ArticlePDF Available

Fine-mapping of the woolly gene controlling multicellular trichome formation and embryonic development in tomato

Authors:

Abstract and Figures

Trichomes are small hairs that originate from the epidermal cells of nearly all land plants, and they exist in unicellular and multicellular forms. The regulatory pathway of unicellular trichomes in Arabidopsis is well characterized. However, little is known about the multicellular trichome formation in tomato (Solanum lycopersicum). The woolly (Wo) gene controls multicellular trichome initiation and leads to embryonic lethality when homozygous in tomato. To clone and characterize Wo, the gene was fine-mapped to a DNA fragment of ~200 kb using the map-based cloning strategy. A series of sequence-based molecular markers, including simple sequence repeat, sequence characterized amplified region, and cleaved amplified polymorphic sequence were utilized in this study. Analysis of the sequence indicated that this region carries 19 putative open reading frames. These results will provide not only the important information for the isolation and characterization of Wo but also the starting point for studying the regulatory pathway responsible for trichome formation and embryonic lethality in tomato.
Content may be subject to copyright.
Theor Appl Genet
DOI 10.1007/s00122-011-1612-x
123
ORIGINAL PAPER
Fine-mapping of the woolly gene controlling multicellular
trichome formation and embryonic development in tomato
Changxian Yang · Hanxia Li · Junhong Zhang ·
Taotao Wang · Zhibiao Ye
Received: 24 October 2010 / Accepted: 30 April 2011
© Springer-Verlag 2011
Abstract Trichomes are small hairs that originate from
the epidermal cells of nearly all land plants, and they exist
in unicellular and multicellular forms. The regulatory path-
way of unicellular trichomes in Arabidopsis is well charac-
terized. However, little is known about the multicellular
trichome formation in tomato (Solanum lycopersicum). The
woolly (Wo) gene controls multicellular trichome initiation
and leads to embryonic lethality when homozygous in
tomato. To clone and characterize Wo, the gene was
Wne-mapped to a DNA fragment of »200 kb using the
map-based cloning strategy. A series of sequence-based
molecular markers, including simple sequence repeat,
sequence characterized ampliWed region, and cleaved ampli-
Wed polymorphic sequence were utilized in this study.
Analysis of the sequence indicated that this region carries
19 putative open reading frames. These results will provide
not only the important information for the isolation and
characterization of Wo but also the starting point for study-
ing the regulatory pathway responsible for trichome forma-
tion and embryonic lethality in tomato.
Introduction
Plant trichomes, which are found in nearly all terrestrial
plants, originate from epidermal cells. Trichomes can be
divided into two types, unicellular and multicellular
(Werker 2000). Arabidopsis and cotton (Gossypium arbo-
retum) are characterized by their unicellular trichomes,
whereas tomato (Solanum lycopersicum) and tobacco
(Nicotiana tabacum) are characterized by multicellular tric-
homes. Due to the simple cell structure of trichomes, they
provide excellent models to study the pattern formation in
plants (Schiefelbein 2003). Many important genes involved
in the initiation of unicellular trichomes on the epidermis of
Arabidopsis have been cloned and characterized. The GLA-
BROUS1 (GL1) gene promotes trichome formation, a loss-
of-function mutation of which results in a complete absence
of trichomes (Marks and Feldmann 1989). This gene
encodes a protein ascribed to the R2R3 MYB family featur-
ing two MYB repeats (Oppenheimer et al. 1991). TRANS-
PARENT TESTA GLABRA1 (TTG1) gene is another key
regulator controlling trichome formation in Arabidopsis
(Koornneef 1981), which encodes a protein containing four
conserved WD repeats (Walker et al. 1999). Genetic studies
indicate that GL1 and TTG1 regulate the same process in
trichome initiation (Larkin et al. 1999). Overexpression of
GL3 results in the formation of additional leaf trichomes.
GL3 encodes a transcription factor of the bHLH family
(Payne et al. 2000). In addition, a bHLH-like protein
encoded by the Rregulator of maize can also activate leaf
trichome formation when overexpressed (Lloyd et al.
1992). Another bHLH gene, ENHANCER OF GLABRA 3
(EGL3) functions in a redundant manner with GL3 to spec-
ify trichome cell fate in Arabidopsis (Bernhardt et al.
2003). A WD-bHLH-MYB complex consisting of these
four genes triggers trichome formation in Arabidopsis by
Communicated by M. Havey.
Electronic supplementary material The online version of this
article (doi:10.1007/s00122-011-1612-x) contains supplementary
material, which is available to authorized users.
C. Yang · J. Zhang · Z. Ye (&)
National Key Laboratory of Crop Genetic Improvement,
Huazhong Agricultural University, Wuhan 430070, China
e-mail: zbye@mail.hzau.edu.cn
H. Li · T. Wang · Z. Ye
Key Laboratory of Horticultural Plant Biology,
Ministry of Education, Huazhong Agricultural University,
Wuhan 430070, China
Theor Appl Genet
123
enhancing the expression of two downstream genes, GL2
and EGL2 (Zhao et al. 2008). Cotton Wbres, resembling
Arabidopsis trichomes, are controlled by GaMYB2, which
shows high sequence homology with GL1 and can restore
trichome formation in a gl1 mutant (Wang et al. 2004). A
common complex possibly regulates trichome formation in
Arabidopsis and cotton, both of which are Rosids (Serna
and Martin 2006).
Whether there is a complex similar to WD-bHLH-MYB
controlling trichome formation in tomato, snapdragon
(Antirrhinum majus), and tobacco (N. tabacum) is still
unknown, three of which are Asterids (Serna and Martin
2006). Overexpression of GL1 in tobacco does not aVect
trichome formation (Payne et al. 1999). MIXTA, a MYB-
related regulator controls conical cell formation in snap-
dragon, overexpression of which can trigger the trichome
formation (Glover et al. 1998). However, the ectopic
expression of MIXTA in Arabidopsis gl1-1 mutants failed to
induce trichome initiation (Payne et al. 1999). Hence, the
trichomes in snapdragon, tobacco, and tomato may develop
through a transcriptional network diVerent from that of
Arabidopsis and cotton. The woolly gene (Wo), a spontane-
ous mutation in tomato, is responsible for trichome forma-
tion (Shilling 1959) and embryo lethality of tomato (Huang
and Paddock 1962). Plenty of trichomes on the epidermal
parts enable them to be easily distinguished from non-
woolly plants (Rick and Butler 1956; Shilling 1959; Huang
and Paddock 1962). The self-pollinated progenies of
woolly plants always exhibit two phenotypes, the woolly
and the non-woolly. However, the oVspring of non-woolly
plants do not segregate. The Wo mutation is inferred to be
lethal for the embryo when homozygous (Shilling 1959);
the lethal action occurs prior to the torpedo stage and no
cambial diVerentiation is found at this period through cyto-
logical observation (Huang and Paddock 1962).
Reportedly, Wo is located near the midpoint of the long
arm of chromosome 2 (Rick and Butler 1956) and a classi-
cal map on pachytene also demonstrated that Wo is located
near the mid-region (Khush and Rick 1968). However, no
nucleotide information regarding the Wo gene is known.
Therefore, Wne mapping and molecular cloning of Wo
would signiWcantly enhance our understanding of the
mechanism of multicellular trichome formation and
embryo lethality when homozygous at this locus in tomato,
as well as the relationship of the regulatory pathway con-
trolling trichome initiation between the tomato and tobacco,
snapdragon, Arabidopsis, and cotton.
In this study, we developed three types of molecular
markers: simple sequence repeat (SSR), sequence charac-
terized ampliWed region (SCAR), and cleaved ampliWed
polymorphic sequence (CAPS), based on the bacterial arti-
Wcial chromosome (BAC) and RFLP probe sequences. We
constructed a high-resolution molecular map of Wo and
delimited it in an »200 kb DNA fragment. Sequence analy-
sis indicated that this region contains 19 putative open-
reading frames (ORFs). These results set a good foundation
for further isolation and characterization of Wo.
