Asc-Dependent and Independent Mechanisms Contribute to Restriction of Legionella Pneumophila Infection in Murine Macrophages

Article (PDF Available)inFrontiers in Microbiology 2:18 · February 2011with41 Reads
DOI: 10.3389/fmicb.2011.00018 · Source: PubMed
Abstract
The apoptosis-associated speck-like protein containing a caspase recruitment domain (Asc) is an adaptor molecule that mediates inflammatory and apoptotic signals. Legionella pneumophila is an intracellular bacterium and the causative agent of Legionnaire's pneumonia. L. pneumophila is able to cause pneumonia in immuno-compromised humans but not in most inbred mice. Murine macrophages that lack the ability to activate caspase-1, such as caspase(-1-/-) and Nlrc4(-/-) allow L. pneumophila infection. This permissiveness is attributed mainly to the lack of active caspase-1 and the absence of its down stream substrates such as caspase-7. However, the role of Asc in control of L. pneumophila infection in mice is unclear. Here we show that caspase-1 is moderately activated in Asc(-/-) macrophages and that this limited activation is required and sufficient to restrict L. pneumophila growth. Moreover, Asc-independent activation of caspase-1 requires bacterial flagellin and is mainly detected in cellular extracts but not in culture supernatants. We also demonstrate that the depletion of Asc from permissive macrophages enhances bacterial growth by promoting L. pneumophila-mediated activation of the NF-κB pathway and decreasing caspase-3 activation. Taken together, our data demonstrate that L. pneumophila infection in murine macrophages is controlled by several mechanisms: Asc-independent activation of caspase-1 and Asc-dependent regulation of NF-κB and caspase-3 activation.
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 1
Original research article
published: 14 February 2011
doi: 10.3389/fmicb.2011.00018
Asc-dependent and independent mechanisms contribute to
restriction of Legionella pneumophila infection in murine
macrophages
Dalia H. A. Abdelaziz
1,2†
, Mikhail A. Gavrilin
1†
, Anwari Akhter
1
, Kyle Caution
1
, Sheetal Kotrange
1
, Arwa Abu
Khweek
1
, Basant A. Abdulrahman
1,2
, Zeinab A. Hassan
2
, Fathia Z. El-Sharkawi
2
, Simranjit S. Bedi
1
, Katherine
Ladner
3
, M. Elba Gonzalez-Mejia
4
, Andrea I. Doseff
4
, Mahmoud Mostafa
1
, Thirumala-Devi Kanneganti
5
, Dennis
Guttridge
3
, Clay B. Marsh
1
, Mark D. Wewers
1
and Amal O. Amer
1
*
1
Division of Pulmonary, Allergy, Critical Care, and Sleep Medicine, Center for Microbial Interface Biology and the Department of Internal Medicine, Ohio State University,
Columbus, OH, USA
2
Faculty of Pharmacy, Department of Biochemistry and Molecular Biology, Helwan University, Helwan, Egypt
3
Human Cancer Genetics Program, Ohio State University, Columbus, OH, USA
4
Department of Molecular Genetics, Davis Heart and Lung Research Institute, The Ohio State University, Columbus, OH, USA
5
Department of Immunology, St Jude Children’s Research Hospital, Memphis, TN, USA
The apoptosis-associated speck-like protein containing a caspase recruitment domain (Asc) is an
adaptor molecule that mediates inflammatory and apoptotic signals. Legionella pneumophila is
an intracellular bacterium and the causative agent of Legionnaires pneumonia. L. pneumophila is
able to cause pneumonia in immuno-compromised humans but not in most inbred mice. Murine
macrophages that lack the ability to activate caspase-1, such as caspase-1
/
and Nlrc4
/
allow
L. pneumophila infection. This permissiveness is attributed mainly to the lack of active caspase-1
and the absence of its down stream substrates such as caspase-7. However, the role of Asc in
control of L. pneumophila infection in mice is unclear. Here we show that caspase-1 is moderately
activated in Asc
/
macrophages and that this limited activation is required and sufficient to
restrict L. pneumophila growth. Moreover, Asc-independent activation of caspase-1 requires
bacterial flagellin and is mainly detected in cellular extracts but not in culture supernatants. We
also demonstrate that the depletion of Asc from permissive macrophages enhances bacterial
growth by promoting L. pneumophila-mediated activation of the NF-κB pathway and decreasing
caspase-3 activation. Taken together, our data demonstrate that L. pneumophila infection in
murine macrophages is controlled by several mechanisms: Asc-independent activation of
caspase-1 and Asc-dependent regulation of NF-κB and caspase-3 activation.
Keywords: inflammasome, caspase-1, Legionella pneumophila, Asc
Edited by:
Yousef Abu Kwaik, University of
Louisville School of Medicine, USA
Reviewed by:
Maya Saleh, McGill University, Canada
Marina Santic’, University of Rijeka,
Croatia (Hrvatska)
*Correspondence:
Amal O. Amer, Division of Pulmonary,
Allergy, Critical Care, and Sleep
Medicine, Center for Microbial
Interface Biology and The Department
of Internal Medicine, Ohio State
University, Biological Research Tower,
460W 12th Avenue, Room 1014,
Columbus, OH 43210, USA.
e-mail: amal.amer@osumc.edu
Dalia H. A. Abdelaziz and Mikhail A.
Gavrilin have contributed equally to this
work.
activation of caspase-1 (Srinivasula et al., 2002; Fernandes-Alnemri
et al., 2007; Fernandes-Alnemri and Alnemri, 2008). NLRs act as
intracellular sensors to stress, and foreign molecules like microbial
components (Kanneganti et al., 2007; Martinon and Tschopp, 2007).
Once activated, caspase-1 subsequently cleaves pro-IL-1β/IL-18 and
accompanies the active cytokines when secreted out of the cell (Stehlik
et al., 2002, 2003; Liepinsh et al., 2003; Hasegawa et al., 2005, 2007,
2009; Sarkar et al., 2006; Bedoya et al., 2007). Caspase-1 also activates
caspase-7 in response to flagellin or LPS (Franchi et al., 2008; Lamkanfi
et al., 2008, 2009; Akhter et al., 2009; Lamkanfi and Kanneganti, 2010;
Shaw et al., 2010). Many Gram-negative bacteria, such as Salmonella
typhimurium, Pseudomonas aeruginosa, Shigella flexneri, and Legionella
pneumophila, are recognized in murine macrophages by the NLR
Nlrc4/Ipaf leading to caspase-1 activation through the inflammasome
(Abdelaziz et al., 2010; Amer, 2010).
Furthermore, when Asc is over expressed, it cooperates with
Nlrp3 (cryopyrin) and Nlrp12 (Pypaf7) in order to promote NF-κB
activity in an over expression system (Masumoto et al., 2003;
Hasegawa et al., 2005). However, other reports show that Asc is
IntroductIon
The apoptosis-associated speck-like protein containing a caspase
recruitment domain (Asc encoded by the Pycard gene) is an adaptor
molecule that mediates inflammatory and apoptotic signals and is
predominantly expressed in monocytes and mucosal epithelial cells
(Taniguchi and Sagara, 2007; Hasegawa et al., 2009). Asc contains
an N-terminal pyrin/PAAD (PYD) death domain and a C-terminal
CARD protein–protein interaction domain (CARD; Masumoto et al.,
1999, 2001; Liepinsh et al., 2003; Stehlik et al., 2003). Both domains
enable Asc to recruit other PYD and CARD-containing proteins
through homotypic protein–protein interactions (Fernandes-Alnemri
et al., 2007; Mariathasan, 2007). Proteins with pyrin and/or caspase
recruitment domains have roles in inflammation, apoptosis, and
innate immunity. Many pyrin domain proteins, such as Asc, modu-
late NF-κB activity. Asc also participates in the assembly of multi-
protein complexes called “inflammasomes” (Srinivasula et al., 2002;
Fernandes-Alnemri et al., 2007; Fernandes-Alnemri and Alnemri,
2008). Within the inflammasome, Asc is able to link caspase-1 to
NOD-like receptors (NLRs) via its CARD domain, leading to the
Frontiers in Microbiology | Cellular and Infection Microbiology February 2011 | Volume 2 | Article 18 | 2
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
of Asc, cells were infected with L. pneumophila and the bacterial
replication was assessed by counting colony-forming units (CFU).
