ArticlePDF Available

Abstract and Figures

The majority of environmental micro-organisms identified with the rRNA approach have never been visualized. Thus, their reliable classification and taxonomic assignment is often difficult or even impossible. In our preliminary 18S rRNA gene sequencing work from the world's largest anoxic marine environment, the Cariaco Basin (Caribbean Sea, Venezuela), we detected a ciliate clade, designated previously as CAR_H [Stoeck, S., Taylor, G. T. & Epstein, S. S. (2003). Appl Environ Microbiol 63, 5656-5663]. Here, we combine the traditional rRNA detection method of fluorescent in situ hybridization (FISH) with scanning electron microscopy (SEM) and confirm the phylogenetic separation of the CAR_H sequences from all other ciliate classes by showing an outstanding morphological feature of this group: a unique, archway-shaped kinety surrounding the oral apparatus and extending to the posterior body end in CAR_H cells. Based on this specific feature and the molecular phylogenies, we propose a novel ciliate class, Cariacotrichea nov. cl.
Content may be subject to copyright.
Class Cariacotrichea, a novel ciliate taxon from the
anoxic Cariaco Basin, Venezuela
William Orsi,
1
Virginia Edgcomb,
2
3Jose Faria,
3
3Wilhelm Foissner,
4
34
William H. Fowle,
1
3Tine Hohmann,
1
3Paula Suarez,
3
3Craig Taylor,
2
3
Gordon T. Taylor,
5
3Peter Vd’ac
ˇny´
6
3and Slava S. Epstein
1
4
Correspondence
Wilhelm Foissner
wilhelm.foissner@sbg.ac.at
Slava S. Epstein
s.epstein@neu.edu
1
Department of Biology, Northeastern University, 313 Mugar Building, Boston, MA 02115, USA
2
Department of Geology and Geophysics, Woods Hole Oceanographic Institution, Woods Hole,
MA 02543, USA
3
Departamento de Biologı´a de Organismos, Universidad Simo
´n Bolı´var, Sartenejas, Baruta,
Estado Miranda, Venezuela
4
Department of Organismal Biology, University of Salzburg, Hellbrunnerstrasse 34, Salzburg,
A 5020, Austria
5
Marine Sciences Research Center, State University of New York, Stony Brook, NY 11794, USA
6
Department of Zoology, Comenius University, Mlynska
´dolina B-1, Bratislava, SK 84215,
Slovak Republic
The majority of environmental micro-organisms identified with the rRNA approach have never
been visualized. Thus, their reliable classification and taxonomic assignment is often difficult or
even impossible. In our preliminary 18S rRNA gene sequencing work from the world’s largest
anoxic marine environment, the Cariaco Basin (Caribbean Sea, Venezuela), we detected a ciliate
clade, designated previously as CAR_H[Stoeck, S., Taylor, G. T. & Epstein, S. S. (2003). Appl
Environ Microbiol 63, 5656–5663]. Here, we combine the traditional rRNA detection method of
fluorescent in situ hybridization (FISH) with scanning electron microscopy (SEM) and confirm the
phylogenetic separation of the CAR_H sequences from all other ciliate classes by showing an
outstanding morphological feature of this group: a unique, archway-shaped kinety surrounding the
oral apparatus and extending to the posterior body end in CAR_H cells. Based on this specific
feature and the molecular phylogenies, we propose a novel ciliate class, Cariacotrichea nov. cl.
INTRODUCTION
Ciliates are highly differentiated and specialized microbial
eukaryotes. The most widely recognized unifying trait
of ciliates is dimorphic nuclei, namely a large macro-
nucleus accompanied by a small micronucleus. A further
characteristic feature is a large number of cilia that are
present at least in some stage(s) of their life cycle. Ciliates
occur across almost every habitat on Earth, from inside
ice and the deep-sea to internal organs of animals (Lynn,
2008). After over 200 years of research on their diversity,
morphology, physiology and evolution, the discovery of
new ciliate taxa continues (Foissner et al., 2002; Song
et al., 2009).
The application of the rRNA approach to environmental
samples suggests the presence of an enormous ‘unseen’
diversity of micro-organisms including ciliates (Epstein &
Lopez-Garcia, 2008). Anoxic environments in particular
have been shown to house a diverse assemblage of micro-
bial eukaryotes of high phylogenetic novelty (e.g. Stoeck
et al.,2003a;Edgcombet al.,2002;Alexanderet al., 2009)
but for the majority of these clades there exists no mor-
phological data. The Cariaco Basin is the largest marine
anoxic basin in the world exhibiting numerous geochem-
ical gradients within the redox transition zone (Taylor
et al., 2001), below which many novel lineages of 18S
rRNA genes have been detected, at different levels of
taxonomic affiliation, from species to classes (Orsi et al.,
2011; Stoeck et al., 2003a, 2006). In 2003, one of these
clades, designated previously as CAR_H (Stoeck et al.,
2003a), was discovered to be affiliated with the ciliates and
phylogenetically distinct from all of the described classes.
Such a high level of phylogenetic novelty is remarkable
considering the widespread belief that ciliates are the best
3These authors are listed in alphabetical order.
4These authors contributed equally to this work.
Abbreviations: FISH, fluorescent in situ hybridization; SEM, scanning
electron microscopy.
A supplementary movie is available with the online version of this paper.
International Journal of Systematic and Evolutionary Microbiology (2012), 62, 1425–1433 DOI 10.1099/ijs.0.034710-0
034710 G2012 IUMS Printed in Great Britain 1425
studied protistan phylum, such that its species have been
mostly discovered (Finlay et al., 1996; but see Foissner
et al., 2008 for discussion). This prompted us to visualize the
cells of the CAR_H clade. Conventional silver staining-based
methods for proper species description require a significant
number of specimens and could not be used here: the natural
abundance of CAR_H cells is low and our attempts to
cultivate them were not successful. However, we were able to
obtain specimens by fixing the cells in situ using a specially
modified deep-sea sampler (Taylor & Doherty, 1990;
Edgcomb et al., 2011b). This provided a means to detect
and visualize the cells of interest using a combined fluo-
rescent in situ hybridization (FISH)/scanning electron micro-
scopy (SEM) approach developed by our group (Stoeck et al.,
2003b). Analyses of SEM images of the CAR_H cells show
that they retain a unique feature not yet seen in any known
ciliate, an archway-shaped kinety extending the whole body
length and surrounding the oral opening. This feature
supports the level of novelty implied by sequence data. We
suggest that the ciliates from the CAR_H clade be considered
as a novel taxon, Cariacotrichea nov. cl., that corresponds to
a new, class-level group of ciliates.