Materials and methods
Plant materials, mapping populations
and phenotyping trichomes
Two introgression lines (ILs), IL2-3 and IL2-5, which con-
tain the middle fragments of chromosome 2 of Solanum
pennellii (Syn. Lycopersicon pennellii) LA716 genome in
S. lycopersicon cv. M82 background (Eshed and Zamir
1994), and LA3186, a spontaneous woolly mutant (derived
from Ailsa Craig, as the “wild-type” for sequence compari-
sons) (Fig. 1), were provided by the Tomato Genetics
Resource Center. Due to embryo lethality when homozy-
gous at Wo locus, the mutation is maintained at the hetero-
zygous state. F2 populations segregated for the woolly
phenotype were obtained by crossing IL2-3 and IL2-5 with
LA3186 (removed non-woolly F1 plants and self-polli-
nated). A total of 106 F2 recessive non-woolly individuals
from the cross of IL2-5 £LA3186 were used for rough
mapping analysis. Then, equal amounts of DNA from 6 F2
recessive individuals (total = 1,035) from the cross of
IL2-3 £LA3186 were pooled to construct non-woolly bulk
and analysed with the newly developed markers for Wne
mapping. Young plants (woolly and nonwoolly) were mon-
itored for the presence of trichomes on the surface of leaf
and stem by visual observation.
Isolation of genomic DNA and PCR
for marker development
Plant DNA was extracted from 3-week-old seedling leaves
for PCR-based genotyping using the method described by
Fulton et al. (1995). Three kinds of molecular markers were
utilized in the mapping of Wo, namely SSR, SCAR, and
CAPS. The PCR for the SSR markers were performed in
20 L containing approximately 50 ng of genomic DNA as
template, 20 pm/L of each primer, 1 U of Taq DNA poly-
merase (Invitrogen, USA), and 2 L of buVer solution
(10£). The reaction program consisted of one cycle at 94°C
for 5 min, followed by 35 cycles at 94°C for 40 s, 55°C for
40 s, and 72°C for 30 s. The PCR products were separated
on a 6% polyacrylamide gel in 1£ TBE buVer. After elec-
trophoresis, the gel was stained with 4 g/L silver nitrate.
The SCAR and CAPS markers from BAC and RFLP
probe sequences were designed using Primer 3 (http://
frodo.wi.mit.edu/primer3/). The PCR mixture contained
1L of DNA, 2 L of 10£ PCR buVer, 0.4 L of 10 mM
Theor Appl Genet
123
dNTPs, 0.4 L of 2.5 U/L Taq polymerase (Invitrogen,
USA), 0.5 L of 20 pm/L of each primer, and 15.7 L of
distilled water. The program used for the PCR machine
(Bio-Rad, USA) was as follows: 1 cycle of 4 min at 94°C;
35 cycles of 40 s at 94°C, 40 s at 57°C, 2.5 min at 72°C,
and, Wnally, 10 min at 72°C. The products were analysed
with a 1.5% (w/v) agarose gel. The PCR products, which
exhibited good polymorphisms between the parents, were
Fig. 1 Trichome phenotypes of non-woolly plant (a, cand e) and woolly mutant LA3186 (b, dand f). Photographs aand bare magniWed images.
cfWere taken by a scanning electron microscope (cand d, trichomes on leaves; eand f, trichomes on stems)
Theor Appl Genet
123
directly used for genetic mapping, and those that showed
no polymorphisms were digested with endonucleases with
recognition sites in the marker sequences in order to iden-
tify the polymorphisms for further mapping.
Genetic mapping
For all the polymorphic markers between IL2-5 and
LA3186, an F2 recessive population of 106 individuals was
initially used for mapping Wo and a rough map was con-
structed. Based on this map, new markers were developed
according to the BAC and RFLP probe sequences between
the two closely linked markers Xanking Wo. These markers
were subsequently analysed for Wne mapping in a larger
population of 1,035 F2 recessive non-woolly individuals
from the cross IL2-3 £LA3186. Data from the genotype
survey of each individual were adopted for linkage analysis
by the MAPMAKER/EXP 3.0 program (Lander et al. 1987;
Lincoln et al. 1992). The Kosambi function was used to
transform the recombinant frequencies into genetic distance
(centiMorgan, cM). Map order was estimated based on the
maximum likelihood estimates.
Construction of a BAC contig and gene prediction
BAC sequences deposited in the SOL genomics network
(SGN), in which the most related markers with Wo were
located, were aligned with each other using the BLAST soft-
ware from the National Center for Biotechnology Informa-
tion (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The physical
map around the Wo locus was constructed if completely
identical overlapping ends were present between the two
BACs. Protein coding genes were predicted from the resul-
tant contig using the FGENESH program (http://linux1.soft-
berry.com/berry.phtml). The predicted proteins were further
analysed by GENESCAN (http://genes.mit.edu).
Results
Segregation of the woolly phenotype and trichome
phenotype analyses
Progenies of the woolly mutant LA3186 presented two phe-
notypes (95 woolly and 46 non-woolly plants) at the segre-
gation of a 2:1 Mendelian ratio (2=0.01, P> 0.05).
Nevertheless, the non-woolly plants did not show pheno-
type segregation. The F1 plants from the crosses IL2-3/IL2-
5£LA3186 presented two phenotypes. We scored 65
woolly plants versus 61 non-woolly plants from the cross
IL2-3 £LA3186, and 53 woolly plants versus 47 non-
woolly plants from IL2-5 £LA3186, both of which corre-
sponded at a 1:1 Mendelian ratio (2= 0.07, P>0.05;
2=0.25, P> 0.05). Previous studies showed that there are
Wve types (I, III, V, VI and VII) of trichomes on the epider-
mis of cultivated tomato plants (Luckwill 1943). LA3186
was found to have much higher density of type I trichomes
on leaves and stems than non-woolly plants (Fig. 1). How-
ever, no obvious alteration of other types of trichomes was
observed.
Generation of PCR-based markers
Although Wo is located near the mid-region of the long arm
of chromosome 2 (Rick and Butler 1956), we do not know
the interval in which Wo is delimited. Twelve markers,
evenly distributed across the mid-region of the long arm of
chromosome 2, were applied to screen polymorphism
between the two parents IL2-5 and LA3186, and eight of
them showed stable polymorphism. The primer sequences
of U237440, C2_At5g64670, HBa44O16SP6, and SSR287
were downloaded from the SGN (http://www.sgn.cor-
nell.edu). STS45 was designed according to the published
sequence of C02HBa0008G02. W124 and SSRD69 were
kindly provided by Dr. Wang. For Wne-mapping, we devel-
oped several new markers based on the published BAC and
RFLP probe sequences. Five markers exhibited stable poly-
morphism between IL2-3 and LA3186. WY42, STS64,
STS64, and STS62 were designed based on the sequences
of C02HBa0323A14, C02HBa0006L05, C02HBa0204D01,
and C02HBa0175O20, respectively. STS4 was converted
from an RFLP marker-TG494 probe sequence. Detailed
information regarding these markers is listed in Table 1.
Rough mapping of Wo
To determine the genetic interval of Wo, 8 markers were
used to screen 106 F2 non-woolly individuals from the cross
IL2-5 £LA3186. Recombination events between these
markers and Wo were statistically analysed. The linkage
analysis indicated that all these markers span a genetic
region of 12.1 cM (Fig. 2). Among these Xanking markers of
Wo, W124 and C2_At5g64670 were the most closely linked.