Depletion of Asc in caspase-1
/
cells supported significantly more L.
pneumophila replication compared to caspase-1
/
cells treated with
control siRNA (Figure 1C). In WT mouse macrophages, depletion of
Asc did not have an effect on the bacterial growth compared to that
of cells treated with control siRNA or untreated cells (Figure 1D).
Therefore, Asc controls L. pneumophila replication in murine mac-
rophages in the absence of caspase-1.
Asc REDUCES NF-κB ACTIVATION INDUCED BY L. pneumophiLa
INFECTION
It has been shown by several reports that L. pneumophila triggers
NF-κB activation in TLR5 dependent and independent manner
depending on the stage of the infection (Bartfeld et al., 2009; Losick
et al., 2010). Nevertheless, the role of Asc in NF-κB modulation
depends on its protein levels and its location within the cells (Stehlik
et al., 2002; Sarkar et al., 2006; Yu et al., 2006; Bedoya et al., 2007).
Our results showed that Asc controls L. pneumophila replication in
a caspase-1-independent manner. To determine if the mechanism
by which Asc restricts L. pneumophila (independently of caspase-1)
involves the NF-κB pathway, Asc was depleted in caspase-1
/
mac-
rophages by siRNA against Asc. Then, cells were infected with L.
pneumophila and NF-κB activation was assessed in nuclear extracts
by electrophoretic mobility shift assay (EMSA). We found that cas-
pase-1
/
macrophages depleted for Asc allowed more NF-κB activa-
tion at 1, 4, and 8 h of infection compared with cells treated with
control siRNA (Figure 2A). These results suggest that Asc decreased
NF-κB during L. pneumophila infection. To confirm these findings,
Asc
/
and WT macrophages were infected with L. pneumophila and
EMSA assay was performed. Initially, WT and Asc
/
macrophages
showed NF-κB activation within 1 h after infection. This activation
declined in WT macrophages by 8 h infection whereas NF-κB path-
way remained activated in Asc
/
8 h after L. pneumophila infection
(Figure 2B). Thus, in the context of L. pneumophila infection, Asc
hinders NF-κB activation, and decreases cell survival.
CASPASE-1 IS ACTIVATED IN THE CYTOSOL OF MURINE MACROPHAGES
LACKING Asc
The involvement of Asc in Nlrc4 inflammasome is still unclear
(Zamboni et al., 2006). To discern the role of Asc in L. pneumophi-
la-mediated caspase-1 activation, Asc
/
macrophages were left
untreated or infected with L. pneumophila at a low multiplicity of
infection (MOI). Then, cleaved caspase-1 was examined in cellular
extracts and culture supernatants of Asc
/
macrophages and of their
WT counterparts. Notably, cells lacking Asc still allowed the cleav-
age of caspase-1 within their cytosols when infected with L. pneu-
mophila (Figure 3A). The amount of cleaved caspase-1 in Asc
/
cell
lysates was less than that of WT macrophages (Figure 3A). Cleaved
caspase-1 was detected in culture supernatants of infected WT mac-
rophages but not that of infected Asc
/
macrophages (Figure 3B).
This data indicates that in the absence of Asc, a fraction of caspase-1
is cleaved by a yet unknown mechanism.
To further investigate the role of Asc in caspase-1 activation
during L. pneumophila of WT macrophages, Asc was depleted
in WT murine macrophages, as in Figure 1B and then infected
with L. pneumophila. The amount of cleaved caspase-1 detected
a suppressor of NF-κB activity and that it uses its CARD inter-
action not only to induce caspase-1 activation, but also to down
regulate NF-κB signaling (Sarkar et al., 2006; Bedoya et al., 2007).
Additionally, other studies demonstrate that Asc can be either an
inducer or an inhibitor of NF-κB depending on expression level
and location (Stehlik et al., 2002; Yu et al., 2006). Thus, Asc regulates
the inflammasome and other signaling complexes depending on
the stoichiometry of its expression and also whether certain other
PYD family proteins are expressed upon activation. On the other
hand, Asc mediates apoptosis by serving as an adaptor molecule
for Bax and regulates a p53-Bax mitochondrial pathway of apop-
tosis resulting in the activation of caspase-2 and -3 (Ohtsuka et al.,
2004; Hasegawa et al., 2007; Fernandes-Alnemri and Alnemri, 2008;
Motani et al., 2010).
Legionella pneumophila is an intracellular bacterium and
the causative agent of Legionnaires pneumonia (Horwitz and
Silverstein, 1981, 1983; Nash et al., 1984). The ability of L. pneu-
mophila to cause pneumonia in humans is dependent on its capa-
bility to evade the immune system and multiply within human
monocytes and derived macrophages (Horwitz and Silverstein,
1981, 1983; Nash et al., 1984). In murine macrophages, L. pneu-
mophila activates the Nlrc4 inflammasome leading to the produc-
tion of active caspase-1 and IL-1β (Amer et al., 2006; Ren et al.,
2006; Zamboni et al., 2006; Coers et al., 2007; Lightfield et al.,
2008; Akhter et al., 2009; Abdelaziz et al., 2010; Amer, 2010; Vance,
2010). Then, Naip5 mediates caspase-7 activation downstream of
caspase-1 which restricts the intracellular survival of the organism
(Akhter et al., 2009; Abdelaziz et al., 2010). Therefore, mice and their
derived macrophages lacking Nlrc4, caspase-1, or caspase-7 allow L.
pneumophila growth and are ideal models to study L. pneumophila
pathogenesis (Amer et al., 2006; Ren et al., 2006; Zamboni et al.,
2006; Coers et al., 2007; Lightfield et al., 2008; Akhter et al., 2009;
Abdelaziz et al., 2010; Amer, 2010; Vance, 2010).
Here we demonstrate that murine macrophages control
L. pneumophila infection through an Asc-dependent mechanism
by decreasing NF-κB activation and an Asc-independent mecha-
nism by modestly activating caspase-1 in the cytosol. Together,
our data show that Asc controls L. pneumophila infection in the
absence of caspase-1.
RESULTS
Asc CONTROLS L. pneumophiLa INFECTION IN MURINE
MACROPHAGES LACKING CASPASE-1
WT mouse macrophages effectively activate and release caspase-1
in response to L. pneumophila infection. This is accompanied by
the fusion of the L. pneumophila-containing phagosome with the
lysosome, bacterial degradation, and elimination (Amer et al., 2006;
Akhter et al., 2009). Consistent with that, caspase-1 knockout (
/
)
macrophages are permissive to L. pneumophila replication. Asc is an
adaptor molecule involved in caspase-1 activation in response to a
variety of agents. However, its role during L. pneumophila infection
is not well established. To characterize the role of Asc during L. pneu-
mophila infection, Asc was down regulated in both caspase-1
/
(Figure 1A) and WT macrophages (Figure 1B) using Asc specific
siRNA. After transfection, Asc protein level declined in both sets of
cells, while other components of the inflammasome, such as Nlrc4
and pro-caspase-1, were not affected (Figures 1A,B). After depletion
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 3
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
Asc
/
macrophages restricted L. pneumophila replication (Amer
et al., 2006; Ren et al., 2006; Zamboni et al., 2006; Lamkanfi et al.,
2007; Akhter et al., 2009; Case et al., 2009; Amer, 2010; Kang et al.,
2010). However, our data demonstrate that caspase-1 is cleaved
in the cytosol of Asc
/
macrophages, therefore, we examined if
this cytosolic cleavage required flagellin and if it is sufficient for
restriction of L. pneumophila infection. WT macrophages were
infected with the L. pneumophila mutant lacking flagellin (Fla),
then, caspase-1 activation in cell extracts was examined by Western
blots. Figure 5 shows that the Fla mutant did not activate caspase-1
within the cytosols of macrophages (Figure 5A). Because caspase-1
activation requires flagellin and is accompanied with restriction
to L. pneumophila infection, we examined the growth of L. pneu-
mophila mutants lacking flagellin (Fla) in macrophages lacking Asc
in comparison to WT cells, since both cells lack caspase-1 activa-
tion in response to Fla (data not shown). Specifically, Figure 5B
demonstrates that the growth of Fla mutants in Asc
/
macrophages
exceeds that exhibited in WT cells. Yet, NF-κB activation during Fla
was similar in WT and Asc
/
macrophages (Figure 5C). Therefore,
there must be another pathway mediated by Asc that maintains the
replication of Fla mutant under control in WT macrophages and
in extracts of cells treated with Asc specific siRNA was less than
that in cells treated with control siRNA (Figure 4A). Accordingly,
the release of active caspase-1 from siAsc treated cells was dimin-
ished (Figure 4B). In support of this data, total cleaved caspase-1
in combined cell extracts and culture supernatants was less in Asc
heterozygote macrophages than that of WT ones (Figure A1 of
Appendix). Furthermore, IL-1β release from macrophages was
impeded when Asc was depleted (Figure 4C). Therefore, Asc con-
tributes to the activation of a portion of pro-caspase-1, while the
rest of caspase-1 pro-form is cleaved independently of Asc.
