Cells Lacking Rieske Iron-Sulfur Protein Have a Reactive Oxygen Species-Associated Decrease in Respiratory Complexes I and IV

Department of Neurology, University of Miami, Miller School of Medicine, Miami, Florida, USA.
Molecular and Cellular Biology (Impact Factor: 4.78). 11/2011; 32(2):415-29. DOI: 10.1128/MCB.06051-11
Source: PubMed
ABSTRACT
Mitochondrial respiratory complexes of the electron transport chain (CI, CIII, and CIV) can be assembled into larger structures
forming supercomplexes. We analyzed the assembly/stability of respiratory complexes in mouse lung fibroblasts lacking the
Rieske iron-sulfur protein (RISP knockout [KO]cells), one of the catalytic subunits of CIII. In the absence of RISP, most
of the remaining CIII subunits were able to assemble into a large precomplex that lacked enzymatic activity. CI, CIV, and
supercomplexes were decreased in the RISP-deficient cells. Reintroduction of RISP into KO cells restored CIII activity and
increased the levels of active CI, CIV, and supercomplexes. We found that hypoxia (1% O2) resulted in increased levels of CI, CIV, and supercomplex assembly in RISP KO cells. In addition, treatment of control cells
with different oxidative phosphorylation (OXPHOS) inhibitors showed that compounds known to generate reactive oxygen species
(ROS) (e.g., antimycin A and oligomycin) had a negative impact on CI and supercomplex levels. Accordingly, a superoxide dismutase
(SOD) mimetic compound and SOD2 overexpression provided a partial increase in supercomplex levels in the RISP KO cells. Our
data suggest that the stability of CI, CIV, and supercomplexes is regulated by ROS in the context of defective oxidative phosphorylation.

Full-text

Available from: Francisca Diaz
Cells Lacking Rieske Iron-Sulfur Protein Have a Reactive Oxygen
Species-Associated Decrease in Respiratory Complexes I and IV
Francisca Diaz,
a
José Antonio Enríquez,
b,c
and Carlos T. Moraes
a
Department of Neurology, University of Miami, Miller School of Medicine, Miami, Florida, USA
a
; Centro National de Investigaciones Cardiovasculares Carlos III, Melchor
Fernández Almagro, Madrid, Spain
b
; and Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Pedro Cerbuna,
Zaragoza, Spain
c
Mitochondrial respiratory complexes of the electron transport chain (CI, CIII, and CIV) can be assembled into larger structures
forming supercomplexes. We analyzed the assembly/stability of respiratory complexes in mouse lung fibroblasts lacking the
Rieske iron-sulfur protein (RISP knockout [KO]cells), one of the catalytic subunits of CIII. In the absence of RISP, most of the
remaining CIII subunits were able to assemble into a large precomplex that lacked enzymatic activity. CI, CIV, and supercom-
plexes were decreased in the RISP-deficient cells. Reintroduction of RISP into KO cells restored CIII activity and increased the
levels of active CI, CIV, and supercomplexes. We found that hypoxia (1% O
2
) resulted in increased levels of CI, CIV, and super-
complex assembly in RISP KO cells. In addition, treatment of control cells with different oxidative phosphorylation (OXPHOS)
inhibitors showed that compounds known to generate reactive oxygen species (ROS) (e.g., antimycin A and oligomycin) had a
negative impact on CI and supercomplex levels. Accordingly, a superoxide dismutase (SOD) mimetic compound and SOD2 over-
expression provided a partial increase in supercomplex levels in the RISP KO cells. Our data suggest that the stability of CI, CIV,
and supercomplexes is regulated by ROS in the context of defective oxidative phosphorylation.
T
he Rieske iron-sulfur protein (RISP) is one of the catalytic
subunits of ubiquinol-cytochrome c oxidoreductase, also
known as complex III (CIII), from the electron transport chain
(ETC). CIII contains two other catalytic subunits, cytochrome b
and cytochrome c
1
. The active enzyme is a homodimer that cata-
lyzes the transfer of electrons from ubiquinol (coenzyme Q) to
cytochrome c in a bifurcated mechanism mediated by RISP (62).
In the last few years, structural evidence indicates that the
mitochondrial complexes of the oxidative phosphorylation
(OXPHOS) system interact with each other to form supramolecu-
lar structures in the inner mitochondrial membrane named su-
percomplexes. Their association into megacomplexes was pro-
posed to form a functional unit known as the “respirasome” (7,
60, 69). Because the electron transport chain is one of the major
contributors to free radicals in the cell, respirasomes could mini-
mize the generation of reactive oxygen species (ROS) by allowing
a more efficient electron transfer and substrate channeling among
the complexes, therefore avoiding the diffusion of reactive inter-
mediates (29, 42).
Supercomplex assemblies have been observed in a wide variety
of organisms, including bacteria, plants, fungi, and mammals, al-
though their composition might vary from organism to organism.
Mammalian supercomplexes are composed mainly by CI, CIII,
and CIV in different stoichiometries (I/III, I/III
2
,I
2
III
2
, I/III/IV,
I/III
2
/IV, I/III/IV
2
, III/IV, and III
2
/IV
1-2
) (58, 69). Recently, Acin-
Perez et al. (2) investigated the composition and functionality of
the different mammalian supercomplexes. The authors showed
that some of these structures contained coenzyme Q and cyto-
chrome c. Moreover, they demonstrated that some supercom-
plexes were able to “respire” by transferring electrons from
NADH to oxygen (2).
Ultimately, the capacity to form supercomplexes arrangements
relies on the stability of its components. Respiratory complex in-
terdependence has been observed in numerous cases. Generally,
CI appears to be the most labile complex of the electron transport
chain. Cells with defects in CIII or CIV assembly have decreased
levels of CI (1, 17, 20, 43), whereas cells lacking cytochrome c
showed defects in CIV and CI (64). Likewise, defects in CV have
been associated with defects in CIII and CIV in both yeast and
mammalian cells (55, 59).
In the last few years, studies have attempted to elucidate the
role of deranged mitochondrial supercomplexes and their patho-
physiological significance in disease conditions. Alterations in the
supramolecular architecture of OXPHOS complexes have been
observed in the rat cortex during aging, and decreased respira-
some levels have been reported in animal models of severe heart
failure (26, 54). Whether these alterations result in significant
physiological changes is still unclear.
Here, we analyzed CIII assembly and supercomplex formation
in mouse fibroblasts deficient in RISP and uncovered a ROS-
dependent mechanism mediating decreases in CI, CIV, and super-
complexes.
MATERIALS AND METHODS
Cell culture. A primary culture lung fibroblast line was produced from a
knock-in mouse homozygous for the floxed UQCRFS1 gene (exon 2)
encoding the Rieske iron-sulfur protein (RISP) (28). The introduction of
loxP sites into the gene did not interfere with RISP function, since the CIII
activities from tissues derived from wild-type or floxed mice were com-
parable. Cells were grown at 37°C in a 5% CO
2
atmosphere in high-
glucose Dulbecco’s modified Eagle’s medium containing 10% fetal bovine
serum, gentamicin, fungizone, 1 mM pyruvate, and 50
g/ml uridine. The
Received 3 August 2011 Returned for modification 1 September 2011
Accepted 10 November 2011
Published ahead of print 21 November 2011
Address correspondence to Francisca Diaz, FDiaz1@med.miami.edu.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/MCB.06051-11
0270-7306/12/$12.00 Molecular and Cellular Biology p. 415– 429 mcb.asm.org 415
Page 1
derived cell line was immortalized by transduction with a G418-resistant
retrovirus expressing E6/E7 oncogenes of type 6 papillomavirus (kindly
provided by E. Shoubridge, McGill University) (45), and G418-resistant
clones were obtained by ring cloning. These immortalized cell lines con-
taining the floxed gene were used as control cell lines from which knock-
out (KO) cells were derived. To ablate the floxed UQCRFS1 gene, one of
the immortalized clones was transfected with a hygromycin-resistant
plasmid expressing P1 Cre recombinase (kindly provided by J. Marth,
University of California San Diego). The control cell lines used in this
study, referred to as clones 8 and 14, contained the floxed UQCRFS1 gene,
whereas the knockout cells deficient in RISP were derived from clone 8
and are referred to as clones 8.2, 8.4, 8.5, and 8.17.
Multiplex PCR. Cre-mediated recombination was determined by
multiplex PCR using 3 primers allowing the simultaneous amplification
of the floxed, wild-type, and deletion alleles, as shown in Fig. 1A. The
primer sequences were as follows: (i) forward, 5=TTCCCTCCTCAGGCT
TCACTTGAC3=; (ii) reverse, 5=GATTGGGAAGACAATAGCAGGCAT
G3=; and (iii) reverse, 5=TTGGCTAGAGAGTAAAATTCAGTCTT3=. The
relative positions and orientations of the primers are depicted in Fig. 1A
by arrows.
Mitochondrial preparation and enzyme activities. Mitochondria
were obtained from 8 confluent T-75 flasks by nitrogen cavitation as de-
scribed previously (20) and used for determination of the enzyme activi-
ties of different respiratory complexes and citrate synthase as described
previously (3). Total cell respiration was determined by polarography
with a Clark oxygen electrode (Hansatech Instruments, Norfolk, United
Kingdom) as described in reference 20.
Protein determination. Protein concentrations were determined us-
ing bovine serum albumin as the standard and either the Bradford or the
bicinchoninic acid (BCA) (detergent-compatible) protein assay kit from
Bio-Rad and Pierce, respectively.
BNGE. To identify individual respiratory complexes, mitochondrial
preparations were treated with lauryl maltoside (Sigma) and separated by
blue native gel electrophoresis (BNGE) in 4 to 13% acrylamide gradient
gels (8, 19). For Western blot analysis, amounts of about 10 to 25
gof
proteins were separated, transferred to polyvinylidene difluoride (PVDF)
membrane (Bio-Rad), and immunodecorated sequentially with antibod-
ies against several subunits of the different mitochondrial respiratory
complexes. For in-gel activity assays, amounts of about 40
g of proteins
were separated by BNGE and gels were incubated with solutions contain-
ing the respective substrates for complex I or IV as described before (19).
For supercomplex analysis, mitochondrial preparations were treated
with digitonin (Calbiochem) at a detergent-to-protein ratio of 8:1 (wt/wt)
FIG 1 Ablation of RISP leads to CIII deficiency. (A) Diagram shows the floxed allele containing 3 loxP sites (triangles) flanking exon 2 of the UQCRFS1 gene
(encoding RISP) and a selection cassette (TK/Neo) present in the knock-in mouse, the deletion allele obtained after Cre recombination, and the wild-type allele.
