Article

The nestin-expressing and non-expressing neurons in rat basal forebrain display different electrophysiological properties and project to hippocampus

Department of Anatomy and Neurobiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China.
BMC Neuroscience (Impact Factor: 2.67). 12/2011; 12(1):129. DOI: 10.1186/1471-2202-12-129
Source: PubMed
ABSTRACT
Nestin-immunoreactive (nestin-ir) neurons have been identified in the medial septal/diagonal band complex (MS/DBB) of adult rat and human, but the significance of nestin expression in functional neurons is not clear. This study investigated electrophysiological properties and neurochemical phenotypes of nestin-expressing (nestin+) neurons using whole-cell recording combined with single-cell RT-PCR to explore the significance of nestin expression in functional MS/DBB neurons. The retrograde labelling and immunofluorescence were used to investigate the nestin+ neuron related circuit in the septo-hippocampal pathway.
The results of single-cell RT-PCR showed that 87.5% (35/40) of nestin+ cells expressed choline acetyltransferase mRNA (ChAT+), only 44.3% (35/79) of ChAT+ cells expressed nestin mRNA. Furthermore, none of the nestin+ cells expressed glutamic acid decarboxylases 67 (GAD(67)) or vesicular glutamate transporters (VGLUT) mRNA. All of the recorded nestin+ cells were excitable and demonstrated slow-firing properties, which were distinctive from those of GAD(67) or VGLUT mRNA-positive neurons. These results show that the MS/DBB cholinergic neurons could be divided into nestin-expressing cholinergic neurons (NEChs) and nestin non-expressing cholinergic neurons (NNChs). Interestingly, NEChs had higher excitability and received stronger spontaneous excitatory synaptic inputs than NNChs. Retrograde labelling combined with choline acetyltransferase and nestin immunofluorescence showed that both of the NEChs and NNChs projected to hippocampus.
These results suggest that there are two parallel cholinergic septo-hippocampal pathways that may have different functions. The significance of nestin expressing in functional neurons has been discussed.

Full-text

Available from: Dongpei Li, Dec 21, 2013
The nestin-expressing and non-expressing
neurons in rat basal forebrain display different
electrophysiological properties and project to
hippocampus
Zhu et al.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129 (20 December 2011)
Page 1
RESEARCH ARTICLE Open Access
The nestin-expressing and non-expressing
neurons in rat basal forebrain display different
electrophysiological properties and project to
hippocampus
Jianhua Zhu
1
, Huaiyu Gu
1
, Zhibin Yao
1*
, Juntao Zou
1
, Kaihua Guo
1
, Dongpei Li
1
and Tianming Gao
2
Abstract
Background: Nestin-immunoreactive (nestin-ir) neurons have been identified in the medial septal/diagonal band
complex (MS/DBB) of adult rat and human, but the significance of nestin expression in functional neurons is not
clear. This study investigated electrophysiological properties and neurochemical phenotypes of nestin-expressing
(nestin+) neurons using whole-cell recording combined with single-cell RT-PCR to explore the significance of
nestin expression in functional MS/DBB neurons. The retrograde labelling and immunofluorescence were used to
investigate the nestin+ neuron related circuit in the septo-hippocampal pathway.
Results: The results of single-cell RT-PCR showed that 87.5% (35/40) of nestin+ cells expressed choline
acetyltransferase mRNA (ChAT+), only 44.3% (35/79) of ChAT+ cells expressed nestin mRNA. Furthermore, none of
the nestin+ cells expressed glutamic acid decarboxylases 67 (GAD
67
) or vesicular glutamate transporters (VGLUT)
mRNA. All of the recorded nestin+ cells were excitable and demonstrated slow-firing properties, which were
distinctive from those of GAD
67
or VGLUT mRNA-positive neurons. These results show that the MS/DBB cholinergic
neurons could be divided into nestin-expressing cholinergic neurons (NEChs) and nestin non-expressing
cholinergic neurons (NNChs). Interestingly, NEChs had higher excitability and received stronger spontaneous
excitatory synaptic inputs than NNChs. Retrograde labelling combined with choline acetyltransferase and nestin
immunofluorescence showed that both of the NEChs and NNChs projected to hippocampus.
Conclusions: These results suggest that there are two parallel cholinergic septo-hippocampal pathways that may
have different functions. The significance of nestin expressing in functional neurons has been discussed.
Background
Medial septal/diagonal band complex (MS/DBB) is a
highly heterogeneous region with different types of neu-
rons and implicated in various functions such as arousal,
sensory processing, motivation, emotion, learning and
memory [1-3]. MS/DBB contains cholinergic, GABAergic
neurons, glutamatergic neurons [4-7], nitric oxide synthase
positive neurons, and a number of peptidergic neurons [8]
that co-localize with GABAergic or cholinergic neurons
[9]. Cholinergic neurons have received particular attention
not only for their roles in learning and memory, but also
for their involvement in the patho logy o f Alz heimer s
disease (AD) [10,11].
There are four classes of neurons in the MS/DBB distin-
guished by electrophysiological characteristics [4,12-15].
The first group includes slow-firing neurons with broad
action potential (AP) and long duration afterhyperpo lari-
zation (AHP). The second group consists of fast-firing
neurons with narrower action potential and shorter AHP.
The thir d gr oup co mprises burst-firing neur ons whose
membrane properties are similar to those of fast-firing
neurons, but can fire in bursts when depolarized from a
hyp erpolarized holding pote ntial (-75 mV or -80 mV). A
recent study confirmed that the slow-firing neurons are
cholinergic, and both of the fast-firing and the burst-firing
neurons are GABAergic neurons. The fourth class of
* Correspondence: yao.zb@163.com
1
Department of Anatomy and Neurobiology, Zhongshan School of Medicine,
Sun Yat-sen University, Guangzhou, China
Full list of author information is available at the end of the article
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
© 2011 Zhu et al; licensee BioMed Central Ltd. This is an Open Ac cess article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Page 2
neurons is cluster-firing neurons and is glutamatergic.
These neurons have electrophysiological properties similar
to those of slow-firing neurons. However, prolonged (4s)
depolarization revealed that these neurons exhibited a
cluster-firing pattern [4]. Huh, et al. [16] revealed that the
glutamatergic neurons in MS/DBB display a highly hetero-
geneous set of firing patterns including fast-, cluster-,
burst-, and slow-firing, therefore, electrophysiologic prop-
erties of the glutamatergic neurons in MS/DBB should be
further studied.
Nestin is an intermediate filament protein expressed
transiently by neural progenitor cells and reactivated glial
cells [17] and is involved in cell survival and reparation
[18]. Recently, researchers identified a group of nestin
immunoreactive (nestin-ir) c ells in the MS/DBB of adult
rats and humans [8,19,20]. The expression of neuron spe-
cific enolase (NSE) and neuron-specific nuclear protein
(NeuN), but not glial fibrillary acidic protein (GFAP), sug-
gests that the nestin-ir cells are functional neurons. They
are also similar to cholinergic neurons in distribution and
morphology and are intermingled with other types of neu-
rons. Double labelling immunohistochemistry showed that
there was no overlap between nestin-ir and parvalbumin
immunoreactive (PV-ir) neurons in the MS/DBB, and
about 35% of nestin-ir neurons were choline acetyltrans-
ferase immunoreactive (ChAT-ir) neurons [8]. Further
study showed that progressive degeneration of nestin-ir
neurons might be involved in the mechani sms of aging
and memory deficit [21]. Although a few basic morpholo-
gical studies have been made on nestin-ir neurons, the
neurochemical properties of nestin-ir neurons and the sig-
nificance of nestin expressi on in functional neurons
remain u nclear. The purpose of the present study is to
explore the neurochemical properties of nestin-expressing
(nestin+) neurons with single-cell RT-CPR (sc-RT-PCR),
to investigate the intrinsic membrane properties and exci-
tatory synaptic afferent currents of nestin+ neurons using
whole-cell patch clamp recording, and to explore the neu-
ronal circuit of nestin+ neurons with retrograde labelling
combined with nestin and ChAT immunohistochemistry.
Results
Chemical phenotypes of MS/DBB neurons identified by
sc-RT-PCR
A total of 106 Medial Septal/Diagonal Band Complex (MS/
DBB) neurons were elec trophysiol ogically recorded a nd
their chemical phenotypes were identified by multiplex sc-
RT-PCR. The results showed that the mRNAs encoding
nestin, ChAT, glutamic acid decarboxylases 67 (GAD
67
),
vesicular glutamate transporters 1 or 2 (VGLUT
1
or
VGLUT
2
) could be reversely transcribed and amplified
from the harvested cytoplasm. Automatic sequencing con-
firmed that each PCR product is from the target cDNA.
The MS/DBB neurons studied in our experiment were
comprised of 79 ChAT mRNA-positive neurons (ChAT+)
that are cholinergic neurons, 13 GAD
67
mRNA-positive
neurons (GAD
67
+) that are GABAergic neurons. There
were 11 neurons co-expressing ChAT mRNA and GAD
67
mRNA, of which, 6 were categorized as cholinergic neuron
and 5 as GABAergic neuron according to their electrophy-
siological properties. Nine neurons solely expressed
VGLUT
1
mRNA or/and VGLUT
2
mRNAs but not ChAT
mRNA or GAD
67
mRNAs, which confirms the identifica-
tion of glutamatergic neurons [4,22]. Among the 40 nestin
mRNA-positive (nestin+) neurons, 87.5% (35/40) neurons
expressed C hAT mRNA. Conversely, 44.3% (35/79) of
ChAT+ neurons expressed nestin mRNA. However, no
nestin mRNA was found co-expressing GAD
67
mRNA or
VGLUT mRNA. The neurons did not express any of these
mRNA were discarded.