Asc-INDEPENDENT ACTIVATION OF CASPASE-1 WITHIN MACROPHAGE
CYTOSOLS REQUIRES FLAGELLIN AND CONTRIBUTES TO THE
RESTRICTION OF L. pneumophiLa INFECTION
The activation of caspase-1 requires flagellin, thereby promoting
the restriction of L. pneumophila infection (Amer et al., 2006; Ren
et al., 2006; Zamboni et al., 2006; Lamkanfi et al., 2007; Akhter et al.,
2009; Case et al., 2009; Amer, 2010; Kang et al., 2010). Thus, we next
examined the growth of L. pneumophila in WT, caspase-1
/
, and
Asc
/
macrophages. As previously reported by our group and by
others, caspase-1
/
macrophages were permissive, whereas WT and
FIGURE 1 | Asc controls Legionella pneumophila replication in
caspase-1
/
macrophages. (A) Caspase-1
/
(casp-1
/
) macrophages and (B)
WT macrophages were either left untreated (NT) or transfected with Asc
specific siRNA (siAsc) or control siRNA (siCTR). After 48 h transfection Asc,
levels were assessed using Western blotting. Actin was used as a loading
control. Casp-1
/
macrophages (C) and wild type macrophages (D) were
transfected or not (NT) with siAsc or siCTR and 48 h after transfection cells
were infected with L. pneumophila (Leg) at MOI = 0.1 and the bacterial
replication was assessed by counting the CFU after 1, 24, 48, and 72 h.
Results are displayed as mean ± SD of three independent wells. **P 0.01.
The data shown in (C,D) are representative of four independent experiments
showing the same results.
Frontiers in Microbiology | Cellular and Infection Microbiology February 2011 | Volume 2 | Article 18 | 4
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
activated during L. pneumophila infection (Molmeret et al., 2004).
First, we tested if the Fla mutant activates caspase-3 in wild type
macrophages. Until 4 h post infection only WT L. pneumophila
activated caspase-3 (Figure 6A). However, at 5 h post infection,
the Fla mutant activated caspase-3 in WT macrophages but not in
Asc
/
macrophages (Figure 6B). Taken together, these data suggest
that Asc is involved in caspase-3 activation which mediates cell
death in WT macrophages at later stages of Fla infection.
LegioneLLa pneumophiLa MODULATES THE EXPRESSION OF Nlrc4
INFLAMMASOME COMPONENTS IN WILD TYPE MOUSE MACROPHAGES
In WT murine macrophages L. pneumophila flagellin is detected by
Nlrc4 with subsequent activation of caspase-1 (Amer et al., 2006;
Ren et al., 2006; Zamboni et al., 2006; Lamkanfi et al., 2007; Akhter
et al., 2009; Case et al., 2009; Amer, 2010; Kang et al., 2010). This
response is completely lacking in human phagocytes. In contrast
to murine phagocytes, human phagocytes which are permissive
to L. pneumophila do not activate caspase-1 in response to the
pathogen (Abdelaziz et al., 2011). This lack of activation is due to
the down regulation of ASC in human cells upon infection with
L. pneumophila (Abdelaziz et al., 2011). To characterize the effect
of L. pneumophila on the expression of the Nlrc4 inflammasome
components in the mouse, murine WT macrophages were infected
with L. pneumophila and the expression of caspase-1, IL-1β, Nlrc4,
and Asc was assessed on both mRNA and protein levels. The expres-
sion of both caspase-1 and IL-1β proteins were induced signifi-
cantly within 4 h after infection and remained up regulated for
24 h of infection (Figures A2A,B of Appendix). Subsequently,
both caspase-1 and IL-1β were activated early upon infection
(Figures A2A,B lower panel of Appendix) and their active forms
were released into the supernatant (Data not shown). Remarkably,
in contrast to mouse macrophages, the expression of Asc was
enhanced 24 h after infection (Figure A2C). As for Nlrc4, mRNA,
and protein levels were decreased later in infection (Figure A2D
lower panel of Appendix). We found that this decrease in Nlrc4
protein levels is due to its release with the rest of the inflamma-
some components into the media (data not shown). Therefore,
L. pneumophila differentially modulates the expression of Asc in
murine and in human phagocytes.
is missing in Asc
/
macrophages. To answer this question, we next
determined the levels of LDH release in culture supernatants of
WT and Asc
/
macrophages infected with L. pneumophila or the
Fla mutant. We found that the absence of Asc allows more host cell
survival during Fla infection. To further understand the mecha-
nism by which Asc modulates cell survival, we examined the activa-
tion of caspase-3, a caspase involved in apoptosis and know to be
FIGURE 2 | Asc hinders the activation of NF-κB induced by L. pneumophila.
(A) Caspase-1
/
(casp-1
−/−
) macrophages were transfected with Asc specific
siRNA (siAsc) or control siRNA (siCTR) and 48 h after transfection cells were
infected or not (NT) with L. pneumophila (Leg) at MOI = 0.5 for 1, 4, and 8 h.
Afterward, NF-κB activation was examined using electrophoretic mobility shift
assay (EMSA). (B) WT and Asc
/
mouse macrophages were infected or not (NT)
with L. pneumophila (Leg) at MOI = 0.5 for 1 and 8 h. Subsequently, NF-κB
activation was examined using EMSA.
FIGURE 3 | A fraction of caspase-1 is activated in the cytosol of murine
macrophages lacking Asc. (A) WT and Asc
/
mouse macrophages were
either not treated (NT) or infected with L. pneumophila (Leg) at MOI = 0.5 for
4 and 8 h. Then active caspase-1 (p-20) was detected in the cell extracts (A)
and the supernatants (B) by Western blotting. Actin was used as a loading
control.
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 5
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
Akhter et al., 2009; Abdelaziz et al., 2010; Amer, 2010; Vance, 2010).
It seems that these discrepancies are largely due to different infection
doses. Consequently, it is plausible to suggest that the activation of
caspase-1 by high bacterial burdens overrides the signaling pathways
controlling their activation at physiological levels of infection. Yet,
our data suggest that Asc is required for the recruitment and cleav-
age of at least a part of pro-caspase-1 protein into its active form
since the amount of cleaved p20 detected in the cell extracts of Asc
/+
macrophages was much less than that of WT macrophages.