METHODS
Sampling site. The sampling site was located in the eastern portion
of the Cariaco Basin located at 10.50uN 64.66uW. This is the location
of a microbial observatory established there in 2005 (Edgcomb et al.,
2011a, b; Orsi et al., 2011) and the time series station of the
cooperative US-Venezuelan Carbon Retention in a Colored Ocean
(CARIACO) program (Taylor et al., 2001; Muller-Karger et al., 2001).
Samples were taken aboard the R/V Hermano Gine
´soperated by
Estacio
´n de Investigaciones Marinas (EDIMAR), Fundacio
´n la Salle
de Ciencias Naturales, located on Margarita Island, Venezuela.
Sample collection and fixation. Samples for FISH-SEM were taken
in January 2009. The position of the oxic/anoxic interface in the water
column was determined just prior to sample collection using a CTD
scanner equipped with a YSI oxygen probe (Sea-Bird electronics)
mounted on a Niskin rosette (General Oceanics). The location of the
interface was defined as the depth at which the oxygen concentration
dropped to zero. At the time of sampling, this depth was 250 m.
Samples for FISH-SEM were taken from a depth of 900 m using a
large sample volume submersible incubation device (LV-SID) in situ
water column sampler (Taylor & Doherty, 1990; Taylor et al., 1993),
which allows for sample fixation at the point of sampling. The LV-
SID sample collection chambers were prefilled with a mixture of
Bouin’s fixative and glutaraldehyde. The volume of the fixative was
such that the final concentration of the fixed sample would contain
0.2 % glutaraldehyde and 50 % Bouin’s fixative. The LV-SID was
programmed on deck to take a 4 l sample of water at 900 m, to be
mixed in situ with the pre-loaded fixative. Fixed samples were
transferred on deck to a 4 l carboy, stored at 4 uC and processed
within 24 h at the EDIMAR shore lab on Margarita Island.
Probe design, evaluation and optimization. We designed a FISH
probe, CARH658 (59-UACUGAUACCCCCGACUGUUUC-39, 22 nt,
G+C content 59 %), to target a CAR _H 18S rRNA gene sequence,
BCB5F14RJ2E06 (GenBank accession no. GU819615), discovered in
our recent survey of the Cariaco Basin (Edgcomb et al., 2011a, b). The
probe-binding site was located using the Probe Design tool available
in the ARB software package (Ludwig et al., 2004). The location of the
hybridization region is within the most accessible portion of the 18S
rRNA gene (positions 658–680 of accession no. GU819615) based on
Saccharomyces cerevisiae secondary structure (Behrens et al., 2003).
The CARH658 probe is unique to the target clade as confirmed by
comparing its sequence to the GenBank-nt database using BLASTN and
the ARB-SILVA database using the Probe Match tool. Allowing for one to
four mismatches, we identified in the public databases only one
uncultivated (anaerobic ciliate Epalxella antiquorum; GenBank acces-
sion no. EF014286) and no cultivated protists. The closest cultivated
species available to test the specificity of the probe is Chlamydomonas
monadina, which exhibits five mismatches to the CARH658 probe. A
culture of Chlamydomonas monadina was obtained and fixed (50 %
Bouin’s fixative, 0.2 % glutaraldehyde) for use in a negative control
experiment in order to optimize hybridization parameters for the
probe. A range of 0–40 % formamide in the hybridization buffer as
well as incubations ranging from 2–4 h were tested to determine
the stringency required to eliminate visible non-specific binding of
the CARH658 FISH probe. The set of incubation parameters that
produced the lowest amount of FISH signal with Chlamydomonas
monadina was chosen for use with environmental samples to detect
ciliates from the CAR_H clade. In a two-hour incubation using 40 %
formamide at 46 uC, the fluorescence from the CARH658 probe was
equal to that of the nonsense probe when used with the fixed culture
of Chlamydomonas monadina (Fig. 1). Thus, we used these hybri-
dization parameters in FISH-SEM for the detection of Cariacothrix
caudata nov. spec.
To confirm the phylogenetic separation of the CAR_H clade from all
ciliate classes and those species that appear similar to members of the
CAR_H clade, the 18S rRNA gene sequence BCB5F14RJ2E06 was
added to a sequence alignment incorporating representatives from all
ciliate classes and ciliates morphologically similar to CAR_H cells.
Only sites that could be reliably aligned were included in subsequent
phylogenetic analyses. Sequences were aligned using the FASTAligner
function in ARB (Ludwig et al., 2004), and alignments were then
Fig. 1. Application of the probe CARH658 (a; lack of hybridization)
and a universal eukaryotic probe Euk1209R (b; presence of
hybridization) to a fixed culture of Chlamydomonas monadina.
W. Orsi and others
1426 International Journal of Systematic and Evolutionary Microbiology 62
manually refined. Alignments of the original sequences, along with
GenBank reference sequences, were analysed using Bayesian and
maximum-likelihood inference methods using RAxML (Stamatakis
et al., 2008) and MrBayes (Ronquist & Huelsenbeck, 2003). Due to
missing sequence information at the 59end of many CAR_H-related
sequences, non-CAR_H sequences were truncated in the alignment to
match this shorter length. Phylogenetic analyses were performed on
the CIPRES portal (www.phylo.org) under the GTR+I+Gamma
model. The model of evolution for phylogenetic analyses was chosen
using ModelTest (Posada & Crandall, 1998). The reliability of the
maximum-likelihood tree was assessed using 1000 bootstrap replicates.
The Bayesian analysis consisted of two independent runs with 5610
6
generations. Trees were sampled every 1000 generations with 25 %
discarded as burn-in. Topologies of maximum-likelihood and Bayesian
trees were compared and the tree with the best log-likelihood was
chosen for presentation.
FISH-SEM and SEM preparation. Samples fixed in situ for FISH-
SEM were processed within 24 h according to the protocol developed
by Stoeck et al. (2003b), with some minor modifications. In short,
fixed samples were filtered onto 0.4 mm polycarbonate transwell
membrane filters (Corning Life Sciences) and washed with 16PBS
(pH 7.4). PBS was gradually replaced during three cycles of bringing
the volume of liquid covering the filter down to 500 ml followed by
adding 3 ml hybridization buffer containing 40 % formamide. After
washing, 500 ml Cy3 labelled probe CARH658 (30 ng ml
21
) was added
to 3 ml fresh hybridization buffer that covered the membrane.
Transwells were incubated at 46 uC for 2 h in the dark, followed by
incubation with a washing buffer preheated to 48 uC for 10 min, and
washing with distilled water. Transwells were then taken through a
dehydration series in preparation for SEM and fixed with 100 %
hexamethyldisilizane (Electron Microscopy Sciences) before air-
drying. As specifically noted by Stoeck et al. (2003b), it was critical
not to expose the transwell filters to air at any point during the
protocol, until this final step, as such exposure would have caused
most fixed protists to collapse. The entire procedure was completed
within 24 h after sampling, and the air-dried transwell filters were
wrapped in aluminium foil and shipped back to the USA at 4 uC.