The intrinsic membrane properties of nestin mRNA+
neurons
Eighty-seven neurons were assesse d for their electrop hy-
siological profile. This assessment identified 69 slow-firing
neurons, 5 cluster-firing neurons and 13 fast-firing neu-
rons. Although some neu rons presented rebound action
potentials following a hyperpolarization current injection,
we did not find any typical burst-firing neuron in our
experiment. All of the recorded nestin+ cells were excita-
ble, with typical electrophysiological characteristics of
functional neurons. In voltage-clamp mode, when depolar-
ized from -60 m V, typical neuronal whole-cell currents
(comprised of large inward Na+ current and outward K+
current) could be el icited (F igure 1B). In current-clamp
mode, typical neural action potential was observed in
response to a short period of depolarization, and repetitive
action potentials could be elicited when sustained positive
current was applied (Figure 1C, D). As most of nestin
mRNA co-expressed with ChAT mRNA, we first com-
pared electrop hysiological properties of nestin+ neurons
(including nestin mRNA-positive & ChAT mRNA-nega-
tive neurons and nestin mRNA-positive & ChAT mRNA-
positive neurons) to nestin mRNA-negative & ChAT
mRNA-positive (nestin- & ChAT+) neurons, and with
GAD
67
+ neurons and VGLUT+ neurons (Table 1, Figures
2, 3 and 4). Then, we compared electrophysiological prop-
erties of nestin mRNA-positive & ChAT mRNA-negativ e
(nestin+ & ChAT-) neurons, nestin mRNA-positive and
ChAT mRNA-positive (nestin+ & ChAT+) neurons, and
nestin mRNA-negative & ChAT mRNA-positive neurons
(nestin- & ChAT+) so as to identify the electrophysiologi-
cal characteristics among different categories of nestin and
ChAT expressing patterns (Figures 3 and 5).
Nestin+ neurons (including those neurons co-expressing
ChATmRNA)hadameanfirerate(MF)of8.39±0.45Hz,
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 2 of 20
Page 3
Figure 1 Nestin mRNA-positive cells in MS/DBB are functional neurons . A. Agarose gel analysis of the sc-RT-PCR products obtained from a
single MS/DBB cell. The only PCR-generated fragment was nestin. B. Whole cell current of the same cell depolarized from -60 mV to 10 mV in
voltage-clamp mode showed characteristic of functional neurons. C. The cell shows typical neural action potential when depolarized to the
threshold potential. D. A sustained depolarizing current (1000 ms) elicits a train of repetitive action potentials. The membrane responses were
elicited using positive currents of 0.2 nA from -60 mV in panel C and D.
Table 1 Electrophysiological properties of chemically identified neurons in the rat medial septal/diagonal band
complex
nestin+ nestin- & ChAT+ GAD
67
+ VGLUT+
number of neurons 33 32 13 9
Cm (pf) 55.76 ± 3.05
b
49.60 ± 2.37
b
76.99 ± 9.60 43.58 ± 3.92
b
Rm (MΩ) 400.56 ± 26.86 387.26 ± 27.27 289.63 ± 44.25 570.07 ± 120.25
Tau (ms) 0.85 ± 0.07 0.70 ± 0.05
a
1.27 ± 0.18 0.64 ± 0.06
a
RMP (mV) -56.73 ± 1.05 -59.75 ± 1.14 -55.62 ± 1.91 -58.00 ± 3.47
AHP duration (ms) 223.77 ± 12.08
b
230.52 ± 8.48
b
165.23 ± 7.04 238.17 ± 16.97
a
AHP amplitude (mV) 4.49 ± 0.21
b
5.02 ± 0.35
b
3.27 ± 0.25 4.80 ± 0.28
b
AP amplitude (mV) 99.04 ± 1.37
a
97.39 ± 1.22
b
104.97 ± 2.22 98.85 ± 2.82
Spike half width (ms) 0.88 ± 0.04
b
0.94 ± 0.03
b
0.67 ± 0.06 0.99 ± 0.05
b
Spike width (ms) 2.46 ± 0.09
b
2.66 ± 0.06
b
2.02 ± 0.14 2.78 ± 0.14
b
rise time (ms) 0.30 ± 0.01
b
0.32 ± 0.01
b
0.23 ± 0.02 0.32 ± 0.01
b
rise slope (mV/ms) 121.91 ± 8.30 105.85 ± 4.99
a
196.45 ± 24.41 106.31 ± 8.06
a
decay time (ms) 0.69 ± 0.03
b
0.73 ± 0.03
b
0.51 ± 0.05 0.82 ± 0.06
b
decay slope (mV/ms) -49.57 ± 3.21
a
-43.69 ± 1.81
b
-83.06 ± 9.41 -38.98 ± 2.55
b
MF (Hz) 8.39 ± 0.45
b
8.19 ± 0.49
b
18.38 ± 1.73 9.22 ± 0.97
b
F
MAX
(Hz) 20.73 ± 2.07
a
18.86 ± 1.77
b
28.99 ± 1.93 19.83 ± 0.82
b
F
STEADY
(Hz) 6.86 ± 0.53
b
6.67 ± 0.35
b
17.23 ± 1.66 7.01 ± 0.49
b
spike adaptation 0.55 ± 0.05
b
0.56 ± 0.04
b
0.28 ± 0.06 0.56 ± 0.11
a
depolarizing sag (mV) 2.74 ± 0.62
b
1.81 ± 0.32
b
16.81 ± 0.77 2.22 ± 0.56
b
I
h
(pA) -12.90 ± 2.57
b
-4.00 ± 2.17
b
-186.82 ± 15.73 -3.49 ± 1.86
b, c
Nestin+, nestin mRNA-positive neuron (including nestin mRNA-positive & ChAT mRNA-negative neurons and nestin mRNA-positive & ChAT mRNA-positive
neurons); Nestin- & ChAT+, nestin mRNA-negative and choline acetyl transferase mRNA-positive neuron; GAD
67
+, glutamic acid decarboxylases 67 mRNA-positive
neuron; VGLUT+, vesicular glutamate transporter 1 or/and 2 mRNA-positive neuron. Cm, membrane capacitance; Rm, membrane resistance; Tau, time constant;
RMP, resting membrane potentia l; threshold, action potential threshold; AHP, afterhyperpolarization; MF, Mean firing rate; F
MAX
, maximal firing frequency; F
STEADY
,
steady firing frequency. I
h
, hyperpolarization activated current of neurons when hyperpolarized from -50 to -120 mV. The current pulses used for membrane
property analyses were 0.1-0.3 nA. All values a re presented as means ± S.M.E. Significant differences are identified:
a
versus GAD
67
+ neurons, P < 0.05;
b
versus
GAD
67
+ neurons, P < 0.01;
c
versus nestin+ neurons, P < 0.05.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 3 of 20
Page 4
maximal firing frequency (F
MAX
) of 20.73 ± 2.07 Hz, and
steady firing frequency (F
STEADY
) of 6.86 ± 0.53 Hz. These
neurons also had broad action potentials (spike width 2.46
± 0.09 ms) and large afterhyperpolarization (duration
223.77 ± 12.08 ms, amplitude 4.49 ± 0.21 mV), which were
similar to nestin- & ChAT+ neurons (P > 0.05). These data
suggest that nestin+ neurons share many basic characteris-
tics with nestin- & ChAT+ neurons in the MS/DBB. The
Figure 2 Comp arison of ac tion potential properties of MS/DBB neurons. A. Representative action potentials from all cell types
(superimposed) show the differences in spike shape and width among the four cell types. GAD
67
+ neurons have the narrowest action
potentials, where as VGLUT+ neurons have the broadest action potentials. B. Histogram of action potential amplitude of all cell types. C.
Histogram of spike parameters of all cell types.
*
P < 0.05;** P < 0.01.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 4 of 20
Page 5
Figure 3 Electrophysiological properties of nestin+ and/or ChAT+ neurons. A1-F1: Nestin+ & ChAT- neurons, A2-F2: Nestin+ & ChAT+
neurons, A3-F3: Nestin- & ChAT+ neurons. A1-3: Agarose gel analysis of the sc-RT-PCR products to identify chemical phenotypes of recorded
neurons. B
1-3
and C1-3: In current-clamp mode, membrane responses of the same MS/DBB neuron to depolarizing current pulses (0.2 nA)
applied from membrane potential of -60 mV (B1-3) or -80 mV (C1-3). All neurons display slow-firing activity. D1-3: Injection of a hyperpolarizing
current pulse from -60 mV, no depolarizing sag and rebound firing were found in each kind of neuron. E1-3: Hyperpolarizing voltage steps
applied from a holding potential of -50 mV showed absence of conspicuous I
h
in all groups of neurons. F1-3: I-V plots of instantaneous (filled
circle) and steady-state (open circle) current derived from the data in E1-3. The I
h
of nestin+ & ChAT+ neuron was mildly larger than that of
nestin- & ChAT+ neuron (E2, E3, F2, F3).