Secondly, macrophages deploy an Asc-dependent restriction
mechanism to control L. pneumophila infection by controlling
NF-κB pathway. Dixit and colleagues demonstrated that macro-
phages from Asc
/
mice are markedly resistant to Salmonella typh-
imurium induced cell death (Mariathasan et al., 2004). However, in
their study, cell death was mainly attributed to caspase-1 mediated
pyroptosis while other pathways such as NF-κB activation were not
examined. Several reports by Isberg and Abu Kwaik showed that L.
pneumophila activates NF-κB in two phases to extend the host cell
survival to permit intracellular growth (Losick and Isberg, 2006; Abu-
Zant et al., 2007; Bartfeld et al., 2009). They clearly demonstrated that
NF-κB activation is absolutely required for L. pneumophila growth
within macrophages. L. pneumophila promotes two phases of NF-κB
activation, a TLR5-dependent and a TLR5-independent activation at
an early and later stages of infection respectively (Losick and Isberg,
2006; Bartfeld et al., 2009). The role of Asc in L. pneumophila-induced
NF-κB activation was not explored previously. A number of studies
suggest that Asc promotes NF-κB activation (Chamaillard et al., 2003;
Masumoto et al., 2003; Hasegawa et al., 2005). Conversely, several
studies by Wewers and Reed showed that THP-1 cells treated with
small interfering RNA for human ASC decreased their caspase-1
activity while enhancing their NF-κB signal (Stehlik et al., 2002;
Sarkar et al., 2006; Yu et al., 2006). The later studies showed that the
interaction of caspase-1 and RIP2 mediates NF-κB activation which
is prevented by human ASC as it hinders their interaction. Here,
we report that mouse Asc deters the activation of NF-κB during
L. pneumophila infection since the depletion of Asc allowed more
NF-κB activation and additional L. pneumophila growth.
Importantly, murine Asc is induced in response to L. pneu-
mophila infection (Figure A2). This is in stark contrast to human
ASC, which is down regulated in human monocytes upon infection
with L. pneumophila (Abdelaziz et al., 2011). The down regulation
of human ASC contributed to the permissiveness to L. pneumophila
growth. These findings are among the first reports clarifying the
mechanism of permissiveness of human monocytes to L. pneu-
mophila (Abdelaziz et al., 2011). Thus, regulating Asc availability
in human phagocytes could be a mechanism employed by L. pneu-
mophila to modulate caspase-1, NF-κB, and pyroptosis.
The detection of cleaved caspase-1 in supernatants of cultured
cells has been widely used as the hallmark for caspase-1 activation.
Few studies have shown that Nlrc4/Ipaf
/
and Asc
/
macrophages
fail to produce cleaved caspase-1 in response to L. pneumophila. The
absence of active caspase-1 promoted L. pneumophila growth. Yet, it
is unclear as to why Asc
/
macrophages do not allow L. pneumophila
replication. Here we show that in Asc
/
murine macrophages, a small
portion of caspase-1 is cleaved during L. pneumophila infection but
is not detected in culture supernatants. However, we cannot exclude
that cleaved caspase-1 was released in amounts below our detection
DISCUSSION
Asc is an adaptor molecule necessary for the assembly and activation
of several inflammasome complexes in response to stress signals and
microbial molecules (Taniguchi and Sagara, 2007; Hasegawa et al.,
2009). Asc is required for caspase-1 activation downstream of Nlrc4/
Ipaf during Salmonella or Shigella infections, yet its role during L.
pneumophila infection has been controversial (Zamboni et al., 2006;
Akhter et al., 2009; Case et al., 2009). In this study, we demonstrate
that a fraction of caspase-1 is activated within the cytosol of infected
macrophages independently of Asc. Data from our group and others
indicate that restriction of L. pneumophila infection is mediated by
several mechanisms. This can occur either via caspase-1-dependent or
independent mechanisms. Moreover, caspase-1 dependent control of L.
pneumophila infection can be either Asc-dependent or independent.
First, caspase-1-dependent restriction of L. pneumophila is by
modulation of pyroptosis and phagosome–lysosome fusion. Several
studies have demonstrated that at high MOIs with L. pneumophila,
the activation of caspase-1 leads to pyroptotic cell death, which
contributes to resistance to infection (Zamboni et al., 2006; Case
et al., 2009). Other reports have shown that during extreme MOIs
of L. pneumophila, murine caspase-1 is activated independently of
Nlrc4 (Case et al., 2009). This is at odds with other data that clearly
demonstrates that the activation of caspase-1 during physiologi-
cal levels of infection requires Nlrc4 (Amer et al., 2006; Ren et al.,
2006; Zamboni et al., 2006; Coers et al., 2007; Lightfield et al., 2008;
FIGURE 4 | Depletion of Asc decreases caspase-1 activation in response
to L. pneumophila infection. (A,B,C) WT mouse macrophages were
transfected or not (NT) with Asc specific siRNA (siAsc) or control siRNA (siCtr)
and 48 h after transfection cells were infected with L. pneumophila (Leg).
Then, active caspase-1 (p-20) was detected in the cell extracts (A) and in the
supernatants (B) of 8 h infected samples by Western blotting. Active IL-1β was
detected in supernatants using ELISA (C). The results displayed as mean ± SD
(**P 0.01) of three independent wells.
Frontiers in Microbiology | Cellular and Infection Microbiology February 2011 | Volume 2 | Article 18 | 6
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
MATERIALS AND METHODS
MICE AND MACROPHAGES
Wild type C57BL/6 (B6) and Asc
/
mice were previously described
(Mariathasan et al., 2004). Caspase-1
/
mice were from Dr.
Amy Hise at Case Western University. All knockout mice were
in a C57BL/6 background. Bone marrow-derived macrophages
(BMDMs) were isolated from femurs of 6- to 12-week-old mice
and were cultured in IMDM containing 10% heat-inactivated FBS,
20% L cell-conditioned medium, 100 U/ml penicillin, and 100 mg/
ml streptomycin at 37°C in a humidified atmosphere contain-
ing 5% CO
2
. After 5 days of incubation, cells were collected and
plated in 6-well plates or in 24-well plates in IMDM containing
10% heat-inactivated FBS (Stanley, 1997; Amer et al., 2005, 2006;
Akhter et al., 2009).
BACTERIAL STRAINS
Legionella pneumophila strain Lp02, is a thymine auxotrophic
derivative of Philadelphia-1 (Brenner et al., 1979; McDade and
Shepard, 1979). L. pneumophila flagellin (Fla) mutant was pre-
viously described (Albert-Weissenberger et al., 2010). L. pneu-
mophila was cultured as described previously (Sturgill-Koszycki
and Swanson, 2000; Akhter et al., 2009) All experiments were per-
formed at a low MOI of 0.5, followed by centrifugation and rinsing
of the wells after 30 min except when otherwise indicated (Derre
and Isberg, 2004).
threshold. Our data agree with recent work by Monack group although
the interpretation differs. They suggested that caspase-1 can be active
without being cleaved and independently of Asc as suggested by the
absence of cleaved caspase-1 in culture supernatants (Broz et al., 2010).
However, it is possible that caspase-1 was modestly cleaved within the
cytosol (which was not examined) and not released in supernatants.
Irrespective of its release, the active cytosolic caspase-1 is required and
sufficient to restrict L. pneumophila growth in Asc
/
macrophages.
On the other hand, the L. pneumophila mutant lacking flagellin
did not activate cytosolic caspase-1 in macrophages and replicated
efficiently. These findings support the idea that cytosolic cleavage of
caspase-1 is sufficient to restrict L. pneumophila growth within mac-
rophages and requires flagellin. The flagellin mutant replicated more
effectively in Asc
/
macrophages than in WT ones although both cells
lacked cytosolic caspase-1 activation and activated NF-κB at compa-
rable levels. However, Asc
/
macrophages survive more that WT ones
allowing more time for Fla replication. This was because caspase-3 was
activated in WT macrophages during late stages of Fla infection but
not in Asc
/
macrophages. It is possible that L. pneumophila activates
caspase-3 directly or through the Bax/Bak pathway which is governed
by Asc (Abu-Zant et al., 2005; Fischer et al., 2006). Taken together, these
data suggest that Asc is involved in caspase-3 activation and apoptosis
induction during L. pneumophila infection. Altogether, our data dem-
onstrate that the host employs more than one mechanism to prevent L.
pneumophila infection and that many of these are governed by Asc.
FIGURE 5 | Asc
−/−
macrophages are permissive to flagellin mutant. (A) WT
macrophages were infected with L. pneumophila (Leg), with corresponding
flagellin mutant (Fla), or left untreated (NT). Active caspase-1 (p-20) was then
detected in the cell extracts. (B) WT and Asc
−/−
macrophages were infected with
Fla mutant and CFUs were scored 72 h after infection. (C) WT and Asc
−/−
macrophages were infected with Fla mutant for 1, 4, and 8 h then, nuclear
extracts were processed for determination of NF-κB activation using
electrophoretic mobility shift assay (EMSA). (D) WT and Asc macrophages were
infected with Leg or Fla for 24 h then LDH release was determined and
presented as percent cell death on the Y axis.