Upon arrival they were immediately placed in a 220 uC freezer until
further processing.
For comparison, ordinary SEM preparations were made, following
the method of Foissner (1991). However, cells were deciliated with a
detergent, as described by Foissner (2003).
Fluorescence microscopy and SEM. FISH-SEM prepared filters
were cut out of the transwells using a scalpel and placed on a glass
slide for visualization via epifluorescence. All filters were examined
with dry objectives, as using immersion oil would have precluded the
use of SEM. Filters were first scanned at 2006under appropriate
illumination using a Zeiss AxioPlan 2 epifluorescence microscope
equipped with a HBO 100 W mercury bulb; 106Neofluar, 206
Neofluar and 406(dry) Neofluar objectives; 106eye pieces; DAPI
and Cy3 filter sets; and a Hamamatsu CCD camera. Photographs of
positively Cy3 labelled cells were taken at 4006. The position of such
cells was then marked for downstream (SEM) observations by making
puncture marks with tweezers in the filter next to the cell’s location. A
minimum of three different punctures around the cell was needed to
facilitate finding the labelled cell under SEM. The filter was then
mounted onto a SEM specimen holder with a carbon adhesive tab
and sputter coated with 10–15 nm of a mixture of platinum and
palladium with a Tousimis Samsputter 2A (Tousimis Research
Corporation). SEM was performed on a Hitachi S-4800 scanning
electron microscope. Approximate location of the marked cell was
achieved under low-magnification mode by finding the puncture
marks in the filter. The exact location of the cell was then determined
in reference to the previously noted position of the cell (during
epifluorescence microscopy) in relation to the puncture marks. High
magnification mode was used to take detailed photographs of the Cy3
labelled cells for morphological assessments. For creation of the film
(see Movie S1, available in IJSEM Online), a Cy3 labelled cell was
photographed multiple times, rotating the specimen one degree for
each subsequent photo. The resulting photographs were imported
into ImageJ (Abramoff et al., 2004) and exported as a Quicktime
movie file (Movie S1).
RESULTS
Taxonomic description
Class Cariacotrichea nov. cl.
Diagnosis. Small, anaerobic Ciliophora with an archway-
shaped kinety surrounding the oral opening and extending
to posterior body end; contain a rRNA gene exhibiting 88 %
sequence similarity with the closest related rRNA sequence from
the described species Amphisiella magnigranulosa (GenBank
accession no. AM412774); contain a unique molecular signature
‘GAAACAGUCGGGGGUAUCAGUA’ (spanning nucleotide
positions 283–305 of GenBank accession no. GU819615).
Type order. Cariacotrichida nov. ord.
Order Cariacotrichida nov. ord.
Diagnosis. Cariacotrichea with oral apparatus in anterior
body half. At least two adoral organelles.
Type family. Cariacotrichidae nov. fam.
Family Cariacotrichidae nov. fam.
Diagnosis. Cariacotrichida with one adoral organelle in left
posterior corner of oral cavity.
Type genus. Cariacothrix nov. gen.
Genus Cariacothrix.
Diagnosis. As for family.
Type species. Cariacothrix caudata nov. spec.
Etymology. Composite of the acronym CARIACO (for both
the geographical name of the region and the multi-
institutional ocean time series project Carbon Retention In
A Colored Ocean) and the Greek noun thrix (hair, cilium).
Feminine gender.
Cariacothrix caudata nov. spec.
Diagnosis. FISH-SEM cells about 26610 mm in size. Body
ellipsoidal with flattened, slightly rostrate anterior (oral)
region. About 8 ciliary rows and two distinctly elongated
caudal cilia.
Type locality. Anoxic, sulfidic water column (900 m depth)
of the Cariaco Basin, Venezuela, 10u509N 64u669W.
Etymology. The epithet refers to the conspicuous caudal cilia.
Type material. SEM prepared filters containing in situ
samples from the deep anoxic portion of the Cariaco Basin.
SEM stubs containing Cariacotrichea specimens have been
Cariacotrichea, a novel ciliate taxon
http://ijs.sgmjournals.org 1427
deposited in the Smithsonian Institution (National
Museum of Natural History, Washington, DC, USA),
under accession numbers 1155310, 1155311, 1155312,
1155313, 1155314 and 1155315. We declare the specimen
shown in Figs 2a, c, d and 3b as the holotype. It is
contained on SEM stub 1155310.
Sequence data. The GenBank accession number for the
partial 18S rRNA gene sequence of clone BCB5F14RJ2E06
is GU819615.
Description. In total, 14 specimens were located by scanning
filters under epifluorescence using the Cy3 filter set, of which
Fig. 2. (a–g) FISH-SEM micrographs of Cariacothrix caudata (a–f) and an ordinary SEM micrograph of a deciliated ciliate (g).
(a, c, d) Ventral overview and details from the anterior and posterior body region of the holotype specimen. The arrowheads in
(a) mark the region shown in (c), i.e. the oral apparatus. The three arrowheads in (c) mark the apex of the archway kinety which is
not interrupted, the most specific feature of the cariacotrichean ciliates. The caudal cilia arise from the last kinetids of the
archway kinety (a, d). (b, f) Lateral overview and detail, showing the rostrate anterior body region, the adoral organelles and the
two branches of the archway kinety. (e) The ciliate’s surface is densely covered by rod-shaped bacteria. (g) Oral region of a
tetrahymenid ciliate. Note the similarity of paroral membrane and archway kinety. AO, Adoral organelles; C, ordinary somatic
cilia; CC, caudal cilia; CR, somatic ciliary row; LB, left branch of archway kinety; OA, oral apparatus; PM, paroral membrane; R,
ridge; RB, right branch of archway kinety; RO, rostrum. Bars, 1 mm (e), 2 mm (c, d, f), 10 mm (b), 20 mm (a). National Museum of
Natural History (IJSNM) accession numbers: 1155310 (a, c, d) and 1155311 (b, g).
W. Orsi and others
1428 International Journal of Systematic and Evolutionary Microbiology 62
Fig. 3. (a–e) FISH-SEM micrographs of Cariacothrix caudata (a–d) and Cariacothrix sp. (e). (a, c) Ventral and lateral overviews,
showing the two branches of the archway kinety extending whole body length (see also Fig. 2a–c). Note the rostrate anterior
body region (c). (b) Lateral view of the holotype specimen, showing the flattened anterior body region and long cilia of the right
branch of the archway kinety. (d) Right side overview, showing the dense ciliation. (e) Very likely, this is a second, slightly larger
species, which is completely ciliated and has the oral apparatus ahead of mid-body. AO, Adoral organelles; C, ordinary somatic
cilia, LB, left branch of the archway kinety; OA, oral apparatus; RB, right branch of the archway kinety; RO, rostrum. Bars, 9 mm
(a, b), 12 mm (c, d, e). National Museum of Natural History (IJSNM) accession numbers: 1155310 (b), 1155312 (a), 1155313
(c), 1155314 (d), 1155315 (e).
