. fumigatus.
To begin investigating the role of Galf in A. fumigatus biology,
we deleted the gene encoding UGM (GenBank accession no.
AJ871145) and named it glfA, following the recommendations
for gene naming for Aspergillus. To do this, we generated a
deletion plasmid containing the regions flanking the glfA cod-
ing sequence separated by the bifunctional selection cassette
phleo/tk, which confers both resistance to phleomycin and sen-
sitivity to FUDR (18). This construct was used to transform
protoplasts of A. fumigatus clinical strain D141, which served as
the wt, and phleomycin-resistant transformants were analyzed
by Southern blotting using several digoxigenin-labeled probes
(Fig. 1). One of the clones that had undergone the desired
gene replacement (Fig. 1) was selected for further analysis and
named ⌬glfA.
The selected disruptant was further subjected to protoplast
transformation with a large DNA fragment encompassing the
glfA coding sequence which contained a single translationally
silent nucleotide exchange that generated an XhoI restriction
site. Gene replacement in the transformants resulted in the
reconstitution of the glfA locus (Fig. 1) as detected by FUDR
resistance and proven by Southern blot analysis for a selected
clone named glfA* (Fig. 1B). The silent mutation introduced in
the reconstituted strain allowed differentiation between the wt
and the glfA* mutant, as demonstrated in Fig. 1B (top), and
thus enabled us to rule out contamination by the wt strain. The
reconstitution of the glfA locus ensures that any phenotype
observed for the ⌬glfA strain can be reverted and hence be
securely attributed to the loss of the glfA gene.
Galf is absent from the A. fumigatus ⌬glfA mutant. To con-
firm that deletion of glfA indeed altered the expression of
Galf-containing glycoconjugates, aqueous mycelial extracts
were tested for reactivity to the Galf-specific MAb EB-A2. This
antibody recognizes preferably ␤1,5-linked Galf residues that
are present in all forms of galactomannan (cell wall bound,
membrane bound, and secreted) (42) as well as in some O-
glycans (23). Moreover, a second binding epitope, Galf(␤1,2)
Man, which is part of galactofuranosylated N-glycans, has been
postulated (29). Thus, EB-A2 can be used to detect galacto-
mannan and galactofuranosylated glycoproteins simulta-
neously. Western blot analysis of wt and glfA* total mycelial
extracts labeled with HRP-conjugated EB-A2 revealed a smear
migrating around 40 to 80 kDa, in accordance with previous
1270 SCHMALHORST ET AL. EUKARYOT.CELL

findings (42). In contrast, the ⌬glfA mycelial extract was not
stained at all, indicating the absence of Galf in the galacto-
mannan and glycoproteins of this mutant (Fig. 2A, left). ConA
used as the loading control bound slightly better to the ⌬glfA
extract than to those of the wt and the glfA* mutant (Fig. 2A,
right). The lack of Galf in the ⌬glfA mutant might increase the
accessibility of the mannan for ConA and thus could explain
this finding.
Similarly, the absence of Galf in ⌬glfA glycolipids was shown
by the absence of reactivity to the MAb MEST-1. This anti-
body, which recognizes ␤1,3- and ␤1,6-linked Galf residues
(43), labeled several A. fumigatus GIPCs after separation by
high-performance thin-layer chromatography, as previously
shown (47), but did not label glycosphingolipids extracted from
the ⌬glfA mutant (Fig. 2B, left). The upper bands observed in
Fig. 2B (left panel) might be attributed to GIPCs containing
one or two Galf and two or three mannose residues, as recently
described (41, 47). In addition, Simenel et al. (41) reported an
unusual GIPC containing a Galf residue substituted at position
6 by a choline phosphate. The lower band present in the wt
chromatogram could correspond to a similar GIPC. Staining of
glycolipids by orcinol was used as the loading control (Fig. 2B,
right). The simpler ⌬glfA chromatogram is compatible with the
absence of Galf-containing GIPCs. The uppermost band ob-
served in the chromatogram most probably corresponds to
Man(␣1,3)Man(␣1,2)Ins-P-Cer, while the band just beneath it
could be attributed to Man(␣1,2)Man(␣1,3)Man(␣1,2)Ins-P-Cer
(47). The chromatograms obtained from the reconstituted glfA*
mutant and the wt were indistinguishable (data not shown).
Additionally, N-glycans enzymatically released from A. fu-
FIG. 1. (A) Schematic representation of the chromosomal glfA locus in wt, ⌬glfA, and reconstituted glfA* strains. The thick black bars show
flanking regions used for homologous recombination. The positions of probes (probes 1 to 3) used for Southern blot analysis, along with the
respective restriction fragments (sizes in kb), are indicated. ble/tk, phleomycin resistance/thymidine kinase fusion gene; P, promoter; T, terminator.