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 5 of 20
Page 6
Figure 4 Electrophysiolog ical properties of GAD67+ and VGLUT+ neurons. A1-F1: GAD
67
+ neuron prese nts elec trophysiological properties
of fast-firing neuron. A2-F2: VGLUT+ neuron presents electrophysiological properties of cluster-firing neuron. A1-2: Agarose gel analysis of the sc-
RT-PCR products to identify chemical phenotypes of recorded neurons. B1 and C1: Membrane responses of the same MS/DBB neuron to
injection of depolarizing current pulses applied from a membrane potential of -60 mV (B1) or -80 mV (C1). GAD
67
+ neuron displays fast-firing
activity. B2 and C2: Membrane responses of the VGLUT+ neuron to injection of depolarizing current pulses (0.2 nA) applied from a membrane
potential of -60 mV, prolonged depolarization current (4s in duration) elicits cluster-firing separated by subthreshold membrane oscillations (C2).
D1-2: In current-clamp mode, the response to injections of hyperpolarizing current pulse from -60 mV, note profound depolarizing sag in GAD
67
+ neuron, but no rebound firing action potential (D1). E1-2: Currents recorded in voltage-clamp mode evoked by a series of hyperpolarizing
voltage steps applied from a holding potential of -50 mV. Notice the profound depolarizing amplitude inward current in GAD
67
+ neuron, as
shown by the differences between the amplitudes of the instantaneous current (filled circle) and steady-state current (open circle). F1-2:
Instantaneous and steady-state I-V plots derived from the data in E1-2.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 6 of 20
Page 7
spike width, AHP amplitude and duration of nestin+ neu-
rons were significantly larger than that of GAD
67
+neurons
(P < 0.01). However, MF, depolarizing sag, and hyperpolari-
zation activated current of neurons (I
h
) were smaller than
those of GAD
67
+ neurons (P < 0.01). F urthermore, other
key properties of nestin+ neurons were significantly differ-
ent from those of GAD
67
+ neurons (P < 0.05, Table 1, Fig-
ure 2). Thus, the nestin+ neurons were distinctive from the
classic GABAergic neurons. Nestin+ neurons shared some
membrane properties of VGLUT+ neurons, but had larger
I
h
and no cluster firing in response to prolonged depolariza-
tion from -60 mV. In summary, the I
h
of nestin+ neurons
were smaller t han those of the GAD
67
+neurons,but
greater than the I
h
of the VGLUT+ (Figures 3 and 4). Statis-
tical analysis showed the different I
h
and other parameters
among the subpopulations of neurons in MS/DBB (Table1).
Interestingly, while further analyzed the electrophysio-
logical properties of nestin+ & ChAT-, nestin+ & Ch AT
+ and nestin+ & ChAT- neurons, we found that the I
h
of nestin+ & ChAT+ neurons were larger than those of
nestin- & Ch AT+ neurons (P < 0.05), and nestin+ &
ChAT- neurons had a RMP of -51.80 ± 1.32 m V, which
were significantly lower than that of nestin- & ChAT+
neurons ( P < 0.01) (Figures 3 an d 5). However, other
electrophysiological differences (e.g., latency for first
spike, slow after-hyperpolari zing potent ial, maxima l
Figure 5 Comparison of RMP and I
h
amplitude of nestin+ and/or ChAT+ neurons in MS/DBB.*P < 0.05; ** P < 0.01.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 7 of 20
Page 8
frequency and action potential decay slope) among these
neurons were not found.
Excitatory postsynaptic currents recorded from nestin+ &
ChAT+ neurons and nestin- & ChAT+ neurons
In this section, nineteen neurons, which contained 12 nes-
tin- & ChAT+ neurons and 7 nestin+ & ChAT+ neurons,
were recorded, and 3993 sEPSCs events and 3570 mEPSCs
events were analyzed in total. The addition of 10 μM6-
cyano-7-nitroquinoxaline-2, 3-dione (CNQX, a non-
NMDA glutamate receptor antagonist) abolished all
synaptic events, indicating the involvement of non-NMDA
glutamate receptors (data not shown).
The sEPSCs amplitude (28.45 ± 1.78 pA) of nestin+ &
ChAT+ neurons was significantly larger than that of the
nestin- & ChAT+ neurons (22.91 ± 1.05 pA) (students
t-test, two tails, P < 0.05). The sEPSCs amplitudes cumula-
tive probability distribution curve of nestin+ & ChAT+
neurons showed a right shift compared to the curve for
nestin- & ChAT+ neurons (K-S Z = 4.549, P < 0.01). This
result suggests that the s EPSCs distribution patterns of
nestin+ & ChAT+ neurons were different from those of
nestin- & ChAT+ neurons. It also pro vided further evi-
dence to confirm that the sEPSCs amplitude of nestin+ &
ChAT+ neurons was significantly larger than those of the
nestin- & ChAT+ n eurons. Both the st udent s t-test and
the Kolmogorov-Smirnov test (KS-test) were used to
determine if the two datasets differ significantly. As stu-
dents t-test is a parametric test and may be more sensitive
if the data meets the requirements of the students t-test.
The KS-test, on the other hand, has the advantage of mak-
ing no assumptions about the distribution of data (non-
parametric). Therefore, in order to compare the mean
value and distribution of the sEPSCs and mEPSCs, we
used both, finding that the KS-test is more suited than the
students t-test. The sEPSCs inter-event intervals cumula-
tive probability distribution curve of nestin+ & ChAT+
neurons was on the left of the curve for nestin- & ChAT+
neurons ( K-S Z = 2.644, P < 0.01), which indicates
the sEPSCs f requency of the nestin+ & ChAT+ neurons
was higher than that of the nestin- & ChAT+ neurons
(Figure 6) [23,24].
In order to further explore the mechanism of the differ-
ent sEPSCs between the nestin- & ChAT+ and nestin+ &
ChAT+ neurons, mEPSCs of both kinds of neurons were
studied. The independent samples students t-test showed
that the mEPSCs amplitude (29.01 ± 1.83 pA) of nestin+ &
ChAT+ neurons was significantly larger than that of nes-
tin- & ChAT+ neurons (22.64 ± 1.06 pA) (P < 0.01). The
mEPSCs amplitudes cumulative probability distribution
curve of nestin+ & ChAT+ neurons was on the right of
that for the nestin- & ChAT+ neurons (K-S Z = 8.2165, P
< 0.01). The mEPSCs inter-event intervals cumulative
probability distribution curve of nestin+ & ChAT+ neurons
was on the right for that of nestin- & ChAT+ neurons (K-S
Z = 1.717, P < 0.01). These results confirmed that nestin+
& ChAT+ neurons had higher mEPSCs amplitude than
nestin- & ChAT+ neurons and that the mEPSCs frequency
of nestin+ & ChAT+ neurons was lower than that of the
nestin- & ChAT+ neurons (Figure 7).
The paired samples students t-test results showed that
the mEPSCs frequency was significantly lower than
sEPSCs frequency in nestin+ & ChAT+ (P < 0.05), but no
difference was found between the mEPSCs and sEPSCs
frequencies of nestin- & ChAT+ neurons (P >0.05).The
sEPSCs/mEPSCs frequency ratio of nestin+ & ChAT+
neurons was approximately two times higher than that
nestin- & ChAT+ neurons. However, there was no differ-
ence between the amplitudes of mEPSCs and sEPSCs of
nestin- & ChAT+ neurons or nestin+ & ChAT+ neurons
(P > 0.05). These results suggest that the higher s EPSCs
amplitude of nestin+ & ChAT+ neurons compared to the
nestin- & ChAT+ neurons was not changed by 1 μM
TTX, implied it might come from the higher excitability
of nestin+ & ChAT+ neurons themselves rather than from
stronger excitatory action potentials of presynaptic neu-
rons. F urthermore, there was no difference between
synaptic multiplicities of nestin+ & ChAT+ neurons
and nestin- & ChAT+ neurons, which s uggests that the
nestin+ & ChAT+ neurons and nestin- & ChAT+ neurons
shared similar maturity (Figure 8). In summary, these
results provide powerful evidence that despite shared simi-
lar maturity, nestin+ & ChAT+ neurons receive stronger
excitatory synaptic inputs and have higher excitability
compared to nestin- & ChAT+ neurons.
Immunofluorescence study of the biocytin-filled neurons
Twenty-eight neurons were successfully filled with biocy-
tin and visualized by Rhodamine Red-X. Cell bodies were
particularly well-labelled, allowing u s to determine their
position relative to the M S/DBB. Biocytin-filled neurons
were bipolar or multipolar and gave off two or three pri-
mary dendrites that subsequently bifurcated to the adja-
cent areas. The axons originated from the soma or
proximal end of a primary dendrite. No evidence of axon
collaterals was found in our slices. Of the 28 biocytin-filled
neurons, 22 were ChAT-immunoreactive (ChAT-ir) neu-
rons, among which 45.45% (10/22) were nestin-immunor-
eactive (nestin-ir) neurons. Eleven out of the 28 biocytin-
filled neurons were nestin-i r neurons, 90.91% (10/11) of
which were also ChAT-immunoreactive (Figure 9).
Retrograde tracing of fast blue from the CA1 area of
hippocampus
Examination of serial section of the basal forebrain region
5 days after injection of the fast blue revealed that the
blue colour fluorescence could be v isualized clearly. The
fast blue labelled somas were seen throughout the entire
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 8 of 20
Page 9
Figure 6 Comparison of sEPSCs of MS/DBB nestin- and nestin+ cholinergic neurons. A. Consecutive tr aces of sEPSCs recorded from MS/
DBB nestin- and nestin+ cholinergic neurons. B. Average sEPSCs of nestin- and nestin+ cholinergic neurons. C. Comparison of the sEPSCs
frequencies of MS/DBB nestin- and nestin+ cholinergic neurons. D. Comparison of the sEPSCs amplitudes of MS/DBB nestin- and nestin+
cholinergic neurons (*: P < 0.05). E. Cumulative probability distribution of sEPSCs inter-event intervals of nestin- and nestin+ cholinergic neurons
in MS/DBB: the curve of nestin+ cholinergic neurons was on the left of the curve for nestin- cholinergic neurons (K-S Z = 2.644, P < 0.01); F.