Cariacotrichea, a novel ciliate taxon
http://ijs.sgmjournals.org 1429
12 were useable; of these, 11 likely belong to Cariacothrix
caudata, while one might be a different species (Fig. 3e). No
cells were visible on filters stained with a nonsense probe.
The mean size of the FISH-labelled cells is 26.469.8 mm
[median 2669.5; SD 5 and 2.3; coefficient of variation (%)
18.9 and 23.4; minimum 17 and 7; maximum 33 and 14;
number of cells 12]after processing samples for FISH-SEM.
Assuming a preparation shrinkage of 20 % for the body, as
is common in dehydrated cells, Cariacothrix caudata might
have an in vivo size of about 32612 mm. When seen ven-
trally, the body is ellipsoidal to very bluntly fusiform, while it
is slenderly ovate and rather distinctly rostrate in lateral
view. The rostrate anterior third contains the oral cavity and
is conspicuously flattened (Figs 4a, b, 2a, b, 3a–c, d and
Movie S1). There is a single, ellipsoidal macronucleus and a
globular micronucleus consistently in the posterior half of
the body as visualized by DAPI staining (Figs 5a–c, 4a). In
the SEM images, the cortex is almost completely covered by
epibiotic bacteria approximately 1 mm long (Fig. 2e and
Movie S1). The cilia are 10 to 15 mm long and 0.2 mm thick,
as typical for many ciliates; likely, they did not or only
slightly shrink during preparation.
The ciliature has been rather poorly preserved, i.e. all cells
lost most cilia. Fortunately, their basal bodies are recog-
nizable. Actually, the specimens look like ciliates deciliated
with a detergent, i.e. most cilia are lost but some remain
(Fig. 2g). There are possibly 7–9 meridional ciliary rows
(including the two branches of the archway kinety des-
cribed below) laterally and dorsally, while the postoral
Fig. 5. DAPI (a–c) and Cy3 (d–f) staining of
cariacotrichean ciliates from the deep anoxic
portion of the Cariaco Basin visualized with the
CARH658 FISH probe. ma, Macronucleus; mi,
micronucleus. Bars, 30 mm.
Fig. 4. Line drawings of Cariacothrix caudata, based on FISH-
SEM micrographs from 11 specimens. Length of cells about
30 mm. (a) Ventral view showing, inter alia, the densely ciliated
archway kinety posteriorly ending in two long caudal cilia. (b) Side
view showing the rostrate anterior body portion. AK, Archway
kinety; AO, adoral organelles; CC, caudal cilium; CR, ordinary
somatic ciliary row; MA, macronucleus; MI, micronucleus; OC, oral
cavity; R, ridge. Bar, 10 mm.
W. Orsi and others
1430 International Journal of Systematic and Evolutionary Microbiology 62
region is very likely barren (Figs 4a, 2b, 3c). The most
conspicuous structure is an archway-shaped ciliary row
(‘archway kinety’) delineating the upper and lateral margin
of the oral cavity, from where it extends to the posterior
body end on both sides of the oral cavity. Each branch
comprises about 70 very narrowly spaced basal bodies and
ends with a 20 to 30 mm long caudal cilium (Figs 2a–d, f,
3a, b and Movie S1). In a few specimens, small portions of
the archway kinety are ciliated, showing that it is, indeed, a
ciliary row (Figs 2c, 3d).
The oral apparatus occupies the anterior body third. The
triangular oral opening is delineated by a shallow ridge.
There are two adoral organelles recognizable: one is in the
Fig. 6. Phylogenetic position of the ciliate class Cariacotrichea within the phylum Ciliophora, based on 18S rRNA gene
sequences. Bootstrap (BT) and posterior probability (PP) values of .50 % are given at the nodes in the order PP/BT. A black
circle denotes full bootstrap and posterior probability support. Dashed lines represent a bootstrap or posterior probability value
of less than 50 % or 0.50. The tree is based on an alignment of 942 nt positions using the maximum-likelihood and Bayesian
methods, respectively. Bar, 0.08 substitutions per nucleotide position.
Cariacotrichea, a novel ciliate taxon
http://ijs.sgmjournals.org 1431
left posterior corner of the oral cavity and composed of
about seven 8 mm-long cilia; the other organelle covers the
bottom of the cavity and consists of 10–15 very narrowly
spaced cilia (Figs 3a, b, 2a–c, f, 3a–c and Movie S1). We
could not locate a ‘typical’ paroral membrane. However,
the cilia that cover the bottom of the oral cavity could
belong to a paroral dislocated by the preparation proce-
dures. Alternatively, the archway kinety could be a highly
modified paroral (see Fig. 2c, g).
The second species is holotrichously ciliated and possibly has
elongated cilia at both ends of the cell. Further, the oral open-
ing is more subapical than in Cariacothrix caudata (Fig. 3e).
Ecology. Cells were found to have an in situ abundance of
0.2 cells ml
21
at a depth of 900 m in the Cariaco Basin. This
region of the basin is permanently anoxic and exhibits a
concentration of hydrogen sulfide up to 53 mM (Edgcomb
et al., 2011a, b). This depth has a typical temperature of
17 uC and a salinity of 36.2 %.
DISCUSSION
In our phylogenetic analyses (Fig. 6), the class Cariaco-
trichea forms a clade that is fully supported by both
maximum-likelihood and Bayesian methods, is affiliated
with the ciliate subphylum Intramacronucleata, and does
not phylogenetically nest within any of the eleven described
classes of ciliates (Lynn, 2008). This suggests that the
cariacotrichea represent a new class of ciliates, presumably
restricted to anoxic marine environments. The micro-
eukaryotic community in the Cariaco Basin has likely
diversified and speciated in response to the biogeochemical
gradients of oxygen and sulfide (Orsi et al., 2011). Thus, the
unique geochemistry of anoxic environments may explain,
in part, the divergent phylogenetic position and outstanding
morphology of the class Cariacotrichea. The closest class to
the class Cariacotrichea is the class Spirotrichea, branching as
a sister clade with bootstrap and posterior probability
support of 64 % and 0.89, respectively. The spirotricheans
are a species-rich, rather diverse taxon, containing the
oligotrichids, euplotids, stichotrichs and, possibly, the ‘ribo-
subclasses’ Protocruziidia, Phacodiniidia and Licnophoridia
(Lynn, 2008). However, none of these closely resemble
members of the class Cariacotrichea morphologically, which
instead superficially looks similar to some hymenostomes,
namely members of the genera Cyclidium,Tetrahymena and
Wilbertia (Fan et al., 2009). Cells of the class Cariacotrichea
also resemble those from the karyorelictean genera Loxodes
and Remanella, which also have a rostrum and live
anaerobically. However, these and all other described ciliates
lack an archway-shaped kinety, as well as the cirrus-like
organelle in the left posterior corner of the oral cavity.
