Clonal structure of rapid-onset MDV-driven CD4+ lymphomas and responding CD8+ T cells. PLoS Pathog 7(5):e1001337

Freie Universitaet Berlin, Germany
PLoS Pathogens (Impact Factor: 7.56). 05/2011; 7(5):e1001337. DOI: 10.1371/journal.ppat.1001337
Source: PubMed
ABSTRACT
Lymphoid oncogenesis is a life threatening complication associated with a number of persistent viral infections (e.g. EBV and HTLV-1 in humans). With many of these infections it is difficult to study their natural history and the dynamics of tumor formation. Marek's Disease Virus (MDV) is a prevalent α-herpesvirus of poultry, inducing CD4+ TCRαβ+ T cell tumors in susceptible hosts. The high penetrance and temporal predictability of tumor induction raises issues related to the clonal structure of these lymphomas. Similarly, the clonality of responding CD8 T cells that infiltrate the tumor sites is unknown. Using TCRβ repertoire analysis tools, we demonstrated that MDV driven CD4+ T cell tumors were dominated by one to three large clones within an oligoclonal framework of smaller clones of CD4+ T cells. Individual birds had multiple tumor sites, some the result of metastasis (i.e. shared dominant clones) and others derived from distinct clones of transformed cells. The smaller oligoclonal CD4+ cells may represent an anti-tumor response, although on one occasion a low frequency clone was transformed and expanded after culture. Metastatic tumor clones were detected in the blood early during infection and dominated the circulating T cell repertoire, leading to MDV associated immune suppression. We also demonstrated that the tumor-infiltrating CD8+ T cell response was dominated by large oligoclonal expansions containing both "public" and "private" CDR3 sequences. The frequency of CD8+ T cell CDR3 sequences suggests initial stimulation during the early phases of infection. Collectively, our results indicate that MDV driven tumors are dominated by a highly restricted number of CD4+ clones. Moreover, the responding CD8+ T cell infiltrate is oligoclonal indicating recognition of a limited number of MDV antigens. These studies improve our understanding of the biology of MDV, an important poultry pathogen and a natural infection model of virus-induced tumor formation.

Full-text

Available from: Susan Jean Baigent
Clonal Structure of Rapid-Onset MDV-Driven CD4
+
Lymphomas and Responding CD8
+
T Cells
William N. Mwangi
1
, Lorraine P. Smith
1
, Susan J. Baigent
1
, Richard K. Beal
1
, Venugopal Nair
1
, Adrian L.
Smith
1,2
*
1 Avian Infectious Disease Programme, Institute for Animal Health, Compton, Berkshire, United Kingdom, 2 Department of Zoology, University of Oxford, Oxford, United
Kingdom
Abstract
Lymphoid oncogenesis is a life threatening complication associated with a number of persistent viral infections (e.g. EBV
and HTLV-1 in humans). With many of these infections it is difficult to study their natural history and the dynamics of tumor
formation. Marek’s Disease Virus (MDV) is a prevalent a-herpesvirus of poultry, inducing CD4+ TCRab+ T cell tumors in
susceptible hosts. The high penetrance and temporal predictability of tumor induction raises issues related to the clonal
structure of these lymphomas. Similarly, the clonality of responding CD8 T cells that infiltrate the tumor sites is unknown.
Using TCRb repertoire analysis tools, we demonstrated that MDV driven CD4+ T cell tumors were dominated by one to three
large clones within an oligoclonal framework of smaller clones of CD4+ T cells. Individual birds had multiple tumor sites,
some the result of metastasis (i.e. shared dominant clones) and others derived from distinct clones of transformed cells. The
smaller oligoclonal CD4+ cells may represent an anti-tumor response, although on one occasion a low frequency clone was
transformed and expanded after culture. Metastatic tumor clones were detected in the blood early during infection and
dominated the circulating T cell repertoire, leading to MDV associated immune suppression. We also demonstrated that the
tumor-infiltrating CD8+ T cell response was dominated by large oligoclonal expansions containing both ‘‘public’’ and
‘‘private’’ CDR3 sequences. The frequency of CD8+ T cell CDR3 sequences suggests initial stimulation during the early
phases of infection. Collectively, our results indicate that MDV driven tumors are dominated by a highly restricted number of
CD4+ clones. Moreover, the responding CD8+ T cell infiltrate is oligoclonal indicating recognition of a limited number of
MDV antigens. These studies improve our understanding of the biology of MDV, an important poultry pathogen and a
natural infection model of virus-induced tumor formation.
Citation: Mwangi WN, Smith LP, Baigent SJ, Beal RK, Nair V, et al. (2011) Clonal Structure of Rapid-Onset MDV-Driven CD4+ Lymphomas and Responding CD8+ T
Cells. PLoS Pathog 7(5): e1001337. doi:10.1371/journal.ppat.1001337
Editor: Nikolaus Osterrieder, Freie Unive rsitaet Berlin, Germany
Received July 21, 2010; Accepted April 5, 2011; Published May 5, 2011
Copyright: ß 2011 Mwangi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was primarily supported by the DEFRA-HEFCE (grant no. VT-0104) and DEFRA (OD0718). ALS and VN are recognised as Jenner Investigators
and receive support from the Jenner Institute, Oxford, UK. The funders had no role in study design, data collection and analysis, decision to publish, or preparation
of the manuscript.
Competing Interests: The authors have decl ared that no competing interests exist.
* E-mail: adrian.smith@zoo.ox.ac.uk
Introduction
Virus driven lymphoid oncogenesis is a serious consequence of
infection with a wide range of herpes and retroviral pathogens in a
variety of hosts. Major lymphoma-associated infections of humans
include Epstein Barr virus (EBV) and Human T cell lymphotropic
virus (HTLV) [1,2]. With both EBV and HTLV tumor
progression is a relatively rare event considering the prevalence
of infection and the persistent nature of the virus [2,3]. In contrast,
Marek’s Disease Virus (MDV) is a widespread, oncogenic a-
herpesvirus infection of chickens which readily causes lymphoid
tumors and has immense impact on the poultry industry [4]. The
oncogenicity of MDV, combined with the ability to vaccinate
against tumor formation make the MDV-chicken system an
excellent natural infection model for understanding the biology
and treatment of viral induced lymphomas [1,5–7].
The spread of MDV occurs through the inhalation of infectious
particles in dust. After a brief lytic phase in B lymphocytes (,2to7
days post infection [dpi]), MDV establishes a life-long latent
infection in CD4+ T lymphocytes [8]. The life-cycle is completed
by transfer of the MDV to the feather follicle epithelium [8]. In
susceptible birds, MDV infection leads to a high incidence of
CD4+ T cell tumors (up to 100%) in a wide range of organs
including heart, liver, ovary, testes, lungs and skin [9–14]. These
CD4+ tumors express high levels of CD30, a tumor necrosis factor
receptor II family member, also over-expressed on human
lymphomas with diverse etiologies [5]. MDV latency and tumor
formation is dependent upon viral encoded genes such as EcoRI-
Q (meq), a c-Jun related molecule [15–17].
The penetrance (up to 100%) and temporal reproducibility of
tumor appearance after infection (within 3 to 4 weeks) in
susceptible lines of bird raises important questions regarding
tumor clonality. These include the clonality of transformed cells in
individual sites and between sites where multiple discrete solid
tumors are evident in a single individual. The MDV genome
readily integrates into the host cell genome particularly at
telomeric or sub-telomeric locations [18,19]. The profile of
MDV integration within the tumor host cell suggested restricted
clonality of most Marek’s Disease-derived cell lines and cells taken
from tumor sites [18,19]. Between two and twelve independent
integration sites were detected in each sample and the pattern of
integration was stable over time in culture. In contrast, analysis of
PLoS Pathogens | www.plospathogens.org 1 May 2011 | Volume 7 | Issue 5 | e1001337
Page 1
T cell receptor (TCR) Vb family usage in CD30
hi
cells from
primary lymphomas led to the conclusion that MD tumors were
polyclonal [10]. During the analysis of MDV integration patterns,
samples obtained from a single chicken contained at least two
major distinct patterns [19] suggesting at least two independent
transformation events. These data coupled with the possibility of
favoured sites for MDV integration [e.g. telomeric or sub-
telomeric preference, [19]] suggest that a non-viral integration
site dependent analysis of clonality would be appropriate. Since
the tumors are derived from CD4+ T cells, the clonally expressed
T cell receptor (TCR) would be an appropriate target for the
molecular definition of tumor clonality.