(B) Efficiency of recombination of the floxed gene. Knockout clones only showed the band corresponding to the deletion allele by multiplex PCR (primers shown
in panel A by arrows), indicating complete recombination. The wild-type (WT) allele was amplified from skin fibroblasts from a wild-type mouse. (C) Enzymatic
activities of CIII, CIV, and citrate synthase (CS) determined spectrophotometrically. Values represent the means and standard deviations of specific activities.
Statistical significance is shown by an asterisk (P 0.05). (D) Western blot of mitochondrial proteins and OXPHOS complex subunits (CI, NDUFA9; CIII,
Core1, Core2, and RISP; and CIV, Cox1). VDAC1 and Tim23 were used as mitochondrial loading controls.
Diaz et al.
416 mcb.asm.org Molecular and Cellular Biology
Page 2
as described previously (20). Proteins (25
g) were separated by BNGE in
3 to 12% precast blue native gels (Invitrogen).
For analysis of respiratory complexes by 2 dimensional (2D) BNGE,
BN gel strips from the first dimension corresponding to each lane were
excised and treated with 1% SDS, 1%
-mercaptoethanol for 10 min, then
with 1% SDS for 5 min, and overlaid on a 10% SDS-acrylamide gel with a
4% stacking gel (20). Proteins were separated in the second dimension,
transferred to PVDF membranes, and blotted sequentially with different
antibodies.
For experiments that included different cell treatments (pharmaco-
logical inhibition or normoxia/hypoxia conditions), a digitonin-enriched
mitochondrial fraction was obtained by resuspending 2 10
6
cells in 200
l phosphate-buffered saline (PBS) containing protease inhibitors and
adding 70
l of 8 mg/ml digitonin (Sigma) for 10 min on ice. Subse-
quently, samples were diluted with 1 ml PBS and centrifuged at 21,000
g for 5 min. Membranes were washed with PBS, and pellets were either
stored at 80°C until needed or resuspended in 100
l of 1.5 M amino-
caproic acid, 50 mM Bis-Tris (pH 7.0) buffer (8). Supercomplexes were
extracted from these preparations with highly purified digitonin (Calbi-
ochem) in an 8:1 ratio (detergent to protein), and proteins were separated
by BNGE (20).
Western blotting. Mitochondrial samples were separated by either
SDS-PAGE in 4 to 20% acrylamide gradient gels (Bio-Rad) or by BNGE
and 2D-BNGE and transferred to PVDF membranes. Membranes were
blocked with 5% nonfat dry milk in PBS– 0.1% Tween 20 and then blotted
with specific primary antibodies. Secondary antibodies conjugated to
horseradish peroxidase (Cell Signaling) were used, and the reaction was
detected by chemiluminescence using SuperSignal West reagent (Pierce,
Rockford, IL) or RapidStep ECL reagent (EMD).
The following antibodies were used to identify individual respiratory
complexes: complex I, NDUFA9 and NDUFS3 (Mitosciences); complex
II, SDHA (succinate dehydrogenase subunit A) flavoprotein (Molecular
Probes); complex III, Core1, Core2 (Mitosciences), and Rieske iron-
sulfur protein (Molecular Probes); complex IV, Cox1 (Mitosciences); and
complex V, ATP synthase
(Molecular Probes). Additionally, premade
antibody cocktails from Mitosciences specific for BNGE (NDUFA9,
SDHA, Core2, Cox IV, and ATPase
) or for SDS-PAGE (NDUFB8,
SDHB [succinate dehydrogenase subunit B], Core2, Cox1, and ATPase
)
were used. Antibodies against VDAC1 (voltage dependent anion-selective
channel protein 1; Mitosciences) or Tim23 (protein import component of
the inner mitochondrial membrane; Molecular Probes) were used as mi-
tochondrial loading controls.
To detect HIF1-
, cells were immediately lysed after hypoxia in ice
using 2 Laemmli buffer without bromophenol blue. Cells were scraped
off the tissue culture plate, and lysate heated at 96°C for 20 min and
sonicated. Amounts of about 50 to 60
g of proteins were separated in 6%
acrylamide gels and transferred to PVDF membranes, and HIF1-
was
detected with a specific antibody obtained from Novus Biologicals.
Signal intensities were quantified using the free NIH software Image J
available for download at http://rsb.info.nih.gov/ij/. Fold changes in pro-
tein levels annotated in the text were calculated as the ratio between the
protein signal and the corresponding loading control (in the same mem-
brane).
Recombinant lentivirus. Wild-type RISP was amplified from mouse
cDNA and cloned into the pLenti-MP2-MCS-IRES-EGFP lentiviral vec-
tor containing an internal ribosome entry site (IRES) site allowing for the
expression of both RISP and green fluorescent protein. A mutant form of
the RISP was created by site-directed mutagenesis. The mutant RISP had
two point mutations in positions 716 and 717 to change the wild-type
CAT codon to a CGG codon. These point mutations resulted in an amino
acid change from histidine to arginine that corresponded to amino acid
239 in the murine sequence. Lentiviruses expressing green fluorescent
protein (GFP) and wild-type or mutant RISP were produced by the Viral
Core Facility at the University of Miami.
RISP KO fibroblasts were transduced with 10
7
pg of viral particles with
lentiviruses expressing GFP, wild-type RISP-GFP, or mutant RISP-GFP.
High-GFP-expressing cells were sorted out by fluorescence-activated cell
sorting (FACS) in an Aria-IIu cell sorter (Becton Dickinson) and main-
tained as a cell line for subsequent experiments.
Lentiviral particles expressing superoxide dismutase 2 (SOD2; enzyme
cloned in the pWXIRESpuro vector) were used to transduce RISP-
deficient cells as described above. Lentivirus expressing SOD2 contained
puromycin resistance. Antibiotic-resistant stable cell lines were used in
the experiments.
Pharmacological inhibition of mitochondrial respiratory com-
plexes. The pharmacological inhibition of CIII was achieved by growing
cells in the presence of 2 nM antimycin A or 2
M myxothiazol in com-
plete medium for 3 days. The inhibition of CI, CIV, and CV was achieved
by growing cells in the presence of 100 nM rotenone, 400
M potassium
cyanide (KCN), or 5
g/ml oligomycin, respectively, for 3 days in com-
plete medium. Fresh medium containing the respective drug was changed
daily to avoid highly acidified medium. All OXPHOS inhibitors were ob-
tained from Sigma.
Hypoxia treatment. Cells (3 10
6
) were plated in 10-cm dishes and
immediately placed under conditions of normoxia or hypoxia. A hypoxic
chamber with a Proox-110 oxygen controller (BioSpherix; Reming Bioin-
struments) directly connected to a nitrogen-CO
2
mixture tank (Medi
-
blend clinical blood gas mixture, 5% CO
2
plus nitrogen) was placed in a
37°C incubator. Cells were exposed for4hor24htohypoxic (1% O
2
,5%
CO
2
) conditions, and control replicates were placed under normoxic con
-
ditions (21% O
2
,5%CO
2
) at 37°C. In some experiments, cells were
treated with different concentrations of MitoQ or decyltriphenylphos-
phonium bromide (dTPP; control compound to account for any nonspe-
cific effect of lipophilic cations) (38) for 4 h prior to the exposure to either
normoxia or hypoxia for 4 h.
Assessment of oxidative stress. To measure superoxide levels, cells
(3 10
5
/well in 6-well plates) were plated, and the next day, the medium
was replaced with fresh medium containing 10
m oligomycin (positive
control) or dimethyl sulfoxide (DMSO; vehicle) for 1.5 h at 37°C. Then,
either 2.5
M MitoSox (Invitrogen) or 2.5
M dihydroethidium (DHE,
Calbiochem) was added and the mixture incubated for 30 min. Cells were
harvested by trypsinization, washed, and resuspended in Hanks balanced
solution. Fluorescence was detected by FACS in an Aria-IIu flow cytom-
etry cell sorter (Becton Dickinson) using excitation/emission wavelengths
of 396/580 for MitoSox and 518/605 for DHE.
To measure hydrogen peroxide production in normoxia/hypoxia
experiments, cells were plated in 96-well plates at a density of 10
4
cells/100
l/well and incubated with 8
MH
2
DCF-DA (2=,7=-
dichlorodihydrofluorescein diacetate) in 200
l medium (56) prior to the
treatment. Then, cells were placed under normoxic or hypoxic conditions for
24 h. At the end of the incubation period, DCF fluorescence was measured
immediately with a plate reader (Victor II; Perkin Elmer). The fluorescence
values were corrected for the fluorescence of the medium alone. Cells were
incubated with 100
M tert-butyl hydroperoxide (tBOOH) and 2 mM
n-acetyl cysteine (NAC) as positive controls for the assay. Values represent
means and standard deviations of the results of 3 to 6 wells of a representative
experiment of at least 3 individual determinations.
Analysis of cellular antioxidant system during normoxia/hypoxia
treatment. The levels and enzyme activities of Mn- and CuZn-superoxide
dismutases (SOD1 and SOD2) were determined by Western blot analysis
and by in-gel activity assay as described previously (68). To determine
steady-state levels of these enzymes by Western blotting, we used an anti-
SOD1 antibody from Calbiochem and an anti-SOD2 antibody from Up-
state. Glutathione (GSH) levels were determined using the GSH-Glo glu-
tathione assay kit from Promega, and glutathione peroxidase (GPx)
activity was measured with the GPx assay kit from Cayman Chemicals,
following the manufacturer’s instructions.
Statistical analysis. Values represent the means and standard devia-
tions of at least 3 independent measurements. Statistical significance was
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 417
Page 3
determined by using the two-tailed unpaired Student t test. A P value of
0.05 was considered statistically significant.
RESULTS
Creation and characterization of RISP KO fibroblasts. Primary
cultures of lung fibroblasts from a knock-in mouse (28) homozy-
gous for the floxed UQCRFS1 gene were immortalized by E6/E7
expression. The knock-in mouse contained loxP sites flanking
exon 2 of the UQCRFS1 gene and a selection cassette at the 3=
untranslated region (UTR) (Fig. 1A) (28). The UQCRFS1 gene
encodes the Rieske iron-sulfur protein (RISP), one of the catalytic
subunits of complex III (CIII). Two immortalized clones harbor-
ing the floxed UQCRFS1 (clones 8 and 14) were used as control
cell lines in this study.
To obtain CIII-deficient cells, the floxed clone 8 was trans-
fected with a plasmid expressing the Cre recombinase. The effi-
ciency of gene ablation in several clones was determined by a PCR
detecting the floxed, deletion, and wild-type alleles simultane-
ously (Fig. 1A). PCR of the RISP knockout (KO) clones (clones
8.2, 8.4, 8.5, and 8.17) only amplified the band corresponding to
the deletion allele. The band corresponding to the floxed allele was
only amplified in the control cells, clones 8 and 14. These results
indicate a complete recombination of the floxed gene (Fig. 1B).
