Suppression of interferon-α signaling by hepatitis E virus

Article (PDF Available)inHepatology 55(5):1324-32 · May 2012with44 Reads
DOI: 10.1002/hep.25530 · Source: PubMed
Abstract
Unlabelled: The interferon (IFN) system is integral to the host response against viruses, and many viruses have developed strategies to overcome its antiviral effects. The effects of hepatitis E virus (HEV), the causative agent of hepatitis E, on IFN signaling have not been investigated primarily because of the nonavailability of an efficient in vitro culture system or small animal models of infection. We report here the generation of A549 cell lines persistently infected with genotype 3 HEV, designated as HEV-A549 cells and the effects HEV has on IFN-α-mediated Janus kinase-signal transducer and activator of transcription (JAK-STAT) signaling. Treatment of HEV-A549 cells with 250, 500, and 1000 U/mL of IFN-α for 72 hours showed a dose-dependent reduction in HEV RNA levels by 10%, 20%, and 50%, respectively. IFN-α-stimulated genes coding for the antiviral proteins dsRNA-activated protein kinase (PKR) and 2',5'-oligoadenylate synthetase (2',5'-OAS) were down-regulated in IFN-α-treated HEV-A549 cells. HEV infection also prevented IFN-α-induced phosphorylation of STAT1. Regulation of STAT1 by HEV was specific, as phosphorylation of STAT2, tyrosine kinase (Tyk) 2, and Jak1 by IFN-α was unaltered. Additionally, STAT1 levels were markedly increased in HEV-A549 cells compared with naive A549 cells. Furthermore, binding of HEV open reading frame (ORF)3 protein to STAT1 in HEV-A549 cells was observed. HEV ORF3 protein alone inhibited IFN-α-induced phosphorylation of STAT1 and down-regulated the IFN-α-stimulated genes encoding PKR, 2',5'-OAS, and myxovirus resistance A. Conclusion: HEV inhibits IFN-α signaling through the regulation of STAT1 phosphorylation in A549 cells. These findings have implications for the development of new strategies against hepatitis E.
Suppression of Interferon-a Signaling by
Hepatitis E Virus
Chen Dong,
1,2
Mohammad Zafrullah,
1
Tonya Mixson-Hayden,
1
Xing Dai,
1
Jiuhong Liang,
2
Jihong Meng,
1,2
and Saleem Kamili
1
The interferon (IFN) system is integral to the host response against viruses, and many
viruses have developed strategies to overcome its antiviral effects. The effects of hepatitis E
virus (HEV), the causative agent of hepatitis E, on IFN signaling have not been investi-
gated primarily because of the nonavailability of an efficient in vitro culture system or
small animal models of infection. We report here the generation of A549 cell lines persis-
tently infected with genotype 3 HEV, designated as HEV-A549 cells and the effects HEV
has on IFN-a–mediated Janus kinase–signal transducer and activator of transcription
(JAK–STAT) signaling. Treatment of H EV-A549 cells with 250, 500, and 1000 U/mL of
IFN-a for 72 hours showed a dose-dependent reduction in HEV RNA levels by 10%, 20%,
and 50%, respectively. IFN-a–stimulated genes coding for the antiviral proteins dsRNA-acti-
vated protein kinase (PKR) and 2
0
,5
0
-oligoadenylate synthetase (2
0
,5
0
-OAS) were down-
regulated in IFN-atreated HEV-A549 cells. HEV infection also prevented IFN-a–induced
phosphorylation of STAT1. Regulation of STAT1 by HEV was specific, as phosphorylation
of STAT2, tyrosine kinase (Tyk) 2, and Jak1 by IFN-a was unaltered. Additionally, STAT1
levels were markedly increased in HEV-A549 cells compared with naive A549 cells. Further-
more, binding of HEV open reading frame (ORF)3 protein to STAT1 in HEV-A549 cells
was observed. HEV ORF3 protein alone inhibited IFN-a–induced phosphorylation of
STAT1 and down-regulated the IFN-a–stimulated genes encoding PKR, 2
0
,5
0
-OAS, and
myxovirus resistance A. Conclusion: HEV inhibits IFN-a signaling through the regulation of
STAT1 phosphorylation in A549 cells. These findings have implications for the develop-
ment of new strategies against hepatitis E. (H
EPATOLOGY 2012;55:1324-1332)
T
he interferon system is an important compo-
nent of the host response against viruses.
1,2
Acute viral infection of susceptible host cells
initiates a type I interferon (IFN) response that is
composed predominantly of interferon-a and -b (IFN-
a/b) signaling through the IFN-a receptor. IFN-a/b
receptor binding results in receptor subunit dimeriza-
tion and activation through tyrosine phosphorylation
of two tyrosine kinases of the Janus family, Janus ki-
nase 1(Jak1) and tyrosine kinase 2 (Tyk2), which then
phosphorylate signal transducer and activator of tran-
scription (STAT) 1 and STAT2 on a single tyrosine
residue, leading to STAT1–STAT2 heterotrimerization
with interferon regulatory factor (IRF) 9 followed by
nuclear localization.
1
In the nucleus these proteins
serve to transactivate the interferon-stimulated response
element (ISRE) found in the promoter of interferon-
stimulated genes (ISGs). A number of these ISGs
encode the antiviral proteins, the best known of which
include myxovirus resistance A (MxA), the double-
stranded RNA-activated protein kinase (PKR), and the
2
0
,5
0
-oligoadenylate synthetase (2
0
,5
0
-OAS).
1,2
Viruses
have evolved different mechanisms to inhibit type I
IFN response and block various aspects of the signal-
ing pathway, thus escaping the host immune response
and causing infection.
Abbreviations: BSA, bovine serum albumin; CPE, cytopathic effect; DMEM, Dulbecco’s modified Eagle’s medium; EDTA, ethylene diamine tetraacetic acid;
EF1A, eukaryotic translation elongation factor 1a; FBS, fetal bovine serum; HBV, hepatitis B virus; HEV, hepatitis E virus; hMPV, human metapneumovirus;
IFA, immunofluorescence assay; IFN, interferon; IPS-1, interferon promoter stimulator 1; IRF, interferon regulatory factor; ISG, interferon-stimulated gene; ISRE,
interferon-stimulated response element; JAK, Janus kinase; Tyk, tyrosine kinase; MAPK, mitogen-activated protein kinase; MxA, myxovirus resistance A; NCR,
noncoding region; OAS, 2
0
,5
0
-oligoadenylate synthetase; ORF, open reading frame; PBS, phosphate-buffered saline; RT-PCR, polymerase chain reaction; PKR,
double-stranded (ds)RNA–activated protein kinase; pY, phosphotyrosin; PMSF, phenylmethylsulfonyl fluoride; RSV, respiratory syncytial virus; SDS-PAGE, sodium
dodecyl sulfate polyacrylamide gel electrophoresis; STAT, signal transducer and activator of transcription.