(B) Southern blots of genomic DNA digested with the indicated restriction enzymes and hybridized to different digoxigenin-labeled probes.
FIG. 2. (A) Western blots of A. fumigatus mycelial extracts containing glycoproteins and cell wall polysaccharides stained with HRP conjugates
of either Galf-specific MAb EB-A2 (left) or ␣-mannose binding lectin ConA (right). (B) A. fumigatus GIPCs separated by high-performance
thin-layer chromatography and stained with Galf-specific MAb MEST-1 (left) or orcinol (right). White bars indicate the origin.
V
OL. 7, 2008 A. FUMIGATUS UDP-GALACTOPYRANOSE MUTASE 1271

1272

migatus secreted proteins were analyzed by capillary electro-
phoresis after fluorescent labeling (8, 20). The profiles ob-
tained are presented in Fig. 3A (panels 1 and 2). The peaks
labeled 1, 2, 3, 4, and 5 present in both electropherograms
comigrated with reference oligosaccharides M5 to M9 (Fig.
3A, panel 9, and 3B). Moreover, digestion of these N-glycans
by Trichoderma reesei ␣1,2-mannosidase indicates that peaks 2,
3, 4, and 5 arise from substitution of oligosaccharide 1 with one
to four mannose residues linked in ␣1,2 (Fig. 3A, panels 3 and
4). The profile obtained with wt N-glycans (Fig. 3A, panel 1)
presents four additional peaks (labeled 1a, 2a, 3a, and 4a) that
were absent from glfA N-glycans. The retention times of these
peaks suggest that they arise from substitution of oligosaccha-
rides 1 to 4 with a single Galf residue. The presence of a
terminal nonreducing Galf residue in A. fumigatus N-glycans
has been reported previously (9) and was demonstrated by
hydrofluoric acid treatment of the N-glycans after T. reesei
␣1,2-mannosidase digestion (Fig. 3A, panels 5 and 6). This
mild acid treatment, known to release Galf, entirely converted
oligosaccharide 1a into oligosaccharide 1 (Fig. 3A, panels 3
and 5). In contrast, hydrofluoric acid treatment did not change
the profile of ⌬glfA N-glycans digested with ␣1,2-mannosidase
(Fig. 3A, panels 4 and 6).
Interestingly, the comparison of wt and ⌬glfA N-glycans di-
gested with T. reesei ␣1,2-mannosidase or jack bean mannosi-
dase helps with positioning of the Galf residue. ␣1,2-Manno-
sidase treatment converted the oligosaccharides 2a, 3a, and 4a
into 1a while the oligosaccharides 2, 3, and 4 generated 1 (Fig.
3A, compare panels 1 and 2 with panels 3 and 4). This indicates
that the Galf residue does not protect any mannose residues
from the exomannosidase digestion and thus does not substi-
tute an ␣1,2-linked mannose (Fig. 3A, panels 3 and 4). More-
over, jack bean mannosidase digestion of wt N-glycans resulted
in a major peak (peak 7), attributed to GalfMan
3
GlcNAc
2
from its retention time, in addition to Man
1
GlcNAc
2
(peak 6),
expected from digestion of high-mannose type N-glycans (Fig.
3A, panels 7 and 8). These experiments do not allow for the
determination of the detailed N-glycan structures but suggest
that they resemble the N-glycans of A. niger ␣-glucosidase and
␣-galactosidase (44, 45). More importantly, these experiments
demonstrate the absence of Galf in the ⌬glfA N-glycans.
Loss of Galf alters morphology and growth of A. fumigatus.
The ⌬glfA strain exhibited a marked growth defect on solid
minimal media or complete media compared to the wt. This
effect could be observed for a wide range of temperatures (Fig.
4) and was statistically different in all cases (P ⬍ 0.001, t test,
n ⫽ 3). The most severe effect was found at 42°C, with a 75%
reduction in radial growth (Fig. 4B). In parallel, ⌬glfA conidia-
tion was diminished by 90% at 37°C and was almost absent at
42°C. In contrast, the onsets and rates of germination of wt,
⌬glfA, and glfA* conidia were similar. In minimal media at
37°C, the conidia of all strains started forming germ tubes at
3.2 h and reached 100% germination within 8 to 9 h (data not
shown).