The RISP KO clones were unable to consume oxygen and
quickly acidified the medium, indicating increased production of
lactate due to impaired respiration (not shown). Biochemical
analysis of the enzymatic activities of the OXPHOS complex mea-
sured spectrophotometrically showed, as expected, that deletion
of RISP completely abolished CIII enzymatic activity (Fig. 1C).
RISP deletion was also associated with a decrease in complex IV
(CIV) activity in most of the KO clones compared to the activity in
the parental cell line (Fig. 1C). Citrate synthase (CS) activity was
increased in all the KO fibroblasts compared to the activity in the
parental clone 8. We found a marked variation in CIV activity
among the KO clones, with a clear reduction compared with their
parental cell line. Control cell lines 8 and 14 showed variation in
CIV and CS (Fig. 1C), possibly related to genome instability in
cultured cells.
Analysis of the steady-state levels of mitochondrial proteins by
Western blotting (Fig. 1D) showed no detectable levels of RISP in
the KO clones, confirming the deletion of the gene. Other CIII
subunits (UQCRC1 and UQCRC2, also known as Core1 and
Core2) were decreased in the KO clones (1.6- to 2-fold and 7- to
10-fold lower than control levels, respectively). The levels of CI
subunits NDUFA9 and NDUFS3 were also decreased (1.9- to 2.7-
fold and 7- to 9.6-fold lower than control levels, respectively).
Likewise, the levels of the CIV subunit Cox1 were decreased in
those clones with decreased CIV activity (2- to 7-fold lower than
control levels). In contrast, CII and CV subunits (SDHA and
ATPase-
, respectively) were increased in the RISP KO clones
compared to the levels in controls (2- to 4-fold higher). The levels
of other mitochondrial proteins, such as cytochrome c, VDAC1
(voltage-dependent anion-selective channel protein 1), and
Tim23 (inner mitochondrial protein import complex compo-
nent) were comparable in all samples analyzed (Fig. 1D).
Deletion of RISP did not alter mitochondrial protein synthesis,
and the levels of newly synthesized Cox1 in the KO cells were
comparable to control levels (not shown). These results suggest
that Cox1 was destabilized posttranslationally.
Assembly of OXPHOS complexes is impaired in the absence
of RISP. We investigated the effect of deletion of RISP on the levels
of assembled OXPHOS complexes using blue native gel electro-
phoresis (BNGE). Proteins were extracted with lauryl maltoside to
detect individual complexes. The deletion of RISP significantly
reduced the levels of assembled CIII in all KO clones. The absence
of RISP also had a profound effect on the assembly/stability of CI,
which could only be detected upon overexposure of the blots. The
levels of CIV were decreased in those KO clones with lower CIV
activity, whereas the levels of CV were not altered in the KO clones
(not shown).
Extraction with milder detergents, such as digitonin, preserves
OXPHOS supramolecular interactions, and we were able to detect
the presence of isolated CI, CIII, and supercomplexes in the con-
trol cell line when analyzed by 2-dimensional blue native gel elec-
trophoresis (2D-BNGE) (Fig. 2A). Still, only by overexposing or
loading more protein into the gels were we able to observe low
levels of CI; however, we were unable to detect supercomplexes in
the RISP KO clones (Fig. 2A and B).
Although all the steps for CIII assembly in mammals are un-
known, the final steps in yeast appear to be the incorporation of
RISP and the Qcr10 subunits. RISP incorporation is mediated by
the chaperone Bcs1. In mammals, the homologue subunits are
termed RISP and UQCRC11, respectively, and the homologue
chaperon is BCS1L. The fully assembled CIII is a dimer with a
molecular mass of about 550 kDa (16, 70). The CIII observed in
the RISP KO clones was actually an intermediate precomplex that
lacks RISP and UQCR11 (pre-CIII). Under the conditions used,
we were unable to detect gel mobility differences between the fully
assembled CIII and pre-CIII from control and RISP KO cells,
respectively, by BNGE. The pre-CIII lacking RISP can be observed
in Fig. 3A (GFP lanes, probed with Core2-specific antibody).
These results suggest that at this point in assembly, a dimerization
of assembly intermediates already occurred to form the pre-CIII
prior to the addition of the last two subunits. We also found a CIII
subassembly/degradation intermediate containing Core2 but not
Core1 in the KO clones (Fig. 2B).
Respiratory complex and supercomplex instability has been
attributed, in some instances, to low levels of phospholipids, such
as cardiolipin (47, 52, 67). However, analysis of phospholipids by
thin-layer chromatography did not reveal major differences be-
tween control and RISP KO cells (data not shown).
To determine whether the pleiotropic effects on CI and CIV in
the KO clones were directly related to the ablation of RISP, recon-
stitution experiments introducing RISP back into the KO clones
were performed. We infected KO clones with lentiviruses contain-
ing GFP (control infection), mouse wild-type RISP (WT-RISP),
or the mutant RISP (MUT-RISP). We mutated the mouse histi-
dine 219 residue to an arginine that corresponded to the histidine
181 in yeast. We chose this particular mutation because the yeast
H181R mutant had the highest levels of RISP protein among the
collection of no-activity mutants (32).
Wild-type RISP was incorporated into CIII in RISP KO cells
(Fig. 3A, RISP panel) and restored the levels of the fully assembled
CIII to control levels (Core2 panel), although the amount of RISP
protein expressed was lower than in the control cells (Fig. 3C). The
expression of either GFP or MUT-RISP did not increase the levels
of CIII in KO clones. In fact, we were unable to detect the mutant
RISP protein (Fig. 3C). It is possible that the mouse mutant pro-
tein, unlike the yeast mutant H181R, was not stable and it was
degraded. The levels of other CIII subunits, Core1 and Core2,
Diaz et al.
418 mcb.asm.org Molecular and Cellular Biology
Page 4
were increased in KO clones expressing WT-RISP compared to
the levels in the clones expressing either GFP or MUT-RISP (Fig.
3C). Not surprisingly, these results suggest that the fully assem-
bled CIII containing wild-type RISP is more stable than the
pre-CIII.
WT-RISP was able to restore CIII activity in KO clones only
partially (perhaps due to lower-than-normal expression from the
integrated transgene). The improvement in CIII activity ranged
between 14% and 32% of that of the parental cell line. The expres-
sion of GFP or MUT-RISP did not have any rescuing effect on CIII
activity (not shown).
Wild-type RISP is required for CI, CIV, and supercomplex
assembly/stability. The pleiotropic CI defect due to ablation of
RISP was abrogated by expressing the wild-type protein in the KO
cells. Fully assembled CI levels were increased to control levels in
KO clones transduced with the WT-RISP (Fig. 3A, NDUFA9
panel). Moreover, analysis by BNGE followed by in-gel activity
staining showed that the restored CI was enzymatically active (Fig.
3B). However, CI levels and activities remained very low in the KO
cells expressing GFP or mutant RISP. Similarly, only WT-RISP
improved the levels and activity of CIV (Fig. 3B). The increase in
CIV in-gel activity was only observed in those clones that initially
had low levels of CIV (clones 8.2, 8.5, and 8.17), in agreement with
spectrophotometric measurements (not shown). The increase in
CIV was accompanied by higher steady-state levels of the CIV
subunits Cox1 and Cox4 (Fig. 3C). The levels of other subunits,
such as ATPase-
from CV or SDHA from CII, were unchanged
upon the expression of GFP, wild-type, or mutant RISP (Fig. 3C).
Analysis of reconstituted KO cells by 2D-BNGE showed that
WT-RISP restored supercomplexes. Figure 4 shows color-coded
OXPHOS complexes and their organization into supercomplexes.
Images of individual antibodies added sequentially to the same
membrane were superimposed. Each color reflects an antibody.
For identification of CIII, we used antibodies against Core2 (red),
RISP (pink), and the assembly factor Bcs1L (blue); for CI, we used
NDUFA9 (yellow); and for CIV, we used Cox1 (green). RISP KO
clones transduced with the WT-RISP lentivirus contained higher
levels of CI compared to those observed in cells transduced with
GFP lentivirus (Fig. 4, yellow spots). Moreover, CI was also de-
tected in supercomplex assemblies (CI/CIII/CIV dotted line). De-
tection of CIV with Cox1 antibody (green spots) showed that its
levels were increased in those cells expressing WT-RISP.
RISP KO cells are able to induce HIF1-
in hypoxia. Free
radicals generated by CIII through RISP have been proposed to
stabilize the hypoxic transcription factor HIF1-
during hypoxia
by inhibiting the prolyl hydroxylase that constantly targets
HIF1-
for degradation. Evidence supporting this hypothesis was
provided by RISP knockdown experiments (6, 33).
The availability of our bona fide RISP knockout cells allows us
to examine the levels of HIF1-
in hypoxic conditions. We found
marked differences in the levels of HIF1-
depending on the time
in hypoxia. Figure 5A shows that, when exposed to hypoxia (1%
O
2
) for 24 h, the RISP KO cells were able to stabilize HIF1-
.
Moreover, the levels of the transcription factor were higher in the
RISP KO cells than in control cells (clones 8.4 and 8.5 had higher
levels than control cells, with a 4- and 2.7-fold increase, respec-
FIG 2 Ablation of RISP reduced the levels of CI, CIII, and supercomplexes. (A) Two-dimensional BNGE (2D-BNGE) and Western blot of mitochondrial
proteins. Membranes were sequentially blotted with different antibodies, and signals obtained are indicated with an arrow in each panel. NDUFS3 antibody
showed a strong unknown signal (?). Cox1 signal is circled with a white dotted line to distinguish it from the unknown signal from NDUFS3. Positions of
respiratory complexes and supercomplexes (CIII/CI or CIII/CIV) are marked with dotted lines. (B) Presence of a subassembly/degradation product (sub) in RISP
KO clones. (C) Western blot of VDAC1 as protein loading control.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 419
Page 5
tively). Additionally, HIF1-
stabilization was also induced when
cells were exposed to CoCl
2
, a prolyl hydroxylase inhibitor, al
-
though the chemical stabilization of HIF1-
was less robust than
with hypoxia (Fig. 5A).
On the other hand, we found that after4hofhypoxia, the RISP
KO clones’ ability to stabilize HIF1-
was severalfold lower (2.9 to
19.7 times depending on the clone) than that of the control cells
(Fig. 5B), in agreement with previous observations (4, 6, 12, 33).