From the
1
Division of Viral Hepatitis, Centers for Disease Control and Prevention, Atlanta, GA; and the
2
School of Medicine, Southeast University, Nanjing, China.
Received July 15, 2011; accepted November 2, 2011.
1324
Hepatitis E, caused by hepatitis E virus (HEV), is an
emerging public health problem in both developing and
developed countries. Hepatitis E mostly manifests as a
self-limiting, icteric hepatitis in most individuals. How-
ever, substantially high mortality rates of as much as
20% are observed in pregnant women.
3
Furthermore,
organ transplant recipients, as well as human immuno-
deficiency virus (HIV)-infected and other immunocom-
promised individuals, run the risk of developing chronic
liver disease when infected with HEV.
4
Tr eatm en t o f
chronically infected patients with pegylated interferon-
a2a/a2b or ribavirin for 3-12 months has been shown
to achieve a sustained virological response for 3-6
months after completion of the therapy.
5,6
HEV is a nonenveloped virus with a single positive-
sense RNA genome of approximately 7.2 kb and is
classified in the Hepevirus genus within the family
Hepeviridae.
3
The viral RNA consists of a short 5
0
noncoding region (NCR), three open reading frames
(ORFs), and a 3
0
NCR. A cap structure has been iden-
tified at the 5
0
end of the viral genome, which may
play a role in the initiation of HEV replication.
7
ORF1, located at the 5
0
end of the genome, encodes
nonstructural polyproteins that are involved in viral
replication.
8,9
ORF2, located at the 3
0
end of the ge-
nome, encodes the viral capsid protein, which plays an
important role in viral immune response.
10
ORF3 enc-
odes a cytoskeleton-associated phosphoprotein
11
that is
responsible for virion egress from infected cells and is
essential for virus infectivity in vivo, although it is not
required for virus infection in vitro.
12
Viruses have been reported to influence the IFN
regulatory pathway,
13,14
but effects of HEV on IFN
signaling have not been studied so far because of the
lack of an efficient HEV cell culture system or a small
animal model of infection. Propagation and produc-
tion of HEV in vitro have been attempted in many
cell lines, but culturing HEV has proven to be diffi-
cult.
15
Recently, successful propagation of HEV in
A549 cells, a human lung adenocarcinoma epithelial
cell line, was reported.
15,16
In this study, we describe
the generation of an A549 cell line (HEV-A549) per-
sistently infected with the genotype 3 HEV strain.
Using this cell line, we investigated whether HEV
inhibits IFN-a signaling.
Materials and Methods
Viral Stock, Antibodies, and Chemicals. Stool
specimens previously collected from a kidney trans-
plant patient chronically infected with HEV genotype
3 strain were stored in our laboratory (GenBank acces-
sion number: JN837481). Stool suspensions were pre-
pared in 0.01 M phosphate-buffered saline (PBS; 10%
[wt/vol]). The suspension was centrifuged at 10,000g
at 4
C for 20 minutes, and supernatants were filtered
through 0.22-lm filters (Millipore, Billerica, MA); af-
ter clarification, they were aliquoted and stored at
80
C. The HEV RNA level pooled from these virus
stocks was determined to be 6.28 10
6
copies/mL.
The generation of a monoclonal antibody, 5G5, which
was raised in mice by inoculation of HEV ORF2 pro-
teins expressed in E. coli, has been described previously.
17
Mouse polyclonal antibody to HEV ORF3 protein was
purchased from Abbiotec, LLC (San Diego, CA). Mouse
monoclonal antibody to b-actin and STAT1, and rabbit
polyclonal antibodies to STAT2, Jak1, Tyk2, phosphotyr-
osin 701-STAT1 (pY-STAT1), phosphotyrosin 690-
STAT2 (pY-STAT2), phosphotyrosin 1022/1023-J ak1
(pY-Jak1), and phosphotyrosin 1054/1055-Tyk2 (pY-
Tyk2) were purchased from Cell Signaling Technology
(Danvers, MA). Recombinant human IFN-a was pur-
chased from Invitrogen (Carlsbad, CA).
Cell Culture and Virus Infection. Virus infection
was carried out as previously described with slight
modifications.
16
The A549 cells were maintained in
Dulbeccos modified Eagles medium (DMEM) con-
taining 10% fetal bovine serum (FBS), penicillin (100
U/mL), and streptomycin (100 lg/mL) at 37
C, 5%
CO
2
, and 100% relative humidity. For virus infection,
monolayers of confluent A549 cells in a 25-cm
2
flask
were washed three times with PBS and inoculated with
0.5 mL of stool suspension containing 3.14 10
6
cop-
ies of HEV RNA that had been diluted with PBS con-
taining 0.2% (wt/vol) bovine serum albumin (BSA) and
filtered through a 0.22-lm filter. After inoculation, the
cells were incubated at room temperature for 1 hour and
the medium was replaced with 6 mL of maintenance
medium, which contained DMEM with 2% FBS and
30 mM MgCl
2
, other supplements being the same as
those in the growth medium. All cultures were per-
formed at 37
C in a humidified 5% CO
2
atmosphere.
Address reprint requests to: Jihong Meng, M.D., Ph.D. or Saleem Kamili, Ph.D., Division of Viral Hepatitis, Centers for Disease Control and Prevention, 1600
Clifton Rd, NE, Atlanta, GA 30333. E-mail: jihongmeng@163.com; and E-mail: skamili@cdc.gov; fax: 404-639-1378.
Copyright
V
C
2011 by the American Association for the Study of Liver Diseases.
View this article online at wileyonlinelibrary.com.
DOI 10.1002/hep.25530
Potential conflict of interest: Nothing to report.
HEPATOLOGY, Vol. 55, No. 5, 2012 DONG ET AL. 1325
One day after inoculation, the cells were washed five
times with PBS, and 6 mL of maintenance medium
was added. Subsequently, 3 mL of the culture medium
was replaced with fresh maintenance medium every
other day, and harvested media were stored at 80
C.
The infected cells were examined daily for specific cyto-
pathic effect (CPE). For passaging, one flask of HEV-
infected A549 cells, designated hereafter as HEV-A549,
were split into three flasks and maintained as described
above. Up to eight passages were made with HEV-
A549 cells. The harvested media were stored at 80
C.