Cumulative probability distribution of sEPSCs amplitudes of nestin- and nestin+ cholinergic neurons in MS/DBB: the curve of nestin+ cholinergic
neurons was on the right of the curve for nestin- cholinergic neurons (K-S Z = 4.549, P < 0.01).
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 9 of 20
Page 10
Figure 7 Comparison of mEPSCs of MS/DBB nestin- and nestin+ cholinergic neurons. A. Consecutive traces recorded from MS/DBB nestin-
and nestin+ cholinergic neurons. B. Average mEPSCs of nestin- and nestin+ cholinergic neurons. C. Comparison of the mEPSCs frequencies of
MS/DBB nestin- and nestin+ cholinergic neurons. D. Comparison of the mEPSCs amplitudes of MS/DBB nestin- and nestin+ cholinergic neurons
(**: P < 0.01). E. Cumulative probability distribution of mEPSCs inter-event intervals of nestin- and nestin+ cholinergic neurons in MS/DBB: the
curve of nestin+ cholinergic neurons was on the right of that of nestin- cholinergic neurons (K-S Z = 1.717, P < 0.01). F. Cumulative probability
distribution of mEPSCs amplitudes of nestin- and nestin+ cholinergic neurons in MS/DBB: the curve of nestin+ cholinergic neurons was on the
right of that of the nestin- cholinergic neurons (K-S Z = 8.217, P < 0.01).
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 10 of 20
Page 11
MS/DBB region. Histological examination of the MS/
DBB area after labelling revealed striking intense signals
in the cell body, however, the neuritis were difficult to
distinguish from background. In order to define the ana-
tomical circuits of the nestin+ and nestin- cholinergic
projection to the hippocampus, we evaluated the percen-
tage of ChAT and nestin i mmunoreactivity among the
fast blue-labelled neurons in the MS/DBB region after
fast blue intra-hippocampus instillation. The nestin and
ChAT immunoreactive cells were clearly labelled by
green and red colour fluorescence specifically. In order to
find the ratio of the nestin+ or nestin- cholinergic neu-
rons projection to the hippocampus, the double or triple
fluorescence of combined immunohistochemistry and
retrograde labelling were carefully measured. Approxi-
mately 20.40% of the fast blue-labelled neurons in the
Figure 8 Comparison of sEPSCs and mEPSCs of nestin- and nestin+ cholinergic neurons in MS/DBB. A. Comparison of the frequencies of
sEPSCs and mEPSCs of nestin- and nestin+ cholinergic neurons. B. Comparison of the amplitude of sEPSCs and mEPSCs of nestin- and nestin+
cholinergic neurons. C. Multiplicity of nestin- and nestin+ cholinergic neurons. D. sEPSCs/mEPSCs frequency ratio of nestin- and nestin+
cholinergic neurons. *: P < 0.05.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 11 of 20
Page 12
MS/DBB a rea were ChAT-immunoreactive. In which,
48.04% were nestin -expressing neurons, and 51.96% nes-
tin non-expressing cholinergic neurons (Figure 10).
Discussion
Themainfindingsofthisstudywereasfollows:the
electrophysiologically recorded ce lls expressing nestin
mRNA in the MS/DBB are functional neurons; the
majority of nestin+ neurons are cholinergic neurons
rather than GABAergic or glutamatergic neurons; nestin
+ & ChAT+ neurons are more excitable and received
stronger excitatory synaptic affe rent currents than those
of the nestin- & ChAT+ neur ons. In addition, the fast
blue retrograde labelling experim ent demonstrates that
Figure 9 Triple immunofluorescent study of biocytin -filled neuron. A. Biocytin-filled neuron was visualized by rh odamine red-X-conjugated
streptavidin. B and C showed ChAT- and nestin-immunoreactive neurons visualized by cy2 (blue) and alexa 405 (green) respectively. D. Image
merged from A, B and C. The red arrow pointed to the cell double labelled by the nestin and ChAT antibodies and filled with biocytin by
whole-cell patch clamp recording. The white arrow pointed to the cell double labelled by ChAT and nestin antibodies. The blue arrow pointed
to a neuron that only expressed ChAT. Because the brain slice was made from neonatal rat and did not perfuse transcardially before slice
preparation, there were some epithelium lining blood vessels labelled by nestin monoclone antibody in C and D. Scale bar was 20 μm.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 12 of 20
Page 13
Figure 10 Retrograde labelling demonstrates that the nestin+ and nestin- cholinergic neurons projec ted to hippocampus.(A)
Photomicrograph demonstrating the deposition of fast blue dye throughout the entire MS/DBB area and the location of ChAT+ and nestin+
neurons. (B) The ChAT+ neurons in MS/DBB area. (C) The nestin+ neurons in the MS/DBB area. (D) The fast blue transported from the
hippocampus was localized in the neurons of the MS/DBB area. (E) The double immunostaining of ChAT+ neurons and nestin+ neurons, arrows
point to the double labelling neurons (nestin+ cholinergic neurons). (F) Photomicrograph of neurons labelled by retrograde tracing of fast blue
from the hippocampus and nestin+/nestin- cholinergic neurons. Arrows and arrowheads point to the nestin+ and nestin- cholinergic neurons
labelled with fast blue. Scale bar: 50 μminA;50μm in B-F.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 13 of 20
Page 14
both the nestin+ and nestin- cholinergic neurons sent
projections to hippocampus.
The recorded cells expressing nestin in MS/DBB are
functional neurons
Using whole-cell recording combined with sc-RT-PCR,
our experiment demonstrated that all of the electrophysio-
logically recorded cells expressing nestin mRNA in MS/
DBB were excitable. Whole cell currents of functional
neurons could be elicited fr om these neurons in voltage-
clamp mode; typical neural action potential was observed
in response to a short period of depolarization, and repeti-
tive act ion po tentials could be elicited when sustained
positive current was applied in current-clamp mode. Due
to their typical intrinsic membrane properties recorde d
here, we concluded that these cells are functional neurons
rather than stem cells or glial cells, since neural stem cells
and glial cells could not be excited to produce neural
action potential. For the first time, these data confirmed
tha t nestin+ ce lls in the MS/DBB are functi onal neuron s
by the joint evidence of mRNA expression and electrophy-
siological properties from whole-cell recordings.
Most of the nestin+ neurons in MS/DBB were cholinergic
neurons
Sc-RT-PCR results revealed 87.5% of nestin+ neurons
expressed ChAT mRNA, and about 44.3% of ChAT+ neu-
rons expressed nestin mRNA. However, no nesti n+ neu-
rons expressed GAD
67
mRNA or V GLUT m RNA. T hese
results were further confirmed by the nestin and ChAT
immunofluorescent labelling of biocytin filled neurons and
fast blue retrograded labelled neurons under the laser con-
focal microscope, which confirmed that nearly one half of
the ChAT-ir neurons were nestin-ir neurons. There were
a few nestin+ neurons that did not express ChAT+,
GAD
67
or VGLUT mRNA. Thi s may stem from limit of
methodology, or there were a new class of neurons in
MS/DBB.
Taken together, these observations provide new e vi-
dence that the majority of nestin+ neurons in MS/DBB
were cholinergic neurons rather than GABAergic or gluta-
matergic neurons. In other words, cholinergic neurons in
the MS/DBB could be s ubdivided into nestin -expressing
cholinergic neurons (NEChs) and nestin non-expressing
cholinergic neurons (NNChs). This result is partially
inconsistent with the previous reports, in which about 35%
of nestin-ir neurons were ChAT-ir [8]. The possible rea-
son of the difference may stem from the sensitivity of th e
methodology. Previous studies used double-staining
immunohistochemistry, which visualized same neuron
with 3-diaminobenzidine (DAB) and 3, 3,5,5-tetra-
methylbenzidine-sodium tu ngstate (TMB-ST). The two
chromogen ic reagents may interfere with each other and
lead to false-negative results. In addition, TMB colour
faded rapidly. Consequently, in the use of this labelling
method some neurons were st ained with ambiguous col-
our and it was, therefore, difficult to accurately assess their
phenotype. The other possible reason may be that sc-RT-
PCR detects mRNA but immunohistochemistry detects
proteins, and that not all mRNA may be translated into
proteins.
NEChs and NNChs had different electrophysiological
properties
The I
h
current serves as a pacemaker, and is implicated
in generating rhythmic bursts in a number of brain
structures such as thalamus, hippocampus and cortex
[25]. Previous work revealed that cholinergic neuron dis-
played slow-firing and little or no I
h
; GABAergic neuron
was fast-firing neuron, had a substantial I
h
; and glutama-
tergic displayed electrophysiological properties similar to
cholinergic neurons such as the o ccurrence of a very
small I
h
[4]. In our study, we found GABAergic neurons
had prominent I
h
, whereas cholinergic and glutamatergic
neurons had small or no I
h
, which was consistent with
previous studies.