However, unlike previous observations (4, 57), MitoQ, a mito-
chondrial antioxidant (38), when used at 1
M concentration, did
not alter the levels of HIF1-
in any of the cell lines compared with
the control compound dTPP (not shown). At 2.5
M MitoQ, we
observed a slight decrease in the levels of HIF1-
in some of the
cell lines (Fig. 5B) but still not as robust as previously described (4,
57). The levels of HIF1-
were still detectable and only decreased
1.4- and 5.7-fold in the control and KO clone 8.4, whereas it re-
mained unchanged in the other clones (Fig. 5B). Similar results
were obtained with the reconstituted clones expressing WT-RISP
(Fig. 5C). In these cells, HIF1-
levels only decreased 1.8- and
2.9-fold in the presence of 2.5
M MitoQ but did not change in
the presence of 5
M MitoQ (Fig. 5C).
Hypoxia increased the levels of OXPHOS complexes and su-
percomplexes in RISP-deficient cells. In the course of the hyp-
oxia experiments, we also tested whether the decrease in oxygen
levels affected the assembly of OXPHOS complexes. We subjected
cells to 1% O
2
for 24 h since that is the time frame required to
observe fully assembled CI and supercomplexes (2, 40, 51). To our
surprise, exposure of RISP KO cells to hypoxia for 24 h resulted in
a significant increase in the levels of OXPHOS complexes in all cell
lines (Fig. 6A). In particular, the levels of CI and CIV were mark-
edly increased in the KO clone 8.5 under low-oxygen conditions.
Assessment of the enzymatic activity of fully assembled complexes
by in-gel activity assay revealed an increase in CI and CIV activities
after 24 h of hypoxia in both control and KO cells compared to the
normoxic activity (not shown).
Analysis of the steady-state levels of OXPHOS subunits
showed that they were slightly increased in the hypoxia-treated
samples (Fig. 6B). NDUFAB8 levels in KO clones 8.4 and 8.5 were
increased 1.5- and 1.6-fold, respectively, during hypoxia, whereas
its levels were unchanged in the control cell line. The highest
changes were observed for Core2, with 4.3- and 3.5-fold the nor-
moxia levels in the KO clones 8.4 and 8.5, respectively, and a
1.9-fold increase for control cells. Likewise, the levels of SDHB in
KO clones 8.4 and 8.5 were 2.4- and 1.3-fold higher than in nor-
moxia. The levels of ATPase-
increased 1.7-fold after hypoxia
exposure in both the control and KO clone 8.4 but not in KO clone
8.5. The levels of other mitochondrial proteins, such as Grp75 and
VDAC1, remained unaltered (Fig. 6B).
An increase in reactive oxygen species affects supercomplex
stability. From the results described above, we inferred that the
FIG 3 Expression of wild-type RISP in KO cells reconstituted the levels of fully
assembled CIII and CIV. (A) BNGE and Western blot of KO fibroblasts trans-
duced with GFP, wild-type (WT) RISP, or mutant (MUT) RISP lentivirus. WT
RISP restored levels of fully assembled CI and increased levels of CIII and CIV
in KO cells. (B) BNGE and in-gel activity stain for CI and CIV. (C) Steady-state
levels of OXPHOS complex subunits by Western blotting.
FIG 4 Expression of wild-type RISP increased levels of CI and CIV and restored
supercomplex assemblies. Two-dimensional BNGE and Western blotting were
performed to assess supercomplex assembly. Antibodies were added sequentially
to the same membrane. Pseudocolors identifying each antibody are used for clar-
ity. For identification of CIII, we used antibodies against Core2, RISP, and the
assembly factor Bcs1L; for CI, NDUFA9; and for CIV, Cox1. The positions of
complexes and supercomplexes are marked by dotted lines. Arrows indicate mo-
lecular mass of RISP (32 kDa).
Diaz et al.
420 mcb.asm.org Molecular and Cellular Biology
Page 6
stability/assembly of respiratory complexes might be affected by
the production of free radicals. We reasoned that under low oxy-
gen levels (hypoxia), fewer free radicals should be produced, and
therefore, the levels of respiratory complexes and supercomplexes
should improve. To test this hypothesis, we treated control cells
with different OXPHOS inhibitors (many known to produce
ROS) and determined their effects on the assembly/stability of
OXPHOS complexes and supercomplexes.
Control cells were grown in the presence of either rotenone,
antimycin A, KCN, or oligomycin (CI, CIII, CIV, and CV inhibi-
tors, respectively) for 3 days, and OXPHOS complexes analyzed
by BNGE after digitonin extraction. Treatment with oligomycin
had a profound effect on CI assembly/stability and completely
disrupted the supercomplexes containing CI (Fig. 7A, NDUFA9
panel). Analysis of steady-state levels of the respiratory complex
subunits showed that oligomycin treatment strongly affected the
levels of the CI subunit NDUFB8, whereas and to a lesser extent, it
also affected the levels of Core2 and Cox1 from CIII and CIV,
respectively (Fig. 7B, Cocktail panel).
Treatment with antimycin A had an effect on CI stability/as-
sembly that was similar to that of the oligomycin treatment, albeit
milder (Fig. 7A). Conversely, CI was not affected when cells were
treated with either rotenone or KCN. In fact, KCN treatment
mainly affected CIV subunit levels and, in turn, also affected su-
percomplexes containing CIV (Fig. 7A and B, respectively). Pre-
vious studies have shown that oligomycin and antimycin A mark-
edly increase ROS generation, whereas KCN does not (44).
We further tested the effects of antimycin A and myxothiazol
on supercomplex assembly and stability since the results of phar-
macological inhibition of CIII presumably should resemble more
FIG 5 RISP is not required for HIF1-
stability during hypoxia. (A) Steady-
state levels of HIF1-
in cells exposed to either hypoxia (1% O
2
) or CoCl
2
(50
M) for 24 h. (B) Levels of HIF1-
in cells preincubated with 2.5
M MitoQ
(MQ) or 2.5
M dTPP for 4 h and then subjected to either normoxia (N; 21%
O
2
) or hypoxia (H; 1% O
2
) for 4 h. (C) Levels of HIF1-
in reconstituted RISP
KO cells expressing wild-type RISP. Tubulin was used as loading control.
FIG 6 Hypoxia increased the levels of OXPHOS complex and supercomplex
assemblies. (A) Cells were subjected to either normoxia or hypoxia (1% O
2
) for
24 h, and supercomplexes (SC) analyzed by BNGE. (B) Steady-state levels of
OXPHOS complex subunits and other proteins in either normoxia or hypoxia.
VDAC1 was used as loading control. LDH, lactate dehydrogenase.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 421
Page 7
closely the data for our RISP KO cells. Antimycin A and myxothia-
zol bind to different sites in CIII (62). Pharmacological inhibition
of CIII decreased the levels of supercomplexes containing CI, CIII,
and CIV compared to the levels in untreated cells (Fig. 7C). Sim-
ilarly, the levels of CI were also reduced (NDUFA9 panel). Most of
CIII appeared to be in supercomplexes in untreated cells, but with
the pharmacological inhibition, this association was disrupted
and most of the complex appeared in its dimeric form (Fig. 7C,
Core2 panel). Likewise, the association of CIV with other com-
plexes was also disrupted by both CIII inhibitors (Fig. 7C, Cox1
panel). The instability of CI upon CIII inhibition was also re-
flected by the lower steady-state levels of the NDUFB8 subunit (3-
to 6-fold lower levels than in untreated cells) (Fig. 7D, Cocktail
panel). Other subunits of the electron transport chain complexes
(ATPase
, Cox1, Core2, and SDHB) or mitochondrial mem-
brane proteins (Tim23 and VDAC1) were not significantly altered
(Fig. 7D). Incubation with antimycin A and myxothiazol inhib-
ited CIII activity and did not have any significant effect on CIV or
citrate synthase activity measured spectrophotometrically (not
shown).
RISP-deficient cells had increased levels of free radicals. Be-
cause antimycin A and oligomycin are potent generators of reac-
tive oxygen species (ROS), we investigated whether instability/
assembly of CI, CIV, and supercomplexes in the RISP-deficient
cells was related to increased levels of free radicals in these cells.
We measured the levels of superoxide by flow cytometry with
the fluorescent probe MitoSox. Figure 8A shows that clone 8.4
contained higher levels of superoxide and clone 8.5 had only a
slight increase in the levels of mitochondrial superoxide, presum-
ably due to its lower mitochondrial membrane potential (not
shown). Oligomycin increased ROS production in all cell lines,
although it had a more pronounced increase in clone 8.5 (Fig. 8A).
The reason for this marked difference in response to oligomycin is
unknown, but it suggests that clone 8.5 produced larger amounts
of ROS when CV was disturbed. In addition, we also measured the
levels of total cellular superoxide using another dye, dihydro-
ethidium (DHE), confirming that the RISP KO clones produced
more ROS than the parental cell line (Fig. 8B).
Antioxidants stabilized OXPHOS complexes/supercom-
plexes. To test whether the stability of OXPHOS complexes, par-
ticularly CI and supercomplexes, is affected by increased free rad-
icals, we treated cells with different antioxidant compounds. Cells
were grown for 3 days in the presence of either a hydrogen perox-
ide scavenger, n-acetylcysteine (NAC), or with a superoxide dis-
mutase mimetic compound, MnTBAP. The results in Fig. 9A
show that NAC had a beneficial effect in CI and supercomplex
stability in control cells (4.9-fold increase in supercomplex levels)
but did not stabilize supercomplexes in the RISP-deficient fibro-
blasts. In contrast, when MnTBAP was used, supercomplex stabil-
ity was preserved in the RISP KO (Fig. 9A).
We also tested the effects of both antioxidants in control cells
treated with a CIII inhibitor. Low NAC concentrations (1 mM)
could not block the detrimental effect of antimycin A on CI and
supercomplex stability. At higher concentrations (10 mM), NAC
slightly protected supercomplex stability from antimycin A. Sim-
ilarly, higher concentrations of MnTBAP improved the super-
complex levels in cells treated with antimycin A (Fig. 9B).
