Epigenetic Silencing of IRF7 and/or IRF5 in Lung Cancer Cells Leads to Increased Sensitivity to Oncolytic Viruses

Article (PDF Available)inPLoS ONE 6(12):e28683 · December 2011with33 Reads
DOI: 10.1371/journal.pone.0028683 · Source: PubMed
Abstract
Defective IFN signaling results in loss of innate immunity and sensitizes cells to enhanced cytolytic killing after Vesticular Stomatitis Virus (VSV) infection. Examination of the innate immunity status of normal human bronchial epithelial cells Beas2B and 7 lung cancer cells revealed that the abrogation of IFN signaling in cancer cells is associated with greater sensitivity to VSV infection. The disruption of the IFN pathway in lung cancer cell lines and primary tumor tissues is caused by epigenetic silencing of critical interferon responsive transcription factors IRF7 and/or IRF5. Although 5-aza-2'-deoxycytidine treatment fails to reactivate IRF7 and IRF5 expression or protect cells from VSV infection, manipulating IFN signaling by altering IRF expression changes the viral susceptibility of these cells. Lung cancer cells can be partially protected from viral killing using IRF5+IRF7 overexpression, whereas IFN pathway disruption by transfection of siRNAs to IRF5+IRF7 increases cells' vulnerability to viral infection. Therefore, IRF5 and IRF7 are key transcription factors in IFN pathway that determine viral sensitivity of lung cancer cells; the epigenetically impaired IFN pathway in lung cancer tissues provides potential biomarkers for successful selective killing of cancer cells by oncolytic viral therapy.
Epigenetic Silencing of IRF7 and/or IRF5 in Lung Cancer
Cells Leads to Increased Sensitivity to Oncolytic Viruses
Qunfang Li
1,2
, Michael A. Tainsky
1,2
*
1 Program in Molecular Biology and Genetics, Barbara Ann Karmanos Cancer Institute, Detroit, Michigan, United States of America, 2 Department of Oncology, Wayne
State University School of Medicine, Detroit, Michigan, United States of America
Abstract
Defective IFN signaling results in loss of innate immunity and sensitizes cells to enhanced cytolytic killing after Vesticular
Stomatitis Virus (VSV) infection. Examination of the innate immunity status of normal human bronchial epithelial cells
Beas2B and 7 lung cancer cells revealed that the abrogation of IFN signaling in cancer cells is associated with greater
sensitivity to VSV infection. The disruption of the IFN pathway in lung cancer cell lines and primary tumor tissues is caused
by epigenetic silencing of critical interferon responsive transcription factors IRF7 and/or IRF5. Although 5-aza-29-
deoxycytidine treatment fails to reactivate IRF7 and IRF5 expression or protect cells from VSV infection, manipulating IFN
signaling by altering IRF expression changes the viral susceptibility of these cells. Lung cancer cells can be partially
protected from viral killing using IRF5+IRF7 overexpression, whereas IFN pathway disruption by transfection of siRNAs to
IRF5+IRF7 increases cells’ vulnerability to viral infection. Therefore, IRF5 and IRF7 are key transcription factors in IFN pathway
that determine viral sensitivity of lung cancer cells; the epigenetically impaired IFN pathway in lung cancer tissues provides
potential biomarkers for successful selective killing of cancer cells by oncolytic viral therapy.
Citation: Li Q, Tainsky MA (2011) Epigenetic Silencing of IRF7 and/or IRF5 in Lung Cancer Cells Leads to Increased Sensitivity to Oncolytic Viruses. PLoS ONE 6(12):
e28683. doi:10.1371/journal.pone.0028683
Editor: Masaru Katoh, National Cancer Center, Japan
Received August 15, 2011; Accepted November 13, 2011; Published December 14, 2011
Copyright: ß 2011 Li, Tainsky. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the Barbara and Fred Erb Endowed Chair in Cancer Genetics to Dr. Tainsky, funds from the Karmanos Cancer Institute, the
Molecular Medicine and Genetics Applied Genomics Technology Center at Wayne State University, and the Genomics and Biostatistics Cores of the Karmanos
Cancer Institute, P30CA02 2453. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: tainskym@karmanos.org
Introduction
As the leading cause of cancer-related mortality in both men
and women, lung cancer is responsible for well over 1 million
deaths worldwide annually. Although diagnosis and treatment
have been improved, the five-year survival rate is only 14% largely
due to the failure of tumor debulking surgery and systemic
chemotherapy. The improvement of lung cancer treatment is a
major public health goal. Recently, naturally occurring or
genetically engineered oncolytic viruses, including measles virus,
Newcastle Disease Virus (NDV), VSV, adenoviruses, reovirus and
Herpes simplex virus offer an effective and promising alternative
therapeutic approach to fight this disease [1]. Used alone or in
combination with chemotherapy, oncolytic viruses selectively
destroy tumor cells by targeting cancer defects in major pathways,
such as p53 tumor suppressor, ras signal transduction and IFN
signaling pathways [1,2]. Currently the effectiveness and safety of
different oncolytic viruses in treatment of various cancers is being
evaluated in preclinical animal models and phase I–III clinical
trials [3]. Among them, a negative strand RNA virus VSV, which
can trigger innate immunity mechanisms, has been shown to be
efficacious against malignant glioma, melanoma, leukemias,
hepatocellular, breast, bladder and prostate cancers that have
defective antiviral responses. [4,5,6,7].
Type I IFN signaling pathway is activated by VSV infection as
first line innate immune response to protect normal tissues from
viral killing, and therefore tumor cells that have lost their antiviral
reactivity represent selective targets for VSV. The primary
response upon viral infection and uptake of double-stranded
RNAs is TLR3 activation which is mediated by IRF-3, cJUN/
ATF-2, and NFkB, thereby inducing the production of immediate-
early response genes primarily IFNb. Those early response IFNs
bind to type I IFN receptors (IFNAR) in an autocrine or paracrine
manner to activate STAT1 and induce expression of secondary
antiviral response genes including the transcription factor IRF7
which then promotes the expression other IFN stimulated genes
(ISGs). Finally, the tertiary transcriptional wave of IFNa
establishes an antiviral state [8,9].
The impairment of IFN signaling is linked to an enhanced risk
of tumor development [10,11,12] as the IFN pathway also exhibits
antiproliferative and immune surveillance activities against cancer.
Accordingly, the majority (,80%) of NCI 60 panel cancer cell
lines display disrupted innate immunity responses [9]. We have
shown that the IFN signaling pathway was abrogated during
spontaneous immortalization in fibroblasts from Li-Fraumeni
Syndrome (LFS) patients, who are predisposed to early onset
and multiple tumors because of germ-line mutations in p53. As an
important epigenetic control mechanism, DNA hypermethylation
of CpGs in promoter regions represses gene expression both
during development and tumorigenesis. Several ISGs were down-
regulated by epigenetic silencing during immortalization, an early
and necessary step in carcinogenesis, and some of the same ISGs
were up-regulated upon replicative senescence [13,14,15]. Treat-
ment of the immortal LFS cell lines with 5-aza-29-deoxycytidine
(5-aza-dC), an inhibitor of DNA methyltransferases restored IFN
signaling and induced a senescence-like state [13,15].