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 7
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
QUANTITATIVE PCR
Total RNA was extracted from cells lysed in Trizol (Invitrogen Life
Technologies) and 1–2 μg of the RNA was converted to cDNA by
ThermoScript RNase H
Reverse Transcriptase (Invitrogen, Life
Technologies). 20–60 ng of the converted cDNA was then used
for quantitative PCR with SYBR Green I PCR Master Mix using
the StepOne Plus Real Time PCR System (Applied Biosystems).
The target gene C
t
values were normalized to the C
t
values of two
housekeeping genes (mouse GAPDH and CAP-1) and expressed as
relative copy number (RCN), as described earlier (Gavrilin et al.,
2006; Zakharova et al., 2010). Primers used in RT-PCR are pre-
sented in Table A1 of Appendix. We also evaluated expression of
an around 600 genes with Open Array Mouse Inflammatory Panel
(BioTrove, Life Technologies). All individual C
t
values were normal-
ized to the average of 18 housekeeping genes used in this array, and
also expressed as RCN.
CASPASE-3 ACTIVITY ASSAY
Active caspase-3 was determined by the AFC assay, as previously
described (Gonzalez-Mejia et al., 2010). Lysates were incubated in
a cyto-buffer (10% glycerol, 50 mM Pipes, pH 7.0, 1 mM EDTA,
containing 1 mM DTT) containing 20 mM of the tetrapeptide
substrate DEVD-AFC. The tetrapeptide was obtained from Enzyme
Systems Products (Livermore, CA, USA). Release of free AFC
was determined using a Cytofluor 4000 fluorometer (Perseptive
Company, Framingham, MA, USA; Filters: excitation; 400 nm,
emission; 508 nm).
LDH RELEASE ASSAY
LDH release into cell culture medium was used as an indica-
tor of cell death using NAD+ reduction assay, according to the
manufacturer (Roche Applied Science). Cells were plated in
12-well plate at the density 0.5 × 10
6
, and 0.5 MOI of both wild
type L. pneumophila (Leg) and its flagellin mutant (Fla) were
added. Cell culture medium was collected 24 h post infection;
clarified from floating bacteria by centrifugation; and used for
LDH assay. To determine spontaneous cell death, referred as
a negative control, we collected medium from cells incubated
the same time without bacteria. To measure total LDH content
in cells, referred as a positive control, cells were lysed by add-
ing TritonX-100 (1% final concentration) to the well. Media
alone was used as a blank. LDH concentration in the medium
was detected at OD 490 nm. Cell death was calculated by the
following formula: cytotoxicity (%) = (sampleblank/positive
controlblank) × 100.
STATISTICAL ANALYSIS
Data are displayed as mean of three independent experiments ± SD.
P value 0.05 was considered significant.
ACKNOWLEDGMENTS
Studies in the Amer laboratory are supported by grants R01HL094586
and R21AI083871 from the National Institute of Health (NIH) and
GRT00013604 from the American Lung Association (ALA). Grants
RO1HL075040-01 and NSF-MCB-0542244 to Andrea I. Doseff.
Dalia H. A. Abdelaziz and Basant A. Abdulrahman are supported
by The Egyptian Cultural and Educational Bureau Fellowship.
INTRACELLULAR GROWTH OF L. pneumophiLa
All experiments were performed at an MOI ranging 0.1–1, fol-
lowed by centrifugation and rinsing of the wells after 30 min except
when otherwise indicated (Derre and Isberg, 2004). All experi-
ments were performed in the absence of ferric nitrate and l-cysteine
from the monocytes or macrophage culture medium, to allow L.
pneumophila multiplication only intracellularly. At designated time
points, macrophages were lysed and plated on AYE plates for CFUs
(Amer et al., 2006; Abdelaziz et al., 2010). The quantification of the
CFU in vitro was performed more than four independent times as
described (Amer et al., 2006; Abdelaziz et al., 2010).
IMMUNOBLOTTING
Cell extracts of macrophages were prepared and immunoblotted
with an antibody that recognizes Nlrc4, Asc (Alexis Biochemicals),
caspase-1 (Santa Cruz), IL-1β (National Cancer Institute), caspase-3
(Cell Signalling), actin (Abcam), followed by appropriate secondary
antibody as described (Amer et al., 2006; Abdelaziz et al., 2010).
NF-κB DNA BINDING ACTIVITY ASSAY
Nuclear extracts of L. pneumophila treated or untreated BMDMs
from WT and Asc
/
mice were prepared as previously described
(Akhter et al., 2009). EMSA was used to measure NF-κB DNA
binding activity as described (Sarkar et al., 2006).
FIGURE 6 | (A) Lysates from WT macrophages infected with L. pneumophila
(Leg), the Fla mutant, or the type IV secretion mutant DotA were used to
determine caspase-3 activity by the DEVD-AFC assay, or inactive full-length
(FL-casp-3) and cleaved caspase-3 (cleaved casp-3) by immunoblotting. (B) WT
and Asc
/
macrophages were infected with Fla mutant for 1, 2, and 5 h then
cell lysates were obtained and used to determine cleaved caspase-3 by
Western Blotting.
Frontiers in Microbiology | Cellular and Infection Microbiology February 2011 | Volume 2 | Article 18 | 8
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
REFERENCES
Abdelaziz, D. H., Amr, K., and Amer, A. O.
(2010). Nlrc4/Ipaf/CLAN/CARD12:
more than a flagellin sensor. Int. J.
Biochem. Cell Biol. 42, 789–791.
Abdelaziz, D. H., Gavrilin, M. A., Akhter,
A., Caution, K., Kotrange, S., Khweek,
A. A., Abdulrahman, B. A., Grandhi, J.,
Hassan, Z. A., Marsh, C., Wewers, M.
D., and Amer, A. O. (2011). ASC con-
trols Legionella pneumophila infection
in human monocytes. J. Biol. Chem.
286, 3203–3208.
Abu-Zant, A., Jones, S., Asare, R., Suttles,
J., Price, C., Graham, J., and Kwaik,
Y. A. (2007). Anti-apoptotic signal-
ling by the Dot/Icm secretion system
of L. pneumophila. Cell Microbiol. 9,
246–264.
Abu-Zant, A., Santic, M., Molmeret, M.,
Jones, S., Helbig, J., and Abu Kwaik, Y.
(2005). Incomplete activation of mac-
rophage apoptosis during intracellular
replication of Legionella pneumophila.
Infect. Immun. 73, 5339–5349.
Akhter, A., Gavrilin, M. A., Frantz, L.,
Washington, S., Ditty, C., Limoli,
D., Day, C., Sarkar, A., Newland, C.,
Butchar, J., Marsh, C. B., Wewers, M.
D., Tridandapani, S., Kanneganti, T.
D., and Amer, A. O. (2009). Caspase-7
activation by the Nlrc4/Ipaf inflamma-
some restricts Legionella pneumophila
infection. PLoS Pathog. 5, e1000361.
doi: 10.1371/journal.ppat.1000361
Albert-Weissenberger, C., Sahr, T.,
Sismeiro, O., Hacker, J., Heuner, K.,
and Buchrieser, C. (2010). Control of
flagellar gene regulation in Legionella
pneumophila and its relation to growth
phase. J. Bacteriol. 192, 446–455.
Amer, A., Franchi, L., Kanneganti, T. D.,
Body-Malapel, M., Ozoren, N., Brady,
G., Meshinchi, S., Jagirdar, R., Gewirtz,
A., Akira, S., and Nunez, G. (2006).
Regulation of Legionella phagosome
maturation and infection through
flagellin and host ipaf. J. Biol. Chem.
281, 35217–35223.
Amer, A. O. (2010). Modulation of cas-
pases and their non-apoptotic func-
tions by Legionella pneumophila. Cell.
Microbiol. 12, 140–147.
Amer, A. O., Byrne, B. G., and Swanson,
M. S. (2005). Macrophages rapidly
transfer pathogens from lipid raft vac-
uoles to autophagosomes. Autophagy
1, 53–58.