The SSR markers SSRD69 and W124 were on one side,
approximately 5.3 and 3.9 cM from the Wo gene, respec-
tively (Fig. 2). On the other side, the SSR marker SSR287,
the SCAR marker C2_At5g64670, and the CAPS markers
U237440, HBa44O16SP6, and STS45 were at a distance of
5.8, 1.9, 2.9, 3.9, and 4.4 cM from the Wo gene, respectively
(Fig. 2). Simultaneously, we observed that the relative posi-
tion between U237440, HBa44O16SP6, and C2_At5g64670
had been inverted by comparing the local map of Wo with
the published EXPEN 2000 map (http://www.sgn.cornell.
edu/) (Fig. 2). The genetic distance between SSR287 and
C2_At5g64670 in the local map (4.9 cM) was much shorter
than in the published EXPEN 2000 map (41.0 cM) (Fig. 2).
Theor Appl Genet
123
According to the bin-mapping of these markers in IL2-3 and
IL2-5 (Fig. 2), SSRD69 and W124 were located in the intro-
gression region of IL2-3, and U237440, HBa44O16SP6,
SSR287, and STS45 were located in the introgression region
of IL2-5 (Fig. 2). C2_At5g64670 was located in the overlap-
ping region of these two lines (Fig. 2).
Fine mapping of Wo
According to the result of rough mapping, Wo has been
delimited to an interval of 5.8 cM Xanked by W124 and
C2_At5g64670. This region was located in the introgres-
sion segment of IL2-3. In order to narrow the interval span-
ning the target locus, we carried out Wne mapping based on
1,035 F2 progenies derived from the cross IL2-3 £LA3186
using the newly exploited markers between W124 and
C2_At5g64670 according to the published BAC sequences
and RFLP probe sequences. Fifteen individuals displayed
recombination between Wo and WY42, and 12 individuals
between Wo and STS33 (Fig. 3). STS64, STS4, and STS62
were further analysed with these recombinants. We delim-
ited Wo in the region between markers STS64 and STS62,
which were both closely linked to Wo with just one recom-
bination event identiWed (Fig. 3). One marker STS4 showed
cosegregated with Wo (Fig. 3).
BAC contig construction spanning the Wo region
As the cosegregating marker STS4 was located in the inter-
val between STS64 and STS62, we did BAC-blast search in
SGN using the probe sequence of TG494, which has been
successfully converted into the CAPS marker STS4. Fortu-
nately, a BAC clone (C02HBa0204D01) displaying 100%
identity with this probe sequence was found. Therefore, we
Table 1 Primer sequences and PCR parameters for SSR, SCAR, and CAPS markers
aProduct length on IL2-3 or IL2-5 and LA3186, respectively
bPolymorphic after digestion with RsaI
cPolymorphic after digestion with MapI
dPolymorphic after digestion with DraI
ePolymorphic after digestion with DraI
fPolymorphic after digestion with AvaII
Marker
type
Marker name Primer sequence (5–3) PCR product
length (bp)
Annealing
temp. (°C)
No. of
cycles
SSR SSRD69 F ATAGTTTATCTGCAATGTATTTAGTTC
R TGGAAATTTCACGGACTGGT 204 55 33
SSR W124 F ATGTATTGTGAAGAAGAGCAGTTTG
R GATAACTGCGATTCAATAGGTGG 194 55 33
SSR SSR287 F GCATCCCAAACAATCCAATC
R TCCACTTTCAAGATCAGAGCAA 168 55 33
SSR WY42 F GGTTTCGCCAGCATAAAATG
R CAACAAGAGTCCCAAGCAAA 234 55 33
SCAR C2_At5g64670 F TGATAAATGCTGGGAAGATTGACTC
R ATCAACCTGGCTCCATCTTCTATTTG 200,220a57 35
SCAR STS33 F GCATCGGAGCTTGCTAAAAG
R ACTTTGGTGGAGGCAAAATG »1800–2450a58 35
SCAR STS64 F TTACGGGTGTAATCGCACAA
R AGGGAGCAGCATGGTTAAAA »2,500 58 35
CAPS U237440bF TCCACACCTCCACCAATTTT
R AACCAAGTTGGACGCACTTC 218 + 209 + 106,614a57 35
CAPS HBa44O16SP6cF CTTGTTGGCAATGCAAGAGA
R AAGGCCGTGAATCATTGAAC 265 +204,469a57 35
CAPS STS45dF GCAGGGTGAAAAATCTGGAA
R AAATCAACGCTTTGCTGCTT »650–450a58 35
CAPS STS4eF ATTTGAGGCCGGTTTAGCTT
R TGCCTGCAGTTCCCTTTCTA »1,200–1,500a58 35
CAPS STS62fF TTTGACTGGGCAAGAACCTT
R TTGGGACTTTCCAGTTGAGG »2,400–1,000 + 1400a
Theor Appl Genet
123
concluded that STS4 is located in C02HBa0204D01.
Simultaneously, as the Xanking markers STS64 and STS62
were designed based on the sequences of C02HBa0006L05
and C02HBa0204D01 separately, we tried to align these
two BAC sequences. These two BAC clones formed a
»200 kb contig with ends overlapping by 15,328 bp
(Fig. 3). We conWrmed the location of Wo in this approxi-
mately 200 kb contig (Fig. 3).
Candidate genes of Wo
The BAC clones used for contig construction were not from
Ailsa Craig (cultivar, background material of the woolly
mutant LA3186). However, all the markers that were
designed according to the BAC sequences derived from the
cultivar Heinz 1706 were used in the physical map, indicat-
ing that the sequence content does not diVer greatly in these
two genetic backgrounds. Therefore, Wo (recessive allele)
must be found in this region. Analysis of the »200 kb
sequence revealed that this fragment contains 19 ORFs as
automatically predicted by FGENESH (http://softberry.
com) and GENESCAN (http://genes.mit.edu) (Table 2).
The best hits of these ORFs include copia LTR rider
(Solanum lycopersicum), COBRA-LIKE PROTEIN 10
PRECURSOR (COBL10) (Arabidopsis thaliana), PROTO-
DERMAL FACTOR 2 (PDF2) (A. thaliana), VPS28-2 (A.
thaliana), beta-glucosidase (Oryza sativa), Cytochrome
P450 (Populus trichocarpa), tobamovirus multiplication 1
homolog 3 (S. lycopersicum), abnormal spindle-like protein
(O. sativa), RNA Binding Protein 45 (N. plumbaginifolia),
MEDIATOR 21 (MED21) (A. thaliana), ATP BINDING
CASSETTE PROTEIN 1 (ATABC1) (A. thaliana), puta-
tive heat shock protein (A. thaliana), multi-antimicrobial
extrusion family protein (N. tabacum), MATE eZux family
protein (O. sativa), hypothetical proteins. We designed 19
primer pairs for full length ampliWcation of these ORFs to
test for polymorphism between the woolly mutant LA3186
and its segregated non-woolly plants (Supplementary
Table 1). No ampliWcation polymorphisms were found in
these PCR products generated by the 19 primer pairs. This
result demonstrated that the woolly phenotype may be con-
ferred by a single nucleotide polymorphism or small frag-
ment mutation. Therefore, all PCR products from the
woolly and non-woolly plants were sequenced and com-
pared. Sequence alignment showed that one putative
homeodomain gene (JF518780) has 41% amino acid
sequence identity to GL2, a trichome related gene regulated
by the WD-bHLH-MYB complex (Zhao et al. 2008), and
73% to PDF2, a shoot epidermal cell diVerentiation related
gene in Arabidopsis (Abe et al. 2003). Both of these genes
contain a homeobox and a bZIP motif. And the putative
homeodomain gene of these 19 ORFs may be a good candi-
date for Wo. We expect to Wnd the gene from the woolly
mutant that has two allelic sequences. Subsequent studies,
including sequence analysis and functional veriWcation, are
under way.