Detection of HEV RNA: Real-Time RT-PCR. The
levels of HEV RNA were determined by a real-time
reverse transcriptase-polymerase chain reaction (RT-
PCR) assay, already described, with slight modifica-
tions.
18
Briefly, total RNA was extracted from 100 lL
of stool suspension or culture medium, which was
then subjected to real-time RT-PCR with the One-
Step Platinum qRT-PCR kit (Invitrogen) using a sense
primer (5
0
- ACCCTGTTTAATCTTGCTGA
TAC-3
0
), an antisense primer (5
0
-ACAGTCGGCTCG
CCAT TGG-3
0
), and a probe (5
0
-FAM-CCGACA
GAATTGATTTCGTCGGC-BHQ-3
0
) on the Mx3005
Real-Time PCR System (Agilent Technologies, Santa
Clara, CA). The thermal cycling conditions were 50
C
for 30 minutes, 95
C for 15 minutes, and 50 cycles of
94
C for 15 seconds, 56
C for 30 seconds, and 72
C
for 30 seconds.
Detection of HEV Proteins: Immunofluorescence
Assay (IFA). Briefly, monolayer cultures of A549 cells
and HEV-A549 cells were fixed with 100% methanol for
2 hours, and then incubated with HEV ORF2 monoclo-
nal antibody 5G5 at 37
C for 1 hour. After three washes
with PBS, cells were incubated for 1 hour at 37
Cwith
an Alexa Fluor 488–conjugated goat anti-mouse antibody
(Invitrogen). After extensive washing with PBS, cells were
viewed with an epifluorescence microscope (Axiovert
200, Carl Zeiss, Germany). Images were acquired with
an Axiocam MRc5 camera (Carl Zeiss).
Treatment of HEV-A549 Cells With IFN-a. The
effects of IFN-a on the replication of HEV in the
HEV-A549 cells were examined in the presence of dif-
ferent concentrations of IFN-a (10, 50, 100, 250,
500, and 1000 U/mL). Various concentrations of
IFN-a were added to the HEV-A549 cell culture su-
pernatant containing approximately 4.16 10
4
HEV-
RNA copies/mL. After 72 hours of treatment, the lev-
els of HEV RNA were quantitated by RT-PCR as
described above. All samples were assayed in triplicate.
Detection of IFN-a–induced Gene Expressio-
n. IFN-a–induced gene expression levels were quanti-
tated by real-time RT-PCR according to the methods
described, with slight modifications.
19
In brief, total
RNA was isolated using the MagNA Pure LC (Roche
Applied Science, Indianapolis, IN) and subsequently
treated with deoxyribonuclease I (Roche Applied Sci-
ence). RNA integrity was assessed using an ND-1000
spectrophotometer (Thermo Scientific, Wilmington,
DE), and then subjected to real-time RT-PCR with
the following Human SYBR Green QuantiTect Primer
Assays (Qiagen, Valencia, CA): double-stranded RNA-
activated protein kinase (PKR, no. QT00022960),
MXA (no. QT00090895), and OAS1 (no.
QT00099134). Reactions were set up in 96-well plates
using the Mx3005 Real-Time PCR System. All sam-
ples were assayed in triplicate. The endogenous control
genes eukaryotic translation elongation factor 1a
(EF1A; no. QT01669934) and b-glucuronidase (no.
QT00371623; Human SYBR Green QuantiTect
Primer Assays, Qiagen) were used to normalize expres-
sion levels of target genes.
Immunoprecipitation and Immunoblotting. Im-
munoblotting was performed as described.
20
For total
protein extracts, cells were washed three times with
ice-cold PBS and scraped from culture dishes in the
presence of NP40 lysis buffer (25 mM Tris-HCl, pH
7.5, 137 mM NaCl, 1% NP40, 2 mM ethylene dia-
mine tetraacetic acid [EDTA], 1 mM phenylmethylsul-
fonyl fluoride [PMSF], 5 mM NaVO
4
, 10% glycerol)
supplemented with protease inhibitor cocktail (Roche
Applied Science). Equal amounts of protein extracts
(50 lg) were run on 10% sodium dodecyl sulfate
(SDS) polyacrylamide gel and transferred to a nitrocel-
lulose membrane (Bio-Rad Laboratories Inc, Hercules,
CA). The nonspecific antibody-binding sites were
blocked with 5% nonfat milk in TBS-T (25 mM Tris,
0.8% NaCl, and 2.68 mM KCl [pH 7.4], with 0.1%
Tween 20) before addition of the primary antibody.
The blots were then treated with a horseradish peroxi-
dase–conjugated secondary antibody (KPL Inc, Gai-
thersburg, MA) and developed with an ECL system
(GE Healthcare Life Science, Piscataway, NJ). For
reblotting, the membrane was washed with stripping so-
lution (Thermo-Scientific) for 15 minutes at room tem-
perature. The membrane was then blocked with 5%
nonfat milk in TBS-T for 1 hour, followed by treat-
ment with the primary antibody. For immunoprecipita-
tion, 400 lg of total protein was incubated with 100
ng of mouse anti-STAT1 monoclonal antibody over-
night at 4
C. Protein complexes were precipitated with
the protein A/G Plus Agarose (Santa Cruz Biotechnol-
ogy, Santa Cruz, CA) for 2 hours at 4
C. Immunopre-
cipitates were washed three times with NP-40 lysis
buffer and boiled in 2X SDS sample buffer. Proteins
1326 DONG ET AL. HEPATOLOGY, May 2012
were separated by SDS-polyacrylamide gel electrophore-
sis (PAGE) followed by immunoblotting analysis.
Plasmid Construction and Transfection Experi-
ments. Full-length HEV ORF3 was amplified from
the same stool suspension containing HEV genotype
3, as described above, using a sense primer 5
0
-GACGA
CGACAAGATGGGATCACCATGCGCC-3
0
and an
antisense primer 5
0
-GAGGAGAAGCCCGGTCAG
CGGCGCAGCCCCAG-3
0
and cloned into pTriEx-4
vector by using the pTriEx-4 EK/LIC Vector kit (Nova-
gen, San Diego, CA). Transfection experiments were con-
ducted in monolayers of A549 cells grown in 6-well plates
to 50%-70% confluency. The cells were transfected with
either HEV ORF3 construct, designated pTriEx-4/ORF3,
or control plasmid, pTriEx-4, using 1 lgofDNAand3
lL FuGENE 6 Transfection Reagent (Roche Applied Sci-
ence, Indianapolis, IN). Twenty-four hours after transfec-
tion, the cells transfected with pTriEx-4 and pTriEx-4/
ORF3 vector were induced with IFN-a (1000 U/mL) for
15 or 30 minutes or left untreated, respectively. Relative
gene expression levels and protein levels were examined by
real-time PCR and immunoblotting as described above.