Scanning electron micrographs of intact mycelium, conidio-
phores, and conidia of ⌬glfA did not reveal any obvious mor-
phological differences when compared to wt. However, the
observation of fractured mycelium revealed a marked reduc-
tion of the ⌬glfA cell wall thickness (Fig. 5). Measurements
indicated that the cell wall thickness of wt A. fumigatus varies
from 85 to 315 nm, which is in good agreement with earlier
findings (39). In contrast, ⌬glfA cell wall thickness ranged from
FIG. 3. (A) Electropherograms of fluorescently labeled N-glycans enzymatically released from secreted A. fumigatus glycoproteins. Oligosac-
charides from the wt and the ⌬glfA mutant were untreated (panels 1 and 2), digested with T. reesei ␣1,2-exomannosidase with or without
hydrofluoric acid (HF) treatment (panels 3 to 6), or digested with jack bean ␣-mannosidase (panels 7 and 8). Bovine RNase B N-glycans served
as the reference (panel 9). (B) Structures of bovine RNase B reference N-glycans. (C) Major N-glycans found on A. niger ␣-galactosidase and
␣-glucosidase (44, 45). Black squares, N-acetylglucosamine; gray circles, mannose; white pentagon, galactofuranose.
FIG. 4. (A) Colony morphology of A. fumigatus on minimal agar after 2 days. Bar, 1 cm. (B) Absolute and relative (rel.) (compared to the wt)
growth rates derived from three independent experiments. P values derived from a t test indicate statistical significance (***, P ⬍ 0.001; ns, not
significant).
V
OL. 7, 2008 A. FUMIGATUS UDP-GALACTOPYRANOSE MUTASE 1273

85 to 150 nm. The mean values (⫾standard deviations) of cell
wall thickness obtained from 25 measurements were 227.5 nm
(⫾15.98 nm) and 109.7 nm (⫾11.3 nm) for wt and ⌬glfA hy-
phae, respectively. The cell wall of ⌬glfA was thus approxi-
mately half the thickness of the wt cell wall.
⌬glfA is more susceptible to drugs. The structural cell wall
defect caused by the Galf deficiency was accompanied by an
increased susceptibility to several antifungal agents (Table 2).
MICs determined by a broth microdilution test were slightly
reduced for amphotericin B and caspofungin in the ⌬glfA mu-
tant. A more pronounced increase in susceptibility was seen for
voriconazole (0.04 mg/liter for ⌬glfA, compared to 0.3 mg/liter
for the wt) and nikkomycin Z (63 to 125 mg/liter for ⌬glfA and
500 mg/ml for the wt), suggesting an increased permeability of
the cell wall caused by the loss of Galf. In contrast, the sensi-
tivity toward oxidative stress remained unchanged, as indicated
by equal MICs for H
2
O
2
in both wt and ⌬glfA strains.
⌬glfA displays attenuated virulence in a murine model of
invasive aspergillosis. The influence of the glfA deletion on the
pathogenicity of A. fumigatus was assessed in a low-dose mouse
infection model of invasive aspergillosis (25). Cyclophospha-
mide was used to induce neutropenia in female BALB/c mice,
and a single dose of cortisone acetate was administered before
intranasal infection with 20,000 A. fumigatus conidia. Neutro-
penia was maintained throughout the observation period of 13
days, and survival was recorded daily (Fig. 6A). Ninety percent
of the animals infected with the wt did not survive beyond day
7 after infection, whereas half of the mice infected with ⌬glfA
were still alive on day 13. A log rank test of wt and ⌬glfA
survival data confirmed that the observed difference was sta-
tistically significant (P ⫽ 0.0004). The attenuation in virulence
could clearly be attributed to the absence of glfA, since animals
infected with the reconstituted glfA* strain showed a survival
pattern nearly identical to that of the wt (no significant differ-
ence by the log rank test, P ⫽ 0.559). A histological examina-
tion of lung tissue from mice infected with the wt, ⌬glfA, and
glfA* strains 5 days after inoculation showed evident fungal
growth surrounding bronchioles and tissue penetration (Fig.
7). For each strain, inflammatory cells were rarely observed at
the sites of infection.
To correlate the delay in the onset and progression of mor-
tality with a growth defect, the fungal burden in lungs of in-
fected mice was determined by qPCR (Fig. 6B). Mice were
treated and infected as described above. After 2, 4, and 6 days,
animals were sacrificed and their lungs taken. DNA was iso-
lated from homogenized lung tissue and fungal content deter-
mined by amplification of a part of A. fumigatus ribosomal
DNA. As shown in Fig. 6B, growth of ⌬glfA was restricted in
vivo compared to that of the wt, which was in agreement with
the slower growth observed in vitro.