Discussion
Transcriptional regulatory network controlling the initia-
tion of unicellular trichome in Arabidopsis and unicellular
Wbre in cotton has been well characterized. However, the
mechanism of multicellular trichome formation in the Sola-
naceous family, which is diVerent from that in Arabidopsis
and cotton, remains to be elucidated (Serna and Martin
Fig. 2 Bin-mapping of molecular markers in the introgression frag-
ments of IL2-3 and IL2-5 (left); genetic linkage map spanning the Wo
locus derived from the cross IL2-5 £LA3186 (mid); the tomato
EXPEN 2000 molecular linkage map of the long arm of chromosome
2 (right) published in the Solanaceae Genomics Network (http://
www.sgn.cornell.edu/). Dotted lines indicate the common markers
during these three maps. Genetic distances are shown in centimorgans
(cM)
Chr 2L
C2_At5g64670
HBa44O16SP6
SSRD69
W124
Wo
U237440
STS45
SSR287
1.4
3.9
1.9
1.0
1.0
0.5
2.4
T1438,HBa0329G05
T0562
T1625,HBa0323A14
TM34,HBa0204D01
T1537
U237440
HBa44O16SP6
C2_At5g64670
SSR287
1.0
1.5
0.5
1.5
0.4
0.2
0.9
41.0
IL2-3
IL2-5
Fig. 3 Tomato BAC contig encompassing the Wo gene. S. lycopersi-
cum BAC contig encompassing the Wo region. The thick horizontal
line represents the region of chromosome 2 encompassing the Wo gene
in S. lycopersicum. The centromere is to the left and the telomer to the
right, as indicated by the arrows. Markers below the thick line are
developed from BAC sequences (except for STS4, which is from probe
sequence of RFLP marker TG494). The numbers above the line repre-
sent the recombinants from the F2 population (derived from the cross
IL2-3 £LA3186) in each interval. The thin arrow lines represent the
contig spanning the Wo gene with the direction indicated by arrow
lines, which consists of C02HBa0006L05 (06L05, 35,580 bp) and
C02HBa0204D01 (04D01, 179,860 bp) (with a 15,328 bp identical
overlapping end)
LETNEC
WY42 STS33STS64 STS62
STS4
Wo
14 11 11
04D01
06L05
~200 kb
Theor Appl Genet
123
2006). Wo triggers multicellular trichome formation in
woolly mutant, which is an excellent basis for studying the
molecular events underlying multicellular trichome forma-
tion and further deWning the relationship between Wo and
homozygous embryo lethality. Wo was reportedly located
near the mid-region of chromosome 2 (Khush and Rick
1968). By comparing the classic map (Khush and Rick
1968) with the published Tomato/pannellii IL map, we
inferred that Wo is in the introgression fragments of IL2-3
and IL2-5. Thus, our mapping populations were con-
structed by crossing these two ILs with woolly mutant
LA3186. Abundant genome data can be downloaded from
the SGN FTP server (ftp://ftp.sgn.cornell.edu) as the Inter-
national Tomato Genome Sequencing Project is ongoing.
The data contain BAC end sequences and full BAC
sequences, which facilitate molecular marker development,
mapping, isolation, and characterization of new genes. Sev-
eral important genes in tomato had been isolated by map
based cloning (Chen et al. 2007; Cong et al. 2008; Xiao
et al. 2008). Using a normal mapping strategy, Wo was
Wnally delimited in the interval between STS64 and STS62,
and cosegregating with STS4. Sequence analysis showed
that this interval includes 19 putative ORFs. None of these
proteins belong to the well-known gene families related to
trichome formation, such as MYB, bHLH, and WD. One
putative homeodomain gene of these 19 ORFs showed
much higher sequence similarity to PDF2 than GL2, the
former of which participates in regulating epidermal cell
diVerentiation, but not in trichome formation (Abe et al.
2003). Therefore, we speculated that trichome formation in
tomato may be regulated by a novel pathway distinct from
that of Arabidopsis and cotton, even snapdragon and
tobacco. Future functional studies of the predicted genes
will provide us direct evidence on the role of Wo in tomato
trichome formation, and the relationship with the key genes
in Arabidopsis, cotton, snapdragon, and tobacco. In addi-
tion, regarding its lethal action on the WoWo embryos, pro-
spective studies will uncover many new genes participating
in embryonic development.
Plant trichomes play an important role in protecting
plants from damage caused by herbivores and pathogens
(Ashraf et al. 1999; Kang et al. 2010). Many researchers
have demonstrated a close relationship between trichome
and resistance against whiteXies, aphids, and viruses in
many species, such as potato (Gregory et al. 1986), poplar
(Philippe and Bohlmann 2007), and tomato (Dimock and
Table 2 Summary of gene prediction for the contig C02HBa0006L05 and C02HBa0204D01
ORF No. Accesion No. BAC gene ID Start End Best hits in GenBank (accession/species) Evalue
ORF1 JF518777 06L05.1 5990 11206 Copia LTR rider (ABO36622/Solanum lycopersicum)0.00E+00
ORF2 JF518778 06L05.2 11648 12884 COBL10 (NP_188694 Arabidopsis thaliana)3.00E¡113
ORF3 JF518779 06L05.3 13836 17332 Hypothetical protein
(XP_002305604/Populus trichocarpa)
2E¡19
ORF4 JF518780 0204D01.4 4357 7758 PROTODERMAL FACTOR 2
(NP_567274/Arabidopsis thaliana)
0.00E+00
ORF5 JF518781 0204D01.5 15839 18406 VPS28-2; transporter (NP_567281/Arabidopsis thaliana)9E¡106
ORF6 JF518782 0204D01.6 25721 39520 Beta-glucosidase (NP_001053302/Oryza sativa)4.00E¡160
ORF7 JF518783 0204D01.7 40410 43654 Hypothetical protein (NP_001060531/Oryza sativa)0.00E+00
ORF8 JF518784 0204D01.8 49605 53967 Cytochrome P450 (XP_002305592/Populus trichocarpa)0.00E+00
ORF9 JF518785 0204D01.9 63089 74650 Hypothetical protein (CAN68639/Vitis vinifera)0.00E+00
ORF10 JF518786 0204D01.10 79122 85647 Tobamovirus multiplication 1 homolog 3
(BAE43840/Solanum lycopersicum)
6.00E¡144
ORF11 JF518787 0204D01.11 99544 110543 Abnormal spindle-like protein (BAC56022/Oryza sativa)3.00E¡133
ORF12 JF518788 0204D01.12 111506 112033 Hypothetical protein (XP_002271195/Vitis vinifera)1.00E¡50
ORF13 JF518789 0204D01.13 115806 121310 RNA Binding protein 45
(CAC01237/Nicotiana plumbaginifolia)
3.00E¡126
ORF14 JF518790 0204D01.14 122072 125002 MED21 (NP_192387/Arabidopsis thaliana)3.00E¡38
ORF15 JF518791 0204D01.15 125548 129990 ATABC1 (NP_192386/Arabidopsis thaliana)0.00E+00
ORF16 JF518792 0204D01.16 145409 152364 Putative heat shock protein
(NP_172631/Arabidopsis thaliana)
0.00E+00
ORF17 JF518793 0204D01.17 154058 156512 Hypothetical protein
(XP_002317001/Populus trichocarpa)
4.00E¡76
ORF18 JF518794 0204D01.18 157542 160222 Multi antimicrobial extrusion family protein
(BAF47752/Nicotiana tabacum)
0.00E+00
ORF19 JF518795 0204D01.19 165679 169171 MATE eZux family protein (ABF97209/Oryza sativa)0.00E+00
Theor Appl Genet
123
Kennedy 1983; Channarayappa et al. 1992). Several genes
controlling trichome initiation in some of these plants have
been mapped and cloned, such as PtaMYB186 in poplar
(Plett et al. 2010) and trichome locus 1 (Ptl1) (Kim et al.
2010) in pepper. Trichome functions as the Wrst line of
defence by two mechanisms, through spatial hindrance and
secreting toxins (DuVey 1986; Wagner 1991). The mecha-
nism of non-glandular trichome defence against insect
attack belongs to the former and glandular to the latter. Pre-
vious studies showed that these two trichome types are dis-
tributed on the epidermis of tomato plants (Luckwill 1943).