Bartfeld, S., Engels, C., Bauer, B., Aurass,
P., Flieger, A., Bruggemann, H., and
Meyer, T. F. (2009). Temporal resolu-
tion of two-tracked NF-kappaB acti-
vation by Legionella pneumophila. Cell.
Microbiol. 11, 1638–1651.
Bedoya, F., Sandler, L. L., and Harton,
J. A. (2007). Pyrin-only protein 2
modulates NF-kappaB and disrupts
ASC:CLR interactions. J. Immunol.
178, 3837–3845.
Brenner, D. J., Steigerwalt, A. G., and
McDade, J. E. (1979). Classification
of the Legionnaires’ disease bacte-
rium: Legionella pneumophila, genus
novum, species nova, of the family
Legionellaceae, familia nova. Ann.
Intern. Med. 90, 656–658.
Broz, P., von Moltke, J., Jones, J. W., Vance,
R. E., and Monack, D. M. (2010).
Differential requirement for caspase-1
autoproteolysis in pathogen-induced
cell death and cytokine processing. Cell
Host Microbe 8, 471–483.
Case, C. L., Shin, S., and Roy, C. R.
(2009). Asc and ipaf inflammasomes
direct distinct pathways for caspase-1
activation in response to Legionella
pneumophila. Infect. Immun. 77,
1981–1991.
Chamaillard, M., Hashimoto, M., Horie,
Y., Masumoto, J., Qiu, S., Saab, L.,
Ogura, Y., Kawasaki, A., Fukase, K.,
Kusumoto, S., Valvano, M. A., Foster, S.
J., Mak, T. W., Nunez, G., and Inohara,
N. (2003). An essential role for NOD1
in host recognition of bacterial pepti-
doglycan containing diaminopimelic
acid. Nat. Immunol. 4, 702–707.
Coers, J., Vance, R. E., Fontana, M. F., and
Dietrich, W. F. (2007). Restriction of
Legionella pneumophila growth in
macrophages requires the concerted
action of cytokine and Naip5/Ipaf
signalling pathways. Cell. Microbiol.
9, 2344–2357.
Derre, I., and Isberg R. R. (2004).
Macrophages from mice with the
restrictive Lgn1 allele exhibit mul-
tifactorial resistance to Legionella
pneumophila. Infect. Immun. 72,
6221–6229.
Fernandes-Alnemri, T., and Alnemri
E. S. (2008). Assembly, purification,
and assay of the activity of the ASC
pyroptosome. Meth. Enzymol. 442,
251–270.
Fernandes-Alnemri, T., Wu, J., Yu, J.
W., Datta, P., Miller, B., Jankowski,
W., Rosenberg, S., Zhang, J., and
Alnemri, E. S. (2007). The pyropto-
some: a supramolecular assembly of
ASC dimers mediating inflammatory
cell death via caspase-1 activation. Cell
Death Differ. 14, 1590–1604.
Fischer, S. F., Vier, J., Muller-Thomas, C.,
and Hacker, G. (2006). Induction of
apoptosis by Legionella pneumophila
in mammalian cells requires the mito-
chondrial pathway for caspase activa-
tion. Microbes Infect. 8, 662–669.
Franchi, L., Park, J. H., Shaw, M. H.,
Marina-Garcia, N., Chen, G., Kim, Y.
G., and Nunez, G. (2008). Intracellular
NOD-like receptors in innate immu-
nity, infection and disease. Cell.
Microbiol. 10, 1–8.
Gavrilin, M. A., Bouakl I. J., Knatz, N. L.,
Duncan, M. D., Hall, M. W., Gunn,
J. S., and Wewers, M. D. (2006).
Internalization and phagosome escape
required for Francisella to induce
human monocyte IL-1beta process-
ing and release. Proc. Natl. Acad. Sci.
U.S.A. 103, 141–146.
Gonzalez-Mejia, M. E., Voss, O. H.,
Murnan, E. J., and Doseff, A. I. (2010).
Apigenin-induced apoptosis of leuke-
mia cells is mediated by a bimodal and
differentially regulated residue-spe-
cific phosphorylation of heat-shock
protein-27. Cell Death Dis. 1, e64.
Hasegawa, M., Imamura, R., Kinoshita, T.,
Matsumoto, N., Masumoto, J., Inohara,
N., and Suda, T. (2005). ASC-mediated
NF-kappaB activation leading to
interleukin-8 production requires
caspase-8 and is inhibited by CLARP.
J. Biol. Chem. 280, 15122–15130.
Hasegawa, M., Imamura, R., Motani,
K., Nishiuchi, T., Matsumoto, N.,
Kinoshita, T., and Suda, T. (2009).
Mechanism and repertoire of ASC-
mediated gene expression. J. Immunol.
182, 7655–7662.
Hasegawa, M., Kawase, K., Inohara, N.,
Imamura, R., Yeh, W. C., Kinoshita,
T., and Suda, T. (2007). Mechanism
of ASC-mediated apoptosis: bid-
dependent apoptosis in type II cells.
Oncogene 26, 1748–1756.
Horwitz, M. A., and Silverstein, S. C.
(1981). Interaction of the Legionnaires’
disease bacterium (Legionella pneu-
mophila) with human phagocytes.
I. L. pneumophila resists killing by
polymorphonuclear leukocytes, anti-
body, and complement. J. Exp. Med.
153, 386–397.
Horwitz, M. A., and Silverstein, S. C.
(1983). Intracellular multiplication
of Legionnaires’ disease bacteria
(Legionella pneumophila) in human
monocytes is reversibly inhibited by
erythromycin and rifampin. J. Clin.
Invest. 71, 15–26.
Kang, T. J., Lee G. S., Kim, S. K., Jin, S. H.,
and Chae, G. T. (2010). Comparison of
two mice strains, A/J and C57BL/6, in
caspase-1 activity and IL-1beta secre-
tion of macrophage to Mycobacterium
leprae infection. Mediators Inflamm.
2010, 708713.
Kanneganti, T. D., Lamkanfi, M., and
Nunez, G. (2007). Intracellular NOD-
like receptors in host defense and dis-
ease. Immunity 27, 549–559.
Lamkanfi, M., Amer, A., Kanneganti,
T. D., Munoz-Planillo, R., Chen, G.,
Vandenabeele, P., Fortier, A., Gros, P.,
and Nunez, G. (2007). The Nod-like
receptor family member Naip5/Birc1e
restricts Legionella pneumophila growth
independently of caspase-1 activation.
J. Immunol. 178, 8022–8027.
Lamkanfi, M., and Kanneganti, T. D.
(2010). Caspase-7: a protease involved
in apoptosis and inflammation. Int. J.
Biochem. Cell Biol. 42, 21–24.
Lamkanfi, M., Kanneganti T. D., Van
Damme, P., Vanden Berghe, T.,
Vanoverberghe, I., Vandekerckhove,
J., Vandenabeele, P., Gevaert, K., and
Nunez, G. (2008). Targeted peptide-
centric proteomics reveals caspase-7
as a substrate of the caspase-1 inflam-
masomes. Mol. Cell Proteomics 7,
2350–2363.
Lamkanfi, M., Moreira, L. O., Makena, P.,
Spierings, D. C., Boyd, K., Murray, P.
J., Green, D. R., and Kanneganti, T. D.
(2009). Caspase-7 deficiency protects
from endotoxin-induced lymphocyte
apoptosis and improves survival. Blood
113, 2742–2745.
Liepinsh, E., Barbals, R., Dahl, E., Sharipo,
A., Staub, E., and Otting, G. (2003).
The death-domain fold of the ASC
PYRIN domain, presenting a basis
for PYRIN/PYRIN recognition. J. Mol.
Biol. 332, 1155–1163.
Lightfield, K. L., Persson, J., Brubaker, S. W.,
Witte, C. E., von Moltke, J., Dunipace,
E. A., Henry, T., Sun, Y. H., Cado, D.,
Dietrich, W. F., Monack, D. M., Tsolis,
R. M., and Vance, R. E. (2008). Critical
function for Naip5 in inflammasome
activation by a conserved carboxy-
terminal domain of flagellin. Nat.
Immunol. 9, 1171–1178.
Losick, V. P., Haenssler, E., Moy, M. Y., and
Isberg, R. R. (2010). LnaB: a Legionella
pneumophila activator of NF-kappaB.