Taken together, these results showed that OXPHOS compo-
nents, especially CI and supercomplexes, are vulnerable to in-
creased levels of ROS. It also showed that by scavenging superox-
ide (but not hydrogen peroxide), we were able to partially rescue
this instability. To confirm these results, we transduced the fibro-
blasts with lentivirus expressing mitochondrial SOD2 and ob-
tained stable cell lines. Figure 9C shows that the SOD2 expression
increased about 2-fold for both the control and KO clone 8.4 after
lentiviral transduction. This increase in SOD2 levels completely
FIG 7 Pharmacological inhibition of OXPHOS complexes affected supercomplex assembly/stability. (A) BNGE and Western blot of control fibroblasts treated
with rotenone (Rot; 100 nM), antimycin A (AA; 20 nM), KCN (400
M), and oligomycin (Olig; 5
g/ml). Ctrl, untreated control. (B) Steady-state levels of
OXPHOS complex subunits in control cells treated with the different OXPHOS inhibitors. (C) BNGE and Western blot of control cells treated with CIII-specific
inhibitors antimycin A (20 nM) and myxothiazol (Myx; 2
M). (D) Steady-state levels of mitochondrial proteins of cells treated with CIII inhibitors. VDAC1 and
Tim23 signals were used as loading controls.
Diaz et al.
422 mcb.asm.org Molecular and Cellular Biology
Page 8
rescued the instability of CI and supercomplexes in the RISP-
deficient clone. An improvement of CI and supercomplex stabil-
ity/assembly was also observed in clone 8.5 but to a much lesser
extent, since SOD2 was only increased 1.3-fold after lentiviral
transduction (Fig. 9C). We also analyzed cells with a more-than-
20-fold increase in SOD2 levels, but the high levels of expression
were detrimental for cell growth and OXPHOS complexes (not
shown).
Antioxidant defenses were increased in RISP KO cells. The
production of free radicals under hypoxia remains controversial
and unresolved. Therefore, we tested whether exposure of cells to
low levels of oxygen resulted in increased free radical production
in our cells. We measured hydrogen peroxide levels in control cells
exposed to normoxia or hypoxia (1% O
2
) for 24 h. We were un
-
able to observe any difference in H
2
O
2
levels in control cells under
hypoxia compared to the levels under normoxia (Fig. 10A). In
contrast, in the positive control of the assay, cells that were treated
with tert-butyl hydroperoxide (tBOOH) produced a significant
increase in DCF fluorescence which was abrogated by the presence
of NAC under both normoxic and hypoxic conditions (Fig. 10A).
Using the same assay, we were unable to detect changes in the
levels of H
2
O
2
in RISP KO cells during hypoxia compared to the
normoxic levels, indicating that our cells did not produce ROS
when exposed to hypoxia (Fig. 10B).
We also examined the antioxidant defense system under
normoxia and hypoxia. The results in Fig. 10C show that the
RISP clone 8.5 had higher steady-state levels of both SOD1 and
SOD2 than the control and clone 8.4. The increased steady-
state levels of these two proteins also correlated with increased
levels in their enzymatic activity as assessed by in-gel activity
FIG 8 Deletion of RISP resulted in increased levels of ROS. (A) Mitochondrial superoxide radicals were measured by MitoSox fluorescence using flow cytometry.
Cells were preincubated with oligomycin (Oligo) to increase ROS production. (B) Determination of cellular ROS using dihydroethidium (DHE) fluorescence by
flow cytometry as described for panel A. Values from representative experiments are shown. Vertical lines indicate the mean fluorescence values for untreated
control cells.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 423
Page 9
assays (not shown). When cells were exposed to hypoxia (1%
O
2
) for 24 h, the levels of SOD2 slightly decreased in the control
and clone 8.5 (0.4- and 0.6-fold decrease, respectively), al-
though in clone 8.4, the levels remained unchanged (Fig. 10C).
After hypoxia, the levels of SOD1 in the control and clone 8.4
were unchanged, whereas clone 8.5 had a slight decrease of
SOD1 levels of about 0.6-fold (Fig. 10C). Reduction of the
levels of superoxide scavenger enzymes during hypoxia sug-
gests less production of free radicals. Since SOD2 is an induc-
ible enzyme, its high levels suggest increased levels of superox-
ide, particularly in the RISP KO clone 8.5. This could explain
why we could not detect higher levels of mitochondrial super-
oxide with MitoSox in this clone (Fig. 8A). Higher levels of
superoxide dismutase could counterbalance the mitochondrial
ROS that is being produced.
The levels of GPx were significantly increased in the RISP KO
clone 8.4 compared to levels in the control cell line (Fig. 10D).
Exposure of cells to hypoxia did not alter the levels of GPx in any
of the cells tested. However, the levels of total glutathione were
significantly increased in RISP KO cells compared to the levels in
the control in normoxia, in agreement with alterations in oxida-
tive status. When cells were exposed to hypoxia, glutathione levels
diminished significantly in all cell lines, suggesting a reduction in
free radical production (Fig. 10D).
FIG 9 Scavenging superoxide radicals increases CI and supercomplex stability. (A) BNGE and Western blot of cells treated with either NAC (10 mM) or
MnTBAP (100
M). (B) BNGE of control cells treated with antimycin A (20 nM) and the effects of different concentrations of either NAC or MnTBAP on
supercomplex (SC) stability. (C) BNGE of control and RISP KO fibroblasts infected with lentivirus expressing mitochondrial SOD2. Antibodies used are
indicated beside each panel. The levels of SOD2 were determined by SDS-PAGE. VDAC1 and Tim23 were used as protein loading controls.
Diaz et al.
424 mcb.asm.org Molecular and Cellular Biology
Page 10
DISCUSSION
The present study characterized the effect of the deletion of the
Rieske iron-sulfur protein on CIII assembly and showed that the
interdependence and supramolecular organization of OXPHOS
complexes are associated with the increased levels of ROS.
The complete assembly process of CIII is still under investiga-
tion, but work in yeast suggested that it starts with the formation
of 3 subassembly intermediates composed by subunits cytb/Qcr7/
Qcr8, cytc1/Qcr6/Qcr9, and Core1/Core2. By an unknown assem-
bly process, these three intermediates form a precomplex, pre-
CIII, to which only the last two subunits (RISP and Qcr10) need to
be inserted (70, 71). In yeast, three chaperones, Cbp3, Cbp4, and
Bcs1, aid in the assembly process (16, 39). The addition of RISP is
catalyzed by Bcs1 in an ATP-dependent manner, and it appears
that the structural dimerization of the complex occurs before
RISP is incorporated (16). The mammalian CIII contains an ad-
ditional subunit (UQCR9) that is derived by the proteolytic cleav-
age of the amino-terminal portion of RISP (5). It is not clear when
the cleavage of RISP to produce UQCR9 occurs, but presumably it
is after its addition into the complex by BCS1L (human homolog
of Bcs1). Interestingly, the Core1 and Core2 subunits display
mitochondrion-processing peptidase activity (18).
We did not detect major differences in the electrophoretic mo-
bility of the fully assembled CIII and that of the one lacking RISP.
Therefore, we have confirmed that in mammals, the dimerization
and the formation of the pre-CIII assembly intermediate take
place prior to RISP addition. Moreover, the pre-CIII appears to be
structurally unstable, as we observed low levels of pre-CIII and
subassembly intermediates/degradation products in the RISP KO
clones. These results are in agreement with observations made in
Bcs1L patients, where little incorporation of RISP into the pre-
CIII occurs (25, 31, 36, 49).
The absence of RISP affected not only the levels of pre-CIII but
also the levels of CI, CIV, and supercomplexes. Several possibili-
ties that could contribute to the interdependence of respiratory
complexes include the existence of specific threshold levels of re-
spiratory complexes (17), specific subunits and lipid interactions
(47, 52), or as we showed in this study, increased levels of ROS.
Mitochondria, in particular the electron transport chain
(ETC), are major generators of ROS (reviewed in reference 41).
The established sites for mitochondrial ROS production are CI,
CII, and CIII. Complexes I and II produce superoxide within the
mitochondrial matrix, whereas CIII releases the radicals into ei-
ther the matrix or the mitochondrial intermembrane space (30,
35, 41, 72).
Analysis of RISP KO clones showed increased levels of ROS
associated with destabilization of CI and supercomplexes. Com-
plex I instability has been shown previously in both human and
mouse cell lines with mutations in the cytochrome b gene that
impeded the assembly of CIII (1). Studies in NDUFS4 KO mice
showed that CI was stabilized by the formation of supercomplexes
containing CIII in the absence of the CI subunit NDUFS4 (9).
Our results suggest that CI stability is affected by factors other
than the “physical support” conferred by CIII to assemble into
supercomplex structures. Here, we show that the presence of RISP
per se is not required for CI stability, since the exposure of RISP
KO fibroblasts to hypoxia and, presumably, low ROS was suffi-
cient to increase CI to the levels observed in control cells. This
indicates that the partial assembly of CIII into the pre-CIII in the
FIG 10 Ablation of RISP leads to an increase in cellular antioxidant defenses.
(A) H
2
O
2
levels were determined by DCF-DA fluorescence in control cells
exposed to normoxia (21% O
2
) or hypoxia (1% O
2
) for 24 h. Cells were treated
with either 100
M tBOOH or a mixture of 2 mM NAC and 100
M tBOOH
to increase or suppress ROS production. AU, arbitrary units. (B) DCF-DA
fluorescence of cells exposed to normoxia or hypoxia for 24 h. Values in panels
A and B represent the means and standard deviations of fluorescence in trip-
licates of a representative experiment of at least 3 independent determinations.
(C) Steady-state levels of the superoxide scavenger enzymes SOD1 and SOD2
in cells exposed to either normoxia or hypoxia for 24 h. (D) Total glutathione
levels and glutathione peroxidase (GPx) activities in cells exposed to normoxia
and hypoxia for 24 h. Values represent means and standard deviations. , P
0.05 for KO cells compared to control in normoxia; ⴱⴱ, P 0.05 for hypoxia
compared to normoxia.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 425
Page 11
RISP KO cells was enough to stabilize CI and supercomplex for-
mation. Unfortunately, the previous studies on CI stability men-
tioned above did not investigate the effect of increased free radi-
cals in stability/assembly (1, 9).
To test whether increased levels of ROS affected OXPHOS
complex stability, we exposed control cells to different OXPHOS
inhibitors known to increase free radicals. Studies in submito-
chondrial particles suggested that rotenone inhibits the binding of
coenzyme Q to its reduction site in CI, permitting the release of
electrons directly to oxygen at the N2 center and forming super-
oxide radicals (24). The generation of free radicals by CIII is inti-
mately linked to its catalytic mechanism. During the Q cycle,
ubiquinol is oxidized and two electrons enter CIII in a bifurcate
fashion. According to this model, inhibition of CIII with antimy-
cin A and myxothiazol, which bind to center N or center P, respec-
tively, can generate superoxide anions. Myxothiazol binds close to
heme b
L
and does not interfere with ubiquinol binding; in this
way, ubiquinol electrons can access RISP but not heme b
H
, allow
-
ing for the formation of superoxide (61). Among the drugs that we
used, CIII and CV inhibitors known to be ROS generators dis-
played the most detrimental effect on CI and supercomplex sta-
bility. Acin-Perez et al. (1) showed that antimycin A decreased the
levels of CI in mouse control cells derived from the L929 line
(subcutaneous aerolar and adipose tissue) (1). However, the de-
crease that they observed in CI levels was not as severe as the one
we observed in this study. This difference could be attributed to
variations in cell type or drug treatment time. It is possible that
during their long treatment period with the drug (2 weeks), cells in
culture adapted to the inhibition or that the “less fit” cells were
selected against in growing cultures.