This character proves that tomato can protect itself by both
spatial hindrance and secreting toxins. Moreover, the abil-
ity of woolly resistance also remains unexplained. Our
study will provide an eYcient approach for resistance
breeding using the woolly phenotype conferred by Wo.
A comparison between the rough map of Wo with the cor-
responding region of the tomato EXPEN 2000 molecular
linkage map reveals considerable disparity. The tomato
EXPEN 2000 molecular linkage map places U237440 and
HBa44O16SP6 up from C2_At5g64670. However, the rela-
tive position in the rough map of Wo had been inverted.
Paracentric inversion between tomato and potato has been
reported by Tanksley et al. (1992). Giovannoni also
observed this phenomenon in the same introgression frag-
ment (private communication). We inferred that this position
inversion may occur during the process of introgression.
Comparing with the published EXPEN 2000 map, we
observed that the recombination frequency between SSR287
and C2_At5g64670 is much lower in the local map. Canady
et al. (2006) found that recombination rate positively corre-
lates with the length of S. lycopersicoides introgression frag-
ment in Solanum. esculentum. Suppression of recombination
is also observed in the Solanum. pannellii introgression seg-
ment of chromosome 7 in Solanum. lycopersicum with
respect to the whole chromosome (Lim et al. 2008). There-
fore, the lower recombination frequency in the local map of
Wo was obtained using the F2 population from the cross of
IL2-5 £LA3186 than the published EXPEN 2000 map
based on the F2 individuals from the cross S. lycopersicum £
S. pennellii. It suggests that construction of mapping popula-
tion for map-based cloning using the ILs containing large
introgression segments is more eYcient than those contain-
ing short introgression segments.
Acknowledgments The authors are grateful to Dr. G. P. Wang from
the South China Agricultural University and Dr. H. H. Kuang from our
College for the helpful advice. The authors acknowledge the Tomato
Genetics Resource Center, University of California, USA, for provid-
ing the seed stocks of the introgression lines and the woolly mutant
LA3186. This project was supported by grants from the 973 project
(No. 2011CB100600), the National Natural Science Foundation of
China (Nos. 30971997 and 30921002) and the Research Fund for the
Doctoral Program of Higher Education of China (4010-081023).
References
Abe M, Katsumata H, Komeda Y, Takahashi T (2003) Regulation of
shoot epidermal cell diVerentiation by a pair of homeodomain
proteins in Arabidopsis. Development 130:635–643
Ashraf M, Zafar ZU, McNeilly T, Veltkamp CJ (1999) Some morpho-
anatomical characteristics of cotton (Gossypium hirsutum L.) in
relation to resistance to cotton leaf curl virus (CLCuV). Angew
Bot 73:76–82
Bernhardt C, Lee MM, Gonzalez A, Zhang F, Lloyd A, Schiefelbein J
(2003) The bHLH genes GLABRA3 (GL3) and ENHANCER OF
GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis
root. Development 130:6431–6439
Canady MA, Ji YF, Chetelat RT (2006) Homeologous recombination
in Solanum lycopersicoides introgression lines of cultivated
tomato. Genetics 174:1775–1788
Channarayappa SG, Muniyappa V, Frist RH (1992) Resistance of
Lycopersicon species to Bemisia tabaci, a tomato leaf curl virus
vector. Can J Bot 70:2184–2192
Chen KY, Cong B, Wing R, Vrebalow J, Tanksley SD (2007) Changes
in regulation of a transcription factor lead to autogamy in culti-
vated tomatoes. Science 318:643–645
Cong B, Barrero LS, Tanksley SD (2008) Regulatory change in
YABBY-like transcription factor led to evolution of extreme fruit
size during tomato domestication. Nat Genet 40:800–804
Dimock MB, Kennedy GG (1983) The role of glandular trichomes in
the resistance of Lycopersicon hirsutum f. glabratum to Heliothis
zea. Entomol Exp Appl 33:263–268
DuVey SS (1986) Plant glandular trichomes: their partial role in
defence against insects. In: Juniper BE, Southwood TRE (eds)
Insects and the plant surface. Edward Arnold, London, pp 151–172
Eshed Y, Zamir D (1994) A genomic library of Lycopersicon pennellii
in L. esculentum: a tool for Wne mapping of genes. Euphytica
79:175–179
Fulton TM, Chunwongse J, Tanksley SD (1995) Microprep protocol
for extraction of DNA from tomato and other herbaceous plants.
Plant Mol Biol Rep 13:207–209
Glover BJ, Perez-Rodriguez M, Martin C (1998) Development of sev-
eral epidermal cell types can be speciWed by the same MYB-related
plant transcriptional factor. Development 125:3497–3508
Gregory P, Tingey WM, Ave DA, Bouthyette PY (1986) Potato glan-
dular trichomes: a physicochemical defense mechanism against
insects. Nat Resist Plants Pests 13:160–167
Huang PC, Paddock EF (1962) The time and site of the semidominant
lethal action of ‘Wo’ in Lycopersicon esculentum. Amer J Bot
49:388–393
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010) Distortion of
trichome morphology by the hairless mutation of tomato aVects
leaf surface chemistry. J Exp Bot 61:1053–1064
Khush GS, Rick CM (1968) Cytogenetic analysis of the tomato genome
by means of induced deWciencies. Chromosoma 23:452–484
Kim HJ, Han JH, Kwon JK, Park M, Kim BD, Choi D (2010) Fine map-
ping of pepper trichome locus 1 controlling trichome formation in
Capsicum annuum L. CM334. Theor Appl Genet 120: 1099–1106
Koornneef M (1981) The complex syndrome of ttg mutants. Arabidop-
sis Inf Serv 18:45–51
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE,
Newburg L (1987) MAPMAKER: an interactive computer pack-
age for constructing primary genetic linkage maps of experimen-
tal and natural populations. Genomics 1:174–181
Larkin JC, Walker JD, Bolognesi-WinWeld AC, Gray JC, Walker AR
(1999) Allele-speciWc interactions between ttg and gl1 during tri-
chome development in Arabidopsis thaliana. Genetics 151:1591–
1604
Theor Appl Genet
123
Lim GTT, Wang GP, Hemming MN, McGrath DJ, Jones DA (2008)
High resolution genetic and physical mapping of the I-3 region of
tomato chromosome 7 reveals almost continuous microsynteny
with grape chromosome 12 but interspersed microsynteny with
duplications on Arabidopsis chromosomes 1, 2 and 3. Theor Appl
Genet 118:57–75
Lincoln S, Daly M, Lander E (1992) Constructing genetic linkage
maps with Mapmaker/exp 3.0: a tutorial and reference manual,
3rd edn. Whitehead Institute Technical Report, Cambridge
Lloyd AM, Walbot V, Davis RW (1992) Arabidopsis and Nicotiana
anthocyanin production activated by maize regulators Rand C1.