The I
h
and sEPSCs amplitude of NEChs were larger
than those of NNChs, which implies that NEChs are
more excitable than NNChs and may have different roles
in learning and memory. The higher sEPSCs frequency
and amplitude of the NEChs suggests that the NEChs
received stronger spontaneous excitatory synaptic inputs
than those of the NNChs. The mEPSCs amplitude of
NEChs were significantly larger than those of NNChs,
but no differences were observed between the amplitudes
of mEPSCs and sEPSCs on NEChs or NNChs, suggesting
that presynaptic spontaneous action potential did not
affect the sEPSCs amplitude of both the NEChs and
NNChs.ThesedataalsosuggestthatthehighersEPSCs
amplitude of NEChs was due to more excitatory recep-
tors or higher sensitivity o f the receptors compared to
the NNChs. The similar multiplicities of NEChs and
NNChs suggested that both kinds of neurons share same
level of maturity. Interestingly, the m EPSCs frequency of
NEChs, but not NNChs, was remarkably lower than
sEPSCs freque ncy, which led to the large shift in the fre-
quency of spontaneous activity, indicating that a great
number of spontaneous events of NEChs recorded in
absence of TTX could be attributed to the neurotrans-
mitter released by action potential dependent mechan-
isms. T herefore, the stronger spontaneous excitatory
afferent current could be attributed to the higher synap-
tic transmission efficacy to the NE Chs, and higher excit-
ability of the NEChs compared to the NNChs.
NEChs and NNChs project parallelly to hippocampus
MS/DBB is one of the most important inputs to the hip-
pocampal neurons [26,27]. The hippocampus receives its
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 14 of 20
Page 15
cholinergic projections predominantly from MS, and to
a lesser extent, from the VDB (Mesulam et al., 1983a).
This cholinergic input is of particular importance for
learning a nd memory processes (Ha sselmo, 1999; Kes-
ner, 1988).
In our exper iment, we have demonstrated that nestin+
neurons are a subtype of basal forebrain cholinergic neu-
rons using single-cell RT-PCR, immunohistochemistry
and electrophysiological property analysis. Therefore, basal
forebrain cholinergic neurons could be divided into two
groups according to whether expressing nestin and their
electrophysiological properties. Retrograde labelling com-
bined with ChAT and nestin immunofluorescenc e sug-
gested that both of the nestin+ and the nestin- cholinergic
neurons project to the hippocampus. Therefore, we con-
cluded that there are two parallel septo-hippocampal cho-
linergic pathways. One pathway originates from MS/DBB
nestin-expressing cholinergic neurons (NEChs), and the
other pathway originates from nestin non-expressing cho-
linergic neurons (NNChs). Because the NEChs and
NNChs had different intrinsic electrophysiological proper-
ties and received distinct excitatory synaptic inputs, they
may have different functions in maintaining the electrical
activities in the hippoca mpus, which is worthy of further
study.
Nestin is expressed transiently by neural progenitor cells
and reactivated glial cells [17] and is involved in cell survi-
val and reparation [18]. Previous studies revealed that Pur-
kinje cells in cerebella of Creutzfeldt-Jakob disease and
dorsal root ganglia neurons following nerve injury express
nestin, and that nestin expression might represent a stage
of protective reaction to prolong the survival of neurons
or enhance the differentiation of neurons in order to com-
pensate for lost neurons [18,28]. In addition, intracerebro-
ventricular injection of colchicine can lead to irreversible
reduction of basal forebrain cholinergic neurons [29], but
only cause transient reduction of basal forebrain nestin-ir
neurons[30].AsmostofthenestinmRNA+neurons
were cholinergic neurons, it is implied that nestin expres-
sion might mark a special stage of cholinergic neurons
that were relativ ely spared from severe degeneration and
cell death. It is also possible that nestin expression marks
a type of newly differentiated neurons that compensate for
lost MS/DBB cholinergic neurons. The mechanism under-
lying the protective plasticity and viability of NEChs and
NNChs are worthy of further study using selectively or
non-selectively MS/DBB neurons damaging model [31].
Conclusions
In conclusion, we studied the electrophysiological prop-
erties of the novel nestin+ neurons in the MS/DBB, and
demonstrated that most of nestin+ neurons are func-
tional cholinergic neurons. We also provided evidence
that the N EChs had higher excitability and received
stronger spontaneous excitatory synaptic inputs than
thos e of the NNChs. Then we dem onstrated that b oth of
the NEChs and NNChs projected to the hippocampus.
The different elec trophysiological properties of NEChs
and NNChs and common neural circuits to hippocampus
suggested that there are two parallel septo-hippocampal
cholinergic pathways that may have different functions.
Whether nestin expression affects the cholinergic neu-
rons properties require further study by manipulation of
gene expression. These results will not only facili tate our
understanding of the structures and biological function
of basal forebrain, the mechanism of learning and mem-
ory, the ageing process and the pathology of AD, but may
also provide a new insight for AD treatment.
Methods
Ethics Statement
All experiments were approved by Institutional Animal
Care and Use Committee of Sun Yat-sen University. All
work was carried out in accordance with the National
Institute of Health Guide for the Care and Use of Labora-
tory Animals (NIH Publications No. 80-2 3) revised 1996.
Every effort was made to minimize the animals used and
their suffering.
Brain slice preparation
Brain slices containing the MS/DBB were prepared from
40 Sprague-Dawley rats (14-21 days postnatal) of either
sex as previously described [4]. Briefly, rats were killed by
decapitation, and brains were quickly removed and sub-
merged in ice-cold artificial cerebrospinal fluid (ACSF)
containing (in mM): 126 NaCl, 3 KCl, 1. 25 NaH
2
PO
4
, 2.0
MgSO
4
, 2.0 CaCl
2
, 24 NaHCO
3
, and 10 D-glucose, equili-
brated with 95% O
2
-5% CO
2
, pH 7.4. After cooling in the
ACSF, brain was trimmed wit h a razor blade and fixed to
specimen tray of a vibratome (Vibratome 3000 EP section-
ing system, USA) with cyanoacrylate adhesive. Coronal
slices of 400 μm t hickness containing the MS/DBB were
prepared and transferred to a custom-designed holding
chamber allowed to recover in oxygenated ACSF at 32 ±
0.5°C for 30 min, and then put at room temperature (25 ±
1°C ) for additional 1- 4 hour before experimental record-
ings. After 1-1.5 hour, the slice was transferred to a
Plexiglas recording chamber on the stage of a Nikon
microscope (Eclipse FN1, Japan) and continuously per-
fused with oxygenated ACSF at a rate of 1-2 m l/min for
electrophysiological recordings. The recording chamber
was kept at a temperature of 26 ± 0.5°C by an au tomatic
temperature controller (WARNER TC-324B, USA). Neu-
rons in the slice were visualized using infrared differential
interference contrast (IR/DIC) video microscopy (IR-
1000E, USA). Medium to large sized neurons in MS/DBB
that had full form and c lear outline were selected ra n-
domly for patch recording.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 15 of 20
Page 16
Whole-cell recordings
Patch pipettes were made from diethyl pyrocarbonate
(DEPC, Amresco, USA) processed and heat-sterilized bor-
osilicate glass capillary tubing containing a fil ament (OD:
1.5 mm, ID: 0.86 mm) by Sutter P-97 horizontal puller
(Sutter Instruments Co. , Novato, USA). The pipette filled
with 5μl internal solution had 3-6 Mohm pipette resis-
tance. The internal solution was prepared with nuclease-
free water containing (in mM): 144 potassi um gluconate,
3MgCl
2
,10Hepes,0.2EGTA,2K
2
-ATP, 0.3 Na
3
-GTP,
pH 7.2 (285-295 mOsm). Whole-cell recordings in vol-
tage-clamp and current-clamp modes were performed at
26±0.5°CusinganAxonMulti Clamp-700B amplifiers
and a Digidata 1322A analog-to-digital converter (Axon
Instruments Inc, USA). The output signal was continu-
ously filtered at 3 kHz, digitized at a sampling rate of
20 kHz, and stored in a computer for off-line analysis
using pClamp 9.2 software ( Axon instruments Inc, USA)
or Mini Analysis 6. 0.3 (Synaptosoft, Leonia, NJ, USA)
software.
Intrinsic membrane properties analysis
All electrophysiological recordings were made from the
medial septum and the vertical limb of the diagonal
band of Broca. The resting membrane potential of each
neuron was measured in current-clamp mode (I = 0)
just after passing in whole cell config uration. All mem-
brane poten tials wer e correcte d for junction potential
(about -15 mV). The experiment was continued only
when the resting membrane potential was more negative
than -45 mV, sp ikes overshot 0 mV and the series resis-
tance was less than 30 Mohm [4]. In current-clamp
mode, the membrane potentials of selected MS/DBB
neurons were held at - 60 mV or - 80 mV, and a series
of hyperpolarizing and depolarizing current pulses (0.1 -
0.3 nA, 1- 4 s duration) were applied from both holding
pot entials to determine membrane properties and f iring
properties. Action potential prope rties were an alyzed
from membrane response to a short threshold depolariz-
ing current pulse (10 ms, 0.1 - 0.3 nA) applied at -60
mV [14,32] using stand ard criter ia (Figure 11, A and
11B) [33,34].
Firing patterns were analyzed in response to series of 1-4
s depolarizing current pulses applied from - 60 mV, and
repeated from a membrane potential of -80 mV. Firing fre-
quencies were dete rmined for e ach neuron depolarized
from -60 mV using a current pulse of 100-300 pA. Maxi-
mal firing frequency (F
MAX
) and steady firing frequency
(F
STEADY
) were calculated from the time interval between
the first two spikes or the last two spikes respectively in a
train of action potentials evoked by a 1 s depolarizing cur-
rent pulse, and mean firing rate was calculated from the
number of spikes evoked by a 1 s depolarizing current
pulse (Figure 11, C and 11D). Spik e adaptati on was mea-
sured using [(F
MAX
-F
STEADY
)/F
MAX
].