RISP is thought to be required for the production of reactive
oxygen species by CIII, indicating that the increased levels of ROS
observed in our RISP KO fibroblasts are probably generated by
other sources (i.e., CI or CII). Along these lines, Hinson et al. (36)
showed that the levels of free radicals produced by mitochondria
from patients with Björnstad syndrome (Bcs1L mutations) and
other CIII deficiencies were increased by 50 to 80%. The authors
determined that the increased levels of H
2
O
2
detected in the pa
-
tients were produced by CI and not by CIII (36). More recently,
Moran et al. confirmed increased levels of H
2
O
2
and upregulation
of ROS-scavenging enzymes in fibroblasts derived from patients
with different mutations in the BCS1L gene. Remarkably, the lev-
els of ROS in these patients correlated with the severity of the
disease (49). These results support our findings of increased ROS
in the RISP KO cells.
The production of free radicals under hypoxia is still contro-
versial. In this paradox, researchers supporting hypoxia-induced
ROS contend that at low oxygen levels, the flow of electrons
through the electron transport chain slows down, increasing the
likelihood for the electrons to escape and produce free radicals. In
contrast, other reports showed decreased ROS during hypoxia
(23, 48, 63). This controversy might rely on the nature of the free
radical species measured. As pointed out by Poyton’s group, not
only reactive oxygen species but also reactive nitrogen species
(RNS) can be generated during hypoxia (10, 53). Low levels of
both ROS and RNS act as signaling molecules during physiologi-
cal conditions, and only excessive amounts, usually generated
during a pathological state, produce oxidative stress (34). A po-
tential reconciliation of this controversy came from the studies
measuring the oxidation state of redox-sensitive GFP (roGFP)
probes in different cellular compartments. Waypa et al. (66)
found that hypoxia increased the oxidation of roGFP in the cyto-
sol and intermembrane space, whereas it decreased oxidation in
the mitochondrial matrix (66). Decreased mitochondrial matrix
ROS supports our observations of increased OXPHOS complex
stability/assembly during hypoxia.
It has been proposed that CIII is the mitochondrial oxygen
sensor that regulates cellular responses during hypoxia and that
the ROS generated by CIII is responsible for stabilizing the tran-
scription factor HIF1-
that initiates the hypoxic signaling cas-
cade (reviewed in reference 11). This hypothesis is based in nu-
merous studies performed in different cell types, including rho
0
cells (cells devoid of mitochondrial DNA [mtDNA]), cytochrome
b and cytochrome c mutants, specific OXPHOS inhibitors, mito-
chondrially targeted antioxidants, and knockdown studies (4, 6,
12, 13, 33, 46). Of particular interest are the studies on the effect of
RISP knockdown on HIF1-
stability. Brunelle et al. (6) showed
that transient transfection of two RISP small interfering RNA se-
quences led to a reduction in the stabilization of HIF1-
in
Hek293 cells exposed to hypoxia (1.5% O
2
) for 2 h (6). Stable
knockdown of RISP in 143B cells showed similar results, and
when exogenous H
2
O
2
was added, hypoxic HIF1-
stabilization
was restored, suggesting that ROS is required for stability of the
transcription factor (33). Hypoxic abrogation of HIF1-
stabili-
zation upon knockdown of RISP (15, 50) and the role of ROS (46)
have been reported in other cell types also. Interestingly, recent
studies implicate another CIII subunit (UQCRB) in the oxygen-
sensing role during hypoxia (37).
The use of MitoQ, a mitochondrially targeted antioxidant,
supported the hypothesis that mitochondrial ROS was required
for hypoxic signaling. Control and cytochrome b mutant cybrids
pretreated with MitoQ prior to hypoxic exposure failed to stabi-
lize HIF1-
(4). This concept has been recently challenged by
Chua et al. (14). The authors observed that pharmacological inhi-
bition of the electron transport chain decreased the HIF1-
half-
life under hypoxia to the same extent independent of the complex
inhibited and that there was no increase in ROS production dur-
ing hypoxia (14). The authors proposed that, rather than requir-
ing ROS produced by CIII, HIF1-
stability during hypoxia is
related to the intracellular concentrations of oxygen, which are
determined by the rate of mitochondrial respiration.
Similar to results of the RISP knockdown studies described
above, we were able to detect a marked decrease in the levels of
HIF1-
after exposing our RISP KO cells to hypoxia (1% O
2
) for 4
h. However, after 24 h of hypoxia, the levels of HIF1-
in KO cells
increased, reaching levels that were even higher than the ones in
control fibroblasts. Moreover, reducing mitochondrial ROS with
different concentrations of MitoQ did not have a significant effect
on HIF1-
stability. This observation suggests that HIF1-
stabil-
ity in the RISP KO cells during hypoxia may be independent of
ROS production, as has been suggested (14). The RISP KO cells
had increased levels of superoxide, and antioxidant defenses were
upregulated. Presumably, in our cells, ROS is generated by means
other than CIII. However, we did not observe an increase in hy-
drogen peroxide during hypoxia.
We were surprised to find that hypoxia also increased the sta-
bility/assembly of CI, CIV, and supercomplexes. Although the re-
sults of the experiments described above do not rule out the par-
ticipation of HIF1-
in this process, they showed that ROS is an
active mediator of complex/supercomplex stability. Interestingly,
Diaz et al.
426 mcb.asm.org Molecular and Cellular Biology
Page 12
there are two forms of CI: one form, called the A-form, is catalyt-
ically active, and the other, called the D-form, is catalytically inac-
tive (65). Deactivation occurs when all reactive redox centers of CI
are in the reduced state. During hypoxia, a deactivation of CI was
observed in epithelial kidney cells (27). The authors proposed that
the deactivation of CI could be a protective mechanism for a po-
tential burst of free radicals during reoxygenation (27). Unfortu-
nately, they did not investigate the stability of the CI and super-
complexes during hypoxia.
The fact that we observed that conditions producing high levels
of free radicals (antimycin A, myxothiazol, and oligomycin) led to
CI instability and affected the levels of supercomplexes and, con-
versely, that conditions of lower oxygen and, presumably, lower
levels of free radicals preserved supercomplexes even in
OXPHOS-defective cells prompts us to propose a possible model
for regulation of OXPHOS complex interactions into supercom-
plexes. Figure 11 illustrates this model: in wild-type cells,
OXPHOS complexes are able to form stable supercomplexes. Al-
terations in OXPHOS function can produce increased free radi-
cals, which are potentially dangerous. To avoid this, CI is degraded
and supercomplexes disassembled. Under conditions of low oxy-
gen or increased superoxide scavengers (SOD2 or MnTBAP), less
ROS is produced, resulting in the restoration of a safe environ-
ment for the respiratory complexes and supercomplexes to reas-
semble. In addition, supercomplex stability/assembly could be
further regulated by the expression of hypoxia-specific isoforms of
subunits of the respiratory chain and could be mediated by
HIF1-
.
Our results also addressed a previously puzzling observation.
Mouse tissues defective in CIV (21, 22) or CIII (F. Diaz, unpub-
lished observations) did not show a decrease in CI, as consistently
observed in cultured cells. However, the oxygen concentration in
tissues is 3 to 6%, which is markedly lower than the 21% concen-
tration observed in cultured cells. Therefore, we feel compelled to
speculate that increases in tissue oxygenation (physiological or
pathological) may lead to a signaling pathway that controls the
levels of CI and supercomplexes to avoid further exacerbation of
the oxidative stress, as postulated in our model.
In conclusion, our data suggest that localized increases in ROS
levels at the mitochondrial inner membrane affect the assembly/
stability of CI and supercomplexes. CI appears to be particularly
sensitive to this oxidant environment effect. This system may be
physiologically relevant for the control of respiration and ROS
levels.
ACKNOWLEDGMENTS
We express our gratitude to Alejandro Ocampo, Xiao Wang, Sofia Garcia,
and Ana LaTorre for their help with flow cytometry and technical assis-
tance, to T. Wenz for insightful discussions, and to A. Barrientos and E.
Perales-Clemente for critical review of the manuscript. We also thank
Mike Murphy and Rob Smith for providing MitoQ and dTPP.
We are indebted to the following funding agencies for supporting our
work: the James and Esther King Biomedical Research Program, Florida
Department of Health, for grant 08KN-01 (F.D.), PHS for grants
NS041777, CA085700, and EY10804 (C.T.M.), and the Spanish Ministry
of Education for DGA-B55 grants SAF2009-08007 and CSD2007-00020
(J.A.E.). The CNIC is supported by the Spanish Ministry of Science and
Innovation and the Pro-CNIC Foundation.
REFERENCES
1. Acin-Perez R, et al. 2004. Respiratory complex III is required to maintain
complex I in mammalian mitochondria. Mol. Cell 13:805–815.
2. Acín-pérez R, Fernández-Silva P, Peleato ML, Pérez-Martos A,
Enriquez JA. 2008. Respiratory active mitochondrial supercomplexes.
Mol. Cell 32:529–539.
3. Barrientos A, Fontanesi F, Diaz F. 2009. Evaluation of the mitochondrial
respiratory chain and oxidative phosphorylation system using polarogra-
phy and spectrophotometric enzyme assays. Curr. Protoc. Hum. Genet.
Chapter 19:Unit19.3.
4. Bell EL, et al. 2007. The Qo site of the mitochondrial complex III is
required for the transduction of hypoxic signaling via reactive oxygen
species production. J. Cell Biol. 177:1029–1036.
5. Brandt U, Yu L, Yu CA, Trumpower BL. 1993. The mitochondrial
targeting presequence of the Rieske iron-sulfur protein is processed in a
single step after insertion into the cytochrome bc1 complex in mammals
and retained as a subunit in the complex. J. Biol. Chem. 268:8387–8390.
6. Brunelle JK, et al. 2005. Oxygen sensing requires mitochondrial ROS but
not oxidative phosphorylation. Cell Metab. 1:409414.
7. Bultema JB, Braun HP, Boekema EJ, Kouril R. 2009. Megacomplex
organization of the oxidative phosphorylation system by structural anal-
ysis of respiratory supercomplexes from potato. Biochim. Biophys. Acta
1787:60 67.