Statistics. Results of experiments with IFN were
expressed as mean 6 standard deviation of three inde-
pendent experiments. For statistical comparison, signif-
icance was evaluated using Student t test.
Results
Infection of A549 Cells With HEV. As shown in
Fig. 1A, HEV RNA appeared in the culture medium
of A549 cells inoculated with HEV genotype 3 stool
suspension containing 3.14 10
6
copies of HEV
RNA on day 40 after inoculation. The levels of HEV
RNA in the culture medium were 1.98 10
2
copies/
mL; these levels continued to increase thereafter, reach-
ing a maximum level of 4.35 10
5
copies/mL on day
100 after inoculation. No CPE was observed in HEV-
A549 cells. To determine whether HEV was stably
generated from HEV-A549 cells, the cells were split
for subsequent passage at a ratio of 1:3 when HEV
RNA reached the peak titer of 4.35 10
5
copies/mL
in culture medium. Figure 1B illustrates that HEV
RNA could be detected in the culture medium har-
vested from HEV-A549 cells at the second passage.
The viral titers were maintained at approximately 3-4
10
4
copies/mL up to the 16
th
day of passage. IFA
showed that ORF2 protein was detectable in the cyto-
plasm of the HEV-A549 cells (Fig. 1C,D).
Effect of IFN-a on HEV. HEV-A549 cells generat-
ing an HEV RNA titer of 4.16 10
4
copies/mL into
the culture medium were treated with increasing con-
centrations of human IFN-a (10, 50, 100, 250, 500,
and 1000 U/mL). As shown in Fig, 2, the average
reduction rates (as a percentage of the rate of the con-
trol) of the HEV RNA in culture supernatants were
only about 10%, 20%, and 50% in the presence of
IFN-a at concentrations of 250, 500, and 1000 U/mL,
respectively, after 72 hours of incubation. Lower doses
of IFN-a (10, 50, and 100 U/mL) did not result in
any appreciable reduction in HEV RNA levels (data
not shown). Furthermore, subsequent experiments
Fig. 1. Infection of A549 cells
with HEV. (A,B) Quantitation of HEV
RNA in culture supernatants of
A549 cells inoculated with fecal
supernatant (3.14 10
6
copies
HEV RNA) (A) or in culture medium
of passaged HEV-infected A549
cells (B). Values are means of
duplicate determinations. (C,D) Im-
munofluorescence analysis of HEV
ORF2 protein (green) in the unin-
fected A549 cells (C) and HEV-
A549 cells at the second passage
(D). Magnification: 400.
HEPATOLOGY, Vol. 55, No. 5, 2012 DONG ET AL. 1327
showed that HEV replication was not completely inhib-
ited by IFN-a even at a concentration of 5000 U/mL
(approximately 50% reduction, data not shown).
HEV Down-regulates IFN-a–induced Gene
Expression. To investigate how HEV resists IFN-a
mediated responses, three IFN-stimulated response ele-
ment–controlled cellular genes, PKR, MxA, and 2
0
,5
0
-
OAS, were analyzed by real-time PCR in both HEV-
A549 cells and A549 cells with and without IFN-a.In
the absence of stimulation by IFN-a, no significant
difference was found in the expression of any of these
genes in A549 cells compared with HEV-A549 cells
(Fig. 3). Addition of IFN-a resulted in a significant
induction of PKR (126-fold increase) and 2
0
,5
0
-OAS
(20-fold). Similarly, an increase in induction of PKR
and 2
0
,5
0
-OSA was obser ved after IFN-a treatment of
HEV-A549 cells that was significantly weaker than
observed in A549 cells (P < 0.005). The difference in
activation of MxA was not significant between A549
cells and HEV-A549 cells with and without IFN-a
treatment.
HEV Blocks IFN-a–induced STAT1 Phosphoryla-
tion. Many viruses inhibit IFN-a signaling by interfer-
ing with the normal activities of STAT1 in the Jak/
STAT signal transduction pathway.
21
Therefore,
steady-state protein level and phosphorylation of
STAT1 in response to IFN-a in uninfected A549 cells
were determined and compared with HEV-infected
HEV-A549 cells. As shown in Fig. 4, STAT1 levels
were markedly increased in HEV-A549 cells compared
with A549 cells. Furthermore, IFN-a induced a rapid
STAT1 phosphorylation in A549 cells, as assessed by
immunoblotting with a phospho-STAT1–specific anti-
body. STAT1 phosphorylation was detectable 15
minutes after addition of IFN-a and was further
increased at 30 minutes, but was not detectable in
uninfected, IFN-a–untreated A549 cells. In contrast,
the levels of tyrosine phosphorylated STAT1 were dra-
matically reduced in IFN-a–treated HEV-A549 cells
compared with uninfected A549 cells.
Effect of HEV on Phosphorylation of STAT2,
Tyk2, and Jak1. To determine whether events
upstream of STAT1 phosphorylation are altered during
HEV infection, STAT2, Tyk2, and Jak1 were evaluated
for abundance and phosphorylation. Immunoblot anal-
ysis showed there was no significant difference in
STAT2 levels between A549 cells and HEV-A549 cells.
Although very low levels of phosphorylated STAT2
were detectable in unstimulated A549 cells, infection
with HEV or stimulation with IFN-a for 15 minutes
significantly increased levels of phosphorylated STAT2
(Fig. 5). Furthermore, phosphorylated STAT2 was
readily detectable in IFN-a–stimulated and HEV-A549
cells, indicating that in contrast to STAT1, HEV infec-
tion in A549 cells did not prevent STAT2 phosphoryl-
ation. To assess whether HEV can alter Tyk2 or Jak1
phosphorylation, immunoblotting with phospho-
Tyk2– or phospho-Jak1–specific antibodies was
performed. Naive A549 cells not treated with IFN-a
displayed a basal level of phosphorylation of both
Tyk2 and Jak1 (Fig. 5). However, stimulation with
IFN-a for 15 or 30 minutes was sufficient to induce
Fig. 2. Resistance of HEV to the antiviral effects of IFN-a. HEV-
A549 cells (producing 4.16 10
4
copies/mL of the HEV RNA in cell
culture medium) were treated with increasing concentrations of human
IFN-a (250, 500, and 1000 U/mL) for 72 hours. Data from the
experiments obtained from cells between the third and eighth pas-
sages are shown.