Science 258:1773–1775
Luckwill LC (1943) The genus Lycopersicon: a historical, biological
and taxonomic survey of the wild and cultivated tomatoes. Aberd
Univ Stud 120:44
Marks MD, Feldmann KA (1989) Trichome development in Arabidop-
sis thaliana I T-DNA tagging of the GLABROUS1 gene. Plant
Cell 1:1043–1050
Oppenheimer DG, Herman PL, Sivakumaran S, Esch J, Marks MD
(1991) A myb gene required for leaf trichome diVerentiation in
Arabidopsis is expressed in stipules. Cell 67:483–493
Payne T, Clement J, Arnold D, Lloyd A (1999) Heterologous myb
genes distinct from GL1 enhance trichome production when over-
expressed in Nicotiana tabacum. Development 126:671–682
Payne CT, Zhang F, Lloyd AM (2000) GL3 Encodes a bHLH protein
that regulates trichome development in Arabidopsis through
interaction with GL1 and TTG1. Genetics 156:1349–1362
Philippe RN, Bohlmann J (2007) Poplar defense against insect herbi-
vores. Can J Bot 85:1111–1126
Plett JM, Wilkins O, Campbell MM, Ralph SG, Regan S (2010)
Endogenous over-expression of Populus MYB186 increases tri-
chome density, improves insect pest resistance, and impacts plant
growth. Plant J 64(3):419–432
Rick CM, Butler L (1956) Cytogenetics of the tomato. Adv Genet
8:267–382
Schiefelbein J (2003) Cell-fate speciWcation in the epidermis: a com-
mon patterning mechanism in the root and shoot. Curr Opin Plant
Biol 6:74–78
Serna L, Martin C (2006) Trichomes: diVerent regulatory networks
lead to convergent structures. Trends Plant Sci 11:274–280
Shilling PR (1959) An investigation of the hereditary character, woolly
in the tomato. Ohio J Sci 59:289–302
Tanksley SD, Ganal MW, Prince JP, de Vicente MC, Bonierbale MW,
Broun P, Fulton TM, Giovanonni JJ, Grandillo S, Martin GB,
Messeguer R, Miller JC, Miller L, Paterson AH, Pineda O, Roder
M, Wing RA, Wu W, Young ND (1992) High density molecular
linkage maps of the tomato and potato genomes. Genetics
132:1141–1160
Wagner GJ (1991) Secreting glandular trichomes: more than just hairs.
Plant Physiol 96:675–679
Walker AR, Davisona PA, Bolognesi-WinWelda AC, Jamesa CM,
Srinivasanb N, Blundellb TL, Eschc JJ, Marksc MD, Graya JC
(1999) The TRANSPARENT TESTA GLABRA1 locus, which reg-
ulates trichome diVerentiation and anthocyanin biosynthesis in
Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11:1337–
1349
Wang S, Wang JW, Yu N, Li CH, Luo B, Gou JY, Wang LJ, Chen XY
(2004) Control of plant trichome development by a cotton Wber
MYB gene. Plant Cell 16:2323–2334
Werker E (2000) Trichome diversity and development. Adv Bot Res
31:1–35
Xiao H, Jiang N, SchaVner E, Stockinger EJ, Knaap E (2008) A retro-
transposon-mediated gene duplication underlies morphological
variation of tomato fruit. Science 319:1527–1530
Zhao MZ, Morohashi K, Hatlestad G, Grotewold E, Lloyd A (2008)
The TTG1-bHLH-MYB complex controls trichome cell fate and
patterning through direct targeting of regulatory loci. Develop-
ment 135:1991–1999

Supplementary resource (1)

... Another tomato mutant, hair absent, which exhibits a complete absence of type-I trichomes on the epidermis, has also been characterised, and encodes a C2H2 zincfinger protein [19]. On the other hand, the woolly (wo) mutant is characterised by an increase in type-I trichome density and embryo lethality [20,21]. Wo encodes an HD-Zip protein containing a START-domain that physically interacts with a B-type cyclin named SlCycB2 necessary for the development of multicellular trichomes [22]. ...
... The expression of the genes previously reported as involved in tomato trichome development, i.e. Hair [19], Woolly [21], SlCycB2 [22], Hairless [17], SlMixta-like [11] and SlMYC1 [29] was analysed in inflorescence stems of WT and hap mutant plants with the purpose to explore possible genetic interactions of HAP. The results obtained showed a slight decrease in the level of transcript of Hairless and SlMYC1 in hap mutant. ...
... In all experiments, three biological replicates per genotype, each one from different plants grown in a random distribution in the same greenhouse, and two technical replicates were analysed [57]. Sequence of primers used for qRT-PCR has been previously described [11,17,19,21,22,29] and those of the hap gene are shown in Supplementary Table S5. Raw data were analysed using the 7300 System Sequence Detection Software v1.2 (Applied Biosystems, Ther-moFisher Scientific, USA). ...
Article
Full-text available
Trichomes are specialised epidermal cells developed in the aerial surface of almost every terrestrial plant. These structures form physical barriers, which combined with their capability of synthesis of complex molecules, prevent plagues from spreading and confer trichomes a key role in the defence against herbivores. In this work, the tomato gene HAIRPLUS (HAP) that controls glandular trichome density in tomato plants was characterised. HAP belongs to a group of proteins involved in histone tail modifications although some also bind methylated DNA. HAP loss of function promotes epigenomic modifications in the tomato genome reflected in numerous differentially methylated cytosines and causes transcriptomic changes in hap mutant plants. Taken together, these findings demonstrate that HAP links epigenome remodelling with multicellular glandular trichome development and reveal that HAP is a valuable genomic tool for pest resistance in tomato breeding.
... Woolly (Wo) and its allele are spontaneous mutations in tomato that exhibit increased trichome density and is thus named the woolly phenotype (Shilling, 1959). The woolly phenotype is caused by a single amino acid substitution in the Wo gene that encodes a HD-ZipIV transcription factor containing a START domain (Yang et al. 2011). A nucleotide substitution at 1904 bp in Wo was shown to cause embryo lethality when homozygous, and the self-pollinated offspring from this plant type were always divided into two phenotypes, non-woolly and woolly (Yang et al. 2011). ...
... The woolly phenotype is caused by a single amino acid substitution in the Wo gene that encodes a HD-ZipIV transcription factor containing a START domain (Yang et al. 2011). A nucleotide substitution at 1904 bp in Wo was shown to cause embryo lethality when homozygous, and the self-pollinated offspring from this plant type were always divided into two phenotypes, non-woolly and woolly (Yang et al. 2011). Plants with a woolly phenotype can be easily distinguished by observing the trichome density on the leaves or hypocotyls at the seedling stage. ...
... Previous investigation found that Ms10 35 is an important fertility gene that is localized to chromosome 2 of tomato and linked to the gene of GSTAA (Jeong et al. 2014;Zhang et al. 2016). Based on the research of existing tomato functional genes, five visible marker trait genes near the region of Ms10 35 were selected, which including the anthocyanin synthesis genes dihydroflavonol 4-reductase (DFR) and flavonoid 3hydroxylase (F3H), the anthocyanin transporter gene GSTAA, the trichome developmental regulatory gene Wo, and the fruit shape-related gene OVATE (Fig. 1c) (Goldsbrough et al. 1994;Liu et al. 2002;Yang et al. 2011;Maloney et al. 2014). Since GSTAA, F3H, and Wo are close to Ms10 35 on the chromosome, we chose these genes as visible markers for further gene editing. ...
Article
Full-text available
Owing to their superior agronomic performance, the hybrids of vegetable crops are currently applied extensively. However, effective hybrid production requires a laborious manual emasculation to ensure the purity of hybrid seeds in tomato because of the lack of an effective male sterility system. Here, we created two types of tomato nuclear male-sterile lines with different screening markers in a clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system. Co-knockouts of male sterile 1035 (Ms1035) and glutathione S-transferase (GSTAA) created a male-sterile line marked by a green hypocotyl. The Ms1035 biallelic mutation was introduced into the woolly tomato background, resulting in the linkage of male sterility and a non-woolly phenotype. Two types of male-sterile lines were easily selected at the seedling stage by hypocotyl color or trichome density and further showed high seed purity during hybrid seed production. Our work established the procedure for a rapid transfer of the male-sterile phenotype to the parents of hybrids without extra-modification by the CRISPR/Cas9 system that can be practically applied to hybrid seed production in tomato. This method will be the basis and example for sterile parent creation of multiple crops for hybrid production with the CRISPR/Cas9 system.