8. Calvaruso MA, Smeitink J, Nijtmans L. 2008. Electrophoresis techniques
to investigate defects in oxidative phosphorylation. Methods 46:281–287.
9. Calvaruso MA, et al. 7 October 2011. Mitochondrial complex III stabi-
lizes complex I in the absence of NDUFS4 to provide partial activity. Hum.
Mol. Gen. [Epub ahead of print
10. Castello PR, David PS, McClure T, Crook Z, Poyton RO. 2006. Mito-
chondrial cytochrome oxidase produces nitric oxide under hypoxic
conditions: implications for oxygen sensing and hypoxic signaling in eu-
karyotes. Cell metabolism 3:277–287.
11. Chandel NS. 2010. Mitochondrial complex III: an essential component of
universal oxygen sensing machinery? Respir. Physiol. Neurobiol. 174:
175–181.
12. Chandel NS, et al. 1998. Mitochondrial reactive oxygen species trigger
hypoxia-induced transcription. Proc. Natl. Acad. Sci. U. S. A. 95:
11715–11720.
13. Chandel NS, et al. 2000. Reactive oxygen species generated at mitochon-
drial complex III stabilize hypoxia-inducible factor-1alpha during
hypoxia: a mechanism of O2 sensing. J. Biol. Chem/ 275:25130–25138.
14. Chua YL, et al. 2010. Stabilization of hypoxia-inducible factor-1alpha
protein in hypoxia occurs independently of mitochondrial reactive oxy-
gen species production. J. Biol. Chem. 285:31277–31284.
15. Comito G, et al. 2011. HIF-1alpha stabilization by mitochondrial ROS
FIG 11 Model of hypoxic-induced stability of OXPHOS complexes and su-
percomplexes. The mitochondrial OXPHOS complexes are able to associate,
forming stable supercomplexes in wild-type (WT) cells. Defects in OXPHOS
function, such as the absence of RISP, can cause increased levels of potentially
dangerous superoxide. To avoid this, CI is degraded and supercomplexes dis-
assembled. CI stability was particularly compromised by the absence of RISP.
Under conditions of low oxygen or increased superoxide scavengers, less ROS
is produced, resulting in the restoration of a safe environment for reassembly
of OXPHOS complexes and supercomplexes. HIF1-
might mediate assem-
bly/stability by expressing hypoxia-specific isoforms. Supercomplexes may
confer protection against increased ROS upon future changes in oxygen levels.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 427
Page 13
promotes Met-dependent invasive growth and vasculogenic mimicry in
melanoma cells. Free Rad. Biol. Med. 51:893–904.
16. Cruciat CM, Hell K, Folsch H, Neupert W, Stuart RA. 1999. Bcs1p, an
AAA-family member, is a chaperone for the assembly of the cytochrome
bc(1) complex. EMBO J. 18:5226–5233.
17. D’Aurelio M, Gajewski CD, Lenaz G, Manfredi G. 2006. Respiratory
chain supercomplexes set the threshold for respiration defects in human
mtDNA mutant cybrids. Hum. Mol. Genet. 15:2157–2169.
18. Deng K, Shenoy SK, Tso SC, Yu L, Yu CA. 2001. Reconstitution of
mitochondrial processing peptidase from the core proteins (subunits I
and II) of bovine heart mitochondrial cytochrome bc(1) complex. J. Biol.
Chem. 276:6499 6505.
19. Diaz F, Barrientos A, Fontanesi F. 2009. Evaluation of the mitochondrial
respiratory chain and oxidative phosphorylation system using blue native
gel electrophoresis. Curr. Protoc. Hum. Genet. Chapter 19:Unit19.4.
20. Diaz F, Fukui H, Garcia S, Moraes CT. 2006. Cytochrome c oxidase is
required for the assembly/stability of respiratory complex I in mouse fi-
broblasts. Mol. Cell. Biol. 26:4872–4881.
21. Diaz F, et al. 2008. Pathophysiology and fate of hepatocytes in a mouse
model of mitochondrial hepatopathies. Gut 57:232–242.
22. Diaz F, Thomas CK, Garcia S, Hernandez D, Moraes CT. 2005. Mice
lacking COX10 in skeletal muscle recapitulate the phenotype of progres-
sive mitochondrial myopathies associated with cytochrome c oxidase de-
ficiency. Hum. Mol. Genet. 14:2737–2748.
23. Fandrey J, Frede S, Jelkmann W. 1994. Role of hydrogen peroxide in
hypoxia-induced erythropoietin production. Biochem. J. 303(Pt 2):
507–510.
24. Fato R, et al. 2009. Differential effects of mitochondrial complex I inhib-
itors on production of reactive oxygen species. Biochim. Biophys. Acta
1787:384–392.
25. Fernandez-Vizarra E, et al. 2007. Impaired complex III assembly associ-
ated with BCS1L gene mutations in isolated mitochondrial encephalo-
pathy. Hum. Mol. Genet. 16:1241–1252.
26. Frenzel M, Rommelspacher H, Sugawa MD, Dencher NA. 2010. Ageing
alters the supramolecular architecture of OxPhos complexes in rat brain
cortex. Exp. Gerontol. 45:563–572.
27. Galkin A, Abramov AY, Frakich N, Duchen MR, Moncada S. 2009. Lack
of oxygen deactivates mitochondrial complex I: implications for ischemic
injury? J. Biol. Chem. 284:36055–36061.
28. Garcia S, Diaz F, Moraes CT. 2008. A 3= UTR modification of the
mitochondrial Rieske iron sulfur protein in mice produces a specific skin
pigmentation phenotype. J. Investig. Dermatol. 128:2343–2345.
29. Genova ML, et al. 2008. Is supercomplex organization of the respiratory
chain required for optimal electron transfer activity? Biochim. Biophys.
Acta 1777:740–746.
30. Genova ML, et al. 2001. The site of production of superoxide radical in
mitochondrial complex I is not a bound ubisemiquinone but presumably
iron-sulfur cluster N2. FEBS Lett. 505:364–368.
31. Gil-Borlado MC, et al. 2009. Pathogenic mutations in the 5= untranslated
region of BCS1L mRNA in mitochondrial complex III deficiency. Mito-
chondrion 9:299–305.
32. Graham LA, Trumpower BL. 1991. Mutational analysis of the mitochon-
drial Rieske iron-sulfur protein of Saccharomyces cerevisiae. III. Import,
protease processing, and assembly into the cytochrome bc1 complex of
iron-sulfur protein lacking the iron-sulfur cluster. J. Biol. Chem. 266:
22485–22492.
33. Guzy RD, et al. 2005. Mitochondrial complex III is required for hypoxia-
induced ROS production and cellular oxygen sensing. Cell Metab.
1:401–408.
34. Hamanaka RB, Chandel NS. 2010. Mitochondrial reactive oxygen species
regulate cellular signaling and dictate biological outcomes. Trends
Biochem. Sci. 35:505–513.
35. Han D, Williams E, Cadenas E. 2001. Mitochondrial respiratory chain-
dependent generation of superoxide anion and its release into the inter-
membrane space. Biochem. J. 353:411–416.
36. Hinson JT, et al. 2007. Missense mutations in the BCS1L gene as a cause
of the Björnstad syndrome. N. Engl. J. Med. 356:809819.
37. Jung HJ, et al. 2010. Terpestacin inhibits tumor angiogenesis by targeting
UQCRB of mitochondrial complex III and suppressing hypoxia-induced
reactive oxygen species production and cellular oxygen sensing. J. Biol.
Chem. 285:11584–11595.
38. Kelso GF, et al. 2001. Selective targeting of a redox-active ubiquinone to
mitochondria within cells: antioxidant and antiapoptotic properties. J.
Biol. Chem. 276:4588 4596.
39. Kronekova Z, Rodel G. 2005. Organization of assembly factors Cbp3p
and Cbp4p and their effect on bc(1) complex assembly in Saccharomyces
cerevisiae. Curr. Genet. 47:203–212.
40. Lazarou M, McKenzie M, Ohtake A, Thorburn DR, Ryan MT. 2007.
Analysis of the assembly profiles for mitochondrial- and nuclear-DNA-
encoded subunits into complex I. Mol. Cell. Biol. 27:42284237.
41. Lenaz G. 2001. The mitochondrial production of reactive oxygen species:
mechanisms and implications in human pathology. IUBMB Life 52:
159–164.
42. Lenaz G, Genova ML. 2010. Structure and organization of mitochondrial
respiratory complexes: a new understanding of an old subject. Antioxid.
Redox Signal. 12:961–1008.
43. Li Y, et al. 2007. An assembled complex IV maintains the stability and
activity of complex I in mammalian mitochondria. J. Biol. Chem. 282:
17557–17562.
44. Liu Y, Schubert DR. 2009. The specificity of neuroprotection by antiox-
idants. J. Biomed. Sci. 16:98.
45. Lochmuller H, Johns T, Shoubridge EA. 1999. Expression of the E6 and
E7 genes of human papillomavirus (HPV16) extends the life span of hu-
man myoblasts. Exp. Cell Res. 248:186–193.
46. Mansfield KD, et al. 2005. Mitochondrial dysfunction resulting from loss
of cytochrome c impairs cellular oxygen sensing and hypoxic HIF-alpha
activation. Cell Metab. 1:393–399.
47. McKenzie M, Lazarou M, Thorburn DR, Ryan MT. 2006. Mitochon-
drial respiratory chain supercomplexes are destabilized in Barth syndrome
patients. J. Mol. Biol. 361:462–469.
48. Mehta JP, et al. 2008. Generation of oxidants by hypoxic human pulmo-
nary and coronary smooth-muscle cells. Chest 133:1410–1414.
49. Moran M, et al. 2010. Cellular pathophysiological consequences of
BCS1L mutations in mitochondrial complex III enzyme deficiency. Hum.
Mutat. 31:930–941.
50. Patten DA, et al. 2010. Hypoxia-inducible factor-1 activation in nonhy-
poxic conditions: the essential role of mitochondrial-derived reactive ox-
ygen species. Mol. Biol. Cell 21:3247–3257.
51. Perales-Clemente E, et al. 2010. Five entry points of the mitochondrially
encoded subunits in mammalian complex I assembly. Mol. Cell. Biol.
30:3038–3047.
52. Pfeiffer K, et al. 2003. Cardiolipin stabilizes respiratory chain supercom-
plexes. J. Biol. Chem. 278:52873–52880.
53. Poyton RO, Ball KA, Castello PR. 2009. Mitochondrial generation of free
radicals and hypoxic signaling. Trends Endocrinol. Metab. 20:332–340.