Fig. 3. HEV inhibition of IFN-a–stimulated genes. Both A549 cells
and HEV-549 cells were treated for 8 hours with 1000 U/mL IFN-a
(þ), or were left untreated (). Expression of the IFN-a–stimulated
genes PKR, 2
0
,5
0
-OAS, and MxA was measured by real-time reverse
transcription PCR. All samples were measured in triplicate. Data from
the experiments obtained from cells between third and eighth pas-
sages are shown. IFN-a–elicited transcriptional induction of two target
genes (PKR and 2
0
,5
0
-OAS) is inhibited in HEV-A549 cells compared
with uninfected A549 cells (P < 0.005).
1328 DONG ET AL. HEPATOLOGY, May 2012
increased phosphorylation of both proteins. The phos-
phorylation of Tyk2 or Jak1 by IFN-a was not inhib-
ited by HEV infection in HEV-A549 cells.
Binding of HEV ORF3 Protein to STAT1 in
HEV-A549 Cells. To investigate the possible mecha-
nism of inhibition of STAT1 phosphorylation in
HEV-infected A549 cells, HEV-A549 cell lysates (400
lg of total protein) were immunoprecipitated with the
anti-STAT1 monoclonal antibody and analyzed by im-
munoblotting with anti-ORF2 or anti-ORF3 antibod-
ies. As controls, HEV ORF2 and ORF3 proteins were
analyzed on immunoblots without immunoprecipita-
tion by anti-STAT1 antibody. As shown in Fig. 6,
ORF3 protein but not ORF2 protein was detected in
immunoprecipitated STAT1, indicating that the ORF3
protein could bind to STAT1 in HEV-infected A549
cells.
HEV ORF3 Protein Blocks IFN-a–induced
STAT1 Phosphorylation and Down-regulates IFN-
a–induced Gene Expression. To investigate whether
HEV ORF3 alone can block IFN-a–induced STAT1
phosphorylation and its effect on IFN-a–stimulated
genes, A549 cells were transfected with either pTriEx-
4 or pTriEx-4/ORF3 vector. As shown in Fig. 7A,
STAT1 phosphorylation was inhibited in IFN-a
treated pTrix-4/ORF3–transfected cells, but not in
pTriEx-4 vector–transfected A549 cells. However,
there was no significant difference in STAT1 levels
between A549 cells transfected with either pTriEx-4
or pTriEx-4/ORF3 vector. Moreover, three IFN-a
stimulated genes, PKR, MxA, and 2
0
,5
0
-OAS, were
analyzed by real-time PCR in A549 cells transfected
with pTriEx-4 or pTriEx-4/ORF3 vector with and
without IFN-a.AsshowninFig.7B,allthreetarget
genes, PKR, 2
0
,5
0
-OAS, and MxA, were inhibited
in pTriEx-4/ORF3–transfected A549 cells compared
with the cells transfected with pTriEx-4 vector
(P < 0.01).
Discussion
Although hepatocytes are recognized as the main
sites of HEV replication, the detection of a replicative
strand of HEV RNA in cell types other than liver cells
shows that the extrahepatic replication of HEV does
occur. In experimentally infected SPF pigs, HEV RNA
has been detected by RT-PCR in peripheral blood,
feces, bile, and numerous tissues including liver, mes-
enteric lymph nodes, stomach, spleen, and lung.
22
In
naturally infected pigs, evidence of HEV replication
can be detected in liver, lymph nodes, spleen, tonsils,
kidney, and small and large intestines by immunohis-
tochemistry and in situ hybridization.
23
Propagation of
HEV in the human lung epithelial A549 cells was
recently reported.
16
In the present study we generated
an HEV-A549 cell line that could stably excrete HEV
Fig. 4. Inhibition of IFN-a–induced tyrosine phosphorylation of
STAT1 by HEV. Uninfected A549 cells and HEV-A549 cells were treated
with 1000 U/mL IFN-a for 15 and 30 minutes or left untreated. Equal
amounts (50 lg) of cell lysates were separated by SDS gel electro-
phoresis, transferred onto nitrocellulose membranes, and examined
with antibodies to phosphotyrosine STAT1 and STAT1. b-Actin levels
served as a loading control. Lower doses of IFN-a, 10, 50, and 100
U/mL, did not induce STAT1 phosphorylation in A549 cells (data not
shown).
Fig. 5. Effect of HEV infection on phopshorylation of STAT2, Jak1,
and Tyk2 in response to IFN-a treatment. Data from the experiments
obtained from cells between the third and eighth passages are shown.
Both A549 cells and HEV-A549 cells were stimulated with IFN-a
(1000 U/mL) for 15 or 30 minutes or left untreated. The protein lev-
els of phosphorylated (P-) and total (T-) STAT2, Jak1, and Tyk2 levels
and b-actin were measured by immunoblotting.
HEPATOLOGY, Vol. 55, No. 5, 2012 DONG ET AL. 1329
in cell culture supernatant, and using this cell culture
system, we have demonstrated that the IFN-induced
JAK–STAT signaling pathway is inhibited during HEV
infection.
It is believed that most, if not all, viruses have the
ability to attenuate the IFN response during infection
to ensure that the virus has sufficient time to success-
fully replicate, be packaged in, and released from host
cells.
24
Previous studies have reported that hepatitis A,
B, C, and D viruses use various strategies to inhibit
IFN-a–stimulated host defense mechanisms. Hepatitis
A virus protein 2B suppresses IFN-b gene transcription
by interfering with IFN regulatory factor 3 activa-
tion.
25,26
Hepatitis B virus (HBV) suppresses IFN-a
response by the inhibition of STAT1 methylation.
27
Moreover, the HBV regulatory protein HBx can bind
to adaptor protein interferon promoter stimulator 1
(IPS-1) and inhibit the activation of IFN-b.
28
A num-
ber of reports indicate that the hepatitis C virus core,
NS3 and NS5A proteins impair IFN responses
through blocking different aspects of the IFN-a signal
pathway.
29-32
Hepatitis D virus has also been shown to
have the ability to block the IFN-a signal pathway
in vitro.
19
However, the effects of HEV on IFN-a sig-
naling have not been investigated so far. By generating
HEV-A549 cells, we report here that, during replica-
tion in A549 cells, HEV suppressed IFN-a–stimulated
gene activation (PKR and 2
0
,5
0
-OSA). Moreover, HEV
replication was not completely inhibited by IFN- a
treatment in vitro, and IFN-a–mediated phosphoryla-
tion of STAT1 was prevented by HEV in A549 cells.
Further investigation of the upstream signaling compo-
nents in the IFN-a signal cascade revealed that the
ability of Tyk2, Jak1, and STAT2 to be phosphoryl-
ated in response to IFN-a stimulation was not affected
by HEV infection. These results suggest that HEV was
able to abolish type I IFN signaling through mecha-
nisms regulating STAT1 phosphorylation.