ACKNOWLEDGEMENTS
We would like to thank the captain and crew of the B/O Hermano
Gine
´sand the staff of the Fundacio
´n La Salle de Ciencias Naturales
(FLASA) for their assistance during our fieldwork in Venezuela,
without whom this work would not be possible. We are also deeply
grateful to Yrene Astor and Ramon Varela who were instrumental in
the transportation of the DEEP-SID to and from Isla Margarita, as
well as Gordon Taylor and Mary Scranton for their logistical support.
We appreciate advice by Dr Rudolf Amann from the Max Planck
Institute for Marine Microbiology in Bremen, Germany, on
optimization of FISH probes in the absence of proper positive
control. This research was supported by grants from NSF (MCB-
0348341 and DEB-0816840 to S. E., MCB-0348407 to V. E. and OCE
03-26175 to G. T. T.) and the Austrian Science Foundation to W. F.
(FWF, P-20360-B17). This is a contribution no. 271 from the Marine
Science Center, Northeastern University, Nahant, MA, USA.
REFERENCES
Abramoff, M. D., Magelhaes, P. J. & Ram, S. J. (2004). Image
processing with ImageJ. Biophotonics International 11, 36–42.
Alexander, E., Stock, A., Breiner, H. W., Behnke, A., Bunge, J.,
Yakimov, M. M. & Stoeck, T. (2009). Microbial eukaryotes in the
hypersaline anoxic L’Atalante deep-sea basin. Environ Microbiol 11,
360–381.
Behrens, S., Ru¨ hland, C., Ina
´cio, J., Huber, H., Fonseca, A., Spencer-
Martins, I., Fuchs, B. M. & Amann, R. (2003). In situ accessibility of
small-subunit rRNA of members of the domains Bacteria, Archaea,
and Eucarya to Cy3-labeled oligonucleotide probes. Appl Environ
Microbiol 69, 1748–1758.
Edgcomb, V. P., Kysela, D. T., Teske, A., de Vera Gomez, A. & Sogin, M.
L. (2002). Benthic eukaryotic diversity in the Guaymas Basin hydro-
thermal vent environment. Proc Natl Acad Sci U S A 99, 7658–7662.
Edgcomb, V., Orsi, W., Bunge, J., Jeon, S. O., Christen, R., Leslin, C.,
Holder, M., Taylor, G. T., Suarez, P. & other authors (2011a).
Protistan microbial observatory in the Cariaco Basin, Caribbean. I.
Pyrosequencing vs Sanger insights into species richness. ISME J 5,
1344–1356.
Edgcomb, V., Orsi, W., Taylor, G. T., Vdacny, P., Taylor, C. T., Suarez,
P. & Epstein, S. (2011b). Accessing marine protists from the anoxic
Cariaco Basin. ISME J 5, 1237–1241.
Epstein, S. & Lopez-Garcia, P. (2008). ‘‘Missing’’ protists: a
molecular prospective. Biodivers Conserv 17, 261–276.
Fan, X., Miao, M., Al-Rasheid, K. A.S. & Song, W. (2009). A new genus of
marine scuticociliate (Protozoa, Ciliophora) from northern China, with
a brief note on its phylogenetic position inferred from small subunit
ribosomal DNA sequence data. J Eukaryot Microbiol 56, 577–582.
Finlay, B. J., Corliss, J. O., Esteban, G. & Fenchel, T. (1996).
Biodiversity at the microbial level: the number of free-living ciliates in
the biosphere. Q Rev Biol 71, 221–237.
Foissner, W. (1991). Basic light and scanning electron microscopic
methods for taxonomic studies of ciliated protozoa. Eur J Protistol 27,
313–330.
Foissner, W. (2003). Deciliation of ciliated protozoa for scanning
electron microscopy: a fast, simple method using tensides. In Abstracts
of the 4th European Congress of Protistology and 10th European
Conference on Ciliate Biology, 31 August–5 September 2003, San
Benedetto del Tronto (AP), Italy, p. 133.
Foissner, W., Agatha, S. & Berger, H. (2002). Soil ciliates (Protozoa,
Ciliophora) from Namibia (Southwest Africa), with emphasis on two
contrasting environments, the Etosha region and the Namib Desert.
Denisia 5, 1–1459.
Foissner, W., Chao, A. & Katz, L. A. (2008). Diversity and geographic
distribution of ciliates (Protista: Ciliophora). Biodivers Conserv 17,
345–363.
W. Orsi and others
1432 International Journal of Systematic and Evolutionary Microbiology 62
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H.,
Yadhukumar, Buchner, A., Lai, T., Steppi, S. & other authors
(2004). ARB: a software environment for sequence data. Nucleic Acids
Res 32, 1363–1371.
Lynn, D. H. (2008). The Ciliated Protozoa: Characterization,
Classification, and Guide to the Literature, 3rd edn. New York:
Springer.
Muller-Karger, F. E., Varela, R., Thunell, R., Scranton, M., Bohrer, R.,
Taylor, G. T., Capelo, J., Astor, Y., Tappa, E. & other authors (2001).
Annual cycle of primary production in the Cariaco Basin: Response
to upwelling and implications for vertical export. Geophys Res 106
(C3), 4527–4542.
Orsi, W., Edgcomb, V., Jeon, S. O., Leslin, C., Bunge, J., Taylor, G. T.,
Varela, R. & Epstein, S. (2011). Protistan microbial observatory in the
Cariaco Basin, Caribbean. II. Habitat specialization. ISME J 5, 1357–
1373.
Posada, D. & Crandall, K. A. (1998). MODELTEST: testing the model of
DNA substitution. Bioinformatics 14, 817–818.
Ronquist, F. & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19, 1572–
1574.
Song, W., Warren, A. & Hu, X. (editors) (2009). Free-living Ciliates in
the Bohai and Yellow Seas, China. Beijing: Science Press.
Stamatakis, A., Hoover, P. & Rougemont, J. (2008). A rapid bootstrap
algorithm for the RAxML Web servers. Syst Biol 57, 758–771.
Stoeck, T., Fowle, W. H. & Epstein, S. S. (2003a). Methodology of
protistan discovery: from rRNA detection to quality scanning electron
microscope images. Appl Environ Microbiol 69, 6856–6863.
Stoeck, T., Taylor, G. T. & Epstein, S. S. (2003b). Novel eukaryotes
from the permanently anoxic Cariaco Basin (Caribbean Sea). Appl
Environ Microbiol 69, 5656–5663.
