Levamisole resistance resolved at the single-channel level in Caenorhabditis elegans

Department of Biomedical Sciences, Iowa State University, Ames, IA 50011, USA.
The FASEB Journal (Impact Factor: 5.04). 09/2008; 22(9):3247-54. DOI: 10.1096/fj.08-110502
Source: PubMed
ABSTRACT
Sydney Brenner promoted Caenorhabditis elegans as a model organism, and subsequent investigations pursued resistance to the nicotinic anthelmintic drug levamisole in C. elegans at a genetic level. These studies have advanced our understanding of genes associated with neuromuscular transmission and resistance to the antinematodal drug. In lev-8 and lev-1 mutant C. elegans, levamisole resistance is associated with reductions in levamisole-activated whole muscle cell currents. Although lev-8 and lev-1 are known to code for nicotinic acetylcholine receptor (nAChR) subunits, an explanation for why these currents get smaller is not available. In wild-type adults, nAChRs aggregate at neuromuscular junctions and are not accessible for single-channel recording. Here we describe a use of LEV-10 knockouts, in which aggregation is lost, to make in situ recordings of nAChR channel currents. Our observations provide an explanation for levamisole resistance produced by LEV-8 and LEV-1 mutants at the single-channel level.

Full-text

Available from: Richard J Martin
The FASEB Journal Research Communication
Levamisole resistance resolved at the single-channel
level in Caenorhabditis elegans
Hai Qian,* Alan P. Robertson,* Jo Anne Powell-Coffman,
and Richard J. Martin*
,1
*Department of Biomedical Sciences and
Department of Genetics, Development, and Cell Biology,
Iowa State University, Ames, Iowa, USA
ABSTRACT Sydney Brenner promoted Caenorhabdi-
tis elegans as a model organism, and subsequent inves-
tigations pursued resistance to the nicotinic anthel-
mintic drug levamisole in C. elegans at a genetic level.
These studies have advanced our understanding of
genes associated with neuromuscular transmission and
resistance to the antinematodal drug. In lev-8 and lev-1
mutant C. elegans, levamisole resistance is associated
with reductions in levamisole-activated whole muscle
cell currents. Although lev-8 and lev-1 are known to code
for nicotinic acetylcholine receptor (nAChR) subunits,
an explanation for why these currents get smaller is not
available. In wild-type adults, nAChRs aggregate at
neuromuscular junctions and are not accessible for
single-channel recording. Here we describe a use of
LEV-10 knockouts, in which aggregation is lost, to make
in situ recordings of nAChR channel currents. Our
observations provide an explanation for levamisole
resistance produced by LEV-8 and LEV-1 mutants at the
single-channel level.—Qian, H., Robertson, A. P., Pow-
ell-Coffman, J. A., and Martin, R. J. Levamisole resis-
tance resolved at the single-channel level in Caenorhab-
ditis elegans. FASEB J. 22, 3247–3254 (2008)
Key Words: resistance LEV-10 LEV-8 LEV-1 nAChR
Resistance to a wide range of antiparasitic drugs is
an urgent and increasing problem for health of hu-
mans and animals (1, 2). Levamisole and related drugs
are cholinergic agonists (3) that selectively paralyze
nematode parasites; they are used to treat many nem-
atode parasite infections, but resistance is now a major
concern. Sydney Brenner promoted the study of the
soil nematode Caenorhabditis elegans as a genetic animal
model for neuromuscular transmission (4, 5) and
thereby initiated investigation of the genetics of levami-
sole resistance (6, 7). The resistance studies led to
identification of genes and proteins required for nem-
atode neuromuscular function. Two types of nicotinic
acetylcholine receptor (nAChR) ion channels have
been described on C. elegans somatic muscle (8): one is
selectively activated by nicotine and one is selectively
activated by levamisole. Genes coding for five protein
subunits of levamisole-activated receptor channels have
been recognized (9–11) as have some of the proteins
that interact with the levamisole receptor channel (12,
13).
Study of this receptor using a whole muscle cell
voltage clamp has helped our understanding of synap-
tic transmission in nematodes and mechanisms of
resistance to levamisole. The levamisole receptor ap-
pears to be composed of a pentameric transmembrane
ring of three essential subunits (UNC-63, UNC-38, and
UNC-29) (9, 10) and two nonessential subunits (LEV-1
and LEV-8) (9–11). Knockout of UNC-63, UNC-29, or
UNC-38 subunits leads to strong levamisole resistance,
absence of levamisole-activated muscle currents, and an
uncoordinated phenotype. Knockout of LEV-8 subunits
produces partial resistance and reduction of levamisole
whole muscle cell current to 33% of that of the wild
type (11); knockout of LEV-1 also produces partial
resistance and reduction of whole muscle cell current
to 14% of that of the wild type (10). Genetic studies and
whole-cell recording, although powerful, have not pro-
vided a clear explanation of why muscle currents are
smaller in lev-8 and lev-1 mutants.
Although single-channel current recordings from
these receptors have been possible using cultured em-
bryonic muscle cells (14), in situ recordings from adult
C. elegans have not yet been possible because the
receptors are aggregated at the synapse and are inac-
cessible. To investigate the origin of the resistance and
current reductions more fully by recording the channel
currents in situ, we exploited a lev-10 mutant (13).
LEV-10 is a receptor-associated protein in C. elegans that
is required for postsynaptic clustering of the levamisole-
selective receptor but not the nicotine-selective recep-
tor. Observations (13) suggested that the levamisole
receptors distribute extrasynaptically in lev-10 mutants.