The development of successful anti-tumor vaccines against
MDV has been critical in poultry production and led to the
proposal of utility for MDV as a model for developing vaccines
against other lymphoma-inducing viral infections reviewed in
[1,6]. The vaccines are highly effective at preventing tumor
formation but fail to eliminate infection or block transmission over
prolonged periods [20]. Periodically, circulating strains of MDV
develop enhanced pathogenicity and vaccine break has necessi-
tated the development of different generations of vaccines over the
past 50 years [Reviewed in [21,22]]. The success of vaccination
indicates acquisition of protective adaptive immunity and both
antibody and T cell responses are readily detected [23,24]. Other
evidence for immune protection includes the association of genetic
resistance with the MHC (B locus) haplotype [25–29]. Similarly,
natural infection induces measurable natural killer cell, antibody,
T cell and cytokine and interferon responses [30–34]. The highly
cell associated nature of MDV supports the notion that cell
mediated responses may predominate in protective immunity
(reviewed by [23,35,36] with the CD8+ T cell mediated cytotoxic
killing demonstrated in several studies [37–39]. The cytotoxic
activity in MHC B
19
and B
21
homozygous chickens was focussed
on the MDV-encoded pp38, meq and gB antigens [38].
Importantly, transient depletion of CD8+ T cells rendered
chickens more susceptible to infection with MDV [40]. The
response to persistent viral infections in humans is often
characterised by cytotoxic T cells specific to latency-associated
antigens. Indeed, large clones of T cells are readily detected during
infection with CMV [41,42] and EBV [2,43,44]. This type of
clonal structure within CD8+ T cells is indicative of a response
focussed on very few antigens.
The issue of tumor clonality and the nature of the CD8+ T cell
response during MDV infection prompted application of the T cell
receptor repertoire analysis tools we have recently developed for
the chicken [45]. The chicken TCRb locus in chickens is much
simpler than in mammals containing 13 Variable (V), 1 Diversity
(D), 4 Joining (J) segments and 1 C segment [45–49]. The Vb
segments group into two families, which simplifies global analysis
of the chicken TCR repertoire. We applied a combination of
CDR3 length analysis (spectratyping) and sequencing of the VDJ-
junction (also known as the complementary determining region 3
[CDR3]) to define the clonality of MDV cell lines and different
populations of cells from tumors or other sites within MDV
infected birds. These approaches revealed clonal structure within
MDV tumors (but not always monoclonal) and a pattern of shared
and distinct clonal origin in different sites within a single
individual. Analysis of the tumor infiltrating and splenic CD8+
T cells allowed identification of large T cell clones within an
oligoclonal framework of responding CD8+ T cells.
Materials and Methods
Experimental infection
Inbred line P (MHC, B
19/19
) white leghorn chickens were
reared pathogen free at the Poultry Production Unit of the
Institute for Animal Health. One-day-old birds were infected with
of MDV strain RB-1B [50] by intra-abdominal injection of
,1000 pfu cell associated virus and observed for the development
of MD using methods described previously [51,52]. Two of the
birds (15 and 16) were sentinel birds and infected by exposure to
experimentally infected birds. Birds were reared with ad libitum
access to water and vegetable-based diet (Special Diet services,
Witham, UK) and wing-banded to allow identification of
individuals.
Ethics statement
This study was carried out according to the guidance and
regulations of the UK Home Office with appropriate personal and
project licences (licence number 30/2621). As part of this process
the work has undergone scrutiny and approval by the ethics
committee at the Institute for Animal Health.
Cell preparation, flow cytometry and sortin
Single-cell suspensions of lymphocytes were prepared from
spleen, blood and tumor tissues by Histopaque-1083 (Sigma-
Aldrich, Steinheim, Germany) density-gradient centrifugation.
CD4+ and CD8 + T cell populations were isolated by positive
magnetic cell sorting (AutoMACS Pro Separator, Miltenyi Biotec,
Bergisch Gladbach, Germany) according to manufacturer’s
instructions using FITC conjugated mouse anti-chicken CD4,
clone CT-4 and anti-chicken CD8b antibodies, clone EP42 [[53];
SouthernBiotech, Birmingham, Alabama, USA)] and goat anti-
mouse IgG microbeads (Miltenyi Biotec). After each antibody
treatment, cells were washed three times with PBS containing
0.5% bovine serum albumin with centrifugation at 450 xg for
10 min. The purity of sorted cells was .99% by flow cytometry.
Cell culture and maintenance of established cell lines
Established lymphoma cell lines derived from MDV-1-induced
tumors included MSB1[54], HP8 [55] and HP18 [56], RPL-1
Author Summary
Many viral infections target the immune system, making
use of the long lived, highly proliferative lymphocytes to
propagate and survive within the host. This characteristic
has led to an association between some viruses such as
Epstein Barr Virus (EBV), Human T cell Lymphotrophic
Virus-1 (HTLV-1) and Mareks Disease Virus (MDV) and
lymphoid tumors. We employed methods for identifying
the T cell receptor repertoire as a molecular bar-code to
study the biology of MDV-induced tumors and the anti-
tumor response. Each individual contained a small number
of large (high frequency) tumor clones alongside some
smaller (lower frequency) clones in the CD4+ T cell
population. The tumor infiltrating CD8+ T cell response
was highly focused with a small number of large clones,
with one representing a public CDR3 sequence. This data is
consistent with the recognition of a small number of
dominant antigens and understanding the relationship
between these and protective immunity is important to
improve development of new vaccination strategies.
Collectively, our results provide insights into the clonal
structure of MDV driven tumors and in the responding
CD8+ T cell compartment. These studies advance our
understanding of MDV biology, an important poultry
disease and a natural infection model of virus-induced
tumor formation.
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 2 May 2011 | Volume 7 | Issue 5 | e1001337
Page 2
[57]. Four additional MDV cell lines were established from four
line P birds infected with pRB-1B5 [51], from testes (T), ovary (O)
and spleen (S) tumors according to standard methods [56]. These
have been given the following identifiers 4523(T), 4525(O),
4590(S) and 760(O). The Reticuloendotheliosis virus T (REV-T
strain)-transformed CD4+ T-cell line AVOL-1 [58,59] was
included as a MDV-negative transformed cell line. Cell lines were
grown at 38.5uCin5%CO
2
in RPMI 1640 medium containing
10% fetal calf serum, 10% tryptose phosphate broth and 1%
sodium pyruvate.
RNA isolation
Tissue samples were stored in RNAlater (QIAGEN Ltd.
Crawley, United Kingdom) at 220uC before disruption by
homogenization (Mini-bead beater; Biospec Products, Bartlesville,
Okla.). Isolated cell subsets or cultured cells were disrupted by
resuspension in RLT buffer (QIAGEN) and stored at 220uC.
RNA was extracted with the RNeasy Mini kit (QIAGEN)
according to the manufacturer’s instructions. Contaminating
DNA was digested on column with RNase-free DNase 1
(QIAGEN) for 15 min at room temperature. The RNA was
eluted with 50
ml RNase-free water (QIAGEN) and stored at
280uC.
Reverse transcription
Reverse transcription reactions were performed using the
iScript Reverse Transcription system (iScript Select cDNA
synthesis Kit, Bio-Rad, USA) according to manufacturer’s
instructions, using 2
mg of isolated RNA from each sample and
oligo(dT) primers. Twenty
ml of cDNA was obtained for each
sample and stored at -20uC.