The voltage-dependent inward rectification (depolariz-
ing sag) was determined by application of a series of 4 s
hyperpolarizing current from -60 mV, and its amplitude
was measured for the current pulse inducing an initial
hyperpolarization to - 95 mV. The hyperpolarization
activated current (I
h
) was activated using a series of 2 s
long hyperpolarizing voltage steps fr om -50 to -120 mV
in 10 mV increments. Th e currents evoked by injection
of hyperpolarizing voltage steps presented two compo-
nents: instantaneous current (an initial in stantaneous
change in membrane conductance) and steady-state cur-
rent (a secondary slowly developing inward current).
The amplitude of I
h
was measured by subtracting
instantaneous current from steady-state current, and
was represented by plotting the instantaneous and
steady state currents as a function of membrane voltage.
Analysis of the excitatory synaptic input current
properties
The selected neurons were clamped at -70 mV. The inter-
nal solution was the same as that used in the experiment
for intrinsic membrane properties study. To study sponta-
neous excitatory postsynaptic currents (sEPSCs), bicucul-
line (10 μM) was added to the perfusing solution to block
GABA
A
-mediated synaptic transmission. Tetrodotoxin
(TTX, 1 μM) was added to the bicuculline-containing
solution to obt ain mEPSCs. The output signal was con-
tinuously filtered at 3 kHz, digitized at a sampling rate of
20 kHz, and stored in a computer for off-line analysis
using Mini Analysis 6.0.3 (Synaptosoft, Leonia, NJ, USA)
software. The excitatory postsynaptic currents analysis was
based on 180 s gap free recordings. The detection thresh-
old was set at twice the baseline noise. The fact that no
false events would be identified was confirmed by visual
inspection for each synaptic current. The cells were
rejected if the acc ess r esistance cha nged more than 20 %
during the experiment. The addition of 10 μM 6-cyano-7-
nitroquinoxaline-2, 3-dione (CNQX, a non-NMDA gluta-
mate receptor antagonist) abolished all synaptic events,
indicating the involvement of non-NMDA glutamate
receptors (data not shown).
To compare the synaptic connectivity, we calculated
multiplicity index, a common parameter used as a
maturation index in synaptic developmental studies,
defined as the numbe r of release sites per p resynaptic
neuron could release neurotransmitter simultaneously
onto the recorded c ell [35-37]. Multiplicity i ndex was
calculated as the mean amplitude of action-p otential-
driven events divided by mean quantal size (q: mean
amplitude of mEPSCs). The Multiplicity index was cal-
culated as follows:
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 16 of 20
Page 17
Multiplicity = (V
b
.b V
q
.q)
[(V
b
V
q
).q
]
Where V
b
and V
q
are the mean frequency o f sEPSCs
and mEPSCs; b and q are the mean amplitude of
sEPSCs and mEPSCs.
Cytoplasm harvest and reverse transcription
Cytoplasm harvest and reverse transcription (RT) were
performed as previously described [4,38-40] with a little
change according to the instruction of the Prime-
script
TM
RT-PCR kit (Takara Biotechnology, Dalian,
China). Briefly, after electrophysiological recording, the
cell Cytoplasm was aspirated by a gentle negative pres-
sure in the patch pipette under visual control. The series
resist ance and leak currents were monitored throughout
the aspiration procedure and the negative pressure was
stopped before the seal was lost. The pipette was then
quickly removed from the slice, and its content was
expelled into a 0.2 ml PCR tube containing 5 μlof20
mM dithiothreitol (DTT, Amresco, USA), 20 U ribo nu-
clease inhibitor and 20 picomoles of random hexamers
(volume was measured and adjusted to 10 μl with nucle-
ase-free wat er and quickly cooled on ice). For first
strand cDNA synthesis, the tube was heated to 95°C for
1 min and quickly cooled on ice. 100 U Primescript
TM
RTase, 4 μl 5 × First Strand Buffer, 1 μl dNTPs (10 mM
each), 1 μ l 0.1 M DTT, 20 U ribonuclease inhibitor and
3 μlRNasefreedH
2
O were then added to make the
total reaction volume to 20 μl. The RT was initiated at
30°C for 10 min, continued for 2 h at 42°C and over-
night at 37°C. The reverse transcriptase was denaturized
at 70°C for 15 min and RNA was removed by incubation
with 2 U ribonuclease H (1 μl, Takara Biotechno logy,
Dalian, China) for 20 min at 37°C.
Multiplex PCR
The cDNAs for ChAT, glutamic acid decarboxylases
67
(GAD
67
), vesicular glutamate transpo rters 1 and 2
(VGLUT
1
and VG LUT
2
), and nestin were amplifi ed wit h
a two-step PCR protocol, slightly modified from that
described by Sotty et al. (2003) and Puma et al. (200 1).
Target cDNAs were amplified simultaneously as a multi-
plex PCR in t he first round and amplified individually in
the second round PCR with nested primers. The first
round PCR reaction was performed in a Mastercycler
(Eppendorf, Germany) with a final volume of 100 μlcon-
taining the 21 μl RT reaction, PCR Buffer (50 mM
KCl, 10 mM Tris-HCl, 1.5 mM MgCl2, pH 8. 3), 50 μM
of each of the dNTPs, 10 p mol of each selected primer
and 2.5 U TaKaRa Ex Taq
TM
HS polymerase (Takara
Biotechnology, Dalian, China). The PCR amplification
protocol was as follows: 2 min at 94°C; 20 cycles: 30 s at
Figure 11 Measurement of action potential parameters and fir ing patterns. A, B: Measurement of action potential parameters. 1) Resting
membrane potential (mV); 2) Action potential threshold (mV); 3) Action potential amplitude (mV); 4) After hyperpolarization (AHP) amplitude
(mV); 5) AHP duration (ms); 6,)Spike rise time (ms); 7) Spike decay time (ms); 8) Spike duration; 9), Spike half width (ms). C, D: Measurement of
parameters of firing properties of a medial septal and diagonal band complex neuron subjected to a depolarizing current pulse: time interval
between: 1, the first two action potentials; 2, the last two action potentials. Reciprocal of time intervals gives maximum firing frequency (F
MAX
)
and steady firing frequency (F
STEADY
). Scale bars: 20 mV, 50 ms in A; 20 mV, 0.5 ms in B; 20 mV, 100 ms in C.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 17 of 20
Page 18
94°C, 30 s at 60°C, 35 s at 72°C; 5 m in at 72°C. Se cond-
round PCRs were performed individually in reaction
volume of 25 μl, using 2 μl of the first round PCR pro-
duct and specific primer pair by 35 PCR cycles under
similar conditions as first round PCR but the concentra-
tion of dNTPs was 200 mM. Five microliters of each last-
round PCR product was run on a 1.5% TEA agarose gel
stained with ethidium bromide, using a 100 bp DNA lad-
der as molecular weight marker. Some PCR products had
been sent to professional company (Beijing AuGCT bio-
technology Co., ltd, Beijing, China) for automatic sequen-
cing to determine their specificity. Primers used in the
experimentareshowninTable2.Toensuretheprimer
specificity a ll primers were designed to span multiple
intron/extron boundaries. To rule out the false-positive
response, bathing medi um near the re corded neuron wa s
collected using a standard recording p ipette to substitute
the cytoplasm as a media control, and double distilled
water substituted the cytoplasm was used as blank con-
trol, the same RT-PCR reactions were performed. Experi-
ment controls for single cell RT-PR are made at each
harvesting sess ion, only the data from experiments in
which both media control and blank control were nega-
tive could be taken into account, otherwise the cell
would be discarded [39,41].
Immunohistochemistry and laser confocal scanning of
recorded neurons
For subsequent immunofluorescence study of the
recorded cells, biocytin (0.2%) was added to internal solu-
tion. In the cells from which recordings had been made,
biocytin, nestin and ChAT were visualized by triple fluor-
escence: Rhodamine Red was the fluorescent label for bio-
cytin, cy2 for nestin-ir and Alexa 405 for ChAT-ir. After
whole-cell recording, the brain slices were fixed by immer-
sion in 4% paraformaldehyde in 0.1 M phosphate buffer,
pH 7.2, at 4°C for l-2 h, washed in 0.1 M phosphate buffer,
and cryoprotected by immersion in 30% buffered sucrose
at 4°C for several hours. The following day, serial sections
at 50 μm thickness were cut on a cryostat, and collected in
0.01 M phosphate-buffered saline (PBS). Sections were
washed (3 × 10 min) i n 0.01 M PBS followed by incuba-
tion in 1% bovine serum albumin (containing 0.3% Triton
X-100 in PBS) for 30 min to prevent non-specific conju-
gate bi nding. Sections were incubated with monoclonal
mouse anti-nestin antibody (1:800, Rat-401, Pharmingen)
and polyclonal rabbit anti-ChAT antibody (1:1000, Chemi-
con) for 2 h at 37°C and then for 14 h at 4° C. After a 3 ×
10 min rinse in PBS, the s ections were incubated in a
cocktail containing Rhodamine Red X-conjugated strepta-
vidin (1:5000, Jackson Immuno Research Laboratories), a
cy2-conjugated goat anti-mouse antibody ( 1:200, Jackson
Immuno Research Laboratories) and a Alexa 405-conju-
gated goat anti-rabbit antibody (2 μg/ml, Invitrogen) for 2
h at room temperature [42].