We tested this hypothesis by observing single-channel
currents in extrasynaptic muscle membrane patches
from wild-type and lev-10 mutants and found a popula-
tion of acetylcholine- and levamisole-activated channels
that increased in number in lev-10 knockouts. We were
then able to examine the in vivo effects of removing
either the LEV-8 subunit or the LEV-1 subunit at the
single-channel level using the double mutants lev-10;
lev-8 and lev-10;lev-1. Here we describe in situ recordings
in adult C. elegans that allow us to see the single-channel
1
Correspondence: Department of Biomedical Sciences,
Iowa State University, Ames, IA 50011, USA. E-mail:
rjmartin@iastate.edu
doi: 10.1096/fj.08-110502
32470892-6638/08/0022-3247 © FASEB
Page 1
properties of receptors of mutants that are resistant to
the anthelmintic levamisole.
MATERIALS AND METHODS
C. elegans and mutants
N2 and lev-10(x17) worms used for single-channel recording
in this work were provided by the Caenorhabditis Genetics
Center (University of Minnesota, Minneapolis, MN, USA),
which is funded by the National Institutes of Health National
Center for Research Resources. Single null mutants lev-10
(kr26::Mos1) (15), lev-1(kr105::Mos1), and lev-8(kr136::Mos1)
were provided by Dr. Jean-Louie Bessereau’s laboratory at the
Institute National de la Sante´ et de la Recherche Me´dicale,
Paris, France. All worms were grown on agar seeded with
Escherichia coli OP50 at 20°C using established methods. Double
mutants were prepared by crossbreeding lev-10(kr26::Mos1)
nulls with either lev-8 or lev-1 nulls. L4 hermaphrodites were
heat shocked for6honOP50-seeded NGM plates. Then the
worms were returned to 20°C for self-fertilization and were
genotyped by polymerase chain reaction to screen for the
double-mutant homozygotes, which were easily recognized
with the Mos1 transposon present. The lev-1 mutant was
identified using primers oTB263 (CGTCCAGCTTCCAAA-
AGTCAAACTGC) and oTB265 (GAGGATCGCCTGATGG-
TCGACC). The lev-8 gene was identified using primers
oTB264 (GTCAGACCAGTTCATAATGCATCAG) and oTB266
(GTTGTAAAGTACAATGTCAGGGATCC). The lev-10 was
amplified by primers LEV10up (AAAATTAATGAAAACTCAGC-
CATGA) and LEV10dwn (CAAGCTATTACCCATTGAGTA-
CACC). The Mos1 was detected by primer oJL103 (TCTGC-
GAGTTGTTTTTGCGTTTGAG). The primers oTB263/265,
oTB264/266, and oJL103 were kindly provided by Drs. Jean-
Louis Bessereau and Thomas Boulin.
Movement assay
Worms from stock plates were examined using a stereo
microscope. L4 larvae were identified and incubated for 24 h
at 20°C. Then the worms were transferred to M9 buffer with
varying concentrations of levamisole. The M9 buffer contains
6 g/L Na
2
HPO
4
, 3 g/L KH
2
PO
4
, 5 g/L NaCl, and 0.12 g/L
MgSO
4
. After 1 h, worms were checked for paralysis or
nonparalysis. The worms showing no movement or coiling
were considered to be paralyzed. Four groups of worms
(n10/group) were tested for each levamisole concentra-
tion.
Preparation for recording
Adult worms were transferred into a recording chamber filled
with extracellular solution containing: 23 mM NaCl, 110 mM
NaAc, 5 mM KCl, 6 mM CaCl
2
, 5 mM MgCl
2
, 5 mM HEPES,11
mM d-glucose, and 10 mM sucrose. The pH of the solution
was adjusted to 7.2 with NaOH. The osmolarity was adjusted
to 330 mosmol with sucrose. The worms were immobilized
onto a Sylgard-coated coverslip with cyanoacrylate (GluSeal
510K# K030574; Glustitch Inc. Massena, NY, USA). The
cuticle was incised to expose anterior body wall muscle cells.
The preparation was cleaned and enzyme-treated with extra-
cellular solution containing 0.5 mg/ml collagenase. This
preparation method was modified from that used in previous
studies. The enzyme treatment was applied for 15 s. Then
the collagenase solution was replaced by recording bath
solution containing 35 mM CsCl, 105 mM CsAc, 4 mM MgCl
2
,
10 mM HEPES, 1 mM EGTA, and 25 mM sucrose (pH 7.2),
adjusted with 330 mosmol CsOH.
Single-channel recording
The patch-clamp technique was used to record the single-
channel currents activated by acetylcholine or levamisole
from the C. elegans preparation. Fire-polished patch pipettes
were pulled from capillary glass (G85150T; Warner Instru-
ments Inc., Hamden, CT, USA). To block K
channels that
may present on the patched membrane, we filled the record-
ing pipettes with high Cs
solution that contained 140 mM
CsCl, 4 mM MgCl
2
, 10 mM HEPES, 1 mM EGTA, and 12 mM
sucrose (pH 7.2), approximately 315 mosmol. Pipettes with
resistances of 46 M were used. The 1 cm near the tip of the
electrode was covered with Sylgard to reduce background
noise and improve frequency responses. All recordings were
made using isolated inside-out patches. Single-channel cur-
rents were recorded at membrane potentials between 100
and 100 mV. The current signal was amplified by an
Axopatch 200B amplifier (Axon Instruments Inc., Union City,
CA, USA) filtered at 5 kHz (three-pole Bessel filter), and then
sampled at 25 kHz, digitized with a Digidata 1320A (Axon
Instruments Inc.), and stored on a computer hard disk.