PLoS ONE | www.plosone.org 1 December 2011 | Volume 6 | Issue 12 | e28683
The IFN-inducible transcription factors, IRFs, are essential
mediators of the IFN-response. Lack of IRF7 expression
corresponded to aberrant promoter hypermethylation of CpG
islands within its promoter and was also identified as one of
methylation-silenced genes in several cancer types including lung,
hepatocellular, gastric and pancreatic cancers [16,17,18,19].
Reduced expression of IRF5, another important transcription
factor of the IFN pathway, was also observed in hematological
malignancies, which is consistent with its role to induce G2-M
growth arrest and apoptosis [20]. Epigenetic inactivation of IRF5
was similarly observed in hepatocellular and gastric cancer
[21,22]. As direct inducers of IFN pathway, IRF7 and IRF5
induce overlapping ISG transcriptional profiles, however, differ-
ential expression patterns and kinetics of ISGs indicted that they
possess nonredundant and distinct roles in innate immune
responses. Compared to IRF7, IRF5 is a much stronger activator
of the early antiviral genes including IFNb [23]. In a recent report
we demonstrated that enhanced expression of IRF5 and/or IRF7
could reactivate IFN related genes, inhibit cell growth, and induce
senescence [15]. Silencing of these essential IRFs and the growth-
suppressive IFN pathway may be a necessary early event in the
development of cancer, particularly associated with immortaliza-
tion.
Although cancer cells, with their IFN-pathway-abrogated, may
have acquired a growth/survival advantage over their normal
counterparts, they simultaneously compromise their antiviral
protective ability. Here, new therapeutic paradigms involving
oncolytic RNA viruses to target the defective innate immune
system in cancer cells are being explored. We found that the
sensitivity to oncolytic VSV was strongly and significantly
associated with the disruption of the IFN signaling pathway. A
failure to up-regulate ISG expression upon dsRNA stimulation
indicated a weakened antiviral response sensitizing lung cancer cell
lines to VSV-induced oncolytic cell death. However, not all lung
cancer cells can be killed by VSV infection, as some of them
possess a relatively normal innate immunity pathway and therefore
are resistant to VSV-mediated viral killing. Bisulfite sequencing
revealed promoter hypermethylation of either IRF7 and/or IRF5
in several lung cancer cell lines. Similarly, when we investigated
DNA from fresh frozen lung cancer tissues, we observed promoter
methylation of IRF7 and/or IRF5, suggesting that their IFN
antiviral response was also epigenetically silenced as functional
IRF7 and IRF5 are required for an intact IFN pathway. However
5-aza-dC treatment failed to reactivate IRF5 or IRF7 expression
or rescue lung cancer cells from VSV infection. Altering innate
immunity by manipulating IRF expression changed viral suscep-
tibility of normal Beas2B bronchial epithelial cells or lung cancer
cells. Cells without a functional IFN response are partially
protected from virus following IRF5 and IRF7 overexpression,
whereas disruption of IFN signaling by targeting IRF5 and IRF7
using siRNAs increased Beas2B cells’ vulnerability to the cytolytic
effects of VSV. Therefore, IRF5 and IRF7 are pivotal factors in
IFN pathway that determine the viral sensitivity of the cells to
oncolytic viruses. The highly selective VSV killing of lung cancer
cells with an impaired IFN pathway due to epigenetically
downregulation of IRFs indicates that these genes are ideal
biomarkers for determining the susceptibility of tumors to
oncolytic viral therapy.
Results
IFN signaling deficiency is associated with VSV sensitivity
The IFN pathway controls the cellular response to viral
infection and dsRNA. Cells that have a fully functional innate
antiviral system are able to protect themselves against viruses,
largely due to the induction of IFN signaling cascade. We have
shown that the IFN pathway was epigenetically inactivated in
fibroblasts from LFS patients after spontaneous immortalization
[14]. Examination of innate immunity status in normal bronchial
epithelial cell line Beas2B, its ras transformed derivative cells and 2
tumorigenic clones revealed that as IFN signaling activity
decreased the sensitivity to VSV killing increased during lung
tumorigenesis (Li and Tainsky, unpublished data). Because
functional inactivation of IFN pathway has been a common
trait of many cancers, we used 7 long-term lung cancer cell lines
(4 adenocarcinomas: CRL5800, CRL5807, CRL5810 and
CRL5872, 2 squamous carcinomas: HTB172 and CRL5928 and
1 small cell carcinoma: CRL5869) to study the changes in their
innate immune system.
Using a representative set of ISGs in Q-RT-PCR assays, we
examined both the baseline ISG expression levels and their
expression after stimulation of the IFN pathway by synthetic
dsRNA polyI:C, which mimics viral RNA [15]. We found lower
baseline expression of most ISGs tested in all lung cancer cell lines
as compared to Beas2B cells (Table 1). The IFN pathway could be
activated in Beas2B cells as 12 out of 14 genes were inducible by
polyI:C stimulation. In contrast, polyI:C failed to induce mRNAs
of all 14 genes tested in CRL5810 cells, while variable induction
deficiencies of essential antiviral response genes such as IFN a,
IFNb, IRF7, IRF5 and STAT1 were detected in CRL5800,
CRL5807, CRL5872 and CRL5869 cells. Surprisingly, Q-RT-
PCR demonstrated polyI:C inducible expression of 10 out of 14
ISGs in HTB182 and CRL5928 cells at similar levels to Beas2B
indicating a relatively normal antiviral response in those two lung
cancer cells (Table 2).
Because compromised innate immune signaling often leads to
increased sensitivity to viral killing, VSV sensitivity was investi-
gated to determine whether the lack of ISG activation corresponds
to elevated vulnerability to oncolytic viral killing in the lung cancer
cells. As expected, Beas2B cells with intact IFN response resisted
VSV infection exhibiting little change in cell viability. In addition,
HTB182 and CRL5928 were relatively resistant compared to
other lung cancer cells as more than 60% of the cells were still
alive at high dose VSV (MOI5) even without exogenous IFNa
pretreatment (Figure 1A). In contrast, the rest of the lung cancer
cell lines variably lost their ability to protect themselves from VSV.
An increasing number of IFN-signaling-deficient lung cancer cells
(from ,30% to ,70%) were killed by raising dose of VSV
exposure and adding IFNa to the medium failed to inhibit
cytotoxicity of high dose VSV (MOI5) in CRL5800, CRL5810
and CRL5869 cells (Figure 1A). Interestingly, the reduced basal
levels of most ISGs in all lung cancer cell lines suggested no
association between VSV susceptibility and basal ISG levels
(Table 1). The variable sensitivity to viral killing corresponded to
the differential abrogation of the IFN response in lung cancer cell
lines. The selective virolytic effects of VSV were most significant in
CRL5810 cells consistent with the most severe defects in their
innate anti-viral system (Table 2 and Figure 1A). We also
identified 5 ISGs (IRF5, IRF7, STAT1, IRF3 and IFI16), whose
expression was distinctively elevated .3-fold in response to poly
I:C treatment only in VSV-resistant cell lines (Table 2 and
Figure 1A). Western blot analysis confirmed that the elevated ISG
mRNA expression upon polyI:C induction resulted in upregulated
protein levels in VSV-resistant cells. Ser727 phosphorylation of
STAT1 can only be induced by IFNb but not by IFN a [24], and
was used as a specific marker for early response gene activation of
IFN pathway. A strong polyI:C-induction of phosphorylated-
STAT1 (p-STAT1, Ser727), STAT1, IRF5 and IRF7 protein
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 2 December 2011 | Volume 6 | Issue 12 | e28683
levels was consistent with the resistance of normal Beas2B cells and
the two cancer cells, HTB182 and CRL5928, to VSV infection
and vice versa for the viral-sensitive lung cancer cell line. Mild
Ser727 phosphorylation of STAT1 can be detected in CRL5807
cells indicating relatively normal early IFN signaling in this cell
line compared to other VSV-sensitive cell lines. IRF5 and IRF7
protein levels were uniformly not inducible upon polyI:C
treatment in all the virus-sensitive lung cancer cell lines
(Figure 1B). No significant change of IRF3 protein was observed
by polyI:C treatment among all lung cancer cells perhaps because
its activity is mainly regulated post-translationally by changes in
phosphorylation (data not shown). Therefore, our observations
supported the inverse association between the oncolytic sensitivity
to VSV and the inducibility of IFN signaling in normal bronchial
epithelial cells Beas2B and lung cancer cells.