Polymerase chain reaction (PCR)
PCR were performed according to standard protocols. Briefly,
cDNA (2
ml) was incubated with 200 mm dNTP, 1.5 mM MgCl
2
,
1x reaction buffer [50 mM KCl, 20 mM Tris–HCl (pH 8.4)], 2
units Platinum Taq DNA polymerase (Invitrogen), 1
ml of each
primer at 10
mM working concentration, in a 50 ml final reaction
volume. The forward primer used for Vb1 and Vb2 was 59AC-
AGGTCGACCTGGGAGACTCTCTGA CTCTGAACTG-39
and 59-CACGGTCGACGATGAGAACGCTACCCTGAGAT-
GC-39 respectively with a common Cb reverse primer 59A-
CAGGTCGACGTACCAAA GCATCATCCCCATCACAA-39
[60]. The TCRb locus lies on chromosome 1 with Vb and Cb
primer design based upon genomic sequence (version 82; http://
www.ensembl.org/Gallus_gallus) as described previously (45). The
use of primers that lie in conserved regions of the TCR segments
minimises any bias associated with PCR amplification. Sequence
analysis of samples derived from uninfected birds reveals a
polyclonal population of amplified TCR CDR3 with no evidence
of PCR bias (45 and our unpublished data).
PCR conditions were as follows, one cycle, 94uC for 2 min,
followed by 35 cycles of 94uC for 30 s, 50uC for 40 s and 72uC for
1 min, followed by one cycle at 72uC for 10 min using a G-storm
thermocycler (Gene Technologies, Essex, UK) or Eppendorf
mastercycler (Eppendorf, Hamburg, Germany). The amplified
products were analysed by electrophoresis through 1% agarose
(Sigma-Aldrich Ltd, Poole, UK) gels in 1x Tris-borate-EDTA
buffer at 50 mA for 1 hr, and products visualized by staining with
ethidium bromide (Bio-Rad, Ltd) or GelRed nucleic acid stain
(Biotium).
PCR products were purified using QIAquick PCR purification
kit (Qiagen Ltd) according to manufacturer’s instructions. DNA
was eluted in 50
ml nuclease free water and stored at 220uC.
Cloning and sequencing of PCR products
To determine the sequence of the expressed Vb-chain, PCR
products were cloned directly into the pCR4-TOPO vector
(Invitrogen) and used to transform competent E. coli, TOP10
(Invitrogen) according to the manufacturer’s instructions. After
incubation on selective LB agar plates containing 100
mg/ml
Ampicillin (Sigma), single bacterial colonies were picked and
screened for insert of correct size by PCR followed by agarose gel
electrophoresis. Positive colonies were processed using the Qiagen
Miniprep kit (Qiagen Ltd) and subsequently sequenced with
plasmid-specific (M13 Forward; 59-GTAAAACGACGGCCAG-
39or M13 reverse; 59-CAGGAAACAGCTATGAC-39)orCb
specific reverse primer (59-TGTGGCCTTCTTCTTCTCTTG-
39). Alternatively, the plasmid insert amplified by PCR was
purified using QIAquick PCR purification kit (Qiagen Ltd)
according to manufacturer’s instructions and sequenced directly
using a nested Cb specific reverse primer (above). Sequencing was
carried out by capillary electrophoresis on the CEQ 8000
sequencer according to the manufacturer’s instructions (Beckman
Coulter, Fullerton, CA).
Up to 22 (usually ,15) independent sequences were obtained
with each sample. The sample size (n) was chosen with reference to
the coefficient of variation of the binomial distribution, which is
proportional to 1/!n. This means that the increased precision
obtained by raising sample size above ,n = 15 rapidly reaches a
point of diminishing return. Appropriate confidence limits for the
repeated sequence frequencies were calculated using the Adjusted-
Wald method for binomial proportinos [61]. All sequence data
was considered with reference to data generated by spectratype
analysis of the CDR3 length profile generated from the total
population of cells examined.
Spectratyping
To determine the CDR3 lengths of the amplified PCR products
by spectratype analysis, a run-off reaction was performed as
follows. Five
ml of purified PCR product was incubated with
200
mm dNTP, 1 mM MgCl
2
, 1x reaction buffer [50 mM KCl,
20 mM Tris–HCl (pH 8.4)], 0.5 units Taq DNA polymerase
(Invitrogen), 1
ml of a WellRED dye D4 (Sigma) labelled nested
Cb specific reverse primer (59-TCA TCT GTC CCC ACT CCT
TC-39)at4
mM working concentration in a 20 ml final reaction
volume.
The reaction conditions were as follows, one cycle 95uC for
2 min, followed by 4 cycles of 57uC for 2 min and 72uC for
20 min using a G-storm thermocycler (Gene Technologies, Essex,
UK) or Eppendorf mastercycler (Eppendorf, Hamburg, Ger-
many). The run-off reaction products were diluted 5x with
nuclease free water and 1
ml of the diluted product was mixed with
40
ml sample loading dye (Beckman Coulter, Fullerton, CA)
containing 0.25
ml DNA size standard kit-600 (Beckman Coulter,
Fullerton, CA). Samples were transferred into a 96 well plate,
overlaid with mineral oil and immediately loaded into a capillary
sequencer (CEQ8000 Genetic Analysis System, Beckman Coulter)
for fragment analysis. For optimal results, samples were analysed
using a modified fragment analysis program (Frag-4) by increasing
separation time to 75 min. The data was compiled in CEQ8000
analysis module and for each sample the range of base pair lengths
of products was identified and displayed as spectratype profiles.
Peak size data was extracted from the fragment analysis software
and transferred into Microsoft Excel. Chi-squared tests were used
to test whether each CDR3 length distribution differed signifi-
cantly from that obtained with uninfected birds (TCRVb1 and
TCRVb2 from unsorted cells or those positively sorted for
expression of CD4 or CD8b ). The spectratype profiles derived
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 3 May 2011 | Volume 7 | Issue 5 | e1001337
Page 3
from uninfected birds (n = 3 for each population) exhibited
consistently broad CDR3 length distributions that were not
statistically different to each other. Reference CDR3 length
distributions were constructed for each population by calculating
the mean proportion of signal obtained at each CDR3 length from
uninfected samples.
Results
MD tumor cell lines are composed of monoclonal T cell
populations
In the first instance we selected eight MDV-transformed cell lines
[[54,56,57,62] and our unpublished data] and subjected these to
TCR repertoire analysis. The REV-T-transformed CD4+ T-cell
line AVOL-1 [58,59] was included for comparison. All of the MD
tumor cell lines expressed either Vb1orVb2 exclusively, whereas
the REV-T transformed AVOL-1 cell line expressed both TCR
Vb1 and Vb2 (Figure 1A). The majority of the randomly selected
cell lines (6/7) expressed Vb1 suggesting a bias in tumor formation
between the two avian TCRb families. The spectratype-derived
CDR3 length profiles for each MD cell line comprised a single
spectral peak, whereas AVOL-1 contained multiple spectral peaks
(Figure 1B). PCR products were cloned into the pCR4-TOPO
vector and the inserts sequenced from single colonies of transformed
E. coli. For each MD cell line, all inserts contained identical TCRb
CDR3 sequences whereas three sequences were obtained for Vb1in
AVOL-1 (Figure 1C and S1). Taken together, these data indicate
the clonal nature of MD cell lines compared with an oligoclonal
structure in the REV-T transformed AVOL-1 cell line.
Restricted clonality is evident in MD tumors
A fresh ovarian tumor was obtained from one pRB-1B5 MDV-
infected bird (designated Bird1) at post mortem (90 DPI).
Spectratype analysis revealed a restricted TCRb repertoire
(Figure 2A) with a single spectral peak for Vb1. The Vb2
spectratype profile of the ovarian tumor had two main peaks and 3
or 4 minor peaks. With Vb1 all CDR3 sequences were identical
(Figure 2B) corresponding in size to the CDR3 length observed by
spectratyping, a profile similar to the tumor-derived cell lines. In
contrast, with Vb2 two repeated CDR3 sequences were detected,
one which coded for the amino acid (aa) sequence ‘GIDSD’ at a
frequency of 9/21sequences which translates to an estimate of
43% (
95%
CI 24-63%) of the population and the second, ‘DRG’ at
7/21 (33%,
95%
CI of 17–54% of the population). The remaining 5
sequences were singlets. The expanded Vb2 clones may indicate
presence of additional tumor clones, latently-infected T cells or a
focussed T cell response infiltrating the tumor. These data
demonstrate that MD tumor may consist of a monoclonal Vb1
and an oligoclonal Vb2 population. Application of spectratype and
CDR3 sequence analysis to T cell populations from uninfected
Line P birds revealed polyclonal repertoire profiles with no
duplicated CDR3 sequence identified in any sample (data not
shown).