Data analysis
Raw data were digitally filtered at 2 kHz and analyzed using
pCLAMP 9 software (Axon Instruments Inc.). Histograms of
the amplitude were fitted with Gaussian distributions. Histo-
grams of the channel open time and closed time were fitted
with exponential curves. All fittings were done in pCLAMP 9.
All statistical analysis was done in GraphPad Prism (version 4;
GraphPad Software, Inc., San Diego, CA, USA). Results are
presented as mean se. Differences were considered signif-
icant at values of P 0.05. Sigmoidal dose-response plots
were fitted using nonlinear regression.
Drugs
NaCl, NaAc, KCl, CaCl
2
, and MgCl
2
were obtained from
Fisher Scientific (Pittsburgh, PA, USA). All the other drugs
were obtained from Sigma-Aldrich (St. Louis, MO, USA).
RESULTS
Comparison of levamisole responses of wild type,
lev-8 mutants, and lev-1 mutants using motility assays
Wild-type C. elegans, like parasitic nematodes, are para-
lyzed by levamisole in a concentration-dependent man-
ner, as we can see in motility assays (Fig. 1); the EC
50
was 9 M, with 96% of the worms being paralyzed by
high concentrations of levamisole. Knockout of the
LEV-8 subunit using the Mos1 insert in the lev-8 gene
produces a phenotype that is less sensitive to levamisole
and that has an EC
50
of 40 M, with 98% of the worms
being paralyzed by high concentrations of levamisole.
The lev-1 mutants were even less sensitive and had an
EC
50
of 223 M, with only 15% of the worms being
paralyzed by high concentrations of levamisole. Previ-
ous researchers have examined levamisole whole mus-
cle cell current responses and demonstrated that le-
vamisole produces smaller currents in lev-8 mutants
3248 Vol. 22 September 2008 QIAN ET AL.The FASEB Journal
Page 2
(33% of wild type) (11) and smaller currents still in
lev-1 mutants (14% of wild type) (10). These observa-
tions offer some explanation for the resistance, but
invite further study of the lev-8 and lev-1 mutants at the
single-channel level. To explore this aspect we used the
in situ preparation (8) for recording single-channel
currents from somatic muscle cells.
Density of extrasynaptic levamisole receptors
in lev-10 mutants
We used isolated inside-out patch recordings (Fig. 2A).
Initially, we used wild-type C. elegans with 30 M acetyl-
choline as the agonist in the patch pipette. In our
sample of 17 patches, channel currents were observed
in only 3 (18%) of the patches. Because there was only
one active channel present at one time in a patch of 3–5
m
2
under the pipette (16), it led to an estimate for the
receptor density of one active extrasynaptic channel
per 17–28 m
2
in the wild type. This low density is
consistent with fluorescent label studies that have
shown that nAChRs are not detectable extrasynaptically
but aggregate at neuromuscular synapses (13). When
the CUB domain-rich transmembrane protein, LEV-10,
is knocked out, postsynaptic receptor clusters disap-
pear, but whole-cell levamisole-activated currents re-
main; so it is hypothesized in lev-10 mutants that
levamisole receptors are distributed extrasynaptically
(13). To test this hypothesis further, we investigated the
properties of nAChRs in lev-10 knockouts. We used 10,
30, and 100 M concentrations of acetylcholine or
levamisole in the pipette as the agonist. Channel cur-
rents were observed much more frequently in lev-10
mutants than in the wild type, with the percentage of
active patches being agonist concentration-dependent,
increasing to 91% with 100 M levamisole (Table 1). If
we use the 60% active patch observation for 30 M
acetylcholine for comparison with the wild type to
illustrate the change in channel density, the lev-10
mutants have an extrasynaptic receptor density of one
active channel per 5– 8 m
2
. This is a clear increase
over the wild type.
Channel properties
To establish that the single-channel currents were
activated by acetylcholine or levamisole, we tested con-
trol patches using agonist-free pipette solution and
Figure 2. Levamisole-activated single-channel currents from
an inside-out patch made from the body wall muscle of a
lev-10 mutant. A) Diagram of technique and recording of
channel currents using inside-out patch recording. C. elegans
were glued down and dissected using the methods of Rich-
mond and Jorgensen (8). Cell-attached patch recordings
were made initially and then the patch was isolated and
air-exposed to prevent vesicle formation. B) In an agonist-free
pipette solution control recording, no channel currents were
observed in the isolated inside-out patch at membrane poten-
tial 75 mV. C) After 1 mM levamisole was added into the
bath solution, inward channel currents were observed from
the same membrane patch. Levamisole readily diffuses across
the membrane patches after a few seconds, crossing from the
cytoplasmic surface to the extracellular ligand binding sites to
open the channel (20). The recording demonstrates the
presence of levamisole-activated nAChRs. D) Levamisole-
activated channel currents at 50 mV, 75 mV, and 100
mV at higher time resolution (from the same patch as in C).
Figure 1. Levamisole concentration-dependent inhibition of
motility. Wild-type C. elegans (F) is paralyzed by levamisole in
a concentration-dependent manner; EC
50
9 M (log EC
50
5.030.27), with 96 2.5% paralyzed by high concentra-
tions of levamisole (n4). The plot was fit to a sigmoid
dose-response plot (GraphPad Prism) to estimate the EC
50
and maximum response. Knockout of lev-8 (E) using the
Mos1 transposon insert in the lev-8 gene produces a pheno-
type that is less sensitive to levamisole; EC
50
40 M (log
EC
50
4.390.08), with 98.5 6.0% of worms being para
-
lyzed by high concentrations of levamisole (n4). The lev-1
knockouts (f) are even less sensitive; EC
50
223 M (log
EC
50
3.650.22), with only 15.3 3.3% of the worms being
paralyzed by high concentrations of levamisole (n4).