Epigenetic silencing of critical transcription factors IRF7
and IRF5 results in abrogation of IFN pathway
Promoter hypermethylation is an epigenetic mechanism of gene
regulation known to silence gene expression in mechanisms of cell
fate determination and carcinogenesis. We previously reported
that the IFN pathway has been abrogated by epigenetic silencing
of a key antiviral defense mediator IRF7 in immortal LFS
fibroblasts [14,15]. Interestingly, another study found cigarette
smoke exposure led to suppression of IFN signaling due to IRF7
promoter hypermethylation, which resulted in decreased antiviral
defenses of the respiratory epithelium [25]. Therefore, we
investigated whether promoter methylation of IRF7 could also
be the cause of IFN pathway disruption in lung cancer cell lines.
DNA sequencing of sodium bisulfite-treated genomic DNA
revealed IRF7 promoter hypermethylation in 2 lung cancer cell
Table 2. Abrogation of IFN pathway activation in human lung cancer cell lines after polyI:C treatment.
Beas2B T/U CRL5800 T/U CRL5807 T/U CRL5810 T/U CRL5872 T/U HTB182 T/U CRL5928 T/U CRL5869 T/U
TLR3 1.22 3.46 2.41 1.27 1.04 2.85 2.22 21.27
IFNa 3.54 1.89 2.44 22.46 21.77 21.17 2.27 21.91
IFNb 25.58 2.30 1.69 23.46 21.73 1.71 1.26 1.40
IRF5 2.15 23.03 1.84 23.01 22.41 2.77 1.23 21.44
IRF7 13.96 1.03 1.33 1.79 1.49 7.31 8.17 21.30
IRF8 9.45 1.84 8.34 21.80 21.80 21.16 1.08 22.22
STAT1 14.25 1.93 1.54 2.16 1.42 10.56 5.62 23.05
OAS1 15.85 2.81 6.32 21.95 22.19 7.41 12.82 21.41
IFI15 27.28 2.53 5.74 21.80 1.64 39.12 75.06 21.45
IFI78 28.76 21.34 5.54 22.64 22.03 6.50 48.50 22.10
IFNAR1 1.34 21.64 21.40 1.18 21.39 1.57 1.24 29.25
IRF3 4.95 2.23 21.42 1.72 21.62 6.15 3.73 29.13
IFI16 35.62 1.40 21.38 22.33 21.04 24.59 17.88
25.24
IFI27 566.7 133.44 121.10 216.45 21.33 675.59 8.63 255.33
T/U: treated with polyI:C versus untrea ted cells.
doi:10.1371/journal.pone.0028683.t002
Table 1. Basal levels of selected ISGs were down-regulated in human lung cancer cell lines compared to Beas2B cells.
CRL5800 CRL5807 CRL5810 CRL5872 HTB182 CRL5928 CRL5869
TLR3 236.00 231.34 223.43 221.41 22.89 21.39 1.47
IFNa 27.01 27.46 24.53 25.89 25.54 21.17 4.06
IFNb 235.75 219.03 215.35 24.11 25.90 1.67 1.11
IRF5 21.87 28.46 23.86 22.57 21.01 22.03 1.80
IRF7 222.32 26.73 225.99 266.26 24.53 213.36 24.79
IRF8 2.27 21.02 21.65 4.86 21.69 30.27 47.18
Stat1 212.55 215.24 26.54 232.45 21.87 22.25 22.38
OAS1 219.16 29.06 292.41 7.94 24.53 2
1.96 2.01
IFI15 2143.01 220.97 2519.15 2270.60 228.64 224.76 277.71
IFI78 2109.90 27.57 2232.32 212.38 1.60 216.91 22.60
IFNAR1 24.35 22.91 1.20 27.11 21.66 26.15 21.10
IRF3 213.36 220.97 236.76 27.31 221.26 27.21 1.44
IFI16 2112.99 22.95 2308.69 255.33 252.71 2172.45 29.45
IFI27 226.91 22592.27 2436.55 26.36 2689.78 22.43 227.86
doi:10.1371/journal.pone.0028683.t001
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 3 December 2011 | Volume 6 | Issue 12 | e28683
lines (CRL5810 and CRL5869), which suggests that epigenetic
silencing of IRF7 has played a role in the disruption of IFN
signaling in these cell lines (Figure 2A). Since IRF5 induced a
stronger transcription profile of the early antiviral genes [23] and
has been newly identified as a novel methylation marker for cancer
[21,22], we further examined the methylation status of IRF5
promoter regions in lung cancer cells. Increasing IRF5 hyper-
methylation was found in CRL5800, CRL5807, CRL5872 and
CRL5810 cell lines (Figure 2B), thus the similar virus susceptibility
of IRF7-unmethylated CRL5800, CRL5807, CRL5872 cells was
the consequence of epigenetic IRF5 inactivation. Moreover,
promoter hypermethylation of both IRF7 and IRF5 explained
the highest sensitivity to VSV manifested by CRL5810 cells. In
contrast, promoter regions of neither IRF7 nor IRF5 were found to
be methylated in Beas2B, CRL5928 and HTB182 cell lines
consistent with their intact innate immunity and resistance to
oncolytic viral killing. Altogether the selective loss of viral
protection in lung cancer cells was related to epigenetic
inactivation of at least one of the IRFs implicating the necessity
of both IRF7 and IRF5 to be active for a functional IFN pathway.