The dominant clones in MD tumors lie within culturable
CD4+ cells
Since MDV transforms CD4+ cells [9–12,14] we compared the
CDR3 length distribution within unsorted and CD4+ populations
of cells derived from tumors. Spectratype analysis of the liver and
kidney tumors (32 DPI) from two additional individuals (desig-
nated Bird 2 and 3) revealed dramatic restriction in Vb1 CDR3
length in unsorted cells (Figure 3, left column). These profiles were
mirrored by the spectratypes of the CD4+ cell populations in all
four tumor samples (Figure 3, middle column). Flow cytometry
analysis showed that CD4 + cells represented between 88–98% of
the cells derived from whole tumor (data not shown). Cell lines
were established from three tumors, two of which had spectratype
profiles identical to those detected within isolated CD4+ cells
(Figure 3, right column). With the kidney tumor of Bird 3, the
CDR3 spectra of cultured cells included a dominant peak of
identical length to that in CD4+ T cells but also included a second
slightly shorter peak. Sequence analysis revealed dominant
sequences that were enriched by sorting for CD4+ cells and by
ex vivo culture with the majority being derived from monoclonal
expansions (Figure 4). The second spectral peak in the cultured
cells of Bird 3 represented a second sequence detected once in the
sorted CD4+ cells. Moreover, as a result of analysing two tumors
from different organs from each individual, this data set also
demonstrated that different tumor clones were present in different
sites, with each site dominated by a single Vb1 clone (e.g. CDR3
aa sequences EWDRGTY and VGGDRLS for Bird 2).
In contrast to Vb1, the Vb2 spectratype profiles of the 4 tumors
(Figure S2) and corresponding sequences (Figure S3) indicate a
wider repertoire although relatively large CD4 + T cell clones
were detected in Bird 2 liver and kidney. However, none of these
clones could be generated into transformed T-cell lines and may
represent non-culturable tumors or a focussed T cell response. To
identify the frequency of profiles consistent with metastatic tumor
clones (shared clones in multiple sites) and those with independent
origin (different clones), we carried out the spectratype analysis of
multiple tumor sites from further seven birds (Bird 4 to 10). The
profiles obtained for both Vb1 and Vb2 are shown in Figure S4 (A
for Vb1 and B for Vb2). Dominant spectral peaks shared between
multiple sites were found in 6 of 7 birds but there were also site-
specific over-represented spectral peaks in most individuals, for
example with the kidney Vb1 of bird 7. Overall, the data indicate
large bias in the profile of CDR3 length in all tumor sites
(p,0.001) and the shared peaks between sites will often be due to a
common CDR3 sequence. However, as seen with Bird 2
sometimes the sequence will be distinct despite shared CDR3
length (Figure 4). Interestingly, the dominant spectral peak seen in
multiple tumor sites was often evident in spleen and/or blood
samples supporting an interpretation of metastatic spread for some
tumor clones.
Further spectratype and sequencing analyses were performed to
identify the nature of the CD8+ response (see below), where cells
from multiple tumor sites were sorted into CD4 and CD8
fractions. The spectratype profiles for whole tumor or sorted
CD4+ cells from tumor sites in Birds 11 to 14 were similar to those
seen with Bird 1 to 10, with dominant spectral peaks in tumor sites
(Figure S5). Some of the dominant peaks were shared between
tumor sites within a single bird whilst others were specific for
particular sites. The Vb1 and Vb2 products were sequenced for all
tumor sites in Birds 11 and 12 (Figures S6 to S9). In the absence of
culturable T-cell lines generated from these tumors, we tentatively
defined tumor-like clones as CD4-enriched and representing
greater than 30% of the sequences in any one site (most were
much higher frequency than 30%). Specifically, the sequence data
for Vb1 in CD4+ cells from Bird 11 (Figure S6) identifies three
large tumor-like clones, ‘‘LDGTGGY’’ (liver only), ‘‘RRLTGD’’
(kidney and as a singlet in ovary) and ‘‘LDTGGS’’ (liver, kidney
and ovary). The sequence for V
b2 in CD4+ cells of Bird 11 (Figure
S7) revealed one highly over-represented sequence in all sites
(ILRDRGW) that may represent a metastatic tumor and a second
in the spleen (IRLGTGGY). For Bird 12 (Figure S8) no Vb1
CDR3 were represented at over 30% of CD4+ T cell derived
sequences but one Vb2 sequence (Figure S9) with the CDR3 motif
‘‘QG’’ was dominant in the kidney (18/19 CD4+ sequences) and
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 4 May 2011 | Volume 7 | Issue 5 | e1001337
Page 4
detected in ovary and spleen. A second CD4+,Vb2 CDR3
sequence ‘‘FVMRGID’’ was dominant in the ovary but not
detected elsewhere.
In most individuals the sequencing approach revealed smaller
clones of CD4+ cells (repeated but ,30% of sequences in any site)
including Vb1 with Birds 2, 11 and 12 and in Vb2 with Birds 3, 11
Figure 1. Clonality of established MDV cell lines revealed by TCRb CDR3 repertoire analysis. RNA was prepared from seven MDV cell lines
and one REV-transformed cell line (AVOL-1) and subjected to (A) RTPCR with products resolved on a 1% agarose gel and (B) spectratype analysis. Each
sample was tested for expression of TCR Vb1 and Vb2 with specific primers. C) Sequencing 16 randomly picked clones of HP18 cell line confirms
monoclonal status. The nucleotide sequences of the 39 end of Vb, whole Db (with N and P nucleotide modifications), whole Jb and the 59 end of Cb
(left column) and translated amino acid (aa) sequences (right column) are shown. For reference the top sequence (bold) is constructed in germ line
configuration with Jb2. All spectratypes were significantly different to the TCRVb1 or TCRVb2 reference profile for unsorted spleen cells obtained from
uninfected birds (X
2
,p,0.001).
doi:10.1371/journal.ppat.1001337.g001
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 5 May 2011 | Volume 7 | Issue 5 | e1001337
Page 5
and 12 (Figures 4, S3, S6 to S9). These sequences may also represent
small tumor clones or responding cells but the expansion of one of
these sequences in cultured cells from Bird 3 kidney indicates that
the ‘‘small tumor clone’’ explanation is valid. Global attribution of
the smaller clones of CD4 T cells to a response or tumor phenotype
is not possible with the current data sets. Nonetheless, our data
clearly demonstrated that culturable tumors were usually dominat-
ed by a single T cell clone but that different sites within the same
individual can contain independent tumor clones.
Large tumor clones can be identified in blood of MDV
infected birds
The detection of tumor clones in the blood, at post-mortem
raised the possibility of identifying tumor clones prior to the
occurrence of overt disease. Initial analysis with samples of blood
collected ,2 weeks befor e the birds exhibited clinical s igns
suppo rted the notion that the TCR spectratype would be useful
to detect tumor clones circulating in the blood. The results of
Vb1 analysis of peripheral blood leukocyte (PBL) samples for two
birds (Bird 15 and 16) are given in Figure 5. The samples from
liver , kidney, muscle, heart and spleen taken at 49 DPI from Bird
15 revealed a dominant spectral peak that could also be detected
in the blood at 42 and 35 DPI (leading to a significant bi as in the
spect ral profile; p,0.001). Simil arly, Bird 16 shared the same
spect ral peak in liver, kidney and ovar y with an overrepresented
peak and a biased CDR3 profile in the blood at 35 DPI
(p,0.001), one week prior to the onset of clinical disease. In Bird
16, there was also a second spectral peak in the ovary and a no n-
shared spectral peak in the muscle that were not detected in the
blood.