3249C. ELEGANS LEVAMISOLE CHANNELS
Page 3
then made patches from the same muscle cells with 30
M acetylcholine or 30 M levamisole in the pipette.
No channels were observed without agonist in 5 patches
made on 5 separate muscle cells. However, in 11
patches with agonist present, 8 patches (5 acetylcholine
and 3 levamisole) contained channels. A
2
test showed
that the presence of the agonist was significant
(p0.007, df1). As another test for levamisole acting
as an agonist, we exploited the fact that levamisole
diffuses through the membrane from the bath solution
to the extracellular membrane surface and reaches the
ligand binding site (17). With levamisole-free pipette
solution, no channel currents were present (Fig. 2B);
but after addition of 1 mM levamisole to the bath,
channels quickly appeared (Fig. 2C). Similar activation
of channels was produced in 3 of 5 patches tested in
this manner.
To determine single-channel conductances of the
channels, membrane potentials were routinely held at
100, 75, and 50 mV while the amplitude of the
currents was recorded. Histograms of current ampli-
tudes were fitted with a single Gaussian curve to esti-
mate the mean amplitude of the current at each
potential (Fig. 3A). The current-voltage plots had a
reversal potential of 1.1 0.6 mV (n33) with
symmetrical Cs
concentrations in the pipette and bath
solutions. The predicted Nernst potential for Cs
was 0
mV, whereas the predicted Nernst potential for Cl
was
33 mV; the reversal potential was consistent with the
ion channel being a nonselective cation channel per-
meable to Cs
. The single-channel current-voltage re
-
lations were not linear but showed inward rectification
(Fig. 3B). We used potentials between 100 and 50
mV to determine the slope conductance in this region,
using linear regression (Fig. 3B). We found that the
channels had a conductance of 30.3 0.4 (n33),
ranging between 26 and 36 pS (Table 1, Fig. 3C) when
tested with 10, 30, and 100 M acetylcholine or levami-
sole. There was no significant difference in the conduc-
tances when activated by either of the agonists (P0.2,
F test; df5,26).
We determined mean open times (
o
) by binning the
open durations and fitting single exponential curves to
the histograms (Fig. 4A). We set the membrane patch
potential to 75 mV for these observations to allow a
good signal-noise ratio consistent with membrane sta-
bility over the recording period. We used 10, 30, and
100 M concentrations of acetylcholine and found that
the mean open times were independent of agonist
concentration: at 10 M acetylcholine, they were
0.31 0.03 ms (n6); at 30 M acetylcholine, they
were 0.44 0.03 ms (n6); and at 100 M acetylcho-
line, they were 0.31 0.04 ms (n4) (Fig. 4B, Table 1).
The mean open times of levamisole-activated channels
decreased with agonist concentration: at 10 M levami-
sole, they were 0.36 0.03 ms (n8); at 30 M
levamisole, they were 0.30 0.02 (n3); and at 100 M
levamisole, they were 0.20 0.02 ms (n4) (Fig. 4B, C,
Table 1). The mean open times of levamisole were
significantly shorter at concentrations of 30 and 100
TABLE 1. Single-channel properties of the levamisole receptor in lev-10 mutants
Parameter
Acetylcholine (M) Levamisole (M)
10 30 100 10 30 100
Active patches (%) 45 60 86 53 47 91
g (pS) 30.1 1.1 (n6) 31.3 1.0 (n5) 31.5 0.9 (n5) 29.3 0.7 (n8) 31.1 1.1 (n5) 28.9 1.2 (n4)
Open times t
o
(ms)
0.31 0.03 (n6) 0.44 0.03 (n6) 0.31 0.04 (n4) 0.36 0.03 (n8) 0.30 0.02 (n3) 0.20 0.02 (n4)
Channel block (ms) 2.9 0.8 (area0.380.08)
Closed times
c
(ms)
45.7 7.8 (n5) 123.3 2.7 (n7) 78.2 35.5 (n5) 133.6 34.1 (n8) 116.3 46.2 (n4) 72.8 47.0 (n4)
Active patches, percentage of patches showing channel activity; g, single-channel conductance;
o
, mean open-time duration;
c
, mean closed-time duration; area, mean proportion of the short
channel-block times. Note that at 100 M levamisole there are two mean closed times because of the appearance of channel block.
3250 Vol. 22 September 2008 QIAN ET AL.The FASEB Journal
Page 4
M(P0.05, t tests) than at 10 M levamisole, and the
mean open time of 100 M levamisole was also signif-
icantly shorter than that at 30 M levamisole (P0.05,
t test). The decrease in open time with increased
levamisole concentration suggests the presence of
open-channel block (3).
Levamisole as an open-channel blocker
Distinctive levamisole flickering channel-block bursts
were not obvious in C. elegans, unlike in the parasitic
nematode Ascaris suum (3). To identify levamisole
blocked times, we compared the distributions of closed
times at different concentrations of acetylcholine and
levamisole (Fig. 5). When levamisole channels were
activated by acetylcholine or low concentrations of
levamisole, bursts of openings were not observed, and
distributions of closed times were described by a single
exponential with a mean duration in the range of
45–133 ms (Fig. 5, Table 1). However, at 100 M
levamisole, an additional short closed-time component
with an overall mean duration of 2.9 0.8 ms (n4)
was clearly present in the closed-time distributions (Fig.