Stoeck, T., Hayward, B., Taylor, G. T., Varela, R. & Epstein, S. S.
(2006). A multiple PCR-primer approach to access the microeukar-
yotic diversity in environmental samples. Protist 157, 31–43.
Taylor, C. D. & Doherty, K. W. (1990). Submersible Incubation Device
(SID), autonomous instrumentation for the in situ measurement of
primary production and other microbial rate processes. Deep-Sea Res
37, 343–358.
Taylor, C. D., Howes, B. L. & Doherty, K. W. (1993). Automated
instrumentation for time-series measurements of primary production
and nutrient status in production platform-accessible environments.
Mar Technol Soc J 27, 32–44.
Taylor, G. T., Iabichella, M., Ho, T.-Y., Scranton, M. I., Thunell, R. C.,
Muller-Karger, F. & Varela, R. (2001). Chemoautotrophy in the redox
transition zone of the Cariaco Basin: A significant midwater source of
organic carbon production. Limnol Oceanogr 46, 148–163.
Cariacotrichea, a novel ciliate taxon
http://ijs.sgmjournals.org 1433
... Later, clone libraries and 454 pyrosequencing revealed a high diversity of protist communities that changed dramatically in composition over the redox gradient and exhibited a degree of vertical endemism, likely controlled by stratified geochemical conditions (Edgcomb et al., 2011a;Orsi et al., 2011). Furthermore, these studies revealed that the Cariaco Basin's euxinic waters were occupied by a previously undiscovered class of ciliates (Cariacotrichea) that has subsequently been reported for other ODWCs (Orsi et al., 2012b). ...
... Similar to the current study, marker gene analyses suggested Oligohymenphorea and Cariacotrichea are commonly found along marine oxyclines (Edgcomb and Pachiadaki, 2014). Cariacotrichea is a novel class of ciliate that was first identified from the Cariaco Basin and observed to have rod-shaped epibionts (Stoeck et al., 2003;Orsi et al., 2012b), the identity of which are unknown. Based on network analysis in the current study, ASVs from class Cariacotrichea were positively associated with several bacterial OTUs, including Phycisphaerae, Deltaproteobacteria (Desulfarculales and Sh765B-TzT-29), spirochetes, and Candidate Division OP3. ...
Article
Full-text available
Oxygen-depleted water columns (ODWCs) host a diverse community of eukaryotic protists that change dramatically in composition over the oxic-anoxic gradient. In the permanently anoxic Cariaco Basin, peaks in eukaryotic diversity occurred in layers where dark microbial activity (chemoautotrophy and heterotrophy) were highest, suggesting a link between prokaryotic activity and trophic associations with protists. Using 18S rRNA gene sequencing, parasites and especially the obligate parasitic clade, Syndiniales, appear to be particularly abundant, suggesting parasitism is an important, but overlooked interaction in ODWC food webs. Syndiniales were also associated with certain prokaryotic groups that are often found in ODWCs, including Marinimicrobia and Marine Group II archaea, evocative of feedbacks between parasitic infection events, release of organic matter, and prokaryotic assimilative activity. In a network analysis that included all three domains of life, bacterial and archaeal taxa were putative bottleneck and hub species, while a large proportion of edges were connected to eukaryotic nodes. Inclusion of parasites resulted in a more complex network with longer path lengths between members. Together, these results suggest that protists, and especially protistan parasites, play an important role in maintaining microbial food web complexity, particularly in ODWCs, where protist diversity and microbial productivity are high, but energy resources are limited relative to euphotic waters.
... Ciliates inhabiting anaerobic or hypoxic environments have received increased attention recently, not only due to discoveries of new species but also due to studies on the evolution of mitochondriarelated organelles and prokaryote-eukaryote symbioses (e.g., Orsi et al., 2012;Fernandes et al., 2018;Lewis et al., 2018;Bourland et al., 2020;Campello-Nunes et al., 2020;Lewis et al., 2020;RotterovaF et al., 2020;Li et al., 2021a;Li et al., 2021b;Zhuang et al., 2021). As far as we know, more than half of known anaerobic ciliates belong to class Armophorea Lynn, 2004. ...
Article
Full-text available
Armophorean ciliates constitute an important component of microeukaryotic community in anaerobic or hypoxic environments. Yet, their diversity remains poorly known due to under-sampling or the scarcity of knowledge. In this study, three metopid ciliates, i.e., Metopus paraes sp. n., Metopus spiculatus sp. n., and Metopus parapellitus sp. n., collected from coastal sediments in Qingdao and Rizhao, China, were investigated using live observation, protargol staining, and molecular phylogenetic methods. M. paraes sp. n. can be distinguished by its long caudal cilia. M. spiculatus sp. n. resembles M. vestitus in many ways, but differs mainly in having a beak-like preoral dome end and a conspicuous tail. The most remarkable features of M. parapellitus sp. n. include an ovate body shape, caudal cilia located at the rear end and right posterior body, and an adoral zone that never extends onto the dorsal surface. Sequence divergences supported the species identification of these three species. Phylogenetic analyses confirmed that the Metopus is not monophyletic, and first revealed that all marine species of Metopus form a well-supported clade. The clustering of these marine forms with M. es (type species) is not rejected by the AU test, which infers that the marine clade represents the genus Metopus together with M. es.
... In environmental studies, individual taxa can serve as indicators for water or soil quality (e.g., Foissner et al., 1999;Stoeck et al., 2018;Dias et al., 2021). Actually, only some ciliates can exclusively be related to specific environmental conditions, namely, the obligate anaerobic Cariacotrichea or the Armophorea (Lynn, 2004;Orsi et al., 2012). ...
Article
Full-text available
Species of the ciliate genus Urotricha are key players in freshwater plankton communities. In the pelagial of lakes, about 20 urotrich species occur throughout an annual cycle, some of which play a pivotal role in aquatic food webs. For example, during the phytoplankton spring bloom, they consume a remarkable proportion of the algal production. In ecological studies, urotrich ciliates are usually merely identified to genus rank and grouped into size classes. This is unsatisfying considering the distinct autecological properties of individual species and their specific spatial and temporal distribution patterns. As a basis for future research, we characterized in detail four common urotrich morphotypes, i.e., specimens identified as U. furcata and tentatively as U. agilis , U. pseudofurcata , and U. castalia , using state-of-the-art methods. We used an integrative polyphasic approach, in which morphological studies ( in vivo observation, silver staining methods, scanning electron microscopy) were linked with a molecular approach exploiting four different gene fragments as taxonomic DNA barcodes with different resolution potential (SSU rDNA, ITS-1, ITS-2, hypervariable V4 and V9 regions of the SSU rDNA). We shed light on the diversity of urotrich ciliates as well as on their global distribution patterns, and annual cycles. Additionally, we coupled individual species occurrences and environmental parameters, and subsequently modeled the distribution and occurrence, using logistic regressions. Furthermore, for one strain putatively identified as U. castalia , we ascertained the optimal cultivation media and food preferences. Thereby, our comprehensive view on these important freshwater ciliates that frequently occur in environmental high throughput sequencing datasets worldwide will allow future studies to better exploit protistan plankton data from lakes.