DISCUSSION
The essential role of the ␤1,3-glucan in cell wall organization
and growth of several pathogenic fungi has been the basis for
the development of the echinocandins (11). Likewise, inhibi-
tors of chitin biosynthesis are currently being explored as new
antifungal drugs since chitin is an important structural element
of the fungal cell wall (6). In contrast, although galactomannan
is a major component of the cell wall and the extracellular
matrix, the role of galactomannan had not yet been investi-
gated, since the enzymes involved in its biosynthesis are un-
known. Recently, we and others characterized the UGM of
various pathogenic eukaryotes, including A. fumigatus (2, 5). In
prokaryotes, like in the protozoan Leishmania, this enzyme is
the only route to the formation of UDP-Galf, the donor sub-
strate of galactofuranosyltransferases, and thus controls the
biosynthesis of all Galf-containing molecules. Likewise, A. fu-
migatus UGM was found to be essential for the biosynthesis of
galactomannan as well as some glycosphingolipids and glyco-
proteins. Like in other organisms (16, 32), deletion of the glfA
gene resulted in the complete absence of Galf, as shown for
instance by the absence of reactivity to the antibody EB-A2.
Besides demonstrating the lack of Galf in the ⌬glfA mutant,
our analyses provide useful structural information for A. fu-
migatus N-glycans. Treatment of wt secreted proteins with
PNGase F released galactofuranosylated high-mannose type
N-glycans. The size of the oligosaccharides and the presence of
a single Galf residue are in agreement with previous studies of
filamentous fungi (26, 29). Moreover, analysis of these oligo-
FIG. 5. Field emission scanning electron micrographs of cross-fractured mycelial walls of A. fumigatus wt and ⌬glfA hyphae. Panels 1 and 3
display the highest measurement of cell wall thickness. Panels 2 and 4 present two measurements illustrating the 50% reduction of ⌬glfA cell wall
thickness.
TABLE 2. MICs of various antifungal agents against A. fumigatus
mutants, obtained from a broth microdilution assay
Genotype
MIC (mg/liter)
a
of:
AmB Vor Cas NiZ H
2
O
2
wt 3.9 0.3 62.5 500 218
⌬glfA 2.0 0.04 31.3 62.5–125 218
glfA* 3.9 0.3 62.5 500 218
a
Values for amphotericin B (AmB) and caspofungin (Cas) are MIC
90
values,
values for voriconazole (Vor) and nikkomycin Z (NiZ) are MIC
50
values, and
values for H
2
O
2
are MIC
100
values.
1274 SCHMALHORST ET AL. EUKARYOT.CELL

saccharides after digestion by jack bean or T. reesei ␣1,2-man-
nosidase helps with positioning of the Galf residue. These data
and the comparison with high-mannose standards suggest that
the N-glycans from A. fumigatus secreted proteins resemble
those of A. niger ␣-
D-galactosidase and ␣-D-glucosidase (44, 45,
49). These N-glycans might have arisen simply from trimming
of the Glc
3
Man
9
GlcNAc
2
precursor and substitution by a Galf
residue. Aspergillus spp. indeed contain several ␣1,2-mannosi-
dase genes, and trimming of high-mannose glycans has been
shown previously (13, 52). Interestingly, Galf addition has been
suggested to act as a stop signal for mannose addition, in
analogy to the role proposed for the ␣1,3-linked terminal man-
nose in Saccharomyces cerevisiae (29, 49). However, preventing
the addition of galactofuranose does not result in an increased
size of the oligosaccharides. On the contrary, Man
5
GlcNAc
2
is
the main oligosaccharide found in the ⌬glfA mutant, while
GalfMan
6
GlcNAc
2
is predominant in the wt.
Although glfA deletion has been shown to be lethal in My-
cobacterium smegmatis (32), the in vitro viability of the A.
fumigatus ⌬glfA mutant is unsurprising, since Galf occupies a
nonreducing terminal position in the molecules of this fungus.
Hence, the absence of Galf does not perturb the basic organi-
zation of the cell wall, as would the absence of the underlying
structures. Nevertheless, it resulted in marked alterations of
the cell surface and a notably thinner cell wall, as revealed by
electron microscopy. The basis of this drastic change is unclear
and difficult to attribute to a particular cell wall component,
since glycosylphosphatidylinositol/cell wall bound galactoman-
FIG. 6. (A) Survival of immunosuppressed mice infected intranasally with A. fumigatus wt (solid line), ⌬glfA (dotted line), or glfA* (dashed line)
strains and of uninfected mice (dotted and dashed line). Each group consisted of 20 animals. (B) qPCR determination of A. fumigatus burden
(measured as conidial equivalents [eq.] [see Materials and Methods]) in lung tissue from immunosuppressed mice infected with wt (solid line) or
⌬glfA (dotted line) strains. Each data point represents the mean value obtained from three to five animals. Error bars indicate standard errors of
the means.
FIG. 7. Periodic acid-Schiff-stained lung sections of mice infected with wt, ⌬glfA,orglfA* A. fumigatus strains. Fungal colonies appear
purple/red. Infected sites are typically surrounded by areas of necrotic tissue but show no or hardly any infiltrating leukocytes. Bar, 100 ␮m.