5B, Table 1). The additional component averaged 38
8% (n4) of the total number of closed-time events at
100 M levamisole and is explained by the presence of
open-channel block. We described the channel kinetics
using the simple channel-block scheme, which consists
of a single-channel open state (O), one channel closed
state (C) and one channel block state (B):
C ^
O -
|
0
k
B
X
k
B
B
where is the channel closing rate, is the effective
Figure 3. Single-channel conductance. A) Channel amplitude histograms at each potential were fitted with Gaussian
distributions to determine the mean value. Example shown made at 75 mV and activated with 30 M levamisole in patch
pipette. B) The channel I-V plot for the experiment in A, showing the characteristic inward rectification that was seen in all the
nAChR channels. The I-V plot is linear between 50 and 100 mV. This region of plot was fitted by linear regression to obtain
the slope conductance of the channel. The conductance is 31.8 0.3 pS. C) Bar chart of channel conductances activated by
10, 30, and 100 M acetylcholine or 10, 30, and 100 M levamisole; conductances are 30 1(n6), 31 1(n5), 31
1(n5), 29 1(n8), 31 1(n5), and 29 1(n4), respectively, and are not significantly different.
Figure 4. Duration of channel open times. A) Representative open-time distribution of 30 M levamisole-activated channel
current at 75 mV (same recording as Fig. 2). Open-time distribution fitted with a single exponential equation to estimate the
mean open time,
o
0.28 0.05 ms. Dwell times shorter than 0.2 ms were not well resolved and are excluded from the
exponential fit. Number of observations 627. B) Bar chart of channel mean open times activated by 10, 30, and 100 M
acetylcholine or 10, 30, and 100 M levamisole; mean open times are 0.31 0.03 (n6), 0.44 0.03 (n6), 0.31 0.04 (n4),
0.36 0.03 (n8), 0.30 0.02 (n3), and 0.20 0.02 (n4), respectively. Significant differences (P0.05) are shown (one-way
analysis of variance). Mean open times range between 0.2 and 0.44 ms. The mean open times of levamisole-activated channels
are significantly shorter than the mean open times of channels activated by 30 and 100 M acetylcholine. C) The mean open
times
o
for levamisole-activated channels decrease with increase in levamisole concentrations. The plot of 1/
o
and levamisole
concentration is linear. The slope is the forward blocking rate k
B
in a simple channel-block model. At a membrane potential
of 75 mV, the blocking rate calculated from this plot is 2.6 10
7
M
1
s
1
.
3251C. ELEGANS LEVAMISOLE CHANNELS
Page 5
channel opening rate, X is the levamisole concentra-
tion, k
B
is the blocking rate constant, and k
B
is the
unblocking rate constant. k
B
was determined from the
reciprocal of the duration of the additional brief
closed-time component (the blocked state) at 100 M
levamisole. At 75 mV, the value of k
B
was 0.35 ms
1
.
k
B
was the slope of the plot of the reciprocal of the
mean open time (1/
o
) against levamisole concentra
-
tion (Fig. 4C). The relation between 1/
o
and the
levamisole concentration at 75 mV was fitted with
linear regression (r
2
0.99, n3), and k
B
was 2.6
0.1 10
7
M
1
s
1
. The channel-block dissociation
constant K
D
is then k
B
/k
B
13 M.
Nicotine was not an effective agonist
Two types of nAChRs are found at neuromuscular
junctions of body muscle in C. elegans (8). One is
sensitive to levamisole and the other is sensitive to
nicotine. To determine whether the extrasynaptic
nAChRs observed in lev-10 mutant body muscle were
sensitive to nicotine, we patched 5 cells with 10 M
nicotine-filled pipettes; no nicotine-activated channel
events were observed. As a further test, we made 3
inside-out patches with 10 M levamisole-filled pipettes
and obtained active channels; 2 mM nicotine was then
added to the bath. Nicotine crosses the membrane to
the extracellular surface, where it acts as an agonist
(18). However, in each of the 3 experiments con-
ducted, it failed to change the activity of the channels,
showing that nicotine does not act as an agonist on the
levamisole-activated nAChRs.
LEV-8 knockouts have increased channel-closed times
To investigate the role of the LEV-8 subunit at the
single-channel level, we constructed lev-10;lev-8 double-
knockout mutants. In lev-10;lev-8, receptors lacking the
LEV-8 subunit were regularly observed in our patch
recordings. When tested with 10 M levamisole, 4 of 10
patches (40%) showed channel activity. Compared with
the levamisole receptor in lev-10 mutants, the single-
channel conductance and mean open time of receptors
lacking LEV-8 subunits were not significantly different.
The single-channel conductance was 30.1 0.7 pS
(n3), and the mean open time was 0.30 0.01 ms
(n3) (Table 2). However, the mean closed times in
lev-8 mutants (Fig. 6) were significantly longer
(P0.0016, t test): in lev-10 mutants, the mean closed
time at 10 M levamisole was 133.6 34.1 ms; and in
lev-8;lev-10 mutants, the mean closed time was 410.4
41.8 ms (Tables 1, 2). These observations showed that
Figure 5. Representative distributions of closed times showing the increase in the short blocked times at 100 M levamisole but
not with 100 M acetylcholine. A) Distribution of closed times produced by 10 M levamisole was fitted with a single exponential
to estimate the mean closed time, in this example 268 6ms(n694). All histograms were obtained from patches held at 75
mV. B) At high concentrations of levamisole (100 M), an additional component is present in the closed-time histogram, so the
distribution of closed times requires two exponentials to describe the distribution. A longer closed time has a mean duration
of 44.0 0.1 ms; the additional brief closings have a mean duration of 2.1 0.2 ms (n486). The decrease in mean duration
of long closed time can be explained by an increase in the opening rate of the channel. The reciprocal of the blocked-time
(1/
b
) is the unblocking rate constant, k
B
. C) At high concentrations of acetylcholine (100 M), the distribution of closed
times is best fitted with a single exponential and does not require an additional brief component, because openings occur as
single events, with bursts being very rare. The closed-time distribution is 46.6 2.4 ms (n2171).