The exact mechanism by which HEV inhibits JAK–
STAT signaling is not yet known. Previous studies
showed that some viral proteins, such as Nipah virus
V and W proteins and Rinderpest virus P and C pro-
teins, can bind to STAT1 or STAT2 and thus inhibit
the type I IFN signaling pathway.
21,33,34
In our study,
coimmunoprecipitation with anti-STAT1 antibody fol-
lowed by immunoblotting with HEV anti-ORF3 or
ORF2 antibody, showed that ORF3 protein, but not
ORF2 protein, could bind to STAT1 in HEV-A549
cells. HEV ORF3 protein has the ability to optimize
the cellular environment for viral infection and replica-
tion by interacting with multiple cellular proteins
involved in signal transduction, such as
mitogen-activated protein kinase (MAPK) phosphatase,
CIN85, a-1-microglobulin, and bikunin precursor
protein.
7,11,35-37
In this study, our transfection experi-
ments with HEV ORF3 showed that the STAT1 phos-
phorylation and IFN-a–stimulated genes PKR, 2
0
,5
0
-
OAS, and MxA were inhibited in the IFN-a–treated
A549 cells. It is thus reasonable to conclude that the
binding of HEV ORF3 protein to STAT1 inhibits
STAT1 phosphorylation and then suppresses the
expression of IFN-a–stimulated genes. Furthermore,
we observed some differences in the inhibition pattern
of IFN-a–stimulated genes when HEV ORF3 alone
Fig. 6. HEV ORF3 but not ORF2 interact with STAT1. Both A549 cells and HEV-A549 cells were stimulated with IFN-a (1000 U/mL) for 15 or
30 minutes or left untreated. Data from the experiments obtained from cells between the third and eighth passages are shown. (A) Whole-cell
lysates immunoprocipitated with anti-STAT1 antibody following immunoblot analysis with anti-ORF2, anti-ORF3, anti-STAT1, and anti-b-actin anti-
body, respectively. (B) Whole-cell lysates subjected to immunoblot analysis with anti-ORF2, anti-ORF3, anti-STAT1, and anti-b-actin antibody,
respectively.
1330 DONG ET AL. HEPATOLOGY, May 2012
was used compared with the whole virus infection of
A549 cells. The expression of target gene MxA was
inhibited in HEV ORF3-transfected cells but not in
HEV-infected A549 cells and the increased levels of
STAT1 were observed in HEV-infected A549 cells but
not in HEV ORF3-transfected cells. Further studies
are needed to determine more definitively the precise
mechanism of IFN signaling inhibition in HEV
infection.
An intriguing finding was the increased levels of
STAT1 during HEV infe ction. Such increased levels
of STAT proteins during viral infection have recently
been shown by other RNA viruses, s uch as human
metapneumovirus (hMPV ) and respiratory syncytial
virus (RSV).
38,39
It is unclear what mechanisms
caused these increased levels and what biological rele-
vance, if any, the increased STAT levels may have in
viral infections. One potential explanation could be
that expression of the STATs is up-regulated in
response to HEV infection in an IFN-independent
manner. V iruses have been shown to up-regulate ISGs
insuchamannerbyactivationofIRF3.
40
Acompo-
ne nt of the HEV v irion could be recognized by a
pathogen-associated molecular pattern receptor, which
then causes STAT protein levels to be increased with-
out dependence on IFN, as previously demonstrated
in hantavirus infection.
41
Alternatively, the increased
levels of STAT1 could be due to the reduction of
normal degradation of STAT1. Because the STAT
proteins have a relatively long biological half-life of 2
or 3 days,
42
the increased levels shown here may be
attributed to a gradual build-up of STAT1 during the
course of our experiments.
In conclusion, the data from our study show that
IFN-a signal pathway plays an important role in
HEV replication in host cells, and point to the role
of type I IFN and STAT1 in protecting the host cells
from HEV infection. Moreover, HEV ORF3 protein
alone has the ability to i nhib it STAT1 phosphoryla-
tion and to reduce IFN-a–stimul ated gene exp ress ion.
An understanding of the precise mechanisms of how
HEV i nhibits the IFN-a signaling pathway will be
important for designing better antiviral strategies
against hepatitis E.
Acknowledgment: We thank Jan Drobeniuc, Tracy
Greene-Montforte, and Ngoc-Thao Le for their assis-
tance with this study.
References
1. Stark GR, Kerr IM, Williams BRG, Silverman RH, Schreiber RD. How
cells respond to interferons. Annu Rev Biochem 1998;67:227-264.
2. Weber F, Kochs G, Haller O. Inverse interference: how viruses fight the
interferon system. Viral Immunol 2004;17:498-515.
3. Emerson SU, Purcell RH. Hepatitis E virus. In: Knipe DM, Howley
PM, Griffin DE, Lamb RA, Martin MA, Roizman B, et al., eds. Fields
Virology. 5th ed. Philadelphia: Lippincott Williams & Wilkins;
2006:3047-3058.
4. Kamar N, Selves J, Mansuy JM, Ouezzani L, Peron JM, Guitard J,
et al. Hepatitis E virus and chronic hepatitis in organ-transplant recipi-
ents. N Engl J Med 2008;358:811-817.
5. Kamar N, Rostaing L, Abravanel F, Garrouste C, Esposito L, Cardeau-
Desangles I, et al. Pegylated interferon-alpha for treating chronic hepa-
titis E virus infection after liver transplantation. Clin Infect Dis 2010;
50:e30-e33.
Fig. 7. (A) HEV ORF3 protein blocks IFN-a–induced STAT1 phospho-
rylation. pTriEx-4 and pTriEx-4/ORF3 plasmid-transfected A549 cells
were treated with 1000 U/mL IFN-a for 15 and 30 minutes or left
untreated. Equal amounts (50 lg) of cell lysates were separated by
SDS gel electrophoresis, transferred onto nitrocellulose membranes,
and examined with antibodies to phosphotyrosine STAT1, STAT1, and
HEV ORF3 protein, respectively. b-Actin levels served as a loading con-
trol. (B) HEV ORF3 protein inhibition of IFN-a–stimulated genes. pTriEx-
4 and pTriEx-4/ORF3 plasmid-transfected A549 cells were treated for
8 hours with 1000 U/mL IFN-a (þ), or were left untreated ().