In control experiments, the primary antibodies were
omitted and, as expected, this resulted in the absence of
any cellular labelling. Additional controls were per-
formed by switching the fluorochromated immunorea-
gents related to the markers visualized by triple
fluorescence labelling procedures which resulted in
identical staining patterns.
Table 2 Primer sequences used in the experiment
mRNA Accession no.
a
primer sequence Start position
b
Product size
c
ChAT
(first round)
XM_001061520 CAGGAAGGTCGGGTGGACAACATC
TCCTTGGGTGCTGGTGGCTTG
1675
2198
524 bp
GAD
67
(first round)
NM_017007 TTTGGATATCATTGGTTTAGCTGGCGAAT
TTTTTGCCTCTAAATCAGCTGGAATTATCT
762
1162
401 bp
VGLUT
1
(first round)
NM_053859 TACTGGAGAAGCGGCAGGAAGG
CCAGAAAAAGGAGCCATGTATGAGG
188
498
311 bp
VGLUT
2
(first round)
NM_053427 CCCGCAAAGCATCCAACCA
TGAGAGTAGCCAACAACCAGAAGCA
1264
1682
419 bp
Nestin
(first round)
M34384 CTCGGGAGTGTCGCTTAGAG
ATTAGGCAAGGGGGAAGGGA
783
1216
434 bp
ChAT
(second round)
XM_001061520 ATGGCCATTGACAACCATCTTCTG
CCTTGAACTGCAGAGGTCTCTCAT
1840
2163
324 bp
GAD
67
(second round)
NM_017007 CTGACATCAACTGCCAATACCAA
GGAGAAAATATCCCATCACCATC
793
929
137 bp
VGLUT
1
(second round)
NM_053859 GTGGTGGACTGCACTTGCTT
CATGTATGAGGCCGACAGTCTC
274
484
211 bp
VGLUT
2
(second round)
NM_053427 CGCAAAGCATCCAACCAT
TGTGGGACCGCAGACAAC
1266
1529
264 bp
Nestin
(second round)
M34384 GGA GCA GGA GAA GCA AGG
GGT CCA GAA AGC CAA GAG
931
1115
185 bp
ChAT, choline acetyltransferase; GAD, glutamic acid decarboxylases; VGLUT, vesicular glutamate transporter.
a
The GenBank accession number for the cDNA
sequence used in primer design;
b
The cDNA position of the 5’’ end of primer;
c
Expected PCR product length.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 18 of 20
Page 19
All sections were then analyzed with the LSM 510
Meta (Zeiss). Nesti n-ir was observed with the blue FITC
filter; ChAT-ir was viewed with the DAPI filter; biocy-
tin-filled cell was viewed with the Rhodamine Red filter.
Confocal images were scanned, edited, reconstructed
and measured using LSM 510 Meta software (Zeiss).
Analyses of the projections of nestin+ and nestin-
cholinergic neurons
To demonstrate whether the nestin+ and nestin- choliner-
gic neurons projected to hippocampus, retrograde label-
ling combined with double immunostaining protocols
were used. Four rats were instilled with 0.5 μlof3%fast
blue dye into the CA1 area (AP-3.8, L 1.5, H 3.0) o f the
hippocampus. After a 5-d transport period, the experimen-
tal animals were sacrificed, immunofluorescence of nestin
and ChAT were performed with a standard protocols.
Rhodamine Red was the fluorescent label for ChAT-ir, cy2
for nestin-ir neurons [42]. The localization of fast blue in
nerve cell bodies of the MS/DBB area were observed,
counted, and analyzed. The e xperimental controls were
performed as described above.
Statistical analysis
All statistical analyses were performed with SPSS 11.5 for
Windows. Data were analyzed statistically using either the
students t-test, one-way ANOVA (post hoc multiple com-
parison by least-significant difference (LSD ) or Dunnetts
T3 test), or the K olmogorov-Smirnov test. Significance
level for all measures was set at P < 0 .05. Data are pre-
sented as means ± S.E.M (standard error of the mean). All
figures were prepared using CorelDraw 10.0 (Corel;
Ottawa) and Adobe Photoshop CS (Adobe; San Jose, CA).
Acknowledgements and Funding
We gratefully acknowledge the assistance of Monique David in manuscript
revision, Yongjun Chen, Pu Wang, QunFang Yuan and Yao Xie for their help
in experimental techniques. This work was supported by National Nature
Science Foundation of China (No. 30700436, 31160221), Doctoral Program of
Guangdong Natural Science Foundation (No. S2011040004372). The funders
had no role in study design, data collection and analysis, decision to publish,
or preparation of the manuscript.
Author details
1
Department of Anatomy and Neurobiology, Zhongshan School of Medicine,
Sun Yat-sen University, Guangzhou, China.
2
Department of Neurobiology,
Southern Medical University, Guangzhou, China.
Authors contributions
JHZ designed and carried out the study, performed the statistical analysis,
and drafted the manuscript. HYG participated in the design of the study,
performed the statistical analysis, and helped to draft the manuscript. ZBY
conceived the study, and participated in its design and coordination, and
helped to draft the manuscript. JTZ carried out the molecular genetic
studies, participated in the sequence alignment. KHG participated in the
immunohistochemistry and neuronal projection study. DPL participated in
the design of the study and performed the statistical analysis. TMG
participated in design and coordination of the study, and helped to draft
the manuscript. All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 26 August 2011 Accepted: 20 December 2011
Published: 20 December 2011
References
1. Colom LV: Septal networks: relevance to theta rhythm, epilepsy and
Alzheimers disease. Journal of neurochemistry 2006, 96(3):609-623.
2. Olton DS, Markowska A, Breckler SJ, Wenk GL, Pang KC, Koliatsos V:
Individual differences in aging: behavioral and neural analyses. Biomed
Environ Sci 1991, 4(1-2):166-172.
3. Sarter M, Bruno JP: Mild cognitive impairment and the cholinergic
hypothesis: a very different take on recent data. Ann Neurol 2002,
52(3):384-385.
4. Sotty F, Danik M, Manseau F, Laplante F, Quirion R, Williams S: Distinct
electrophysiological properties of glutamatergic, cholinergic and
GABAergic rat septohippocampal neurons: novel implications for
hippocampal rhythmicity. The Journal of physiology 2003, 551(Pt
3):927-943.
5. Colom LV, Castaneda MT, Reyna T, Hernandez S, Garrido-Sanabria E:
Characterization of medial septal glutamatergic neurons and their
projection to the hippocampus. Synapse (New York, NY) 2005,
58(3):151-164.
6. Manns ID, Mainville L, Jones BE: Evidence for glutamate, in addition to
acetylcholine and GABA, neurotransmitter synthesis in basal forebrain
neurons projecting to the entorhinal cortex. Neuroscience 2001,
107(2):249-263.
7. Gritti I, Manns ID, Mainville L, Jones BE: Parvalbumin, calbindin, or
calretinin in cortically projecting and GABAergic, cholinergic, or
glutamatergic basal forebrain neurons of the rat. The Journal of
comparative neurology 2003, 458(1):11-31.
8. Wang S, Yao Z, Wang J, Ai Y, Li D, Zhang Y, Mao J, Gu H, Ruan Y, Mao J:
Evidence for a distinct group of nestin-immunoreactive neurons within
the basal forebrain of adult rats. Neuroscience 2006, 142(4):1209-1219.
9. Senut MC, Menetrey D, Lamour Y: Cholinergic and peptidergic projections
from the medial septum and the nucleus of the diagonal band of Broca
to dorsal hippocampus, cingulate cortex and olfactory bulb: a combined
wheatgerm agglutinin-apohorseradish peroxidase-gold
immunohistochemical study. Neuroscience 1989, 30(2):385-403.
10. Semba K: Multiple output pathways of the basal forebrain: organization,
chemical heterogeneity, and roles in vigilance. Behavioural brain research
2000, 115(2):117-141.
11. Schliebs R, Arendt T: The significance of the cholinergic system in the
brain during aging and in Alzheimers disease. Journal of neural
transmission 2006, 113(11):1625-1644.
12. Griffith WH: Membrane properties of cell types within guinea pig basal
forebrain nuclei in vitro. Journal of neurophysiology 1988, 59(5):1590-1612.
13. Markram H, Segal M: Electrophysiological characteristics of cholinergic
and non-cholinergic neurons in the rat medial septum-diagonal band
complex. Brain research 1990, 513(1):171-174.
14. Gorelova N, Reiner PB: Role of the afterhyperpolarization in control of
discharge properties of septal cholinergic neurons in vitro. Journal of
neurophysiology 1996, 75(2):695-706.
15.
Alreja M, Wu M, Liu W, Atkins JB, Leranth C, Shanabrough M: Muscarinic
tone sustains impulse flow in the septohippocampal GABA but not
cholinergic pathway: implications for learning and memory. J Neurosci
2000, 20(21):8103-8110.
16. Huh CY, Goutagny R, Williams S: Glutamatergic neurons of the mouse
medial septum and diagonal band of Broca synaptically drive
hippocampal pyramidal cells: relevance for hippocampal theta rhythm. J
Neurosci 30(47):15951-15961.
17. Gilyarov AV: Nestin in central nervous system cells. Neuroscience and
behavioral physiology 2008, 38(2):165-169.
18. Mizuno Y, Ohama E, Hirato J, Nakazato Y, Takahashi H, Takatama M,
Takeuchi T, Okamoto K: Nestin immunoreactivity of Purkinje cells in
Creutzfeldt-Jakob disease. J Neurol Sci 2006, 246(1-2):131-137.
19. Gu H, Wang S, Messam CA, Yao Z: Distribution of nestin immunoreactivity
in the normal adult human forebrain. Brain research 2002, 943(2) :174-180.