VOL. 7, 2008 A. FUMIGATUS UDP-GALACTOPYRANOSE MUTASE 1275

nan, N-glycans, O-glycans, and GIPCs are affected by UDP-
Galf deficiency. In other fungi, the loss of terminal sugar res-
idues has sometimes been associated with reduced cell wall
strength. For instance, a Schizosaccharomyces pombe mutant
deficient in cell wall galactosylation displays morphological
changes, attenuated growth, and a 25 to 35% reduction in cell
wall thickness (46).
The structural changes originating from the glfA deletion are
associated with slower growth, indicating that Galf plays an
important role in A. fumigatus morphogenesis. The tempera-
ture-sensitive growth defect at a higher temperature displayed
by the ⌬glfA mutant is reminiscent of that observed for the
⌬AfPmt1 mutant, a mutant characterized by reduced O glyco-
sylation (53). Interestingly, an influence of Galf deficiency on
the growth rate was also observed for ⌬glfA mutants of As-
pergillus nidulans (F. H. Routier, unpublished data) and As-
pergillus niger (10). Conversely, glfA deletion had no effect on
the in vitro growth of Leishmania parasites (16), highlighting
that the role of Galf cannot be translated to every Galf-con-
taining organism.
The ability to thrive at 37°C is a characteristic of human
pathogens that has been shown to correlate with virulence
potential in the case of A. fumigatus (31). Consequently, mu-
tations that affect the growth of fungi at mammalian body
temperature are commonly associated with attenuated viru-
lence (40). In this study, we observed slower growth of the A.
fumigatus ⌬glfA mutant in vitro but also in vivo by using qPCR.
In agreement with this observation, the mutant was clearly
attenuated in virulence, showing a delay in both the onset and
the progression of mortality when tested in a low-dose mouse
infection model of invasive aspergillosis. An altered immune
response caused by the different cell wall structure of the ⌬glfA
mutant may also contribute to the attenuation in virulence.
However, no differences in adherence and uptake of wt and
⌬glfA conidia by murine bone marrow-derived dendritic cells
or in production of tumor necrosis factor alpha or interleu-
kin-10 by infected murine bone-marrow derived macrophages
were observed (K. Kotz, F. Ebel, and F. H. Routier, unpub-
lished data).
The value of echinocandins in invasive aspergillosis treatment
resides in their synergistic effects with azoles and amphotericin
B. Similarly, chitin synthesis inhibitors demonstrate synergy
with echinocandins and azoles (24). These synergistic effects
that offer new options for combination antifungal therapy are
most likely due to greater cell wall permeability. We did note
an increase in susceptibility of the ⌬glfA mutant to several
antifungal agents, notably to voriconazole. However, in the
liquid culture conditions classically used for antifungal suscep-
tibility testing, the fungus is not surrounded by an extracellular
matrix. This extracellular matrix that delays the penetration of
drug is rich in galactomannan (3) and is probably altered in the
⌬glfA mutant, as suggested by the compact appearance of
colonies on agar plates. In vivo, a greater increase in suscep-
tibility of the ⌬glfA mutant to drugs would therefore be ex-
pected. Besides the attenuated virulence, this suggests that
inhibitors of UGM might be useful in antifungal therapy. The
absence of Galf biosynthesis in mammals would represent a
considerable advantage for the development of antifungal
drugs with selective toxicity.
ACKNOWLEDGMENTS
We thank Florian La¨nger, Frank Ebel, and Jakob Engel for their
help with histopathology, cytokine analysis, and glycolipid analysis,
respectively. Monika Berger, Verena Grosse, Sabine Schild, Olaf
Macke, and Brigitte Philippens are thanked for excellent technical
assistance, and Anita Straus and Helio Takahashi are thanked for the
generous gift of the MEST-1 MAb. We are indebted to Rita Gerardy-
Schahn for her constant support.
REFERENCES
1. Aquino, V. R., L. Z. Goldani, and A. C. Pasqualotto. 2007. Update on the
contribution of galactomannan for the diagnosis of invasive aspergillosis.
Mycopathologia 163:191–202.
2. Bakker, H., B. Kleczka, R. Gerardy-Schahn, and F. H. Routier. 2005. Iden-
tification and partial characterization of two eukaryotic UDP-galactopyra-
nose mutases. Biol. Chem. 386:657–661.
3. Beauvais, A., C. Schmidt, S. Guadagnini, P. Roux, E. Perret, C. Henry, S.
Paris, A. Mallet, M. C. Pre´vost, and J. P. Latge´. 2007. An extracellular matrix
glues together the aerial-grown hyphae of Aspergillus fumigatus. Cell. Micro-
biol. 9:1588–1600.