Figure 2. Restricted TCRb repertoire in an ovarian tumor. Spectratype analysis on RNA isolated from an ovarian tumor from an MDV
challenged Line P bird (90 dpi with pRB-1B), A) A single spectral peak for Vb1 (left) and oligoclonal spectratype for Vb2 (right) profile. B) Sequence
analysis of Vb1 CDR3 products (single clone) and an oligoclonal Vb2 with two dominant CDR3 sequences at a frequency of 43% and 33%. The
nucleotide sequences of the 39 end of Vb, whole Db (with N and P nucleotide modifications), whole Jb and the 59 end of Cb (left column) and
translated amino acid (aa) sequences (right column) are shown. The Jb identity is indicated to right of aa sequence. For reference the top sequence
(bold) is constructed in germ line configuration with Jb3, the germ line aa sequences for Jb are: Jb1, SNMIFGDGTKLTVI; Jb2, NVRLIFGTGTKLTVL; Jb3,
NTPLNFGQGTRLTVL; Jb4, YVNIQYFGEGTKVTVL. All spectratypes were significantly different to the TCRVb1 or TCRVb2 reference profile for unsorted
spleen cells obtained from uninfected birds (X
2
,p,0.001).
doi:10.1371/journal.ppat.1001337.g002
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 6 May 2011 | Volume 7 | Issue 5 | e1001337
Page 6
A further two birds (17 and 18) were blood sampled serially
(twice a week) throughout infection for more precise detection of
the tumor clones in the blood, and the results for Vb1andVb2
spect ratypes are depicted in Figure 6. The tumor profile for Bird
17 at post-mortem ( 33 DP I) indicated a shared spectral profile for
Vb1 in kidney, testes and spleen (and in CD4+ cells isolated from
kidney and spleen) and a second site-restricted tumor in the
kidney comprising CD4+ Vb2+ cells. Th e multi-site tumor
CDR3 spec tral length was readily detected in the PBL from 16
DPI (p,0.01 and at later time points p,0.001) whereas ea rlier
PBL samples exhibited a ‘‘normal’’ distributi on of CDR 3 lengths
that were not significantly different to the spec tral profiles
obtained from uninfected birds. In contra st, the site specific Vb2
tumor was not detected as a spectratype bias in the PBL at any
time. The tumor profiles of Bird 18 revealed one shared site
(ovary and s pleen) Vb1 tumor, one single site Vb1 tumor (liver)
and on e shared site Vb2 tumor in all three sites (although the
more complex ovarian tumor spectratype sugges t it may be less
highly represented). The multi-site Vb1 tumor was detected as
spect ral bias in the P BL between 16 and 19 DPI (p,0.00 1)
although the overall bias was less dra matic than seen with Bird
17.
The spectral profiles of PBL from MDV infected birds indicate
that multi site tumor clones can be readily detected in the blood
over two weeks prior to clinical symptoms. Unlike the multi site
tumors, those restricted to a single site were not detected in the
blood. The appearance of tumor clones in the blood affected the
repertoire of the overall PBL population especially within the
TCRVb family that comprise the tumor (e.g. for Bird 17, the
blood Vb1 profile was completely dominated by the tumor).
Moreover, the disturbance caused by a large CD4+ T cell tumor
clone in Vb1 also affected the repertoire profile of Vb2 (compare
pre- and post- 12 DPI spectratype profiles) with significantly
altered CDR3-length profiles in the PBL of Bird 17 at 16 DPI
(p,0.005), 29 DPI and 33 DPI (both p,0.001).
MD tumors contain populations of highly focussed CD8+
cells
Although the nature of the tumor complicates identification of
CD4+ T cell responses the CD8+ TCRab+ T cells clearly
represent a responding T cell population capable of specific
recognition, cytokine production and anti-MDV capability
[38,39,63]. Moreover, in humans infected with persistent viruses
(e.g. EBV, CMV and HTLV) the responding CD8+ T cells
develop a highly focussed repertoire [2,41–43,64,65]. Hence, to
define the repertoire of the CD8+ response in MDV infected birds,
we isolated CD8+ T cell populations from a range of tumor sites
and subjected them to spectratype and sequence based repertoire
analysis (simultaneous analysis of CD4+ populations was used to
determine the nature of the tumor profiles in these individuals,
Figures S5, S6, S7, S8, and S9).
Spectratype profiles obtained for Vb repertoire analysis of
CD8+ cells isolated from multiple tumor sites in four birds (11 to
14) are presented in Figure 7. CD8+ cells represented a minority
cell population within the tumor, ranging between 0.4 and 5% by
flow cytometric analysis (data not shown). Highly purified CD8+
cells (.99%) exhibited a restricted Vb1 CDR3 length spectral
profile (p,0.001; Figure 7). Within birds, the spectral profiles
taken from different sites often included shared peaks detected in
multiple samples. The Vb2 spectral profiles were more variable
but were also characteristic of biased populations (p,0.01 to
p,0.001) with large over-represented peaks in some samples. The
Vb1 products were sub-cloned and sequenced from all sites in two
birds (11 and 12) (Figure 8) allowing identification of clonal
expansion by the presence of repeated sequences. These sequences
included the CDR3 aa motif ‘‘GGS’’ present in both Bird 11 and
Figure 3. Dominant CDR3-lengths identified in tumors are present in sorted CD4
+
cells and cultured cells. TCRVb1 CDR3 length
distribution (spectratype) within unsorted (left column) and CD4+ populations of cells derived from tumors (middle column) and cell lines established
from three tumors (right column). Samples derived from liver and kidney of two Line P birds 32dpi with RB-1B MDV. The data indicates that the
dominant spectral peaks in MDV tumors lie within a transformed population of CD4+ cells. All spectratypes were significantly different to the
reference profiles for unsorted or CD4+ spleen cells obtained from uninfected birds (X
2
,p,0.001).
doi:10.1371/journal.ppat.1001337.g003
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 7 May 2011 | Volume 7 | Issue 5 | e1001337
Page 7
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 8 May 2011 | Volume 7 | Issue 5 | e1001337
Page 8
12 as a large, multi-site, overrepresented ‘‘public’’ CDR3
sequence. Considering this clone was the only sequence at this
length in either Bird 11 or 12 it is intriguing that this spectral peak
was also over-represented in the CD8+ T cells from Bird 13 and
14. Other repeated CDR3 sequences in CD8+ T cells included
‘‘RDRGIY’’ (in liver kidney and spleen), ‘‘SRTGGS’’ (ovary and
spleen) and ‘‘IFGIY’’ (spleen) of Bird 11 and ‘‘GGSI’’ in the spleen
of Bird 12. Further candidate CD8+ CDR3 sequences were
identified as present in unsorted populations and not present in
CD4+ sorted populations. These included those revealed by the
Vb2 sequencing efforts; two from Bird 2 (ETGGVY and
FAFIDRGI), one from Bird 3 (TIERVD), two from Bird 11
(EVGEILY and TTPQGDRSQ) and one from Bird 12
(RGGYQPA).