54. Rosca MG, et al. 2008. Cardiac mitochondria in heart failure: decrease in
respirasomes and oxidative phosphorylation. Cardiovasc. Res. 80:30–39.
55. Saddar S, Dienhart MK, Stuart RA. 2008. The F1F0-ATP synthase com-
plex influences the assembly state of the cytochrome bc1-cytochrome ox-
idase supercomplex and its association with the TIM23 machinery. J. Biol.
Chem. 283:6677–6686.
56. Salnikow K, Su W, Blagosklonny MV, Costa M. 2000. Carcinogenic
metals induce hypoxia-inducible factor-stimulated transcription by reac-
tive oxygen species-independent mechanism. Cancer Res. 60:3375–3378.
57. Sanjuan-Pla A, et al. 2005. A targeted antioxidant reveals the importance
of mitochondrial reactive oxygen species in the hypoxic signaling of HIF-
1alpha. FEBS Lett. 579:2669–2674.
58. Schagger H, Pfeiffer K. 2001. The ratio of oxidative phosphorylation
complexes I-V in bovine heart mitochondria and the composition of re-
spiratory chain supercomplexes. J. Biol. Chem. 276:37861–37867.
59. Soto IC, et al. 2009. Synthesis of cytochrome c oxidase subunit 1 is
translationally downregulated in the absence of functional F1F0-ATP syn-
thase. Biochim. Biophys. Acta 1793:1776–1786.
60. Strecker V, Wumaier Z, Wittig I, Schagger H. 2010. Large pore gels to
separate mega protein complexes larger than 10MDa by blue native
electrophoresis: isolation of putative respiratory strings or patches. Pro-
teomics 10:3379–3387.
61. Sun J, Trumpower BL. 2003. Superoxide anion generation by the cyto-
chrome bc1 complex. Arch. Biochem. Biophys. 419:198–206.
62. Trumpower BL. 1990. The protonmotive Q cycle. Energy transduction by
coupling of proton translocation to electron transfer by the cytochrome
bc1 complex. J. Biol. Chem. 265:11409–11412.
63. Vaux EC, Metzen E, Yeates KM, Ratcliffe PJ. 2001. Regulation of
hypoxia-inducible factor is preserved in the absence of a functioning mi-
tochondrial respiratory chain. Blood 98:296–302.
Diaz et al.
428 mcb.asm.org Molecular and Cellular Biology
Page 14
64. Vempati UD, Han X, Moraes CT. 2009. Lack of cytochrome c in mouse
fibroblasts disrupts assembly/stability of respiratory complexes I and IV. J.
Biol. Chem. 284:4383–4391.
65. Vinogradov AD. 1998. Catalytic properties of the mitochondrial NADH-
ubiquinone oxidoreductase (complex I) and the pseudo-reversible active/
inactive enzyme transition. Biochim. Biophys. Acta 1364:169–185.
66. Waypa GB, et al. 2010. Hypoxia triggers subcellular compartmental re-
dox signaling in vascular smooth muscle cells. Circ. Res. 106:526–535.
67. Wenz T, et al. 2009. Role of phospholipids in respiratory cytochrome
bc(1) complex catalysis and supercomplex formation. Biochim. Biophys.
Acta 1787:609 616.
68. Weydert CJ, Cullen JJ. 2010. Measurement of superoxide dismutase,
catalase and glutathione peroxidase in cultured cells and tissue. Nat. Pro-
toc. 5:51–66.
69. Wittig I, Carrozzo R, Santorelli FM, Schagger H. 2006. Supercomplexes
and subcomplexes of mitochondrial oxidative phosphorylation. Biochim.
Biophys. Acta 1757:1066–1072.
70. Zara V, Conte L, Trumpower BL. 2009. Evidence that the assembly of
the yeast cytochrome bc1 complex involves the formation of a large
core structure in the inner mitochondrial membrane. FEBS J. 276:
1900–1914.
71. Zara V, Conte L, Trumpower BL. 2007. Identification and characteriza-
tion of cytochrome bc(1) subcomplexes in mitochondria from yeast with
single and double deletions of genes encoding cytochrome bc(1) subunits.
FEBS J. 274:4526 4539.
72. Zhang L, Yu L, Yu CA. 1998. Generation of superoxide anion by
succinate-cytochrome c reductase from bovine heart mitochondria. J.
Biol. Chem. 273:33972–33976.
RISP Knockout Decreases Levels of Complexes I and IV
January 2012 Volume 32 Number 2 mcb.asm.org 429
Page 15
  • Source
    • "Also a mutation in the UQCRC2 subunit resulted in aberrant supercomplex formation and deficiency of complex I in addition to complex III (Miyake et al 2013 ). Similar results were found in a knockdown cell line of Rieske iron-sulphur protein, another subunit of complex III (Diaz et al 2012). Furthermore, a deficiency of supercomplex formation was shown in SURF1 deficiency, which is known to be an assembly factor of cytochrome c oxidase (Kovarova et al 2012 ). "
    [Show abstract] [Hide abstract] ABSTRACT: Inherited disorders of mitochondrial energy metabolism form a large and heterogeneous group of metabolic diseases. More than 250 gene defects have been reported to date and this number continues to grow. Mitochondrial diseases can be grouped into (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis. Deficiency of more than one respiratory chain enzyme is a common finding. Combined defects are found in 49 % of the known disease-causing genes of mitochondrial energy metabolism and in 57 % of patients with OXPHOS defects identified in our diagnostic centre. Combined defects of complexes I, III, IV and V are typically due to deficiency of mitochondrial DNA replication, RNA metabolism or translation. Defects in cofactors can result in combined defects of various combinations, and defects of mitochondrial homeostasis can result in a generalised decrease of all OXPHOS enzymes. Noteworthy, identification of combined defects can be complicated by different degrees of severity of each affected enzyme. Furthermore, even defects of single respiratory chain enzymes can result in combined defects due to aberrant formation of respiratory chain supercomplexes. Combined OXPHOS defects have a great variety of clinical manifestations in terms of onset, course severity and tissue involvement. They can present as classical encephalomyopathy but also with hepatopathy, nephropathy, haematologic findings and Perrault syndrome in a subset of disorders.
    Full-text · Article · Mar 2015 · Journal of Inherited Metabolic Disease
  • Source
    • "Here, we reported that Uqcrfs1 is also a cerebellar PGC-1α- dependent gene. Uqcrfs1 is a component of complex III of the mitochondrial electron transport chain, and while other members of complex III can associate to form a complex in the absence of uqcrfs1, the resultant complex has limited enzymatic activity, leading to the degradation of complexes I and IV (Diaz et al., 2012). Thus, the combined decreases in expression of the metabolism-related genes Phyh, Idh3a, Mfn2, MnSOD, and Uqcrfs1 may lead to abnormalities in energy homeostasis or the increased production of reactive oxygen species, contributing to decreased viability of Purkinje cells of PGC-1α −/− animals. "
    [Show abstract] [Hide abstract] ABSTRACT: Alterations in the expression and activity of the transcriptional coactivator peroxisome proliferator-activated receptor γ coactivator-1α (ppargc1a or PGC-1α) have been reported in multiple movement disorders, yet it is unclear how a lack of PGC-1α impacts transcription and function of the cerebellum, a region with high PGC-1α expression. We show here that mice lacking PGC-1α exhibit ataxia in addition to the previously described deficits in motor coordination. Using q-RT-PCR in cerebellar homogenates from PGC-1α −/− mice, we measured expression of 37 microarray-identified transcripts upregulated by PGC-1α in SH-SY5Y neuroblastoma cells with neuroanatomical overlap with PGC-1α or parvalbumin (PV), a calcium buffer highly expressed by Purkinje cells. We found significant reductions in transcripts with synaptic (complexin1, Cplx1; Pacsin2), structural (neurofilament heavy chain, Nefh), and metabolic (isocitrate dehydrogenase 3a, Idh3a; neutral cholesterol ester hydrolase 1, Nceh1; pyruvate dehydrogenase alpha 1, Pdha1; phytanoyl-CoA hydroxylase, Phyh; ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, Uqcrfs1) functions. Using conditional deletion of PGC-1α in PV-positive neurons, we determined that 50% of PGC-1α expression and a reduction in a subset of these transcripts could be explained by its concentration in PV-positive neuronal populations in the cerbellum. To determine whether there were functional consequences associated with these changes, we conducted stereological counts and spike rate analysis in Purkinje cells, a cell type rich in PV, from PGC-1α −/− mice. We observed a significant loss of Purkinje cells by 6 weeks of age, and the remaining Purkinje cells exhibited a 50% reduction in spike rate. Together, these data highlight the complexity of PGC-1α's actions in the central nervous system and suggest that dysfunction in multiple cell types contribute to motor deficits in the context of PGC-1α deficiency.
    Full-text · Article · Jan 2015 · Frontiers in Cellular Neuroscience
  • Source
    • "These results suggest an impairment of CI levels/activity induced by the presence of MT-CYB microdeletion, in agreement with several previous reports indicating a tight dependence between CIII mutations and CI assembly/activity [Acin-Perez et al., 2004; Schagger et al., 2004; Blakely et al., 2005]. The reduction of CIV activity observed in both heteroplasmic and homoplasmic cybrids is more difficult to explain and further experiments are needed to shed light on the relationship between MT-CYB mutations and CIV activity that is still controversial and poorly understood [Rana et al., 2000; Acin-Perez et al., 2004; Diaz et al., 2012; Lapuente-Brun et al., 2013]. "
    [Show abstract] [Hide abstract] ABSTRACT: A novel heteroplasmic mitochondrial DNA (mtDNA) micro-deletion affecting the cytochrome b gene (MT-CYB) was identified in an Italian female patient with a multisystem disease characterized by sensorineural deafness, cataracts, retinal pigmentary dystrophy, dysphagia, postural and gait instability and myopathy with prominent exercise intolerance. The deletion is 18-base pair long and encompasses nucleotide positions 15649-15666, causing the loss of six amino acids (Ile-Leu-Ala-Met-Ile-Pro) in the protein, but leaving the remaining of the MT-CYB sequence in frame. The defective complex III function was co-transferred with mutant mtDNA in cybrids, thus unequivocally establishing its pathogenic role. Maternal relatives failed to show detectable levels of the deletion in blood and urinary epithelium, suggesting a de-novo mutational event. This is the second report of an in-frame intragenic deletion in MT-CYB, which most likely occurred in early stages of embryonic development, associated with a severe multisystem disorder with prominent exercise intolerance. This article is protected by copyright. All rights reserved.
    Full-text · Article · Aug 2014 · Human Mutation
Show more