Because epigenetic events may occur during long-term culture,
which were not present in the original cancer, we examined IRF-
promoter methylation patterns in fresh-frozen primary lung cancer
tissues. The IRF7 promoter was fully methylated in 6 out of 20
NSCLCs, while 5 other tumors had 59-partial methylation
(Figure 2B) as an initial event that can spread to neighboring
CpG sites [26]. In parallel, we found heavy methylation in 4 of 20
NSCLC samples and 11 others had partial methylation of the
Figure 1. VSV sensitivity was directly correlated with the status of the IFN pathway of the cells. A. Selective cytotoxicity of VSV in lung
cancer cells with defective IFN pathway. Beas2B and 7 lung cancer cell lines were evaluated for their ability to induce antiviral response upon VSV
infection with or without IFNa pretreatment by virus-induced cytopathicity using MTT assay. The values were normalized to the value of control
uninfected cells, which was set to 100% from at least two independent experiments (n = 3) with SD at ,10%. (-): No VSV infection control. MOI0.05:
multiplicity of infection 0.05, low dose of VSV infection. MOI5: multiplicity of infection 5, high dose of VSV infection. B. Protein expression levelsof
several ISGs in polyI:C treated Beas2B and lung cancer cells were compared to untreated cells using western blots. Fold changes of IRF5 and IRF7
expression after polyI:C treatment were indicated. Tubulin was used as a normalizing control.
doi:10.1371/journal.pone.0028683.g001
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 4 December 2011 | Volume 6 | Issue 12 | e28683
Figure 2. Sequencing of bisulfite treated genomic DNA revealed promoter methylation of
IRF7
and
IRF5
in lung cancer cell lines and
primary tissues. The methylation status of CpG islands in the IRF7 and IRF5 promoter regions in Beas2B, human lung cancer cell lines and primary
tissues was examined by sequencing of bisulfite treated genomic DNA. A. IRF7. B. IRF5. Closed circles, methylated C in CpG dinucleotides; open
circles, unmethylated C in CpG dinucleotides. TSS, transcription start site.
doi:10.1371/journal.pone.0028683.g002
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 5 December 2011 | Volume 6 | Issue 12 | e28683
IRF5 promoter regions. Overall, 15 out of 20 patient samples had
promoter methylation of either one or both IRFs, events sufficient
to attenuate their IFN response. No aberrant IRF7 or IRF5
hypermethylation was detected in the matching buffy coat DNAs
from these same patients indicating that the IRF promoter
hypermethylation had not resulted from germ-line epigenetic
changes. Therefore the methylation IRF7 or IRF5 promoters
found in the lung cancer cell lines probably had its origin in the
tumor rather than being an event selected during to cell culture.
Our results demonstrated that the increased susceptibility to viral
infection is mediated by epigenetic mechanisms down-regulating
key antiviral defense pathway regulators IRF5 and IRF7. The
prevalence of epigenetic silencing of IRFs and its tight association
with VSV sensitivity make them ideal theranostic biomarkers to
screen lung cancer patients for possible oncolytic viral therapy.
Manipulation of IFN signaling pathway targeting IRFs
alters VSV viral sensitivity
We previously demonstrated that 5-aza-dC demethylation
treatment could restore gene expression of epigenetically silenced
IRF7 and other ISGs thereby reactivating the IFN signaling
pathway in immortal LFS fibroblast cell lines [14,15]. To our
surprise, IRF7 and IRF5 expression levels remained absent
(Figure 3A, less than 1.5 fold increase for both IRF5 and IRF7)
in lung cancer cell line CRL5810 after 5-aza-dC treatment for as
long as 4 weeks. Remarkably, sequencing of bisulfite-treated DNA
at the IRF5 and IRF7 promoter regions revealed that prolonged 5-
aza-dC application was not able to reverse promoter hypermethy-
lation of IRFs in CRL5810 cells (data not shown). Similar
resistance to 5-aza-dC treatment was found for the other IRF7-
methylated lung cancer cell line CRL5869 (data not shown). As a
result, extended demethylation treatment with 5aza-dC was
unable to affect the VSV sensitivity of CRL5810 cells (Figure 3B)
and further indicate that IRF5 and IRF7 are two of the
fundamental factors in IFN signaling that can regulate oncolytic
viral sensitivity.
Neither of these two IRF transcription factors was able to be
induced in VSV-sensitive lung cancer cells (Table 2 and Figure 1B),
whereas overexpression of IRF5 and/or IRF7 in immortal LFS
fibroblasts upregulated other ISGs, manifested a faster and
stronger innate immune signaling upon dsRNA stimulation, which
is sufficient to induce senescence [15]. In order to revive the
disabled IFN response in lung cancer cells, IRF5 and IRF7 alone
or in combination were stably transfected into CRL5810 cells, in
which sustained 5-aza-dC treatment had no effect on demethyl-
ation of IRF promoter. Western blot analysis confirmed the
elevated basal protein expression of IRFs in IRF5 and IRF7
overexpressing cells (Figure 4A). Individual restoration of IRF
expression partially protected CRL5810 cells from VSV cytolysis
with the greatest increase of cell viability from ,50% to more than
85% at MOI0.05, and from ,30% to ,50% at MOI5 of VSV
infection in cells overexpressing both IRF5 and IRF7 compared to
vector control cells (Figure 4B). We explained the modest gain of
viral protection even after IRF5 and IRF7 combined transfection
by severe loss of other important ISGs in CRL5810 cells as
indicated by the lack of effect upon exogenous IFN.
The selective replication of VSV in tumors with compromised
IFN pathway is the cornerstone for its clinical application as
oncolytic viral therapy. However, not all lung cancer patients’
cancers are deficient in their innate immune pathway. To
overcome this obstacle and destroy those VSV-resistant cells,
siRNAs to IRF5 (siIRF5) and IRF7 (siIRF7) were applied to
suppress IFN response in cells with active IFN pathway.
Compared to Beas2B cells transfected with control scrambled
siRNA, cells transfected with siIRF5 or siIRF7 resulted in a
decrease in IRF5 and IRF7 induction after polyI:C treatment
while transfection of both siIRF5+siIRF7 totally eliminated IRF
activation (Figure 5A). Transfection of siIRF5 alone significantly
inhibited polyI:C-activation of both IRF5 and IRF7, which can be
explained by an essential role for IRF5 as a strong inducer of IFNb
[23]. Diminished IRF5 expression by siIRF5 resulted in much less
IFNb production leading to decreased stimulation of secondary
response gene IRF7. As expected, the suppression of those 2 genes
by siRNAs resulted in significant loss of protection from VSV
infection with the most cytotoxicity increase to nearly 40% upon
higher dose VSV exposure in the combination knockdowns
compared to control siRNA (Figure 5B). Similar findings were
observed in parallel transfection studies of VSV-resistant
CRL5928 cells, which have relatively intact IFN signaling (data
not shown). This clearly demonstrates that IRF5 and IRF7 are
Figure 3. 5-aza-dC treatment failed to reactivate IFN pathway or protect CRL5810 cells from VSV infection. A. Western blots revealed
no increase of IRF7 or IRF5 protein expression after 5-aza-dC treatment of CRL5810 cells. Fold changes of IRF5 and IRF7 expression were indicated on
top of the 5-aza-dC treated column. B. CRL5810 cells were still sensitive to VSV cytolyic effects after 5-aza-dC treatment.
doi:10.1371/journal.pone.0028683.g003
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 6 December 2011 | Volume 6 | Issue 12 | e28683
functionally essential for innate immunity that determines the viral
sensitivity of these cells.
In summary, the loss of IFN signaling is necessary and sufficient
for increased sensitivity to killing by oncolytic viruses. The
manipulation of the IFN pathway through the transcription
factors IRF5 and IRF7 altered the cells’ response to VSV
infection. Analysis of the IFN pathway using these IRF
methylation biomarkers may provide new theranostic biomarkers
for determining a patient’s sensitivity to oncolytic viruses.