Collectively, these results indicate a highly focussed CD8+ T cell
response with some clones present at high frequencies in multiple
tumor sites and the spleen. The tumor profile of Bird 11 (5 tumor-
like clones, with two metastatic) and Bird 12 (2 tumor-like clones
with one metastatic and one ovary-restricted) may relate to the
identity of the CD8+ T cell expansions seen in different sites. For
Figure 5. Spectratype analysis revealed that tumor clones can be identified in blood of MDV-infected birds. TCRVb1 CDR3 length
distribution of tumor, spleen and peripheral blood lymphocyte (PBL) samples from bird 15 (left column) and bird 16 (right column). Tumor and spleen
samples were taken at post-mortem (49 dpi with RB1B MDV) and samples of PBL at 27 and 35dpi. Dominant spectral peaks could be detected in the
blood at 35 DPI which correspond to the tumor profiles which contained the expected dominant spectral peaks. The spectratype distributions of
samples were compared with the TCRVb1 or TCRVb2 reference profiles for unsorted or CD4+ spleen cells obtained from uninfected birds by X
2
analysis; statistical significance is indicated with each panel. NS = not significant (at p.0.05). Li, liver; Kd, Kidney; Ov, ovary; Spl, spleen; Musl, muscle;
Hrt, heart; PBL, peripheral blood lymphocytes.
doi:10.1371/journal.ppat.1001337.g005
Figure 4. TCRVb1 CDR3-sequence identity confirms clonal identity of T cells in tumor CD4
+
and cultured cells. CDR3 amino acid
sequences obtained by in silico translation of TCRVb1 associated CDR3 nucleotide sequences. Samples derived from liver and kidney of two Line P
birds 32 dpi with RB-1B MDV and represent unsorted tumors (left column) and CD4+ populations of cells derived from tumors (middle column) and
cell lines established from three tumors (right column). Each sequence derives from cloned RTPCR product picked from single transformed colonies of
E. coli. For reference the top sequence (bold) is constructed in germ line configuration with Jb3, the germ line aa sequences for Jb are: Jb1,
SNMIFGDGTKLTVI; Jb2, NVRLIFGTGTKLTVL; Jb3, NTPLNFGQGTRLTVL; Jb4, YVNIQYFGEGTKVTVL. The data confirms clonal identity between MDV
tumors and culturable CD4+ cells as suggested by spectratype analysis.
doi:10.1371/journal.ppat.1001337.g004
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 9 May 2011 | Volume 7 | Issue 5 | e1001337
Page 9
example the public GSS CDR3 sequence was detected at most
tumor sites, whereas some other CD8+ clones were more restricted
in their distribution to certain locations.
Based upon an assumption of similar TCR mRNA levels in all
cells and the known numbers of Vb1+ and Vb2+ CD8+ cells in
the tumor and spleen we can estimate the size of the CD8+ clones
Figure 6. Early appearance of metastatic tumor clones in the blood of MDV-infected birds. TCRVb1 and TCRVb2, CDR3 length distribution
of samples obtained from B17 (left columns) and B18 (right columns). Peripheral blood lymphocytes (PBL) were isolated from samples taken
throughout infection with tumor, spleen and PBL samples taken at post-mortem. Some tumor and spleen samples were subjected to positive
enrichment of CD4+ T cells by magnetic bead sorting. The dominant tumor associated spectral peaks could be detected in the PBL at the early stages
of infection (e.g. bird 17 Vb1 at 16 DPI). The spectratype distributions of samples were compared with the TCRVb1 or TCRVb2 reference profiles for
unsorted or CD4+ spleen cells obtained from uninfected birds by X
2
analysis; statistical significance is indicated with each panel. NS = not significant
(at p.0.05). Li, liver; Kd, Kidney, Tes, testes, Ov, ovary; Spl, spleen; PBL, peripheral blood lymphocytes.
doi:10.1371/journal.ppat.1001337.g006
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 10 May 2011 | Volume 7 | Issue 5 | e1001337
Page 10
in the tumor site and spleen. For example, within Bird 11, the
splenic population of the three CD8+ Vb1+ clones ‘‘GGS’’
‘‘RDRGIY’’ and ‘‘IFGIY’’ each represented 12.5% of the CDR3
which translate into populations of ,25 million cells (
95%
CI 4–
74610
6
).. In Bird 12, the public CDR3 aa sequence ‘‘GGS’’ was
present in 6/22 (27%) CDR3 sequences from CD8+ T cells
representing ,54 million cells (
95%
CI 24–96610
6
) and the private
‘‘GGSI’’ represented in ,27.2 million cells (
95%
CI 8–72610
6
).
Summary of CDR3 identified in MDV-infected birds or
MDV transformed cell lines
For comparative purposes we have displayed the aa identity of
all over-represented CDR3 sequences identified in this study and
grouped these according to frequency in different T cell subsets
(Figure 9). All cell lines contained monoclonal CDR3 sequences
except for one short-term cultured cell line, which was biclonal.
Within CD4+ T cells derived from tumor sites, fourteen high
frequency CDR3 (.50%) were identified with ten represented at
greater than 70% of the sequences obtained. Of the 21 ‘‘high
frequency’’ CDR3 (established cell lines, ex vivo cultured cells and
tumor sites), these were distributed in Vb1 and Vb2 based CDR3
(13 and 8 respectively). All four Jb segments were represented.
Other CD4+ CDR3 were present at 10 to 30% with a small
number of low frequency (,10%) repeated sequences. Within
positively sorted CD8 or non-CD4 (presumably CD8+) popula-
tions some large clones were detected, most of which represented
private CDR3 but one represented a public CDR3 sequence
detected in multiple birds. Samples of T cells from uninfected birds
were polyclonal (no repeated CDR3) and none of the CDR3 seen
in MDV infected birds was detected (data not shown).
Discussion
Virus driven transformation of lymphoid cells is a major clinical
consequence of infection with persistent infections such as EBV
and HTLV in humans. Progress in understanding these human
diseases is hindered by the lack of suitable model systems. MDV
represents a natural a-herpesvirus of galliform birds capable of
inducing rapid onset of tumors in susceptible birds. Losses caused
by this group of viruses also represent a substantial problem in
their own right; without MDV vaccination the poultry industry
would be unsustainable. Indeed the ability to vaccinate against
MDV tumor formation has implications for control of medically
relevant tumors [1,6]. Within this framework, we addressed the
issue of T cell clonality during infection and tumor formation,
dissecting the tumor, spleen and blood to identify repertoire
changes in the transformed CD4+ cells and the responding CD8+
cells. With MD almost all cell lines and in vivo tumors have been
characterised as CD4+, [9–11,13,14]. In one study using the
intraperitoneal infection route one of twelve cell lines was CD4-
CD8a+ but this lacked expression of CD8b [12]. All of the CD8+
samples in this study were prepared using anti-CD8b to avoid
isolation of non-classical CD8aa T cells. We chose to examine the
Figure 7. The responding CD8
+
T cell repertoire is highly focussed in tumor sites and spleen. Spectratypes of TCR Vb1 and Vb2
transcripts from magnetically sorted CD8+ cells derived from multiple tumor sites of four birds (birds 11–14) are presented. The profiles show skewed
distributions evident in all tumors sites within both Vb1 and Vb2, with some being shared between different tumors within a single host, some of
which are also seen in spleen. These birds were also examined for CD4+ tumor clonality by spectratype (Figure S6) and CDR3 sequence (Figure S7)
which revealed a combination of shared and tumor site-specific clones. The spectratype distributions of samples were compared with the TCRVb1or
TCRVb2 reference profiles from CD8b+ spleen cells obtained from uninfected birds by X
2
analysis; statistical significance is indicated with each panel.
NS = not significant (at p.0.05). Li, liver; Kd, Kidney; Ov, ovary; Spl, spleen.
doi:10.1371/journal.ppat.1001337.g007
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 11 May 2011 | Volume 7 | Issue 5 | e1001337
Page 11
Figure 8. Private and public CDR3-sequences in CD8
+
T cells derived from multiple tumor sites and spleen. CDR3 amino acid
sequences obtained by in silico translation of TCRb CDR3 nucleotide sequences for TCRVb1 and: TCRVb2. Samples derived from bird 11 and bird 12,
magnetically sorted CD8+ cells (.99% pure) from multiple tumor sites and spleen. Each sequence derives from cloned RTPCR product picked from
single transformed colonies of E. coli. Alignments are made with TCRVb and Jb regions, where possible remnants of the Db sequence are also used for
alignment. For simplicity the top sequence (bold) is derived from translation of the genomic conformation of Vb,Db and Jb3. Translation of genomic
sequences of Jb segments are as follows: Jb1, SNMIFGDGTKLTVI; Jb2, NVRLIFGTGTKLTVL; Jb3, NTPLNFGQGTRLTVL; Jb4, YVNIQYFGEGTKVTVL.: The
data reveals clonal structure within CD8+ T cell populations with shared clones between sites and a public TCRVb1 CDR3 sequence shared between
individuals.
doi:10.1371/journal.ppat.1001337.g008
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 12 May 2011 | Volume 7 | Issue 5 | e1001337
Page 12
Vb profiles as a measure of clonality since this receptor is clonally
expressed with a single in-frame sequence present in each clone of
T cells due to the process of allelic exclusion that takes place
during T cell development in the thymus [66–68].