TABLE 2. Channel properties of lev-8 and lev-1 mutants
Parameter Mutants Acetylcholine (10 M) Levamisole (10 M)
g (pS) lev-1;lev-10 26.9 0.7 (n3)
lev-8;lev-10 27.4 0.3 (n3) 30.1 0.7 (n3)
o
(ms)
lev-1;lev-10 0.72 0.18 (n3)
lev-8;lev-10 0.34 0.02 (n3) 0.30 0.01 (n3)
c
(ms)
lev-1;lev-10 426 232 (n3)
lev-8;lev-10 114 15 (n3) 410 42 (n3)
3252 Vol. 22 September 2008 QIAN ET AL.The FASEB Journal
Page 6
receptors lacking the LEV-8 subunit 1) were functioning
receptor channels expressed in the plasma membrane at
approximately the same frequency as receptors with
LEV-10, 2) had a similar channel conductance, and 3)
had longer closed times. Comparison of levamisole
EC
50
values for the wild-type and lev-8 mutants showed
that levamisole is 4.4 times (9 vs.40M) more potent
in the wild type. Comparison of the reported peak inward
currents produced by 500 M levamisole currents
showed that they were one-third of the wild type in lev-8
mutants. Comparison of mean closed times showed
that in lev-8 mutants they are 3 times longer than those
in the wild type (410 vs. 133.6 ms). The observations
suggest that most of the change in sensitivity to levami-
sole in lev-8 knockouts is due to increased channel
closed times (reduced opening rate) and not changes
in conductance, channel number, or mean open times.
Lev-1 knockouts express fewer channels and have a
smaller conductance
We constructed lev-10;lev-1 mutants to examine the
single-channel properties of receptors lacking the
nAChR subunit, LEV-1. When we tested 37 patches with
10 M levamisole, we found channels in only 14% (5 of
37) of patches. The single-channel conductance of the
lev-1;lev-10 mutant was 26.9 0.7 pS (n3), and this
was less than the mean 30.3 0.4 pS of the lev-10
mutants (P0.019, df34). At 10 M levamisole, the
mean closed times of receptors lacking LEV-1 subunits
were not significantly different (Fig. 6, Table 2).
The presence of levamisole-activated channels in lev-10;
lev-1 mutants shows that functional levamisole receptor
channels can be formed in adult C. elegans without LEV-1
subunits, but there is an 11% (1–26.9/30.3) reduction in
the single-channel conductance and 73% (1–14/53) re-
duction in the number of active channels (to one active
channel per 21–36 m
2
). These changes predict a reduc
-
tion of the levamisole whole-cell current to 23% of
control; this compares to the reported reduction in lev-1
mutant whole-cell current to 14%.
DISCUSSION
C. elegans levamisole receptor and LEV-10 knockouts
C. elegans has proved to be a very useful genetic model
for the study of movement and neuromuscular trans-
mission, and it is an increasingly powerful model for
drug resistance in parasitic nematodes (9 –13). Whole-
muscle currents in adults from lev-1 (10) and lev-8
mutants (11) suggest that the levamisole receptor is
composed of three essential subunits, UNC-38, UNC-
63, and UNC-29, and two nonessential subunits, LEV-8
and LEV-1. Until now it had not been possible to record
from in situ receptors as they were inaccessible because
they are aggregated at the synaptic region. We were
able to overcome this limitation by using knockouts of
a CUB protein, LEV-10 (13), and to show that the
levamisole-sensitive but not nicotine-sensitive receptors
become distributed extrasynaptically, making channel
recordings possible.
Our approach has allowed the channel conductances
and open times of levamisole receptors to be described
in adult C. elegans. We found that with lev-10 mutants,
the levamisole receptors had a mean channel conduc-
tance of 29.3 0.7 (n8) and mean open times of
0.36 0.03 (n8) with 10 M levamisole; comparable
observations were obtained with acetylcholine. A simi-
lar population of levamisole channels has been re-
ported in embryonic muscle, although the mean con-
ductance of the channel in high potassium (37 pS) is
slightly greater (14).
Effects of lev-8 and lev-1 knockout
In our experiments we examined the functional contri-
butions of LEV-8 and LEV-1 subunits at the single-
channel level. We found, in mutants lacking the LEV-8
-subunit, that the opening rate of the levamisole
receptor channel was decreased without a significant
change in channel conductance, channel numbers, or
closing rate. The 3-fold increase in the mean channel
closed times in the lev-8 knockouts is sufficient to
explain a reduction to one-third (11) of the whole
muscle-cell current and the reduced levamisole sensi-
tivity. In LEV-1-deficient animals, the number of func-
tional channels in the muscle plasma membrane was
reduced to one active channel opening per 21–36 m
2
.
This reduction to approximately one-quarter the den-
sity of channels in lev-1 mutants together with the 11%
decrease in channel conductance provides an explana-
tion for the observation that the whole muscle cell
currents are reduced to 14% of those in the wild type
(10).
Figure 6. Representative channel currents from lev-10, lev-8;lev-10 double mutants and lev-1;lev-10 double mutants recorded at
75 mV. A) Channel currents from lev-10 knockouts. B) Channel currents from lev-10;lev-8 double knockouts. Note that the
lev-10;lev-8 double mutant has a lower channel opening rate. C) Channel currents from a lev-10;lev-1 double-knockout mutant.