Cell. Microbiol. 12, 1083–1097.
Losick, V. P., and Isberg, R. R. (2006).
NF-kappaB translocation prevents
host cell death after low-dose chal-
lenge by Legionella pneumophila. J.
Exp. Med. 203, 2177–2189.
Mariathasan, S. (2007). ASC, ipaf and cry-
opyrin/Nalp3: bona fide intracellular
adapters of the caspase-1 inflamma-
some. Microbes Infect. 9, 664–671.
Mariathasan, S., Newton, K., Monack,
D. M., Vucic, D., French, D. M., Lee,
W. P., Roose-Girma, M., Erickson, S.,
and Dixit, V. M. (2004). Differential
activation of the inflammasome by
caspase-1 adaptors ASC and Ipaf.
Nature 430, 213–218.
Martinon, F., and Tschopp, J. (2007).
Inflammatory caspases and inflam-
masomes: master switches of inflam-
mation. Cell Death Differ. 14, 10–22.
Masumoto, J., Dowds, T. A., Schaner, P.,
Chen, F. F., Ogura, Y., Li, M., Zhu, L.,
Katsuyama, T., Sagara, J., Taniguchi,
S., Gumucio, D. L., Nunez, G., and
Inohara, N. (2003). ASC is an activat-
ing adaptor for NF-kappa B and cas-
pase-8-dependent apoptosis. Biochem.
Biophys. Res. Commun. 303, 69–73.
Masumoto, J., Taniguchi, S., Ayukawa, K.,
Sarvotham, H., Kishino, T., Niikawa,
N., Hidaka, E., Katsuyama, T., Higuchi,
T., and Sagara, J. (1999). ASC, a novel
22-kDa protein, aggregates during
apoptosis of human promyelocytic
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 9
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
leukemia HL-60 cells. J. Biol. Chem.
274, 33835–33838.
Masumoto, J., Taniguchi, S., Nakayama,
K., Ayukawa, K., and Sagara, J. (2001).
Murine ortholog of ASC, a CARD-
containing protein, self-associates
and exhibits restricted distribution in
developing mouse embryos. Exp. Cell
Res. 262, 128–133.
McDade, J. E., and Shepard, C. C. (1979).
Virulent to avirulent conversion
of Legionnaires’ disease bacterium
(Legionella pneumophila) – its effect
on isolation techniques. J. Infect. Dis.
139, 707–711.
Molmeret, M., Zink S. D., Han, L., Abu-
Zant, A., Asari, R., Bitar, D. M., and
Abu Kwaik, Y. (2004). Activation of cas-
pase-3 by the Dot/Icm virulence system
is essential for arrested biogenesis of the
Legionella-containing phagosome. Cell.
Microbiol. 6, 33–48.
Motani, K., Kawase, K., Imamura, R.,
Kinoshita, T., Kushiyama, H., and Suda,
T. (2010). Activation of ASC induces
apoptosis or necrosis, depending on
the cell type, and causes tumor eradi-
cation. Cancer Sci. 101, 1822–1827.
Nash, T. W., Libby, D. M., and Horwitz,
M. A. (1984). Interaction between
the legionnairesdisease bacterium
(Legionella pneumophila) and human
alveolar macrophages. Influence of
antibody, lymphokines, and hydrocor-
tisone. J. Clin. Invest. 74, 771–782.
Ohtsuka, T., Ryu, H., Minamishima, Y. A.,
Macip, S., Sagara, J., Nakayama, K. I.,
Aaronson, S. A., and Lee, S. W. (2004).
ASC is a Bax adaptor and regulates the
p53-Bax mitochondrial apoptosis
pathway. Nat. Cell Biol. 6, 121–128.
Ren, T., Zamboni, D. S., Roy, C. R., Dietrich,
W. F., and Vance, R. E. (2006). Flagellin-
deficient Legionella mutants evade
caspase-1- and Naip5-mediated mac-
rophage immunity. PLoS Pathog. 2, e18.
doi: 10.1371/journal.ppat.0020018
Sarkar, A., Duncan, M., Hart, J., Hertlein,
E., Guttridge, D. C., and Wewers, M. D.
(2006). ASC directs NF-kappaB activa-
tion by regulating receptor interacting
protein-2 (RIP2) caspase-1 interac-
tions. J. Immunol. 176, 4979–4986.
Shaw, P. J., Lamkanfi, M., and Kanneganti,
T. D. (2010). NOD-like receptor (NLR)
signaling beyond the inflammasome.
Eur. J. Immunol. 40, 624–627.
Srinivasula, S. M., Poyet, J. L., Razmara,
M., Datta, P., Zhang, Z., and Alnemri,
E. S. (2002). The PYRIN-CARD
protein ASC is an activating adap-
tor for caspase-1. J. Biol. Chem. 277,
21119–21122.
Stanley, E. R. (1997). Murine bone mar-
row-derived macrophages. Methods
Mol. Biol. 75, 301–304.
Stehlik, C., Fiorentino, L., Dorfleutner, A.,
Bruey, J. M., Ariza, E. M., Sagara, J., and
Reed, J. C. (2002). The PAAD/PYRIN-
family protein ASC is a dual regulator
of a conserved step in nuclear factor
kappaB activation pathways. J. Exp.
Med. 196, 1605–1615.
Stehlik, C., Krajewska, M., Welsh, K.,
Krajewski, S., Godzik, A., and Reed,
J. C. (2003). The PAAD/PYRIN-only
protein POP1/ASC2 is a modulator
of ASC-mediated nuclear-factor-ka-
ppa B and pro-caspase-1 regulation.
Biochem. J. 373(Pt 1), 101–113.
Sturgill-Koszycki, S., and Swanson, M. S.
(2000). Legionella pneumophila rep-
lication vacuoles mature into acidic,
endocytic organelles. J. Exp. Med. 192,
1261–1272.
Taniguchi, S., and Sagara, J. (2007).
Regulatory molecules involved in
inflammasome formation with special
reference to a key mediator protein, ASC.
Semin. Immunopathol. 29, 231–238.
Vance, R. E. (2010). Immunology taught by
bacteria. J. Clin. Immunol. 30, 507–511.
Yu, J. W., Wu, J., Zhang, Z., Datta, P.,
Ibrahimi, I., Taniguchi, S., Sagara, J.,
Fernandes-Alnemri, T., and Alnemri,
E. S. (2006). Cryopyrin and pyrin acti-
vate caspase-1, but not NF-kappaB,
via ASC oligomerization. Cell Death
Differ. 13, 236–249.
Zakharova, E., Grandhi, J., Wewers,
M. D., and Gavrilin, M. A. (2010).
Mycoplasma suppression of THP-1
Cell TLR responses is corrected with
antibiotics. PLoS ONE 5, e9900. doi:
10.1371/journal.pone.0009900
Zamboni, D. S., Kobayashi, K. S.,
Kohlsdorf, T., Ogura, Y., Long, E. M.,
Vance, R. E., Kuida, K., Mariathasan,
S., Dixit, V. M., Flavell, R. A., Dietrich,
W. F., and Roy, C. R. (2006). The Birc1e
cytosolic pattern-recognition receptor
contributes to the detection and con-
trol of Legionella pneumophila infec-
tion. Nat. Immunol. 7, 318–325.
Conflict of Interest Statement: The
authors declare that the research was
conducted in the absence of any com-
mercial or financial relationships that
could be construed as a potential conflict
of interest.
Received: 09 December 2010; paper pend-
ing published: 22 December 2010; accepted:
25 January 2011; published online: 14
February 2011.
Citation: Abdelaziz DHA, Gavrilin
MA, Akhter A, Caution K, Kotrange S,
Khweek AA, Abdulrahman BA, Hassan
ZA, El-Sharkawi FZ, Bedi SS, Ladner K,
Gonzalez-Mejia ME, Doseff AI, Mostafa
M, Kanneganti T-D, Guttridge D, Marsh
CB, Wewers MD and Amer AO (2011) Asc-
dependent and independent mechanisms
contribute to restriction of Legionella
pneumophila infection in murine macro-
phages. Front. Microbio. 2:18. doi: 10.3389/
fmicb.2011.00018
This article was submitted to Frontiers in
Cellular and Infection Microbiology, a spe-
cialty of Frontiers in Microbiology.