4. Bernard, M., and J. P. Latge´. 2001. Aspergillus fumigatus cell wall: compo-
sition and biosynthesis. Med. Mycol. 39(Suppl 1):9–17.
5. Beverley, S. M., K. L. Owens, M. Showalter, C. L. Griffith, T. L. Doering,
V. C. Jones, and M. R. McNeil. 2005. Eukaryotic UDP-galactopyranose
mutase (GLF gene) in microbial and metazoal pathogens. Eukaryot. Cell
4:1147–1154.
6. Borgia, P. T., and C. L. Dodge. 1992. Characterization of Aspergillus nidulans
mutants deficient in cell wall chitin or glucan. J. Bacteriol. 174:377–383.
7. Bowman, J. C., G. K. Abruzzo, J. W. Anderson, A. M. Flattery, C. J. Gill,
V. B. Pikounis, D. M. Schmatz, P. A. Liberator, and C. M. Douglas. 2001.
Quantitative PCR assay to measure Aspergillus fumigatus burden in a murine
model of disseminated aspergillosis: demonstration of efficacy of caspofun-
gin acetate. Antimicrob. Agents Chemother. 45:3474–3481.
8. Callewaert, N., S. Geysens, F. Molemans, and R. Contreras. 2001. Ultrasen-
sitive profiling and sequencing of N-linked oligosaccharides using standard
DNA-sequencing equipment. Glycobiology 11:275–281.
9. Costachel, C., B. Coddeville, J. P. Latge´, and T. Fontaine. 2005. Glyco-
sylphosphatidylinositol-anchored fungal polysaccharide in Aspergillus fu-
migatus. J. Biol. Chem. 280:39835–39842.
10. Damveld, R. A., A. Franken, M. Arentshorst, P. J. Punt, F. M. Klis, C. A. van
den Hondel, and A. F. Ram. 2008. A novel screening method for cell wall
mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an
important protein in fungal cell wall biosynthesis. Genetics 178:873–881.
11. Denning, D. W. 2002. Echinocandins: a new class of antifungal. J. Antimi-
crob. Chemother. 49:889–891.
12. Denning, D. W. 2003. Echinocandin antifungal drugs. Lancet 362:1142–1151.
13. Eades, C. J., and W. E. Hintz. 2000. Characterization of the class I alpha-
mannosidase gene family in the filamentous fungus Aspergillus nidulans.
Gene 255:25–34.
14. Fontaine, T., C. Simenel, G. Dubreucq, O. Adam, M. Delepierre, J. Lemoine,
C. E. Vorgias, M. Diaquin, and J. P. Latge´. 2000. Molecular organization of
the alkali-insoluble fraction of Aspergillus fumigatus cell wall. J. Biol. Chem.
275:27594–27607.
15. Guan, S., A. J. Clarke, and C. Whitfield. 2001. Functional analysis of the
galactosyltransferases required for biosynthesis of
D-galactan I, a component
of the lipopolysaccharide O1 antigen of Klebsiella pneumoniae. J. Bacteriol.
183:3318–3327.
16. Kleczka, B., A. C. Lamerz, G. van Zandbergen, A. Wenzel, R. Gerardy-
Schahn, M. Wiese, and F. H. Routier. 2007. Targeted gene deletion of
Leishmania major UDP-galactopyranose mutase leads to attenuated viru-
lence. J. Biol. Chem. 282:10498–10505.
17. Ko¨plin, R., J. R. Brisson, and C. Whitfield. 1997. UDP-galactofuranose
precursor required for formation of the lipopolysaccharide O antigen of
Klebsiella pneumoniae serotype O1 is synthesized by the product of the
rfbD
KPO1
gene. J. Biol. Chem. 272:4121–4128.
18. Krappmann, S., O. Bayram, and G. H. Braus. 2005. Deletion and allelic
exchange of the Aspergillus fumigatus veA locus via a novel recyclable marker
module. Eukaryot. Cell 4:1298–1307.
19. Kremer, L., L. G. Dover, C. Morehouse, P. Hitchin, M. Everett, H. R. Morris,
A. Dell, P. J. Brennan, M. R. McNeil, C. Flaherty, K. Duncan, and G. S.
Besra. 2001. Galactan biosynthesis in Mycobacterium tuberculosis. Identifi-
cation of a bifunctional UDP-galactofuranosyltransferase. J. Biol. Chem.
276:26430–26440.
20. Laroy, W., R. Contreras, and N. Callewaert. 2006. Glycome mapping on
DNA sequencing equipment. Nat. Protoc. 1:397–405.