Tumor clonality is a fundamental issue in MD pathogenesis.
The infectious cycle involves transfer of the virus from the lungs to
initiate a cytolytic infection in B cells. This is followed by spread
and lytic cycling infection largely within CD4 TCRab T cell
population, before development of latent infection and transfer of
MDV into the feather follicle epithelium from where the infectious
virus is shed [8]. All infected birds experience a persistent, latent
infection, and susceptible birds develop tumors usually within 4 to
5 weeks. Herein resides the problem; if the transformation event is
rare, how to explain the high penetrance and temporal
reproducibility of the tumor phenotype, unless the ‘‘tumors’’ are
induced as a result of polyclonal transformation. Previous studies
have addressed this issue in relation to the pattern of MDV
genomic integration within the host cell genome [18,19] or by cell
surface staining with CD30 as a tumor associated marker [10].
These two studies reached opposing conclusions, with the
restricted MDV integration profiles used to propose clonal tumors
(with metastasis), contrasted with the high expression of CD30 in
both TCRab families within a single tumor being used to propose
polyclonality. Our studies using TCRVb repertoire analysis
techniques [45] as a viral integration independent clonal ‘‘bar-
code’’ to identify the repertoire of CD4+ TCRab+ T cells in
Figure 9. Summary of CDR3 identified in MDV-infected birds or MDV transformed cell lines. The CDR3 sequences are grouped according
to Vb usage and frequency detected in samples and/or the ability to grow in vitro (L = established cell line; C = new cell line; C* = new cell line from a
small in vivo clone). ** CDR3 sequences detected at frequencies .70% of the sampled sequences. All data extracted from sequences presented in
Figures 1, 2, 4, 7, S1, S3, and S6–S9. For comparison germ-line configuration of Vb—Db—Jb3Cb sequence is given. Translation of genomic sequences
of Jb segments are as follows: Jb1, SNMIFGDGTKLTVI; Jb2, NVRLIFGTGTKLTVL; Jb3, NTPLNFGQGTRLTVL; Jb4, YVNIQYFGEGTKVTVL.: The identity of
each Jb is indicated to the right of each sequence.
doi:10.1371/journal.ppat.1001337.g009
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 13 May 2011 | Volume 7 | Issue 5 | e1001337
Page 13
tumor-derived cell lines and with in vivo derived tumor samples
revealed a characteristic of clonal dominance within an oligoclonal
framework of tumor-capable CD4+ T cells.
All of the established tumor-derived cell lines were monoclonal
(each expressing a single TCRb CDR3 sequence), although one
short-term line developed during the course of these studies was
biclonal at second passage. In contrast the REV-T-transformed
AVOL-1 cell line was oligoclonal after over 37 passages expressing at
least three TCRVb1andoneVb2 TCR CDR3 sequences. The
spectratype profiles obtained with all cell lines were diagnostic in
terms of the clonality of the CDR3 as defined by sequence analysis.
The clonal structure of the cell lines was not influenced by the length
of time in culture which suggests that monoclonality is not an artefact
of in vitro selection as a result of multiple passages. It is therefore likely
that selection for dominant transformed clones had already occurred
in vivo and is retained in MDV cell lines as suggested previously [19].
Furthermore, cell lines generated in this study from fresh tumors
expressed a TCR identity shared with the source tumor in vivo.
Where cell lines were established most (,90%) expressed the Vb1
family of T cell receptors with only one expressing Vb2, a ratio
consistent with the 84% bias previously reported [13].
The profile of most primary tumors was dominated by a single
clone of transformed T cells, although biclonal dominance in
individual tumor sites was not uncommon. However, sequence
analysis revealed smaller secondary clones of expanded CD4+ T
cells in most tumors (,10% of the CDR3 sequences) and the
outgrowth of one of these during ex vivo culture indicates the tumor
potential of sub-dominant CD4+ clones. Some of the very large
clonal populations also failed to establish as tumor cells lines ex vivo,
perhaps indicating a phenotypic variability in transformation state.
Indeed, considering the very large TCR clones (40 to 100% of
CD4+ CDR3 in one site) these were evenly distributed between
TCRVb1 (9 sequences) and TCRVb2 (8 sequences) (Figure 9).
The bias in TCRVb usage within cell lines may represent a
cultivation artefact or reflect the biology of cells expressing
different TCR family members. Nonetheless, the multi-step
analysis of dominant CDR3 in the primary tumor, in sorted
CD4+ cells and after establishment of lymphoblastoid cell lines ex
vivo are important in confirming the capacity of the identified large
clones to express a tumor capability. All four Jb segments were
present in the CDR3 of both TCRVb1 and TCRVb2 expressing
large tumor-like clones or in cultured tumor cell lines.
Our data resolves many of the issues surrounding MD tumor
clonality. Essentially, we demonstrate clonal dominance within
MD tumors (broadly similar to that reported by Delacluse et al.,
[19]) although our integration-site independent analysis using the
T cell receptor CDR3 region revealed a more complex clonal
framework within, and between, tumor sites in vivo. Different
tumor sites within a single individual may be dominated by shared
or distinct clones, hence a single individual may experience
multiple transformation events giving rise to tumors that have very
different characteristics. On most occasions the dominant in vivo
clone present at a particular site was the only clone represented in
ex vivo cultured cell lines grown under tumor culture conditions.
However, on one occasion one of the lower frequency clones
exhibited tumor-like growth patterns ex vivo (alongside the
dominant clone in the original site) indicating that some of the
smaller clones exist in a transformation capable state. The fact that
many individuals harbour both metastatic and single-site tumor
clones indicates a complex interplay between transformation and
clonal competition. Indeed, with most individuals the overall
tumor burden was the result of a small number of independent
transformation events (i.e. more than one but fewer than 3 or 4). In
contrast, with some individuals the multi-site tumors were the
result of metastasis from a single tumor clone. The relationship
between these ‘‘successful’’ tumor clones and the infected cell
population deserves attention.
In a broader context, the monoclonal origin of adult T-cell
leukaemia/lymphoma (ATLL) induced by the human T-lympho-
tropic virus type -1 (HTLV-1) associated malignancy is well
documented [2,69,70]. This profile is probably related to the rarity
of ATLL even among HTLV-1 seropositive individuals [3]
reflecting the acquisition of secondary genomic lesions in
persistently infected T cells. Nonetheless, the rapid onset MD
tumors with clonal dominance in the context of a more complex
framework of oligoclonal expansion may also reflect a circum-
stance common to other tumor associated persistent viruses of
lymphocytes including HTLV-1. Perhaps the main differences
may lie in the vigor of MDV-induced T cell replication leading to
a compressed time-frame compared with other lymphotropic,
tumor associated viruses.
Biological differences were also detected amongst the very large
clonal CD4+ ‘‘tumors’’, with some clones found in multiple sites
including the blood and spleen whereas others were located in a
single site, indicating phenotypic diversity based upon metastatic
capability. The identification of metastatic tumor clones in the
blood allowed serial analysis of blood samples from infected birds to
determine the dynamics of the appearance of the tumor clone, in
relation to the time of infection and onset of clinical signs. The
spectratype analysis of blood samples prior to infection and in the
first 10–14 days revealed a profile consistent with a polyclonal
population of circulating cells. However in some cases, the ‘tumor-
specific’ spectratype signature could be detected in blood 12 to 16
dpi, more than two weeks before appearance of clinical signs. The
appearance of the tumor clone at detectable levels in the blood
supports the proposal of an early transformation event. The level of
tumor clone expansion in the blood compartment at the onset of
clinical disease was extreme, and in some individuals, these were the
only T cell clones detectable (e.g. within TCRVb1 for Bird15 and
17) represented the tumor (Figure 5 and 6). There was also evidence
for disturbance within the polyclonal repertoire in TCRVb2
expressing cells (Figure 6) suggesting that the blood niche for T
cells was being filled by the tumor. Hence, with a circulating TCR
profile dominated by a single clone, it is of little surprise that MDV-
infected birds develop immune deficiency [reviewed in [71]]. These
dramatic repertoire changes would have greater impact than the
reported changes in cytokine production [72] and would be
immunologically catastrophic. Infiltration of the skin with CD4+
T cells is a consequence of MDV infection [73,74] [75] and the high
frequency tumor clones in the blood are likely to represent the
relocation of MDV to the site of transmission.