... A hairy phenotype was caused by the overproduction of mutant alleles of Wo in type I trichomes. However, the suppression of Wo or SlCycB2 expression by RNA interference decreased trichome density in tomato [21,22]. Addititonally, three transcription factors, Woolly, Hair, and Mixta-like, were found to be necessary for the development of type I glandular trichomes, while Woolly, Hair, and Myc1 were found to be required for type VI glandular trichome development [19,23]. ...
... This result was confirmed by the upregulation of HlGLABRA2 in young cones and leaves of bitter hop cultivars. The GL2 gene possibly regulates the expression of SlCycB2 during the initiation and development of type I trichomes in tomato [21,22], and its homologue HlCYCB2-4 was also upregulated in young cones of bitter hop cultivars. ...
Article
Full-text available
Background Hop (Humulus lupulus L.) bitter acids are valuable metabolites for the brewing industry. They are biosynthesized and accumulate in glandular trichomes of the female inflorescence (hop cone). The content of alpha bitter acids, such as humulones, in hop cones can differentiate aromatic from bitter hop cultivars. These contents are subject to genetic and environmental control but significantly correlate with the number and size of glandular trichomes (lupulin glands). Results We evaluated the expression levels of 37 genes involved in bitter acid biosynthesis and morphological and developmental differentiation of glandular trichomes to identify key regulatory factors involved in bitter acid content differences. For bitter acid biosynthesis genes, upregulation of humulone synthase genes, which are important for the biosynthesis of alpha bitter acids in lupulin glands, could explain the higher accumulation of alpha bitter acids in bitter hops. Several transcription factors, including HlETC1, HlMYB61 and HlMYB5 from the MYB family, as well as HlGLABRA2, HlCYCB2–4, HlZFP8 and HlYABBY1, were also more highly expressed in the bitter hop cultivars; therefore, these factors may be important for the higher density of lupulin glands also seen in the bitter hop cultivars. Conclusions Gene expression analyses enabled us to investigate the differences between aromatic and bitter hops. This study confirmed that the bitter acid content in glandular trichomes (lupulin glands) is dependent on the last step of alpha bitter acid biosynthesis and glandular trichome density.
... Tomato (Solanum lycopersicum L.), a model plant of Solanaceae, has seven distinct trichome types (I-VII) (Goffreda et al., 1990), of which studies focused mostly on type I and type VI glandular trichomes (Goffreda et al., 1990;Schilmiller and Charbonneau, 2012). Type I multicellular trichome formation is controlled by Wooly (Wo), which encodes an HD-ZIP IV transcription factor, and its interactors SlCycB2 and Hair (H), a B-type protein and a C2H2 zinc-finger protein (Yang et al., 2011;Gao et al., 2017;Chang et al., 2018). SlMYC1 encodes bHLH transcription factors, which when knocked down do not lead to reduced density and smaller type VI glandular trichomes, and regulation of terpene biosynthesis (Xu et al., 2018). ...
Article
Full-text available
Trichomes are unicellular or multicellular epidermal structures that play a defensive role against environmental stresses. Although unicellular trichomes have been extensively studied as a mechanistic model, the genes involved in multicellular trichome formation are not well understood. In this study, we first classified the trichome morphology structures in Capsicum species using 280 diverse peppers. We cloned a key gene ( Hairiness ) on chromosome 10, which mainly controlled the formation of multicellular non-glandular trichomes (types II, III, and V). Hairiness encodes a Cys2-His2 zinc-finger protein, and virus-induced gene silencing of the gene resulted in a hairless phenotype. Differential expression of Hairiness between the hairiness and hairless lines was due to variations in promoter sequences. Transgenic experiments verified the hypothesis that the promoter of Hairiness in the hairless line had extremely low activity causing a hairless phenotype. Hair controlled the formation of type I glandular trichomes in tomatoes, which was due to nucleotide differences. Taken together, our findings suggest that the regulation of multicellular trichome formation might have similar pathways, but the gene could perform slightly different functions in crops.
... Endoreduplicationassociated genes, like RETINOBLASTOMA-RELATED1 (AtRBR1), AtCYCA2;3 AtCYCB1;1, are downregulated in those mutant backgrounds suggesting that AtMYB106, AtTCP14 and AtTCP15 also impact the endoreduplication process during trichome formation (Fig. 2a) (Camoirano et al., 2020). WOOLLY is well-characterized in S. lycopersicum and Nicotiana benthamiana as a transcription factor involved in trichome development (Yang et al., 2011b;Wu et al., 2020). Transcriptomic data showed a boost of expression of wax-and cutin-specific genes in SlWOOLLY-overexpressing lines (SlCER6, SlKCR1, SlPAS2, SlABCG11, SlTCP22 and SlMAH1) (Yang et al., 2011a;Xiong et al., 2020). ...
Article
Trichomes and cuticles are key protective epidermal specializations. This review highlights the genetic interplay existing between trichome and cuticle formation in a variety of species. Controlling trichome development, the biosynthesis of trichome‐derived specialized metabolites as well as cuticle biosynthesis and deposition can be viewed as different aspects of a common defensive strategy adopted by plants to protect themselves from environmental stresses. Existence of such interplay is based on the mining of published transcriptomic data as well as on phenotypic observations in trichome or cuticle mutants where the morphology of both structures often appear to be concomitantly altered. Given the existence of several trichome developmental pathways depending on the plant species and the types of trichomes, genetic interactions between cuticle formation and trichome development are complex to decipher and not easy to generalize. Based on our review of the literature, a schematic overview of the gene network mediating this transcriptional interplay is presented for two model plant species: Arabidopsis thaliana and Solanum lycopersicum. In addition to fundamental new insights on the regulation of these processes, identifying key transcriptional switches controlling both processes could also facilitate more applied investigations aiming at improving much desired agronomical traits in plants.
Article
Trichomes are epidermal structures with a large variety of ecological functions and economic applications. Glandular trichomes produce a rich repertoire of secondary metabolites, whereas non-glandular trichomes create a physical barrier on the epidermis: both operate in tandem against biotic and abiotic stressors. A deeper understanding of trichome development and function would enable the breeding of more resilient crops. However, little is known about the impact of altered trichome density on leaf photosynthesis, gas exchange and energy balance. Previous work has compared multiple, closely related species differing in trichome density. Here, we analysed monogenic trichome mutants in the same tomato genetic background (Solanum lycopersicum cv. ‘Micro-Tom’). We determined growth parameters, leaf spectral properties, gas exchange and leaf temperature in the hairs absent (h), Lanata (Ln) and Woolly (Wo) trichome mutants. Shoot dry weight, leaf area, leaf spectral properties and cuticular conductance were not affected by the mutations. However, the Ln mutant showed increased carbon assimilation (A) associated with higher stomatal conductance (gs), with no differences in stomatal density or stomatal index between genotypes. Leaf temperature was furthermore reduced in Ln in the hottest, early hours of the afternoon. We show that a single monogenic mutation that modifies trichome density, a desirable trait for crop breeding, concomitantly improves leaf gas exchange and reduces leaf temperature.
Article
Trichomes are specialized epidermal appendages that serve as an excellent model to study cell morphogenesis. Although the molecular mechanism underlying trichome morphogenesis in Arabidopsis has been well characterized, most of the regulators essential for multicellular trichome morphology remain unknown in tomato. In this study, we determined that the recessive hairless-2 (hl-2) mutation in tomato causes severe distortion of all trichome types along with increased stem fragility. Using map-based cloning, we found that the hl-2 phenotype was associated with a 100-bp insertion in the coding region of Nck-associated protein 1, a component of the SCAR/WAVE complex. Transgenic experiments confirmed that the hl-2 phenotype was caused by loss-of-function of this gene. Direct protein-protein interaction was detected between Hl-2 and Hl (SRA1) using yeast two-hybrid and co-immunoprecipitation assays, implying that these proteins may work together during trichome formation. In addition, knock-down of an HD-Zip IV transcription factor, HDZIPIV8, distorted trichomes similarly to the hl-2 mutant. HDZIPIV8 regulates the expression of Hl-2 by binding to the L1-box in the Hl-2 promoter region and is involved in organizing actin filaments. We also found that the brittleness of hl-2 stems resulted from decreased cellulose content. Taken together, these findings suggest that the Hl-2 gene plays an important role in controlling multicellular trichome morphogenesis and stem mechanical properties in tomato.