21. Lass-Flo¨rl, C., M. Cuenca-Estrella, D. W. Denning, and J. L. Rodriguez-
Tudela. 2006. Antifungal susceptibility testing in Aspergillus spp. according to
EUCAST methodology. Med. Mycol. 44:319–325.
22. Latge´, J. P., H. Kobayashi, J. P. Debeaupuis, M. Diaquin, J. Sarfati, J. M.
Wieruszeski, E. Parra, J. P. Bouchara, and B. Fournet. 1994. Chemical and
1276 SCHMALHORST ET AL. EUKARYOT.CELL

immunological characterization of the extracellular galactomannan of As-
pergillus fumigatus. Infect. Immun. 62:5424–5433.
23. Leita˜o, E. A., V. C. Bittencourt, R. M. Haido, A. P. Valente, J. Peter-
Katalinic, M. Letzel, L. M. de Souza, and E. Barreto-Bergter. 2003. Beta-
galactofuranose-containing O-linked oligosaccharides present in the cell wall
peptidogalactomannan of Aspergillus fumigatus contain immunodominant
epitopes. Glycobiology 13:681–692.
24. Li, R. K., and M. G. Rinaldi. 1999. In vitro antifungal activity of nikkomycin
Z in combination with fluconazole or itraconazole. Antimicrob. Agents Che-
mother. 43:1401–1405.
25. Liebmann, B., T. W. Mu¨hleisen, M. Mu¨ller, M. Hecht, G. Weidner, A. Braun,
M. Brock, and A. A. Brakhage. 2004. Deletion of the Aspergillus fumigatus
lysine biosynthesis gene lysF encoding homoaconitase leads to attenuated
virulence in a low-dose mouse infection model of invasive aspergillosis. Arch.
Microbiol. 181:378–383.
26. Maras, M., I. van Die, R. Contreras, and C. A. van den Hondel. 1999.
Filamentous fungi as production organisms for glycoproteins of bio-medical
interest. Glycoconj. J. 16:99–107.
27. Mikusova´, K., M. Bela´nova´, J. Kordula´kova´, K. Honda, M. R. McNeil, S.
Mahapatra, D. C. Crick, and P. J. Brennan. 2006. Identification of a novel
galactosyl transferase involved in biosynthesis of the mycobacterial cell wall.
J. Bacteriol. 188:6592–6598.
28. Mohr, J., M. Johnson, T. Cooper, J. S. Lewis, and L. Ostrosky-Zeichner.
2008. Current options in antifungal pharmacotherapy. Pharmacotherapy 28:
614–645.
29. Morelle, W., M. Bernard, J. P. Debeaupuis, M. Buitrago, M. Tabouret, and
J. P. Latge´. 2005. Galactomannoproteins of Aspergillus fumigatus. Eukaryot.
Cell 4:1308–1316.
30. Nassau, P. M., S. L. Martin, R. E. Brown, A. Weston, D. Monsey, M. R.
McNeil, and K. Duncan. 1996. Galactofuranose biosynthesis in Escherichia
coli K-12: identification and cloning of UDP-galactopyranose mutase. J.
Bacteriol. 178:1047–1052.
31. Paisley, D., G. D. Robson, and D. W. Denning. 2005. Correlation between in
vitro growth rate and in vivo virulence in Aspergillus fumigatus. Med. Mycol.
43:397–401.
32. Pan, F., M. Jackson, Y. Ma, and M. McNeil. 2001. Cell wall core galactofu-
ran synthesis is essential for growth of mycobacteria. J. Bacteriol. 183:3991–
3998.
33. Patterson, T. F. 2006. Treatment of invasive aspergillosis: polyenes, echino-
candins, or azoles? Med. Mycol. 44(Suppl 1):357–362.
34. Pedersen, L. L., and S. J. Turco. 2003. Galactofuranose metabolism: a
potential target for antimicrobial chemotherapy. Cell. Mol. Life Sci. 60:259–
266.
35. Perea, S., G. Gonzalez, A. W. Fothergill, W. R. Kirkpatrick, M. G. Rinaldi,
and T. F. Patterson. 2002. In vitro interaction of caspofungin acetate with
voriconazole against clinical isolates of Aspergillus spp. Antimicrob. Agents
Chemother. 46:3039–3041.
36. Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. MacDonald, and A. W.
Bufton. 1953. The genetics of Aspergillus nidulans. Adv. Genet. 5:141–238.
37. Punt, P. J., and C. A. van den Hondel. 1992. Transformation of filamentous
fungi based on hygromycin B and phleomycin resistance markers. Methods
Enzymol. 216:447–457.
38. Reichard, U., S. Bu¨ttner, H. Eiffert, F. Staib, and R. Ru¨chel. 1990. Purifica-
tion and characterisation of an extracellular serine proteinase from Aspergil-
lus fumigatus and its detection in tissue. J. Med. Microbiol. 33:243–251.