Note that their opening pattern is similar to that of the lev-10 knockouts.
3253C. ELEGANS LEVAMISOLE CHANNELS
Page 7
C. elegans levamisole receptor as a model
for parasitic nematodes
It is of interest to compare the single-channel proper-
ties of the C. elegans levamisole receptor seen here with
those of the receptor observed in parasitic nematodes
(19, 20) to inform the discussion of the use of C. elegans
as a model for parasitic nematodes. Levamisole-acti-
vated receptor channels from C. elegans and A. suum are
both gated by concentrations of levamisole of 10–100
M, conduct cesium because they nonselective cation
channels, and are present on somatic muscle. Levami-
sole produces open-channel block in both receptors
with a similar K
D
at 75 mV of 13 MinC. elegans and
46 MinA. suum. Despite many similarities, there are
some differences. The levamisole receptor in C. elegans
is not activated by high concentrations of nicotine, in
contrast to the levamisole-sensitive nAChR in the para-
sitic nematode, A. suum (18). The population of levami-
sole-activated channels found in wild-type C. elegans
ranged between 26 and 36 pS, with mean open times of
0.25 to 0.53 ms. These observations contrast with those
for receptor subtypes found in A. suum (20), which
have conductances ranging between 18 and 53 pS, with
some longer mean open times ranging between 0.2 and
2.5 ms. Another difference was the rectification seen in
the C. elegans receptors, which is not present in the A.
suum receptors. The differences are not surprising,
perhaps, because C. elegans is a free-living nematode
belonging to Clade V, whereas A. suum is an animal
parasite belonging to Clade III (21), having been
separated by some 350 million years of evolution.
Despite these differences, the powerful genetic C. el-
egans model opens the door to mechanistic studies of
anthelmintic action and resistance, which remain in-
tractable in parasitic nematodes. We can expect the use
of the C. elegans levamisole receptor model to be of
great benefit to parasitology as well as to the study of
ligand-gated channels more generally.
We thank Drs. Jean-Louis Bessereau and Thomas Boulin
for providing mutant strains, primers and advice and Dr.
Janet Richmond for encouragement and for showing us the
dissection method. The project was supported by grant R01
AI047194 from the National Institute of Allergy and Infec-
tious Diseases to R.J.M. The content is solely the responsibility
of the authors and does not necessarily represent the official
views of the National Institute of Allergy and Infectious
Diseases of the National Institutes of Health.
REFERENCES
1. Prichard, R. K. (2007) Markers for benzimidazole resistance in
human parasitic nematodes? Parasitology 134, 1087–1092
2. Wolstenholme, A. J., Fairweather, I., Prichard, R., von Samson-
Himmelstjerna, G., and Sangster, N. C. (2004) Drug resistance
in veterinary helminths. Trends Parasitol. 20, 469 476
3. Robertson, S. J., and Martin, R. J. (1993) Levamisole-activated
single-channel currents from muscle of the nematode parasite
Ascaris suum. Br. J. Pharmacol. 108, 170–178
4. Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics
77, 71–94
5. White, J. G., Southgate, E., Thomson, J. N., and Brenner, S.
(1983) Factors that determine connectivity in the nervous
system of Caenorhabditis elegans. Cold Spring Harb. Symp. Quant.
Biol. 48(Pt. 2), 633– 640
6. Lewis, J. A., Wu, C. H., Berg, H., and Levine, J. H. (1980) The
genetics of levamisole resistance in the nematode Caenorhabditis
elegans. Genetics 95, 905–928
7. Lewis, J. A., Wu, C. H., Levine, J. H., and Berg, H. (1980)
Levamisole-resistant mutants of the nematode Caenorhabditis
elegans appear to lack pharmacological acetylcholine receptors.
Neuroscience 5, 967–989
8. Richmond, J. E., and Jorgensen, E. M. (1999) One GABA and
two acetylcholine receptors function at the C. elegans neuromus-
cular junction. Nat. Neurosci. 2, 791–797
9. Fleming, J. T., Squire, M. D., Barnes, T. M., Tornoe, C.,
Matsuda, K., Ahnn, J., Fire, A., Sulston, J. E., Barnard, E. A.,
Sattelle, D. B., and Lewis, J. A. (1997) Caenorhabditis elegans
levamisole resistance genes lev-1, unc-29, and unc-38 encode
functional nicotinic acetylcholine receptor subunits. J. Neurosci.