Discussion
A functional innate immune antiviral system protects cells
against viral infection, mainly due to the induction of the defensive
IFN signaling cascade, which appears to be the basis for virus
resistance and immune stimulatory properties. Here, we have
demonstrated the strong and convincing inverse relationship
between effective innate antiviral response and oncolytic viral
susceptibility using lung cancer cell lines. Moreover, transcription
factors IRF5 and IRF7 were identified as critical regulators of
innate immune system and useful biomarkers for oncolytic virus
susceptibility in lung cancer cells as both of them have to be
inducible for a functional IFN pathway. Inactivation of either
IRF5 or IRF7 weakened the antiviral response with the most
significant loss when both IRFs were epigenetically silenced in
CRL5810 cells. The varying extent of cytolytic death was related
to the differential severity of IFN pathway defects. Despite the
presence of exogenous IFNa, CRL5810 cells are non-responsive
and remain vulnerable to VSV killing corresponding to the
complete disruption of IFN pathway activity.
Loss of tumor suppressor gene expression by aberrant promoter
methylation is an early and common epigenetic event during the
onset and progression of cancer [27]. We have shown epigenetic
silencing of IRF5 and IRF7 at CpG islands of promoter regions in
lung cancer. Pharmacological targeting of aberrant epigenetic
changes by demethylation agents has shown clinical efficacy in
several hematologic malignancies [28]. However, those methyla-
tion inhibitors may not prevent the recurrence of hypermethyla-
tion and we have presented evidence that epigenetic deregulation
cannot be fully reverted in a series of lung cancer cell lines. The
failure of demethylation agents to restore crucial ISG expression
indicates that those lung cancer cells are ideal targets for oncolytic
viral therapy.
Although basal levels of most ISGs were reduced in all the lung
cancer cell lines compared to normal bronchial epithelial cells,
oncolytic viral sensitivity is only associated with polyI:C-inducible
expression levels of certain key ISGs such as IRF7 and IRF5.
However, IRF5 and IRF7 overexpression is not sufficient to
completely restore IFN pathway and only partially rescued cells
from viral infection due to deficiency of other important ISGs.
Failure to induce Ser727 phosphorylation upon polyI:C treatment
suggested additional innate immunity defects in several VSV
sensitive cell lines (Figure 1B). In addition, mRNA of 3 other ISGs
(STAT1, IRF3 and IFI16, Table 2) is consistently induced in
VSV-resistant cells. Further studies are needed to confirm them as
theranostic biomarkers and may identify additional ISGs as
biomarkers in lung cancer whose activation could distinguish
virus-resistant from virus-sensitive cancers.
We presented evidence that functional inactivation of IRF5 and
IRF7 is the major mechanism to disrupt IFN signaling in lung
cancer cells. Nevertheless, various malignancies harbor diverse
molecular defects of this pathway. Deregulated JAK3 and RNase
L pathways in LNCaP prostate cancer cells [29], defective STAT1
and STAT2 activation in fibrosarcoma and melanoma cells
[30,31] and down-regulated IFNAR in high grade bladder cancer
[32] have all been reported to disable the innate immune
signaling. Overall, the IFN pathway is frequently downregulated
during tumorigenesis even though distinct sets of ISGs are
suppressed by different mechanisms in a cancer-type-specific
manner.
A failure to activate innate immunity response upon oncolytic
RNA virus infection leads to the highly selective clearance of IFN-
nonresponsive tumor cells. In addition to VSV, other RNA viruses
such as NDV [33] and influenza virus [34] have also been
demonstrated to have tumor-selective cytotoxicity using the same
mechanism to target cells with diminished IFN activity. Clinical
Figure 4. Overexpression of IRF5 and/or IRF7 partially rescued CRL5810 cells from cytolytic effect of VSV. A. Protein expression levels
of STAT1, IRF5 and IRF7 were analyzed by western blots in IRF stable transfected CRL5810 cells. Anti-flag antibody was applied to detect transfected
IRF protein levels, while IRF5- and IRF7-specific antibodies were used for total IRF protein expression. B. Overexpression of IRF5 and/or IRF7 partially
increased CRL5810 cells’ resistance to VSV infection with the most increase in the combined trasfection. * P,0.02, ** p,0.001.
doi:10.1371/journal.pone.0028683.g004
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 7 December 2011 | Volume 6 | Issue 12 | e28683
trials of intravenous administration of NDV (PV701) proved its
initial oncolytic effects in several solid tumors [35]. In addition,
VSV strains with M protein mutations (AV1 and AV2) triggered
more robust antiviral response because of their defects in the
ability to shutdown IFN signaling; these mutants are selectively
destroyed in IFN-responsive cells at a lower therapeutic dose while
remaining highly lytic in cancer cells [9]. Expression of immune
stimulating proteins such as interleukin-2 (IL-4) or IFNb in
genetically engineered VSV has also been generated to promote
viral cytolytic responses [5,6]. Hence, boosting anti-viral responses
in normal cells will enhance oncolytic selectivity in IFN-
nonresponsive tumors.
Although a reduced antiviral response may be a common
feature of a broad range of cancers, the oncolytic efficacy of
naturally occurring RNA viruses may still be relatively low, as
some tumors manifest robust innate immunity responses that
inhibit viral replication and spread. To overcome this obstacle,
damping of cellular IFN responses in cancer cells by IFN-
antagonist, such as influenza NS1 or inhibition of IFN-stimulating
kinase (mTORC1) have been demonstrated to be effective
strategies to augment therapeutic viral activity [36,37]. Another
study showed that down-regulation of IFNAR1 sensitized bladder
cancer cells to VSV-induced cell death [32]. In this report we
eliminated IFN signaling using specific siRNAs to essential IRFs,
which potentiated cytolysis killing by VSV. Therefore small
molecule manipulation of the innate immune response could, in
the future, modulate the cellular response to oncolytic RNA
viruses to make them more effective.
The abrogated IFN response in more than 80% of human
cancers favors the selective viral replication and cytotoxicity in
those tumor cells and makes them ideal targets for oncolytic virus
treatment [9]. Our results support the use of a diminished innate
Figure 5. Disruption of IFN pathway increases Beas2B cells’ sensitivity to VSV. A. Abrogation of IRF5 and/or IRF7 induction by siRNAs upon
polyI:C treatmentwas shown by western blot. Fold changes of IRF5 and IRF7 expression after polyI:C treatment were indicated. Si(-): control siRNA. B.
IRF5 and IRF7 are important factors that determine viral sensitivity of the cells. Inhibition of these 2 genes resulted in loss of protection from VSV
infection with the most cytotoxicity increase in the combination knockdown. * P,0.03, ** p,0.001.
doi:10.1371/journal.pone.0028683.g005
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 8 December 2011 | Volume 6 | Issue 12 | e28683
immune response due to epigenetic silencing by promoter
methylation of IRF5 and IRF7 as a theranostic strategy for
oncolytic virus VSV treatment of lung tumors. Because not all of
the lung cancer patients may benefit from VSV oncolytic viral
therapy due to relatively normal function of the IFN pathway in
some cancer cells, using IRF-promoter methylation as theranostic
method for developing ISG-promoter related biomarkers is
capable of assessing the susceptibility of each specific cancer case.
Its absence limits the successful application of oncolytic therapy,
causing delay of other more effective treatment and unnecessary
side effects in VSV resistant patients [38]. Screening individual
patients using those ISG biomarkers is necessary as only those
individuals with defective innate immune system will benefit from
VSV treatment. These ISG biomarkers will not only determine
cells’ innate immunity status and sensitivity to oncolytic viruses
such as VSV but also provide future possibilities for IFN pathway
manipulation to make resistant tumors more vulnerable to
oncolytic virus killing by targeting these key ISGs.