39. Reijula, K. E. 1991. Two common fungi associated with farmer’s lung: fine
structure of Aspergillus fumigatus and Aspergillus umbrosus. Mycopathologia
113:143–149.
40. Rementeria, A., N. Lo´pez-Molina, A. Ludwig, A. B. Vivanco, J. Bikandi, J.
Ponto´n, and J. Garaizar. 2005. Genes and molecules involved in Aspergillus
fumigatus virulence. Rev. Iberoam. Micol. 22:1–23.
41. Simenel, C., B. Coddeville, M. Delepierre, J. P. Latge´, and T. Fontaine. 2008.
Glycosylinositolphosphoceramides in Aspergillus fumigatus. Glycobiology 18:
84–96.
42. Stynen, D., J. Sarfati, A. Goris, M. C. Pre´vost, M. Lesourd, H. Kamphuis, V.
Darras, and J. P. Latge´. 1992. Rat monoclonal antibodies against Aspergillus
galactomannan. Infect. Immun. 60:2237–2245.
43. Suzuki, E., M. S. Toledo, H. K. Takahashi, and A. H. Straus. 1997. A
monoclonal antibody directed to terminal residue of beta-galactofuranose of
a glycolipid antigen isolated from Paracoccidioides brasiliensis: cross-reactiv-
ity with Leishmania major and Trypanosoma cruzi. Glycobiology 7:463–468.
44. Takayanagi, T., A. Kimura, S. Chiba, and K. Ajisaka. 1994. Novel structures
of N-linked high-mannose type oligosaccharides containing alpha-D-galacto-
furanosyl linkages in Aspergillus niger alpha-D-glucosidase. Carbohydr. Res.
256:149–158.
45. Takayanagi, T., K. Kushida, K. Idonuma, and K. Ajisaka. 1992. Novel
N-linked oligo-mannose type oligosaccharides containing an alpha-D-ga-
lactofuranosyl linkage found in alpha-D-galactosidase from Aspergillus niger.
Glycoconj. J. 9:229–234.
46. Tanaka, N., M. Konomi, M. Osumi, and K. Takegawa. 2001. Characteriza-
tion of a Schizosaccharomyces pombe mutant deficient in UDP-galactose
transport activity. Yeast 18:903–914.
47. Toledo, M. S., S. B. Levery, B. Bennion, L. L. Guimaraes, S. A. Castle, R.
Lindsey, M. Momany, C. Park, A. H. Straus, and H. K. Takahashi. 2007.
Analysis of glycosylinositol phosphorylceramides expressed by the opportu-
nistic mycopathogen Aspergillus fumigatus. J. Lipid Res. 48:1801–1824.
48. Trejo, A. G., J. W. Haddock, G. J. Chittenden, and J. Baddiley. 1971. The
biosynthesis of galactofuranosyl residues in galactocarolose. Biochem. J.
122:49–57.
49. Wallis, G. L., R. L. Easton, K. Jolly, F. W. Hemming, and J. F. Peberdy. 2001.
Galactofuranoic-oligomannose N-linked glycans of alpha-galactosidase A
from Aspergillus niger. Eur. J. Biochem. 268:4134–4143.
50. Weston, A., R. J. Stern, R. E. Lee, P. M. Nassau, D. Monsey, S. L. Martin,
M. S. Scherman, G. S. Besra, K. Duncan, and M. R. McNeil. 1997. Biosyn-
thetic origin of mycobacterial cell wall galactofuranosyl residues. Tuber.
Lung Dis. 78:123–131.
51. Wing, C., J. C. Errey, B. Mukhopadhyay, J. S. Blanchard, and R. A. Field.
2006. Expression and initial characterization of WbbI, a putative D-Galf:
alpha-D-Glc beta-1,6-galactofuranosyltransferase from Escherichia coli
K-12. Org. Biomol. Chem. 4:3945–3950.
52. Yoshida, T., Y. Kato, Y. Asada, and T. Nakajima. 2000. Filamentous fungus
Aspergillus oryzae has two types of alpha-1,2-mannosidases, one of which is a
microsomal enzyme that removes a single mannose residue from
Man9GlcNAc2. Glycoconj. J. 17:745–748.
53. Zhuo, H., H. Hu, L. Zhang, R. Li, H. Ouyang, J. Ming, and C. Jin. 2007.
O-Mannosyltransferase 1 in Aspergillus fumigatus (AfPmt1p) is crucial for
cell wall integrity and conidium morphology, especially at an elevated tem-
perature. Eukaryot. Cell 6:2260–2268.
VOL. 7, 2008 A. FUMIGATUS UDP-GALACTOPYRANOSE MUTASE 1277