Article
Trichomes are specialized epidermal cells that play crucial roles in resisting environmental stress and enhancing plant development. In Arabidopsis thaliana, the main genes controlling trichome formation have been consecutively identified. However, few genes like this were reported in rice. In this study, we identified the hairy phenotype of indica variety 75-1-127. This was used to construct a segregation population with a cross of hairless variety Minghui63 (MH63) to fine map the trichome formation genes. Genetic analysis indicated that hairy phenotype was controlled by a pair of dominant genes on chromosome 6, which was designated as GLABRA6 (OsGL6). OsGL6 was an allele of HL6 gene whose sequences containing rich variations in genomes. Compared to wild type, the overexpressing transgenic lines revealed that OsGL6 promoted trichome initiation. We found that OsGL6 interacted with serine/threonine protein kinase OSK3 (OSK3) or COP9 signalosome complex subunit 5a (CSN5) in yeast. These results provide potential information for understanding the molecular mechanism of trichome formation in rice.
Article
Glandular trichomes are epidermal outgrowths that are the site of biosynthesis and storage of large quantities of specialized metabolites. Besides their role in the protection of plants against biotic and abiotic stresses, they have attracted interest due to the importance of the compounds they produce for human use, for example as pharmaceuticals, flavor and fragrance ingredients or pesticides. Here, we review what novel concepts investigations on glandular trichomes have brought to the field of specialized metabolism, in particular with respect to chemical and enzymatic diversity. Furthermore, understanding the metabolic network underlying the high productivity of glandular trichomes, as well as the transport and storage of metabolites, represent the next challenges in the field. Another emerging area is the development of glandular trichomes. Studies in some model species, essentially tomato, tobacco and Artemisia, are now providing the first molecular clues, but many open questions remain: how is the distribution and density of different trichome types on the leaf surface controlled? When is the decision for an epidermal cell to differentiate into one type of trichome or another taken? Recent advances in gene editing make it now possible to address these questions and promise exciting discoveries in the near future.
Article
Full-text available
Trichomes are specialized epidermal cells and a vital plant organ that protect plants from various harms and provide valuable resources for plant development and use. Some key genes related to trichomes have been identified in the model plant Arabidopsis thaliana through glabrous mutants and gene cloning and the hub MYB‐bHLH‐WD40, consisting of several factors including GLABRA1 (GL1), GL3, TRANSPARENT TESTA GLABRA1 (TTG1), and ENHANCER OF GLABRA3 (EGL3), has been established. Subsequently, some upstream transcription factors, phytohormones and epigenetic modification factors have also been studied in depth. In cotton, a very important fiber and oil crop globally, in addition to the key MYB‐like factors, more important regulators and potential molecular mechanisms (e.g. epigenetic modifiers, distinct metabolic pathways) are being exploited during different fiber developmental stages. This is occurring due to increased cotton research, resulting in the discovery of more complex regulation mechanisms from the allotetraploid genome of cotton. In addition, some conservative as well as specific mediators are involved in trichome development in other species. This study summarizes molecular mechanisms in trichome development and provides a detailed comparison of the similarities and differences between Arabidopsis and cotton, analyzes the possible reasons for the discrepancy in identification of regulators, and raises future questions and foci for understanding trichome development in more detail. This article is protected by copyright. All rights reserved.
Article
Full-text available
Cotton leaf curl virus (CLCuV), transmitted by whitefly Bemisia tabaci, causes one of the most devastating diseases of cotton. The first disease symptom appearing on the leaves of susceptible plants is thickening of mid ribs and veins. To examine whether leaf morphology plays any role in avoiding or restricting the insect-vector, epicuticular wax content and hairiness of leaves were determined in three cultivars of cotton differing in resistance to CLCuV(i.e., S-12, CLCuV-susceptible; NIAB-Krishma, moderately resistant; CIM-448, CLCuV-resistant). CIM-448 had considerably greater epicuticular wax on its leaf compared with the other two, but relatively very low leaf hair density as found in S-12. The diseased leaves of cvs S-12 and NIAB-Krishma had significantly greater epicuticular wax than on their healthy leaves. Hairiness was greatest in NIAB-Krishma. While probing the effects of disease on vein thickening, electron micrographs of the mid ribs of the three cultivars showed remarkable differences. In the mid rib of the diseased leaf of S-12, the xylem and phloem elements were partially or completely collapsed, whereas no such effect of the disease was observed in NIAB-Krishma or CIM-448. The vascular elements of the veins of S-12 were severely affected, and those of NIAB-Krishma slightly affected, thus clearly reflecting their differential degree of resistance to CLCuV. Thickening of mid ribs and veins in diseased leaves seemed to be mainly due to proliferation of parenchymatous tissues in these leaf parts.
Article
Full-text available
Cotton leaf curl vim (CLCuV), transmitted by whitefly Bemisia tabaci, causes one of the most devastating diseases of cotton. The first disease symptom appearing on the leaves of susceptible plants is thickening of mid ribs and veins. To examine whether leaf morphology plays any role in avoiding or restricting the insect-vector, epicuticular wax content and hairiness of leaves were determined in three cultivars of cotton differing in resistance to CLCuV(i.e., S- 12, CLCuV-susceptible; NIABKrishrna, moderately resistant; CIM-448, CLCuV-resistant). CIM-448 had considerably greater epicuticular wax on its leaf compared with the other two, but relatively very low leaf hair density as found in S-12. The diseased leaves of cvs S-12 and NIAB-Krishma had significantly greater epicuticular wax than on their healthy leaves. Hairiness was greatest in NIAB-Krishma. While probing the effects of disease on vein thickening, electron micrographs of the mid ribs of the three cultivars showed remarkable differences. In the mid rib of thediseased leaf of S- 12, the xylem and phloem elements were partially or completely collapsed, whereas no such effect of the disease was observed in NIAB-Krishma or CIM-448. The vascularelements of the veins of S-12 were severely affected, and those of NIAB-Krishma slightly affected, thus clearly reflecting their differential degree of , resistance to CLCuV. Thickening of mid ribs and veins in diseased leaves seemed to be mainly due to proliferation of parenchymatous tissues in these leaf parts.
Article
Author Institution: Department of Horticulture, The Ohio State University, Columbus 10
Chapter
Studies on the genetics of the tomato have been stimulated recently by the organization of the Tomato Genetics Cooperative, which, like the older and exemplary groups in maize, drosophila, and other organisms, serves to coordinate and facilitate the activities of many workers by offering a medium of exchange of stocks and information and proposing standard procedures wherever advisable. This review is concerned with the genetics and cytology of the tomato, lycopersicon esculentum, a widely cultivated annual species of the Solanaceae. Studies of other species of lycopersicon are also included insofar as they deal directly with lycopersicon esculentum.
Article
The TRANSPARENT TESTA GLABRA1 ( TTG1 ) locus regulates several developmental and biochemical pathways in Arabidopsis, including the formation of hairs on leaves, stems, and roots, and the production of seed mucilage and anthocyanin pigments. The TTG1 locus has been isolated by positional cloning, and its identity was confirmed by complementation of a ttg1 mutant. The locus encodes a protein of 341 amino acid residues with four WD40 repeats. The protein is similar to AN11, a regulator of anthocyanin biosynthesis in petunia, and more distantly related to those of the β subunits of heterotrimeric G proteins, which suggests a role for TTG1 in signal transduction to downstream transcription factors. The 1.5-kb TTG1 transcript is present in all major organs of Arabidopsis. Sequence analysis of six mutant alleles has identified base changes producing truncations or single amino acid changes in the TTG1 protein.