Copyright © 2011 Abdelaziz, Gavrilin,
Akhter, Caution, Kotrange, Khweek,
Abdulrahman, Hassan, El-Sharkawi, Bedi,
Ladner, Gonzalez-Mejia, Doseff, Mostafa,
Kanneganti, Guttridge, Marsh, Wewers
and Amer. This is an open-access article
subject to an exclusive license agreement
between the authors and Frontiers Media
SA, which permits unrestricted use, distri-
bution, and reproduction in any medium,
provided the original authors and source
are credited.
Frontiers in Microbiology | Cellular and Infection Microbiology February 2011 | Volume 2 | Article 18 | 10
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
FIGURE A1 | (A) Wild type (WT) mouse macrophages and heterozygous Asc
(Asc
/+
) were infected or not (NT) with L. pneumophila (Leg) at MOI = 0.5 for 1,
2, and 4 h. Total active caspase-1 (p-20) was detected in combined lysate and
supernatants by Western blotting. (B) WT and caspase-1
/
macrophages were
infected with L. pneumophila (Leg) at MOI = 0.1 and the bacterial replication
was assessed by counting the colony-forming units (CFU) after 1, 24, 48, and
72 h. Results are displayed as mean ± SD of three independent
wells. **P 0.01.
APPENDIX
www.frontiersin.org February 2011 | Volume 2 | Article 18 | 11
Abdelaziz et al. Mouse Asc regulates L. pneumophila infection
Table A1 | Mouse primers used in RT-PCR.
Gene Size Sequence
Casp1 145 F ACCCTCAAGTTTTGCCCTTT
R CCCTCGGAGAAAGATGTTGA
Cap1 96 F GAAGGCGGTGATTTTAACGA
R TCCAGCGATTTCTGTCACTG
Gapdh 128 F TGGCATTGTGGAAGGGCTCA
R TGGATGCAGGGATGATGTTCT
Pycard 173 F GCTCACAATGACTGTGCTTAG
R TGACCCTGGCAATGAGTGCT
Il 1b 153 F CCTGAACTCAACTGTGAAATGC
R GTGCTGCTGTGAGATTTGAAG
NIrc4 152 F AGGACTTGCCAAACTTGGATT
R TGAAGTAAAGCCATCCGTCAC
FIGURE A2 | Legionella pneumophila differentially regulates the expression
of several components of the inflammasome. WT mouse macrophages were
infected or not (NT) with Legionella pneumophila (Leg) at MOI = 0.5 for 4 and 24 h.
then the expressions of (A) pro-caspase-1, (B) pro-Il-1β, (C) Pycard (Asc), and (D)
Nlrc4 (Ipaf) were then assessed on both mRNA (upper panels) and protein levels
(lower panels) using RT-PCR and Western blots, respectively. The data of RT-PCR
are displayed as mean relative copy numbers (RCN) ± SD of three independent
experiments. *P 0.05, **P 0.01. Actin was used as loading control.
    • "LDH concentration in the medium was detected at wavelength 490 nm. Cell death was calculated by the formula: (cytotoxicity (%)  =  (sample/positive control) ×100), as described earlier [17]. "
    [Show abstract] [Hide abstract] ABSTRACT: Lung epithelial cell death is critical to the lung injury that occurs in the acute respiratory distress syndrome. It is known that FasL plays a prominent role in this lung cell death pathway and may work in part through activation of the receptor interacting protein-2 (RIP2). RIP2 is serine/threonine kinase with a C-terminal caspase activation and recruitment domain (CARD). This CARD contains a highly conserved, predicted tyrosine phosphorylation site. Thus, involvement of tyrosine phosphorylation in the CARD domain of RIP2 may play a critical role in Fas-mediated apoptosis in the human lung immune system. To test this hypothesis, human lung epithelial cells (BEAS-2B) were induced to undergo cell death in response to the Fas agonist antibody CH11 with and without manipulation of endogenous RIP2 concentrations. We show that CH11 increases lung epithelial cell death in a dose-dependent manner as determined by LDH release and nuclear condensation. Fas-induced LDH release was inhibited by RIP2 knock-down. Reduced levels of RIP2 in BEAS-2B cells after treatment with RIP2 siRNA were confirmed by immunoblot. Overexpression of RIP2 in BEAS-2B cells synergized with Fas ligand-induced LDH release in a dose-dependent manner. Finally, mutation of the tyrosine phosphorylation site in CARD of RIP2 protected BEAS-2B cells from Fas ligand induced cell death. Thus RIP2's CARD tyrosine phosphorylation may represent a new therapeutic target to promote the survival of human lung epithelial cells in disorders that lead to acute lung injury and ARDS.
    Full-text · Article · Mar 2014
    • "NLRC4- independent caspase-1 activation and IL-1β and IL-18 secretion require ASC and NLRP3, although the identity of the L. pneumophila-derived signal sensed via NLRP3 is unknown (Case et al., 2009, 2013; Casson et al., 2013). Caspase-1 cleavage in the absence of ASC can be detected in either the supernatant or the cytosol, depending on the MOI (Case et al., 2009; Abdelaziz et al., 2011a). ASC also drives formation of a punctate structure containing caspase-1 and NLRC4 in L. pneumophila-infected macrophages (Case and Roy, 2011). "
    [Show abstract] [Hide abstract] ABSTRACT: Cell death can be critical for host defense against intracellular pathogens because it eliminates a crucial replicative niche, and pro-inflammatory cell death can alert neighboring cells to the presence of pathogenic organisms and enhance downstream immune responses. Pyroptosis is a pro-inflammatory form of cell death triggered by the inflammasome, a multi-protein complex that assembles in the cytosol to activate caspase-1. Inflammasome activation by pathogens hinges upon violation of the host cell cytosol by activities such as the use of pore-forming toxins, the use of specialized secretion systems, or the cytosolic presence of the pathogen itself. Recently, a non-canonical inflammasome has been described that activates caspase-11 and also leads to pro-inflammatory cell death. Caspase-11 is activated rapidly and robustly in response to violation of the cytosol by bacterial pathogens as well. In this mini-review, we describe the canonical and non-canonical inflammasome pathways that are critical for host defense against a model intracellular bacterial pathogen that accesses the host cytosol-Legionella pneumophila.
    Full-text · Article · Dec 2013
    • "In contrast to murine macrophages, human monocytes-derived macrophages (hMDMs) are permissive to planktonic L. pneumophila at least in part due to diminished caspase-1 and -7 activation (Horwitz, 1983; Abdelaziz et al., 2011a,b). Replication within macrophages is essential for establishing Legionnaire's pneumonia. "
    [Show abstract] [Hide abstract] ABSTRACT: Legionella pneumophila, the causative agent of Legionnaire's disease, replicates in human alveolar macrophages to establish infection. There is no human-to-human transmission and the main source of infection is L. pneumophila biofilms established in air conditioners, water fountains, and hospital equipments. The biofilm structure provides protection to the organism from disinfectants and antibacterial agents. L. pneumophila infection in humans is characterized by a subtle initial immune response, giving time for the organism to establish infection before the patient succumbs to pneumonia. Planktonic L. pneumophila elicits a strong immune response in murine, but not in human macrophages enabling control of the infection. Interactions between planktonic L. pneumophila and murine or human macrophages have been studied for years, yet the interface between biofilm-derived L. pneumophila and macrophages has not been explored. Here, we demonstrate that biofilm-derived L. pneumophila replicates significantly more in murine macrophages than planktonic bacteria. In contrast to planktonic L. pneumophila, biofilm-derived L. pneumophila lacks flagellin expression, do not activate caspase-1 or -7 and trigger less cell death. In addition, while planktonic L. pneumophila is promptly delivered to lysosomes for degradation, most biofilm-derived bacteria were enclosed in a vacuole that did not fuse with lysosomes in murine macrophages. This study advances our understanding of the innate immune response to biofilm-derived L. pneumophila and closely reproduces the natural mode of infection in human.
    Full-text · Article · May 2013
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined

Recommended publications

Discover more