Materials and Methods
Cell culture
Beas2B cell line was derived from immortalization of normal
human bronchial epithelial cells (NHBE) with SV40-adenovirus
E1a hybrid virus. Beas2B cells were used as normal control cells as
they retain many properties of NHBE including potential for
terminal differentiation; they are believed to represent the normal
progenitor cells for lung carcinomas [39]. Beas2B cells were grown
with LHC-9 media (Invitrogen, Carlsbad, CA) in a 37uC, 5%
CO2 incubator in dishes precoated with fibronectin (BD
Biosciences, San Jose, CA), type I collagen and Bovine Albumin
Fraction V (Invitrogen, Carlsbad, CA). Lung cancer cell lines
CRL5928 and CRL5869 were obtained from ATCC, Manassas,
VA and the remaining cell lines were kind gifts of Dr. Anil Wali.
All the lung cancer cell lines were cultured in RMPI1640 media
with 10% fetal bovine serum (Invitrogen, Carlsbad, CA)) in a
37uC, 5% CO2 incubator.
Primary lung cancer tissue collection
Twenty fresh frozen primary non-small-cell lung carcinoma
(NSCLC) tissue samples and buffy coats from the same lung
cancer patients were obtained from The Ontario Tumour Bank,
Toronto, Ontario, Canada. This included 12 adenocarcinomas
and 8 squamous cell carcinoma tissues. Detailed information of
those samples is listed in Table S1.
5-aza-dC and polyI:C treatment
5-aza-dC (Sigma-Aldrich, Inc., Sainte Louis, MO) treatment
was done followed the protocol described earlier [14]. Polyinosi-
nic:polycytidylic acid (polyI:C) (Amersham Biosciences Corp.,
Piscataway, NJ) was diluted according to manufacture’s instruction
and 100
m/ml polyI:C was applied on Beas2B and lung cancer
cells for 24 hours. The untreated control cells were changed with
fresh media for the same period of time before total RNA and
protein were harvested.
Quantitative RT-PCR
Total RNA was extracted from each experiment using the
QIAGEN RNeasy Kit (QIAGEN, Inc., Valencia, CA). Two
mg
total RNA was reverse transcribed into cDNA using Superscript II
(Invitrogen, Carlsbad, CA). Q-RT-PCR was performed using
SYBR Green PCR Detection kit (PE Biosystems, Warrington,
U.K.) as described previously [14]. The primer sets used are listed
in Table S2. The housekeeping gene GAPDH was used as a
normalizing control.
Western blots
Western blots were performed as described [15] using 50 mgof
cell extracts. Primary antibodies used in our study were rabbit anti-
IRF5 and chicken anti-OAS1 (Abcam Inc., Cambridge, MA);
rabbit anti-STAT1, rabbit anti-IRF7 and mouse anti-a-tubulin
(Santa Cruz Biotechnology, Inc. Santa Cruz, CA); rabbit antipho-
spho-STAT1 (Ser727) (Cell Signaling Technology, Inc., Beverly,
MA) and mouse anti-flag (Sigma-Aldrich, Inc., Sainte Louis, MO).
PCR amplification, cloning and sequencing of bisulfite
modified genomic DNA
Genomic DNA for lung cancer cell lines, primary lung cancer
patient tissues, and buffy coat DNAs from those patients were
prepared using QIAamp DNA kit (QIAGEN, Inc., Valencia, CA).
Genomic DNA (0.5
mg) was denatured and bisulfite converted
using EZ DNA methylation-GOLD kit (Zymo Research, Orange,
CA). The bisulfite modified genomic DNA was suspended in 10
ml
of water and 2
ml of DNA was amplified by PCR with two nested
PCR reactions. The annealing temperature was 56uC for the first
PCR and 58uC for the second PCR. The two sets of primers for
IRF7 are:
F1 59 GT AAGGGTTTT TGTCGTAGTAGACGT-
TAG;
R1 59 AACGTAAT AATTCATACCTATAATCC-
CAAC;
F2 59 GGTTATAGGTGTGATTGTAGGTGTG;
R2 59 CCCTAAACTATAATAAAATAACTC-
CATCTC.
The two sets of primers for IRF5 are:
F1 59 TGATTGGAAGGCGATTTAGG;
R1 59 AAAATCCCAAACCGACCGAA;
F2 59 AGTGGGGAAGTATTTTATTTTTTTT;
R2 59 CCCCTAAACAACTACTACTAAACTCC.
The PCR products were subjected to double-strand DNA
sequencing using primer F2.
VSV sensit ivity assay
Cells were seeded in 96 well plates at a density of 122610
4
cells
per well and cultured overnight in the presence or absence of
IFNa (Biosource International, Inc., Camarillo, CA. 1000 U/ml).
The cells were then infected with a low dose (multiplicity of
infection, MOI = 0.05) or high dose (MOI = 5.0) of VSV (Indiana
strain) for 1 hr. Virus-induced cytopathicity was determined the
next day by modified version of MTT assay as described
previously [15]. Results were expressed as relative values of cell
viability compared to control uninfected cells (set to 100).
Manipulation of IFN pathway by IRF overexpression or
siRNA disruption
pCMV-IRF7, pCMV-IRF5 and control vector pcDNA3.1 were
stably transfected into CRL5810 cells followed by 200
mg/ml
G418 selection as described previously [15]. SiRNAs targeting
IRF5 and IRF7 and control siRNA were transfected into Beas2B
and CRL5928 cells using siRNA transfection reagent (all from
Santa Cruz Biotechnology, Inc. Santa Cruz, CA). Forty-eight
hours later, the siRNA transfected cells were treated with 100
mg/
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 9 December 2011 | Volume 6 | Issue 12 | e28683
ml polyI:C for an additional 24 hours before western blots were
used to examine protein expressions of several ISGs. VSV
sensitivity assays were performed on both IRF-overexpressed
and siRNA- transfected cells.
Supporting Information
Table S1 Information about collected lung cancer tissue
samples.
(DOC)
Table S2 List of primer sets used in Q-RT-PCR.
(DOC)
Acknowledgments
We are grateful to Dr. Curtis C. Harris for his kind gift of the Beas2B cell
lines and to Dr. Anil Wali at Wayne State University School of Medicine
for 6 lung cancer cell lines.
Author Contributions
Conceived and designed the experiments: QL MAT. Performed the
experiments: QL. Analyzed the data: QL. Contributed rea gents/
materials/analysis tools: QL MAT. Wrote the paper: QL MAT.
References
1. Wong HH, Lemoine NR, Wang Y (2010) Oncolytic Viruses for Cancer
Therapy: Overcoming the Obstacles. Viruses 2: 78–106.
2. Naik S, Russell SJ (2009) Engineering oncolytic viruses to exploit tumor specific
defects in innate immune signaling pathways. Expert Opin Biol Ther 9:
1163–1176.
3. Rowan K (2010) Oncolytic viruses move forward in clinical trials. J Natl Cancer
Inst 102: 590–595.
4. Balachandran S, Porosnicu M, Barber GN (2001) Oncolytic activity of vesicular
stomatitis virus is effective against tumors exhibiting aberrant p53, Ras, or myc
function and involves the induction of apoptosis. J Virol 75: 3474–3479.
5. Fernandez M, Porosnicu M, Markovic D, Barber GN (2002) Genetically
engineered vesicular stomatitis virus in gene therapy: application for treatment of
malignant disease. J Virol 76: 895–904.