17, 5843–5857
10. Culetto, E., Baylis, H. A., Richmond, J. E., Jones, A. K., Fleming,
J. T., Squire, M. D., Lewis, J. A., and Sattelle, D. B. (2004) The
Caenorhabditis elegans unc-63 gene encodes a levamisole-sensitive
nicotinic acetylcholine receptor subunit. J. Biol. Chem. 279,
42476 42483
11. Towers, P. R., Edwards, B., Richmond, J. E., and Sattelle, D. B.
(2005) The Caenorhabditis elegans lev-8 gene encodes a novel type
of nicotinic acetylcholine receptor subunit. J. Neurochem. 93,
1–9
12. Gottschalk, A., Almedom, R. E., Schedletzky, T., Anderson,
S. D., Yates, J. R., and Schafer, W. R. (2005) Identification and
characterization of novel nicotinic receptor-associated proteins
in Caenorhabditis elegans. EMBO J. 24, 2566–2578
13. Gally, C., Eimer, S., Richmond, J. E., and Bessereau, J. L. (2004)
A transmembrane protein required for acetylcholine receptor
clustering in Caenorhabditis elegans. Nature 431, 578–582
14. Rayes, D., Flamini, M., Hernando, G., and Bouzat, C. (2007)
Activation of single nicotinic receptor channels from Caenorhab-
ditis elegans muscle. Mol. Pharmacol. 71, 1407–1415
15. Williams, D. C., Boulin, T., Ruaud, A. F., Jorgensen, E. M., and
Bessereau, J. L. (2005) Characterization of Mos1-mediated
mutagenesis in Caenorhabditis elegans: a method for the rapid
identification of mutated genes. Genetics 169, 1779–1785
16. Hamill, O.P., Marty, A., Neher, E., Sakmann, B., and Sigworth,
F. J. (1981) Improved patch-clamp techniques for high-resolu-
tion current recording from cells and cell-free membrane
patches. Pflu¨gers Arch. 391, 85–100
17. Robertson, S. J., and Martin, R. J. (1993) The activation of
nicotinic acetylcholine receptors in the nematode parasite
Ascaris suum by the application of levamisole to the cytoplasmic
surface of muscle membrane. Pest. Sci. 37, 293–299
18. Levandoski, M. M., Robertson, A. P., Kuiper, S., Qian, H., and
Martin, R. J. (2005) Single-channel properties of N- and L-
subtypes of acetylcholine receptor in Ascaris suum. Int. J. Parasi-
tol. 35, 925–934
19. Robertson, A. P., Bjorn, H. E., and Martin, R. J. (1999) Resis-
tance to levamisole resolved at the single-channel level. FASEB J.
13, 749 –760
20. Qian, H., Martin, R. J., and Robertson, A. P. (2006) Pharmacol-
ogy of N-, L-, and B-subtypes of nematode nAChR resolved at the
single-channel level in Ascaris suum. FASEB J. 20, 2606 –2608
21. Blaxter, M. L., De Ley, P., Garey, J. R., Liu, L.X., Scheldeman, P.,
Vierstraete, A., Vanfleteren, J.R., Mackey, L. Y., Dorris, M.,
Frisse, L.M., Vida, J. T., and Thomas, W. K. (1998) A molecular
evolutionary framework for the phylum Nematoda. Nature 392,
71–75
Received for publication April 8, 2008.
Accepted for publication May 2, 2008.
3254 Vol. 22 September 2008 QIAN ET AL.The FASEB Journal
Page 8
  • Source
    • "Emodepside selectively inhibits body muscle contraction of nematodes (Terada 1992; Willson et al., 2003). Emodepside is effective against nematode isolates that have developed resistance to drugs from the major classes of anthelmintic (Samson-Himmelstjerna von et al., 2005), namely: ivermectin (an allosteric modulator of GluCl channels, Pemberton et al., 2001), levamisole (a nematode selective nAChR agonist, Qian et al., 2006; Qian et al., 2008) and febantel (a selective ligand for nematode b-tubulin, Miro et al., 2006) E-mail address: rjmartin@iastate.edu (R.J. Martin). "
    Dataset: emodepide
    Full-text · Dataset · Jan 2015
  • Source
    • "showed that while ACR-8 is not required for wild-type L-nAChRs, it can replace LEV-8 in lev-8 mutants. The lev-8; acr-8 double mutant is strongly resistant to levamisole. Since no gene corresponding to lev-8 has been found in several trichostrongylid species it is possible that acr-8 replaces lev-8 in these parasitic nematodes (Neveu et al., 2010). Qian et al. (2008) have also made single channel recordings from C. elegans body wall muscle. In these experiments they used lev-10 mutants in which aggregation of nAChRs is absent, allowing recordings from single channels. The mean conductance for these channels was around 30 pS when activated by either levamisole or acetylcholine. These levamisole-activ"
    [Show abstract] [Hide abstract] ABSTRACT: Parasitic nematodes infect many species of animals throughout the phyla, including humans. Moreover, nematodes that parasitise plants are a global problem for agriculture. As such, these nematodes place a major burden on human health, on livestock production, on the welfare of companion animals and on crop production. In the 21st century there are two major challenges posed by the wide-spread prevalence of parasitic nematodes. First, many anthelmintic drugs are losing their effectiveness because nematode strains with resistance are emerging. Second, serious concerns regarding the environmental impact of the nematicides used for crop protection have prompted legislation to remove them from use, leaving agriculture at increased risk from nematode pests. There is clearly a need for a concerted effort to address these challenges. Over the last few decades the free-living nematode Caenorhabditis elegans has provided the opportunity to use molecular genetic techniques for mode of action studies for anthelmintics and nematicides. These approaches continue to be of considerable value. Less fruitful so far, but nonetheless potentially very useful, has been the direct use of C. elegans for anthelmintic and nematicide discovery programmes. Here we provide an introduction to the use of C. elegans as a 'model' parasitic nematode, briefly review the study of nematode control using C. elegans and highlight approaches that have been of particular value with a view to facilitating wider-use of C. elegans as a platform for anthelmintic and nematicide discovery and development.
    Preview · Article · Dec 2014 · WormBook
  • Source
    • "Emodepside selectively inhibits body muscle contraction of nematodes (Terada 1992; Willson et al., 2003). Emodepside is effective against nematode isolates that have developed resistance to drugs from the major classes of anthelmintic (Samson-Himmelstjerna von et al., 2005), namely: ivermectin (an allosteric modulator of GluCl channels, Pemberton et al., 2001), levamisole (a nematode selective nAChR agonist, Qian et al., 2006; Qian et al., 2008) and febantel (a selective ligand for nematode b-tubulin, Miro et al., 2006) E-mail address: rjmartin@iastate.edu (R.J. Martin). "
    Full-text · Dataset · Nov 2014
Show more