... The presence of Scuticociliata and Stichotrichia, albeit in lower numbers, in the lower hypoxic and upper hypoxic water column of the outer shelf suggests that they are also adapted to live in low-oxygen waters. Our observations agree with the results of earlier molecular surveys showing that scuticociliates are diverse and abundant members of the ciliate communities in oxygen-depleted marine habitats such as the Saanich Inlet, the Framvaren Fjord and the Cariaco Basin (Behnke et al. 2006;Edgcomb et al. 2011;Orsi et al. 2012). ...
Article
Full-text available
The diverse physicochemical conditions prevailing in the Arabian Sea are expected to result in marked spatial variations in heterotrophic flagellate (HF) and ciliate communities. Here, we report the environmental association of heterotrophic micro-eukaryotes, particularly the heterotrophic flagellates and ciliates, based on 18S rRNA gene survey in the region. High-throughput next-generation sequencing, using the V4 eukaryotic-specific primer, was employed to study the composition of these communities associated with low-O2 waters in both coastal and offshore settings. Canonical correspondence analysis (CCA) revealed a preference of the heterotrophic flagellates for nitrate- and nitrite-rich zones. Notably, the heterotrophic nanoflagellate genus Monosiga showed a strong positive correlation with NO3−, which suggests its potential denitrifying capability. Shannon’s entropy analysis revealed a higher HF diversity in the hypoxic waters of the open ocean (depth 103 m), whereas ciliates were more diverse at oxygenated coastal stations. The estuarine waters exhibited a low diversity of both ciliates and flagellates. The UPGMA clusters of heterotrophic flagellates and ciliates in suboxic waters of the open ocean oxygen minimum zone were distinct from those found at other sites. Overall, CCA revealed the important relationship between nitrite, nitrate, salinity and chlorophyll a, which could be important factors for the partitioning of different ecological niches for specific HF and ciliate communities in the Arabian Sea. The community of heterotrophic protists that can adapt to varying biogeochemical regimes has been identified.
... This proves the importance of meta-analyses such as our GenBank survey, which may reveal insights unappreciated in dozens of individual publications. These efforts show the potential of environmental sequencing for pointing at novel taxa awaiting formal description, as it has happened for other ciliates (Orsi et al. 2012) and planktonic groups such as dinoflagellates (Guillou et al. 2008) and stramenopiles (Massana et al. 2004). It is also important to explore environments that have not been commonly surveyed even by traditional microscopy and that can hide potentially novel tintinnids, such as those recently reported in mesopelagic waters (Dolan et al. 2019). ...
... This proves the importance of meta-analyses such as our GenBank survey, which may reveal insights unappreciated in dozens of individual publications. These efforts show the potential of environmental sequencing for pointing at novel taxa awaiting formal description, as it has happened for other ciliates (Orsi et al. 2012) and planktonic groups such as dinoflagellates (Guillou et al. 2008) and stramenopiles (Massana et al. 2004). It is also important to explore environments that have not been commonly surveyed even by traditional microscopy and that can hide potentially novel tintinnids, such as those recently reported in mesopelagic waters (Dolan et al. 2019). ...
Chapter
GOOGLEBOOKS ACCESS: https://books.google.ca/books?hl=en&lr=&id=Wjf-DwAAQBAJ&oi=fnd&pg=PT10&dq=info:voA0qu75x7gJ:scholar.google.com&ots=LS2dhV9VmB&sig=s45GRiCKaJnStIfKY-PFPKAzZUc&redir_esc=y#v=onepage&q&f=false
Article
Anaerobiosis has independently evolved in multiple lineages of ciliates, allowing them to colonize a variety of anoxic and oxygen‐depleted habitats. Anaerobic ciliates commonly form symbiotic relationships with various prokaryotes, including methanogenic archaea and members of several bacterial groups. The hypothesized functions of these ecto‐ and endosymbionts include the symbiont utilizing the ciliate’s fermentative end‐products to increase host’s anaerobic metabolic efficiency, or the symbiont directly providing the host with energy by denitrification or photosynthesis. The host, in turn, may protect the symbiont from competition, the environment, and predation. Despite rapid advances in sampling, molecular, and microscopy methods, as well as the associated broadening of the known diversity of anaerobic ciliates, many aspects of these ciliate symbioses, including host‐specificity and co‐evolution, remain largely unexplored. Nevertheless, with the number of comparative genomic and transcriptomic analyses targeting anaerobic ciliates and their symbionts on the rise, insights into the nature of these symbioses and the evolution of the ciliate transition to obligate anaerobiosis continue to deepen. This review summarizes the current body of knowledge regarding the complex nature of symbioses in anaerobic ciliates, the diversity of these symbionts, their role in the evolution of ciliate anaerobiosis and their significance in ecosystem‐level processes.
Article
Full-text available
Although ciliates are one of the most dominant microbial eukaryotic groups in many environments, there is a lack of updated global ciliate alignments and reference trees that can be used for phylogenetic placement methods to analyze environmental metabarcoding data. Here we fill this gap by providing reference alignments and trees for those ciliates taxa with available SSU-rDNA sequences derived from identified species. Each alignment contains 478 ciliate and six outgroup taxa, and they were made using different masking strategies for alignment positions (unmasked, masked and masked except the hypervariable V4 region). We constrained the monophyly of the major ciliate groups based on the recently updated classification of protists and based on phylogenomic data. Taxa of uncertain phylogenetic position were kept unconstrained, except for Mesodinium species that we constrained to form a clade with the Litostomatea. These ciliate reference alignments and trees can be used to perform taxonomic assignments of metabarcoding data, discover novel ciliate clades, estimate species richness, and overlay measured ecological parameters onto the phylogenetic placements.
Article
Full-text available
Rainforest aquatic ecosystems include complex habitats with scarce information on their unicellular eukaryote diversity and community structure. We have investigated the diversity of ciliates in freshwater and brackish environments along the Brazilian Atlantic Forest, based on the hypervariable V4 region of the 18S-rDNA obtained by high- throughput DNA sequencing. Our analyses detected 409 ciliate taxonomic units (OTUs), mostly attributed to the classes Oligohymenophorea and Spirotrichea. A total of 11 classes, 12 subclasses, 112 genera, and 144 species were reported. We found that: (i) the ciliate communities are more diverse in freshwater than in Atlantic Forest associated brackish environments; (ii) the ciliate communities are composed by a small amount of highly abundant OTUs, but a high number of low-abundant or rare OTUs; (iii) nearly one-third of the ciliate OTUs share less than 97% sequence identity to reference sequences; (iv) phylogenetic inference supports the hypothesis that V4 region of the Ciliophora 18S-rDNA is a suitable marker for accurate evolutionary inferences at class-level. Our results showed that a considerable fraction of the HTS- detected diversity of ciliates from Brazilian Atlantic Forest is not represented in the currently available molecular databases.