6. Obuchi M, Fernandez M, Barber GN (2003) Development of recombinant
vesicular stomatitis viruses that exploit defects in host defense to augment specific
oncolytic activity. J Virol 77: 8843–8856.
7. Wollmann G, Robek MD, van den Pol AN (2007) Variable deficiencies in the
interferon response enhance susceptibility to vesicular stomatitis virus oncolytic
actions in glioblastoma cells but not in normal human glial cells. J Virol 81:
1479–1491.
8. Stojdl DF, Lichty B, Knowles S, Marius R, Atkins H, et al. (2000) Exploiting
tumor-specific defects in the interferon pathway with a previously unknown
oncolytic virus. Nat Med 6: 821–825.
9. Stojdl DF, Lichty BD, tenOever BR, Paterson JM, Power AT, et al. (2003) VSV
strains with defects in their abil ity to shutdown innate immunity are potent
systemic anti-cancer agents. Cancer Cell 4: 263–275.
10. Dunn GP, Koebel CM, Schreiber RD (2006) Interferons, immunity and cancer
immunoediting. Nat Rev Immunol 6: 836–848.
11. Picaud S, Bardot B, De Maeyer E, Seif I (2002) Enhanced tumor development in
mice lacking a functional type I interferon receptor. J Interferon Cytokine Res
22: 457–462.
12. Uno K, Hirosaki M, Kakimi K, Tominaga M, Suginoshita Y, et al. (2007)
Impaired IFN-alpha production and the risk of cancer development. J Interferon
Cytokine Res 27: 1013–1017.
13. Fridman AL, Tang L, Kulaeva OI, Ye B, Li Q, et al. (2006) Expression profiling
identifies three pathways altered in cellular immortalization: interferon, cell
cycle, and cytoskeleton. J Gerontol A Biol Sci Med Sci 61: 879–889.
14. Kulaeva OI, Draghici S, Tang L, Kraniak JM, Land SJ, et al. (2003) Epigenetic
silencing of multiple interferon path way genes after cellular immortalization.
Oncogene 22: 4118–4127.
15. Li Q, Tang L, Roberts PC, Kraniak JM, Fridman AL, et al. (2008) Interferon
regulatory factors IRF5 and IRF7 inhibit growth and induce senescence in
immortal Li-Fraumeni fibroblasts. Mol Cancer Res 6: 770–784.
16. Fukasawa M, Kimura M, Morita S, Matsubara K, Yamanaka S, et al. (2006)
Microarray analysis of promoter methylation in lung cancers. J Hum Genet 51:
368–374.
17. Jee CD, Kim MA, Jung EJ, Kim J, Kim WH (2009) Identification of genes
epigenetically silenced by CpG methylation in human gastric carcinoma.
Eur J Cancer 45: 1282–1293.
18. Kumagai T, Akagi T, Desmond JC, Kawamata N, Gery S, et al. (2009)
Epigenetic regulation and molecular characterization of C/EBPalpha in
pancreatic cancer cells. Int J Canc er 124: 827–833.
19. Yu J, Zhang HY, Ma ZZ, Lu W, Wang YF, et al. (2003) Methylation profiling of
twenty four genes and the concordant methylation behaviours of nineteen genes
that may contribute to hepatocellular carcinogenesis. Cell Res 13: 319–333.
20. Barnes BJ, Kellum MJ, Pinder KE, Frisancho JA, Pitha PM (2003) Interferon
regulatory factor 5, a novel mediator of cell cycle arrest and cell death. Cancer
Res 63: 6424–6431.
21. Shin SH, Kim BH, Jang JJ, Suh KS, Kang GH (2010) Identification of novel
methylation markers in hepatocellular carcinoma using a methylation array.
J Korean Med Sci 25: 1152–1159.
22. Yamashita M, Toyota M, Suzuki H, Nojima M, Yamamoto E, et al. (2010)
DNA methylation of interferon regulatory factors in gastric cancer and
noncancerous gastric muco sae. Cancer Sci 101: 1708–1716.
23. Barnes BJ, Richards J, Mancl M, Hanash S, Beretta L, et al. (2004) Global and
distinct targets of IRF-5 and IRF-7 during innate response to viral infection.
J Biol Chem 279: 45194–45207.
24. Sanceau J, Hiscott J, Delattre O, Wietzerbin J (2000) IFN-beta induces serine
phosphorylation of Stat-1 in Ewing’s sarcoma cells and mediates apoptosis via
induction of IRF-1 and activation of caspase-7. Oncogene 19: 3372–3383.
25. Jaspers I, Horvath KM, Zhang W, Brighton LE, Carson JL, et al. (2010)
Reduced expression of IRF7 in nasal epithelial cells from smokers after infection
with influenza. Am J Respir Cell Mol Biol 43: 368–375.
26. Singal R, vanWert JM (2001) De novo methylation of an embryonic globin gene
during normal development is strand specific and spreads from the proximal
transcribed region. Blood 98: 3441–3446.
27. Ellis L, Atadja PW, Johnstone RW (2009) Epigenetics in cancer: targeting
chromatin modifications. Mol Cancer Ther 8: 1409–1420.
28. Issa JP (2007) DNA methylation as a therapeutic target in cancer. Clin Cancer
Res 13: 1634–1637.
29. Dong B, Kim S, Hong S, Das Gupta J, Malathi K, et al. (2007) An infectious
retrovirus susceptible to an IFN antiviral pathway from human prostate tumors.
Proc Na tl Acad Sci U S A 104: 1655–1660.
30. Krishnamurthy S, Takimoto T, Scroggs RA, Portner A (2006) Differentially
regulated interferon response determines the outcome of Newcastle disease virus
infection in normal and tumor cell lines. J Virol 80: 5145–5155.
31. Wong LH, Krauer KG, Hatzinisiriou I, Estcourt MJ, Hersey P, et al. (1997)
Interferon-resistant human melanoma cells are deficient in ISGF3 components,
STAT1, STAT2, and p48-ISGF3gamma. J Biol Chem 272: 28779–28785.
32. Zhang KX, Matsui Y, Hadaschik BA, Lee C, Jia W, et al. (2010) Down-
regulation of type I interferon receptor sensitizes bladder cancer cells to vesicular
stomatitis virus-induced cell death. Int J Cancer 127: 830–838.
33. Wilden H, Fournier P, Zawatzky R, Schirrmacher V (2009) Expression of RIG-
I, IRF3, IFN-beta and IRF7 determines resistance or susceptibility of cells to
infection by Newcastle Disease Virus. Int J Oncol 34: 971–982.
34. Muster T, Rajtarova J, Sachet M, Unger H, Fleischhacker R, et al. (2004)
Interferon resistance promotes oncolysis by influen za virus NS1-deletion
mutants. Int J Cancer 110: 15–21.
35. Pecora AL, Rizvi N, Cohen GI, Meropol NJ, Sterman D, et al. (2002) Phase I
trial of intravenous administration of PV701, an oncolytic virus, in patients with
advanced solid cancers. J Clin Oncol 20: 2251–2266.
36. Alain T, Lun X, Martineau Y, Sean P, Pulendran B, et al. (2010) Vesicular
stomatitis virus oncolysis is potentiated by impairing mTORC1-dependent type
I IFN production. Proc Natl Acad Sci U S A 107: 1576–1581.