Expression of the IFN-a–stimulated genes PKR, 2
0
,5
0
-OAS, and MxA
were measured by real-time reverse transcription PCR. All samples
were measured in triplicate. The IFN-a–stimulated genes PKR, 2
0
,5
0
-
OAS, and MxA were inhibited in A549 cells transfected with pTriEx-4/
ORF3 plasmid compared with the cells transfected with pTriEx-4 vector
(P < 0.01).
HEPATOLOGY, Vol. 55, No. 5, 2012 DONG ET AL. 1331
6. Kamar N, Rostaing L, Abravanel F, Garrouste C, Lhomme S, Esposito L,
et al. Ribavirin therapy inhibits viral replication on patients with chronic
hepatitis E virus infection. Gastroenterology 2010;139:1612-1618.
7. Ahmad I, Holla RP, Jameel S. Molecular virology of hepatitis E virus.
Virus Res 2011;161:47-58.
8. Karpe YA, Lole KS. NTPase and 5
0
to 3
0
RNA duplex-unwinding
activities of the hepatitis E virus helicase domain. J Virol 2010;84:
3595-3602.
9. Neuvonen M, Ahola T. Differential activities of cellular and viral macro
domain proteins in binding of ADP-ribose metabolites. J Mol Biol
2009;385:212-225.
10. Meng JH, Dai X, Chang JC, Lopareva E, Pillot J, Fields HA, et al.
Identification and characterization of the neutralization epitope(s) of
hepatitis E virus. Virology 2001;288:203-211.
11. Zafrullah M, Ozdener MH, Panda SK, Jameel S. The ORF3 protein
of hepatitis E virus is a phosphoprotein that associates with the cyto-
skeleton. J Virol 1997;71:9045-9053.
12. Nagashima S, Takahashi M, Jirintai D, Tanaka T, Yamada K, Nishizawa
T, et al. A PSAP motif in the ORF3 protein of hepatitis E virus is neces-
sary for virion release from infected cells. J Gen Virol 2011;92:269-278.
13. Levy DE, Garcı
´
a-Sastre A. The virus battles: IFN induction of the anti-
viral state and mechanisms of viral evasion. Cytokine Growth Factor
Rev 2001;12:143-156.
14. Cebulla CM, Miller DM, Sedmak DD. Viral inhibition of interferon
signal transduction. Intervirology 1999;42:325-330.
15. Okamoto H. Hepatitis E virus cell culture models. Virus Res 2011;
161:65-77.
16. Takahashi M, Tanaka T, Takahashi H, Hoshino Y, Nagashima S, Jirin-
tai MH, et al. Hepatitis E virus (HEV) strains in serum samples can
replicate efficiently in cultured cells despite the coexistence of HEV
antibodies: characterization of HEV virions in blood circulation. J Clin
Microbiol 2010;48:1112-1125.
17. Zhang HM, Dai X, Shan XN, Meng JH. Characterization of antigenic
epitopes of the ORF2 protein from hepatitis E virus genotype 4. Virus
Res 2009;142:140-143.
18. Gyarmati P, Mohammed N, Norder H, Blomberg J, Belak S, Widen F.
Universal detection of hepatitis E virus by two real-time PCR assays:
TaqMan and Primer-Probe Energy Transfer. J Virol Methods 2007;
146:226-235.
19. Pugnale P, Pazienza V, Guilloux K, Negro F. Hepatitis delta virus inhib-
its alpha interferon signaling. H
EPATOLOGY 2009;49:398-406.
20. Ramaswamy M, Shi L, Varga SM, Barik S, Behlke MA, Look DC.
Respiratory syncytical virus nonstructural protein 2 specifically inhibits
type I interferon signal transduction. Virology 2006;344:328-339.
21. Shaw ML, Garcı
´
a-Sastre A, Palese P, Basler CF. Nipah virus V and W
proteins have a common STAT1-binding domain yet inhibit STAT1
activation from the cytoplasmic and nuclear compartments, respectively.
J Virol 2004;78:5633-5641.
22. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette
DK, Toth TE, et al. Evidence of extrahepatic sites of replication of the
hepatitis E virus in a swine model. J Clin Microbiol 2001;39:
3040-3046.
23. Choi C, Chae C. Localization of swine hepatitis E virus in liver and ex-
trahepatic tissues from naturally infected pigs by in situ hybridization. J
Hepatol 2003;38:827-832.
24. Katze MG, He YP, Gale M Jr. Viruses and interferon: a fight for su-
premacy. Nat Rev Immunol 2002;2:675-687.
25. Paulmann D, Magulski T, Schwarz R, Heitmann L, Flehmig B, Vall-
bracht A, et al. Hepatitis A virus protein 2B suppresses beta interferon
(IFN) gene transcription by interfering with IFN regulatory factor 3
activation. J Gen Virol 2008;89:1593-1604.
26. Fensterl V, Grotheer D, Berk I, Schlemminger S, Vallbracht A, Dotza-
uer A. Hepatitis A virus suppresses RIG-I-mediated IRF-3 activation to
block induction of beta interferon. J Virol 2005;79:10968-10977.
27. Li J, Chen F, Zheng M, Zhu H, Zhao D, Liu W, et al. Inhibition of
STAT1 methylation is involved in the resistance of hepatitis B virus to
interferon alpha. Antiviral Res 2010;85:463-469.
28. Kumar M, Jung SY, Hodgson AJ, Madden CR, Qin J, Slagle BL. Hep-
atitis B virus regulatory HBx protein binds to adaptor protein IPS-1
and inhibits the activation of beta interferon. J Virol 2011;85:987-995.
29. Lin W, Kim SS, Yeung E, Kamegaya Y, Blackard JT, Kim KA, et al.
Hepatitis C virus core protein blocks interferon signaling by interaction
with the STAT1 SH2 domain. J Virol 2006;80:9226-9235.
30. Cheng G, Zhong J, Chisari FV. Inhibition of dsRNA-induced signaling
in hepatitis C virus-infected cells by NS3 protease-dependent and -in-
dependent mechanisms. Proc Natl Acad Sci U S A 2006;103:
8499-8504.
31. Lan KH, Lan KL, Lee WP, Sheu ML, Chen MY, Lee YL, et al. HCV
NS5A inhibits interferon-alpha signaling through suppression of
STAT1 phosphorylation in hepatocyte-derived cell lines. J Hepatol
2007;46:759-767.
32. Horner SM, Gale M Jr. Intracellular innate immune cascades and inter-
feron defenses that control hepatitis C virus. J Interferon Cytokine Res
2009;29:489-498.
33. Nanda SK, Baron MD. Rinderpest virus blocks type I and type II
interferon action: role of structural and nonstructural proteins. J Virol
2006;80:7555-7568.