Article
Full-text available
For more than 200 years, ciliated protozoa have been identified and allocated species names largely on the basis of the rich morphological variety they present. We have examined the species richness of all free-living ciliate genera, described historical trends in the descriptions of new species, and estimated the number of species currently known. We have quantified the value of taxonomic revisions, and conclude that the number of known, extant, free-living species is close to 3000. We have investigated the concept of ''species'' and the meaning of ''biodiversity'' in relation to ciliates, and conclude that the biological species concept is neither appropriate nor practicable. Insofar as ciliate morphology is closely correlated with the function of the organism in nature, the morphospecies concept is as valid as any, and probably more pragmatic than any other Thus, when speaking of ''species diversity,'' or the ''biodiversity'' of ciliates, rue refer to diversity of form and function. The majority of ciliate species in the more frequently studied habitats have probably already been discovered but an accurate picture of ciliate diversity on a global scale will require substantial taxonomic revision of many long-established and crowded genera, together with the investigation and description of new forms from previously unexplored habitats.
Book
The third edition of The Ciliated Protozoa continues the innovative approach of the previous two editions, thoroughly documenting the progress in our understanding of the evolutionary diversification of these widely distributed eukaryotic microorganisms. The Glossary is considerably revised and expanded, serving as an illustrated 'subject index' of more than 700 terms. An introduction to the phylum is followed by chapters on the 11 classes. Each class chapter contains 7 sections: •taxonomic structure •life history and ecology •somatic structures •oral structures •division and morphogenesis •nuclei, sexuality, and life cycle •other features. The book includes new data on the ultrastructure of the somatic cortex of each class, molecular phylogenetics, ecology, and on other important aspects of ciliate biology. These new data are used, along with a novel conceptual approach, to rationalize a new system of classification for the phylum, presented in a major chapter on The Ciliate Taxa. The book includes an up-to-date bibliography of approximately 3,000 citations to both the 'classical' and recent literature, and both a Subject Index and a Systematic Index. This unique and timely book will serve as a comprehensive and authoritative reference work for students, teachers, and researchers who have an interest in the protozoa, and particularly the ciliates.
Article
Presents new instrumentation for the automated in situ measurement of photosynthesis and other microbial processes and for assessment of micro-nutrient pools in coastal and oceanic environments. -from Authors
Article
During the CARIACO time series program, microbial standing stocks, bacterial production, and acetate turnover were consistently elevated in the redox transition zone (RTZ) of the Cariaco Basin, the depth interval ( ;240-450 m) of steepest gradient in oxidation-reduction potential. Anomalously high fluxes of particulate carbon were captured in sediment traps below this zone (455 m) in 16 of 71 observations. Here we present new evidence that bacterial chemoautotrophy, fueled by reduced sulfur species, supports an active secondary microbial food web in the RTZ and is potentially a large midwater source of labile, chemically unique, sedimenting biogenic debris to the basin's interior. Dissolved inorganic carbon assimilation (27-159 mmol C m 22 d 21 ) in this zone was equivalent to 10%- 333% of contemporaneous primary production, depending on the season. However, vertical diffusion rates to the RTZ of electron donors and electron acceptors were inadequate to support this production. Therefore, significant lateral intrusions of oxic waters, mixing processes, or intensive cycling of C, S, N, Mn, and Fe across the RTZ are necessary to balance electron equivalents. Chemoautotrophic production appears to be decoupled temporally from short-term surface processes, such as seasonal upwelling and blooms, and potentially is more responsive to long- term changes in surface productivity and deep-water ventilation on interannual to decadal timescales. Findings suggest that midwater production of organic carbon may contribute a unique signature to the basin's sediment record, thereby altering its paleoclimatological interpretation.
Article
Monthly hydrographic, primary production, bacterial production, and settling particulate carbon flux observations were collected between November 1995 and December 1997 at 10.5 degreesN, 64.67 degreesW within the Cariaco Basin, off Venezuela. Upwelling of Subtropical Underwater (SUW) started around October and lasted through approximately May of the following year. Wind speeds >7 m s(-1) were observed between January and June, with weaker winds (<5 m s(-1)) between July and December. The upwelling cycle was therefore out of phase with that of the trade winds by 2-3 months. A seasonal cycle punctuated by transient extremes associated with subsurface ventilation events was observed in primary production. High bacterial activity and organic carbon recycling rates were observed near the oxic-anoxic interface. Integrated primary production was 690 gC m(-2) yr(-1) in 1996 and 540 gC m(-2) yr(-1) in 1997. Settling carbon flux measured with sediment traps was about 5.6% of integrated primary production at 275 m and about 1.7% at 1225 m, with no seasonality in the proportion of vertical flux to primary production. In total, between 10 and 11 gC m(-2) yr were delivered to the bottom sediment of Cariaco, which suggests that between 4 x 10(5) and 1 x 10(6) t of C yr(-1) were delivered to sediments within the upwelling area of the Cariaco Basin. This represents permanent sequestration of carbon previously entrained in the North Atlantic gyre in the area of formation of SUW. Results suggests that upwelled inorganic nitrogen, rather than nitrogen fixation, is responsible for the large productivity and particulate carbon settling flux in the Cariaco Basin.
Article
The following methods for taxonomic studies of ciliated protozoa are described in detail: live observation, supravital staining with methyl green-pyronin, dry silver nitrate impregnation, wet silver nitrate impregnation, silver carbonate impregnation, protargol impregnation (three procedures), and scanning electron microscopy. Familiarity with these methods (or modifications) is an absolute prerequisite for successful taxonomic work. No staining method is equally appropriate to all kinds of ciliates. A table is provided which indicates those procedures which work best for certain groups of ciliates. A second table relates to the structures revealed by the procedures. Good descriptions usually demand at least live observation, silver nitrate and protargol or silver carbonate impregnation. Some instructions are provided for distinguishing mono- and dikinetids as well as ciliated and non-ciliated basal bodies in silvered ciliates. The brilliancy of the silver preparations has unfortunately recently tempted some taxonomists to neglect live observation. However, many important species characters cannot be seen or are changed in silvered specimens. I thus consider all species descriptions based exclusively on silver slides as incomplete and of doubtful value for both α-taxonomists and ecologists. Especially the latter are usually not trained to correlate the silvered structures with the live appearance of the cell.