20. Ruan YW, Wang JM, Gu HY: A cluster of nestin immunoreactive neurons
exist in basal forebrain of adult rats. Anat Res 2001, 23(1):35-38.
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 19 of 20
Page 20
21. Li D, Wang J, Yew DT, Lucy Forster E, Yao Z: Age-related alterations of
Nestin-immunoreactive neurons in rat basal forebrain with aged
memory deficit. Neurochemistry international 2008, 53(6-8):270-277.
22. Gritti I, Henny P, Galloni F, Mainville L, Mariotti M, Jones BE: Stereological
estimates of the basal forebrain cell population in the rat, including
neurons containing choline acetyltransferase, glutamic acid
decarboxylase or phosphate-activated glutaminase and colocalizing
vesicular glutamate transporters. Neuroscience 2006, 143(4):1051-1064.
23. Lappin SC, Randall AD, Gunthorpe MJ, Morisset V: TRPV1 antagonist, SB-
366791, inhibits glutamatergic synaptic transmission in rat spinal dorsal
horn following peripheral inflammation. European journal of pharmacology
2006, 540(1-3):73-81.
24. Momiyama T, Zaborszky L: Somatostatin presynaptically inhibits both
GABA and glutamate release onto rat basal forebrain cholinergic
neurons. Journal of neurophysiology 2006, 96(2):686-694.
25. Xu C, Datta S, Wu M, Alreja M: Hippocampal theta rhythm is reduced by
suppression of the H-current in septohippocampal GABAergic neurons.
The European journal of neuroscience 2004, 19(8):2299-2309.
26. Amaral DG, Kurz J: An analysis of the origins of the cholinergic and
noncholinergic septal projections to the hippocampal formation of the
rat. The Journal of comparative neurology 1985, 240(1):37-59.
27. Baisden RH, Woodruff ML, Hoover DB: Cholinergic and non-cholinergic
septo-hippocampal projections: a double-label horseradish peroxidase-
acetylcholinesterase study in the rabbit. Brain research 1984,
290(1):146-151.
28. Kuo LT, Simpson A, Schanzer A, Tse J, An SF, Scaravilli F, Groves MJ: Effects
of systemically administered NT-3 on sensory neuron loss and nestin
expression following axotomy. The Journal of comparative neurology 2005,
482(4):320-332.
29. Shaughnessy LW, Mundy WR, Tilson HA, Barone S Jr: Time course of
changes in cholinergic and neurotrophin-related markers after infusion
of colchicine into the basal forebrain. Brain research 1998, 781(1-2):61-76.
30. Zhou LB, Ruan YW, Yao ZB: The Effect of Colchicine on the Nestin - IR
Neurons in the Rat Basal Forebrain. Progress of Anatomical Sciences 2003,
9(2):105-108.
31. Mu JS, Li WP, Yao ZB, Zhou XF: Deprivation of endogenous brain-derived
neurotrophic factor results in impairment of spatial learning and
memory in adult rats. Brain research 1999, 835(2):259-265.
32. Morris NP, Henderson Z: Perineuronal nets ensheath fast spiking,
parvalbumin-immunoreactive neurons in the medial septum/diagonal
band complex. The European journal of neuroscience 2000, 12(3):828-838.
33. Garrido-Sanabria ER, Perez MG, Banuelos C, Reyna T, Hernandez S,
Castaneda MT, Colom LV: Electrophysiological and morphological
heterogeneity of slow firing neurons in medial septal/diagonal band
complex as revealed by cluster analysis. Neuroscience 2007,
146(3):931-945.
34. Henderson Z, Morris NP, Grimwood P, Fiddler G, Yang HW, Appenteng K:
Morphology of local axon collaterals of electrophysiologically
characterised neurons in the rat medial septal/ diagonal band complex.
The Journal of comparative neurology 2001, 430(3)
:410-432.
35. Fuenzalida M, Aliaga E, Olivares V, Roncagliolo M, Bonansco C:
Developmental increase of asynchronic glutamate release from
hippocampal synapses in mutant taiep rat. Synapse (New York, NY 2009,
63(6):502-509.
36. Hsia AY, Malenka RC, Nicoll RA: Development of excitatory circuitry in the
hippocampus. Journal of neurophysiology 1998, 79(4):2013-2024.
37. Groc L, Gustafsson B, Hanse E: Early establishment of multiple release site
connectivity between interneurons and pyramidal neurons in the
developing hippocampus. The European journal of neuroscience 2003,
17(9):1873-1880.
38. Lambolez B, Audinat E, Bochet P, Crepel F, Rossier J: AMPA receptor
subunits expressed by single Purkinje cells. Neuron 1992, 9(2):247-258.
39. Cauli B, Audinat E, Lambolez B, Angulo MC, Ropert N, Tsuzuki K, Hestrin S,
Rossier J: Molecular and physiological diversity of cortical nonpyramidal
cells. J Neurosci 1997, 17(10):3894-3906.
40. ODowd DK, Gee JR, Smith MA: Sodium current density correlates with
expression of specific alternatively spliced sodium channel mRNAs in
single neurons. J Neurosci 1995, 15(5 Pt 2):4005-4012.
41. Smith MA, ODowd DK: Cell-specific regulation of agrin RNA splicing in
the chick ciliary ganglion. Neuron 1994, 12(4):795-804.
42. Hartig W, Reichenbach A, Voigt C, Boltze J, Bulavina L, Schuhmann MU,
Seeger J, Schusser GF, Freytag C, Grosche J: Triple fluorescence labelling
of neuronal, glial and vascular markers revealing pathological alterations
in various animal models. Journal of chemical neuroanatomy 2009,
37(2):128-138.
doi:10.1186/1471-2202-12-129
Cite this article as: Zhu et al.: The nestin-expressing and non-expressing
neurons in rat basal forebrain display different electrophysiological
properties and project to hippocampus. BMC Neuroscience 2011 12:129.
Submit your next manuscript to BioMed Central
and take full advantage of:
Convenient online submission
Thorough peer review
No space constraints or color figure charges
Immediate publication on acceptance
Inclusion in PubMed, CAS, Scopus and Google Scholar
Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Zhu et al. BMC Neuroscience 2011, 12:129
http://www.biomedcentral.com/1471-2202/12/129
Page 20 of 20
Page 21
  • Source
    • "Similar to previous studies, our results demonstrate that about 35% of ChAT+ neurons within the MS/dB co-express nestin. As shown by Zhu et al. (2011), these nestin-expressing cholinergic neurons are mature neurons that have a higher excitability and receive stronger spontaneous excitatory synaptic inputs than ChAT+ neurons that do not express nestin (ChAT+/nestin−). Stronger spontaneous excitatory activity of ChAT+/nestin+ neurons can result in higher synaptic transmission efficacy. "
    [Show abstract] [Hide abstract] ABSTRACT: Exercise has been shown to improve cognitive functioning in a range of species, presumably through an increase in neurotrophins throughout the brain, but in particular the hippocampus. The current study assessed the ability of exercise to restore septohippocampal cholinergic functioning in the pyrithiamine-induced thiamine deficiency (PTD) rat model of the amnestic disorder Korsakoff Syndrome. After voluntary wheel running or sedentary control conditions (stationary wheel attached to the home cage), PTD and control rats were behaviorally tested with concurrent in vivo microdialysis, at one of two time points: 24-h or 2-weeks post-exercise. It was found that only after the 2-week adaption period did exercise lead to an interrelated sequence of events in PTD rats that included: (1) restored spatial working memory; (2) rescued behaviorally-stimulated hippocampal acetylcholine efflux; and (3) within the medial septum/diagonal band, the re-emergence of the cholinergic (choline acetyltransferase [ChAT +]) phenotype, with the greatest change occurring in the ChAT +/nestin + neurons. Furthermore, in control rats, exercise followed by a 2-week adaption period improved hippocampal acetylcholine efflux and increased the number of neurons co-expressing the ChAT and nestin phenotype. These findings demonstrate a novel mechanism by which exercise can modulate the mature cholinergic/nestin neuronal phenotype leading to improved neurotransmitter function as well as enhanced learning and memory.
    Full-text · Article · Jan 2016 · Experimental Neurology
  • [Show abstract] [Hide abstract] ABSTRACT: Nestin(+) neurons have been shown to express choline acetyltransferase (ChAT) in the medial septum-diagonal band of Broca in adult rats. This study explored the projection of nestin(+) neurons to the olfactory bulb and the time course of nestin(+) neurons in the medial septum-diagonal band of Broca in adult rats during injury recovery after olfactory nerve transection. This study observed that all nestin(+) neurons were double-labeled with ChAT in the medial septum-diagonal band of Broca. Approximately 53.6% of nestin(+) neurons were projected to the olfactory bulb and co-labeled with fast blue. A large number of nestin(+) neurons were not present in each region of the medial septum-diagonal band of Broca. Nestin(+) neurons in the medial septum and vertical limb of the diagonal band of Broca showed obvious compensatory function. The number of nestin(+) neurons decreased to a minimum later than nestin(-)/ChAT(+) neurons in the medial septum-diagonal band of Broca. The results suggest that nestin(+) cholinergic neurons may have a closer connection to olfactory bulb neurons. Nestin(+) cholinergic neurons may have a stronger tolerance to injury than Nestin(-)/ChAT(+) neurons. The difference between nestin(+) and nestin(-)/ChAT(+) neurons during the recovery process requires further investigations.
    No preview · Article · Feb 2014 · Neural Regeneration Research