37. Zamarin D, Martinez-Sobrido L, Kelly K, Mansour M, Sheng G, et al. (2009)
Enhancement of oncolytic properties of recombinant newcastle disease virus
through antagonism of cellular innate immune responses. Mol Ther 17:
697–706.
38. Hotte SJ, Lorence RM, Hirte HW, Polawski SR, Bamat MK, et al. (2007) An
optimized clinical regimen for the oncolytic virus PV701. Clin Cancer Res 13:
977–985.
39. Ke Y, Reddel RR, Gerwin BI, Miyashita M, McMenamin M, et al. (1988)
Human bronchial epithelial cells with integrated SV40 virus T antigen genes
retain the ability to undergo squamous differentiation. Differentiation 38: 60–66.
IRF Epigenetic Silencing Increases VSV Sensitivity
PLoS ONE | www.plosone.org 10 December 2011 | Volume 6 | Issue 12 | e28683
    • "Recently, intratumoral Newcastle disease virus (NDV) has been shown to sensitize murine melanoma to immune checkpoint blockade, highlighting the promise of this approach [30]. The lack of response in IFN signaling after infection with VSV-GFP indicate that the type I IFN response to viral infection is indeed defective in many NSCLC cell lines as has been previously demonstrated [9, 31]. The differential effect of VSV-GFP and VSV-hIFNβ on H838 cells strongly suggested that a component of the IFNβ pathway is responsible for resistance. "
    [Show abstract] [Hide abstract] ABSTRACT: Vesicular stomatitis virus (VSV) is a potent oncolytic virus for many tumors. VSV that produces interferon-β (VSV-IFNβ) is now in early clinical testing for solid tumors. Here, the preclinical activity of VSV and VSV-IFNβ against non-small cell lung cancer (NSCLC) is reported. NSCLC cell lines were treated in vitro with VSV expressing green fluorescence protein (VSV-GFP) and VSV-IFNβ. VSV-GFP and VSV-IFNβ were active against NSCLC cells. JAK/STAT inhibition with ruxolitinib re-sensitized resistant H838 cells to VSV-IFNβ mediated oncolysis. Intratumoral injections of VSV-GFP and VSV-IFNβ reduced tumor growth and weight in H2009 nude mouse xenografts (p < 0.01). A similar trend was observed in A549 xenografts. Syngeneic LM2 lung tumors grown in flanks of A/J mice were injected with VSV-IFNβ intratumorally. Treatment of LM2 tumors with VSV-IFNβ resulted in tumor regression, prolonged survival (p < 0.0001), and cure of 30% of mice. Intratumoral injection of VSV-IFNβ resulted in decreased tumor-infiltrating regulatory T cells (Treg) and increased CD8+ T cells. Tumor cell expression of PDL-1 was increased after VSV-IFNβ treatment. VSV-IFNβ has potent antitumor effects and promotes systemic antitumor immunity. These data support further clinical investigation of VSV-IFNβ for NSCLC.
    Full-text · Article · Jul 2015
    • "In many cancer cell types, specific genes associated with type I IFN signaling are transcriptionally downregulated or functionally inactive (Balachandran and Barber, 2004; Marozin et al., 2008 Marozin et al., , 2010 Moussavi et al., 2010; Zhang et al., 2010). Also, type I IFN mediated responses can be inhibited by MEK/ERK signaling, which is often upregulated in cancer cells (Noser et al., 2007), or by epigenetic silencing of IFN responsive transcription factors IRF7 or IRF5 (Li and Tainsky, 2011). Although all tested PDAC cell lines retain at least partially functional type I IFN signaling (Moerdyk-Schauwecker et al., 2013), it is likely that they have some dysregulation of this pathway, as type I IFN responses are generally anti-proliferative and pro-apoptotic (Stojdl et al., 2000; Vitale et al., 2007). "
    [Show abstract] [Hide abstract] ABSTRACT: Virus-encoded tumor suppressor p53 transgene expression has been successfully used in vesicular stomatitis virus (VSV) and other oncolytic viruses (OVs) to enhance their anticancer activities. However, p53 is also known to inhibit virus replication via enhanced type I interferon (IFN) antiviral responses. To examine whether p53 transgenes enhance antiviral signaling in human pancreatic ductal adenocarcinoma (PDAC) cells, we engineered novel VSV recombinants encoding human p53 or the previously described chimeric p53-CC, which contains the coiled-coil (CC) domain from breakpoint cluster region (BCR) protein and evades the dominant-negative activities of endogenously expressed mutant p53. Contrary to an expected enhancement of antiviral signaling by p53, our global analysis of gene expression in PDAC cells showed that both p53 and p53-CC dramatically inhibited type I IFN responses. Our data suggest that this occurs through p53-mediated inhibition of the NF-κB pathway. Importantly, VSV-encoded p53 or p53-CC did not inhibit antiviral signaling in non-malignant human pancreatic ductal cells, which retained their resistance to all tested VSV recombinants. To the best of our knowledge, this is the first report of p53-mediated inhibition of antiviral signaling, and it suggests that OV-encoded p53 can simultaneously produce anticancer activities while assisting, rather than inhibiting, virus replication in cancer cells. Copyright © 2015 Elsevier Inc. All rights reserved.
    Full-text · Article · May 2015
    • "Our study focused on the altered IRF7 expression as a potential mechanism for impaired IFN response. Previous reports have shown that the expression of IRF7 is regulated epigenetically by DNA methylation [14, 15]. Asthma is a complex multifactorial disease, in which various environmental factors including allergen, microbiome, air pollution, and diet affect gene expression. "
    [Show abstract] [Hide abstract] ABSTRACT: Human rhinoviruses are the major cause of asthma exacerbation in both children and adults. Recently, impaired antiviral interferon (IFN) response in asthmatics has been indicated as a primary reason of the susceptibility to respiratory virus, but the mechanism of defective IFN production is little understood to date. The expression of IFN regulatory factor 7 (IRF7), a transcriptional factor for virus-induced type I IFN production is known to be regulated epigenetically by DNA methylation. We aimed to investigate the expression of IFN-α, IFN-β, and IRF7 in response to rhinovirus infection in the adult asthmatics and evaluate DNA methylation status of IRF7 gene promotor. Twenty symptomatic adult asthmatics and 10 healthy subjects were enrolled and peripheral blood was collected from each subject. Peripheral blood mononuclear cells (PBMCs) were isolated, cultured, and ex vivo stimulated with rhinovirus-16. The mRNA expressions of IFN-α, IFN-β, and IRF7 were analyzed using real time quantitative polymerase chain reaction. Genomic DNA was isolated from untreated PBMCs and the methylation status of IRF7 gene promotor was investigated using bisulfite pyrosequencing. The mean age of asthmatics was 45.4 ± 15.7 years and 40% was male, which were not different with those of control group. Asthmatics showed significantly decreased mRNA expressions (relative expression to beta-actin) of IFN-α and IFN-β compared with normal control. The mRNA expression of IRF7 in the asthmatics was also significantly lower than those in the normal control. No significant difference of DNA methylation was observed between asthmatics and controls in all analyzed positions of IRF7 promotor CpG loci. The mRNA expression of type I IFN in response to rhinovirus was impaired in the PBMCs of adult asthmatics. The mRNA expression of IRF7, transcriptional factor inducing type I IFN was also reduced, but not caused by altered DNA methylation in the IRF7 gene promotor.
    Full-text · Article · Apr 2015
Show more

Supplementary resources