34. Boxer EL, Nanda SK, Baron MD. The rinderpest virus nonstructural
C protein blocks the induction of type 1 interferon. Virology 2009;
385:134-142.
35. Chandra V, Kalia M, Hajela K, Jameel S. The ORF3 protein of hepati-
tis E virus delays degradation of activated growth factor receptors by
interacting with CIN85 and blocking formation of the Cbl–CIN85
complex. J Virol 2010;84:3857-3867.
36. Tyagi S, Surjit M, Lal SK. The 41-amino-acid C-terminal region of the
hepatitis E virus ORF3 protein interacts with bikunin, a kunitz-type
serine protease inhibitor. J Virol 2005;79:12081-12087.
37. Tyagi S, Surjit M, Roy AK, Jameel S, Lal SK. The ORF3 protein of
hepatitis E virus interacts with liver-specific alpha1-microglobulin and
its precursor alpha1-microglobulin/bikunin precursor (AMBP) and
expedites their export from the hepatocyte. J Biol Chem 2004;279:
29308-29319.
38. Dinwiddie DL, Harrod KS. Human metapneumovirus inhibits IFN-
alpha signaling through inhibition of STAT1 phosphorylation. Am J
Respir Cell Mol Biol 2008;38:661-670.
39. Ramaswamy M, Shi L, Monick MM, Hunninghake GW, Look DC.
Specific inhibition of type I interferon signal transduction by respira-
tory syncytial virus. Am J Respir Cell Mol Biol 2004;30:893-900.
40. Bao X, Liu T, Spetch L, Kolli D, Garofalo RP, Casola A. Airway epi-
thelial cell response to human metapneumovirus infection. Virology
2007;368:91-101.
41. Prescott J, Ye C, Sen G, Hjelle B. Induction of innate immune
response genes by Sin Nombre hantavirus does not require viral replica-
tion. J Virol 2005;79:15007-15015.
42. Horvath CM. Weapons of STAT destruction. Interferon evasion by
paramyxovirus V protein. Eur J Biochem 2004;271:4621-4628.
1332 DONG ET AL. HEPATOLOGY, May 2012
    • "Interestingly, there is a genotype difference in the enhancement of RIG-I: genotypes 1 and 3 VP13 but not genotypes 2 and 4 VP13 have the role, implicating that VP13 may relate to HEV virulence and pathogenesis. On the other hand, another study demonstrate that VP13 of a genotype 3 HEV strain is able to interact with the STAT1 (signal transducer and activator of transcription) to inhibit interferon-α mediated signaling in A549 (human lung adenocarcinoma epithelial cell line; Dong et al., 2012). In summary, as the product of the smallest ORF of HEV, VP13 has multiple functions and plays an indispensable role in infectivity in experimentally infected animal models. "
    [Show abstract] [Hide abstract] ABSTRACT: Hepatitis E virus (HEV) is a viral pathogen transmitted primarily via fecal-oral route. In humans, HEV mainly causes acute hepatitis and is responsible for large outbreaks of hepatitis across the world. The case fatality rate of HEV-induced hepatitis ranges from 0.5 to 3% in young adults and up to 30% in infected pregnant women. HEV strains infecting humans are classified into four genotypes. HEV strains from genotypes 3 and 4 are zoonotic, whereas those from genotypes 1 and 2 have no known animal reservoirs. Recently, notable progress has been accomplished for better understanding of HEV biology and infection, such as chronic HEV infection, in vitro cell culture system, quasi-enveloped HEV virions, functions of the HEV proteins, mechanism of HEV antagonizing host innate immunity, HEV pathogenesis and vaccine development. However, further investigation on the cross-species HEV infection, host tropism, vaccine efficacy, and HEV-specific antiviral strategy is still needed. This review mainly focuses on molecular biology and infection of HEV and offers perspective new insight of this enigmatic virus.
    Full-text · Article · Sep 2016
    • "However, HEV has developed mechanisms to suppress IFN-α signaling. In vitro studies on A549 human lung epithelial cells [57] and Huh7 hepatocarcinoma cells [58] indicate that IFN-induced phosphorylation of signal transducer and activator of transcription STAT1 can be inhibited by the ORF3 protein, leading to a down regulation of two key antiviral proteins, dsRNA-activated protein kinase and 2 1 ,5 1 -oligoadenylate synthetase. Nan et al., working on HEK293T cells, showed that ORF3 protein enhanced type I IFN production by interacting directly with the pattern recognition receptor (PRR) retinoic acid-inducible gene I (RIG-I) [59]. "
    [Show abstract] [Hide abstract] ABSTRACT: Although most hepatitis E virus (HEV) infections are asymptomatic, some can be severe, causing fulminant hepatitis and extra-hepatic manifestations, including neurological and kidney injuries. Chronic HEV infections may also occur in immunocompromised patients. This review describes how our understanding of the pathogenesis of HEV infection has progressed in recent years.
    Article · Aug 2016
    • "Ruddell et al. [60] have suggested that ferritin acts as a cytokine regulating proinflammatory function via NF-jB-regulated signaling in hepatic stellate cells. HEV infection induces synthesis of pro-inflammatory chemokines, cytokines, and type 1 interferons in A549 cells (lung epithelial cell line) [61, 62]. TNF-a and IL-1b exposure can modulate iron uptake and ferritin synthesis in these cells [63]. "
    [Show abstract] [Hide abstract] ABSTRACT: Hepatitis E Virus (HEV) is the major causative agent of acute hepatitis in developing countries. Its genome has three open reading frames (ORFs)—called as ORF1, ORF2, and ORF3. ORF1 encodes nonstructural polyprotein having multiple domains, namely: Methyltransferase, Y domain, Protease, Macro domain, Helicase, and RNA-dependent RNA polymerase. In the present study, we show that HEV-macro domain specifically interacts with light chain subunit of human ferritin (FTL). In cultured hepatoma cells, HEV-macro domain reduces secretion of ferritin without causing any change in the expression levels of FTL. This inhibitory effect was further enhanced upon Brefeldin-A treatment. The levels of transferrin Receptor 1 or ferroportin, two important proteins in iron metabolism, remained unchanged in HEV-macro domain expressing cells. Similarly, there were no alterations in the levels of cellular labile iron pool and reactive oxygen species, indicating that HEV-macro domain does not influence cellular iron homeostasis/metabolism. As ferritin is an acute-phase protein, secreted in higher level in infected persons and HEV-macro domain has the property of reducing synthesis of inflammatory cytokines, we propose that by directly binding to FTL, macro domain prevents ferritin from entering into circulation and helps in further attenuation of the host immune response.
    Article · May 2016
Show more

Recommended publications

Discover more