In mammals, many persistent viral infections including EBV,
CMV and HTLV stimulate highly focussed repertoire expansion in
responding CD8+ T cells [2,76,77]. Although the MDV tumors
were populated by relatively small numbers of CD8+ T cells, their
repertoire was highly structured and oligoclonal in nature. The
CD8+ T cell clone sizes of around 25 to 50 million cells are similar
to those reported during persistent viral infections in humans [78].
However in the case of MD, these are developed over a much
shorter period of time than considered with mammalian infections.
For example, taking a conservative estimate of prolonged T cell
division of 12 hours/division [79] and assuming no cell death
(unlikely), the latest time point for initial stimulation of the CD8+ T
cell would be ,15 days prior to sampling. This calculation would
place the initiation of these clones of specific CD8+ T cells at ,15
DPI, probably earlier, around the time at which latent infection was
initiated. The rapid focussing and clonal expansion of the MDV-
specific repertoire suggests restriction to a small selection of MDV
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 14 May 2011 | Volume 7 | Issue 5 | e1001337
Page 14
antigens. Indeed, Omar and Schat [38] examined the cytolytic
response of infected birds against a panel of cell lines expressing
individual genes from MDV found that in MHC B
19
homozygote
Line P
2a
birds, the cytolytic activity was restricted to meq, gB and
pp38 antigens, while the genetically-resistant line N
2a
(B
21
) birds also
detected the ICP4 antigens. In our studies, tumor-infiltrating CD8+
T cells produce greater levels of IFNc mRNA than CD8+ T cells
derived from the spleen of uninfected birds (unpublished data,
Mwangi, Peroval et al.,). The CD8+ T cell response of susceptible
birds is insufficient to prevent tumor progression; our data provides
a framework for comparisons with resistant or vaccinated birds
which do not develop tumors. Our sequence analysis clearly
detected large CD8+ T cell clones and allowed an approximation of
the clone size, the application of higher throughput sequencing
technologies may be useful in the future to identify smaller clonal
expansions and provide more accurate estimations of clone sizes.
Understanding the nature of the TCR repertoire to specific antigens
after infection and vaccination can be used to improve vaccine
approaches in the future. The rapid nature of focussing within the
CD8+ population may reflect a combination of the minimal MHC
configuration where each haplotype is dominated by presentation
through a single MHC class I gene [80] and the minimal TCRVb
locus with 13 Vb segments in just two families [45].
The high frequency CD8+ T cell clones were found in both
tumor sites and in the spleen of infected individuals, either
restricted to one tumor site or present in multiple tumor sites. One
of the largest CD8+ clones has a CDR3 sequence (‘‘GSS’’) of note,
in that identical sequences were detected in different individuals.
This type of CDR3 is known as a ‘‘public’’ TCR rearrangement
and, although previously reported with mammals, is relatively rare
[81]. Upon closer examination, it was clear that the public GSS
amino acid sequence for the CDR3 also represented shared
nucleotide sequence in different individuals. Interestingly, the GSS
sequence represents retention of a fragment of the D segment,
after deletion of six nucleotides in the D and three nucleotides in
the Vb1 segment. Although not noted previously, it is clear that a
CDR3 constructed by deletion (with no retained nucleotide
addition) is much more likely to occur in multiple individuals than
one generated by addition of nucleotides. We propose that public
CDR3 sequences in other contexts (e.g. in humans) may also
conform to this arrangement, representing a deletion-based
junctional modification. This feature might be useful and
exploitable in diverse scenarios to improve ‘‘public’’ responses to
vaccines. The remaining CDR3 sequences positively identified as
clonal expansions in CD8+ cells (or as not in CD4+ cells) all
represented ‘‘private’’ CDR3 identities (Figure 9).
In this report, we have documented the TCR Vb repertoire
changes associated with infection, tumor development and anti-
tumor response that characterise MDV pathogenesis. Upon
consideration of our data in the context of previous reports, we
propose that the MD tumors are dominated by clonal expansion in
an oligoclonal framework of minor clones of pre-cancerous cells. We
propose that this type of population structure explains the
penetrance and narrow temporal window that characterise MD in
susceptible birds. The CDR3 analysis identified that all established
MDV-transformed cell lines tested were clonal (with one bi-clonal
short term culture), and that these clones represent dominant clones
detected in vivo. Within birds harbouring multiple tumors there was
a mixture of metastatic and site-specific tumor clones. Overall, we
examined 50 tumors derived from 21 individuals, and all tumors
were dominated by one or two clones with some birds harbouring a
single metastatic tumor clone and others with different clones in
different sites. The TCR repertoire analysis system has allowed
examination of diverse areas of MD lymphoma biology and the
CD8+ response against the infection. We consider that this type of
approach can be used to further define MD pathogenesis and the
response generated against infection and/or tumors. These types of
study also have the potential to impact much more broadly,
identifying strategies to vaccinate against or otherwise control viral
driven lymphomas in medical and veterinary fields.
Supporting Information
Figure S1 Monoclonal CDR3 sequences in MDV cell lines.
Amino acid sequence alignment of TCRb CDR3 for each cell line
obtained by in silico translation of TCRb CDR3 nucleotide
sequences derived from 13–15 independent cloned plasmid inserts.
For reference the top sequence (bold) in each alignment represents
an unmodified germline sequence with appropriate Jb. B) The
TCRb CDR3 nucleotide sequences from each cell line. The top
sequence in each alignment (bold) in Vb
1
and Vb
2
is a constructed
germline sequence (Vb-Db-Jb-Cb). The total number of repeats
for each sequence as a fraction of all sequences and Jb identity is
indicated to the right of the sequence.
Found at: doi:10.1371/journal.ppat.1001337.s001 (1.63 MB EPS)
Figure S2 Complex TCRVb
2
CDR3-length profiles in tumors
and sorted CD4+ cells from birds 2 and 3. TCRVb
2
CDR3 length
distribution within samples analysed in Figure 3 (for TCRVb
1
),
unsorted (left column) and CD4+ populations of cells derived from
tumors (middle column). No product was obtained from cultured
cells. Samples derived from liver and kidney of two Line P birds 32
dpi with RB-1B MDV. Although the distribution of spectral peaks
was biased from that observed in unsorted or CD4+ spleen cells
from uninfected birds (X
2
,p,0.001) no TCRVb
2
signal was
represented in the transformed, cultured cells.
Found at: doi:10.1371/journal.ppat.1001337.s002 (0.88 MB EPS)
Figure S3 Oligoclonal CDR3-sequence repertoire of TCRV b
2
in tumors and CD4+ cells from birds 2 and 3. CDR3 amino acid
sequences obtained by in silico translation of TCRVb
2
associated
CDR3 nucleotide sequences. Samples derived from liver and
kidney of two Line P birds 32 dpi with RB-1B MDV and represent
unsorted tumors (left column) and CD4+ populations of cells
derived from tumors (middle column) and cell lines established
from three tumors (right column). Each sequence derives from
cloned RTPCR product picked from single transformed colonies
of E. coli. Alignments are made with TCRVb
2
and Jb regions,
where possible remnants of the Db sequence are also used for
alignment. For simplicity the top sequence (bold) is derived from
translation of the genomic conformation of Vb
2
,Db and Jb
3
.
Translation of genomic sequences of Jb segments are as follows:
Jb
1
, SNMIFGDGTKLTVI; Jb
2
, NVRLIFGTGTKLTVL; Jb
3
,
NTPLNFGQGTRLTVL; Jb
4
, YVNIQYFGEGTKVTVL.: The
data indicates an oligoclonal repertoire and identifies some
TCRVb
2
CDR3 associated with CD4+ T cells and others not
represented in CD4+ cells.
Found at: doi:10.1371/journal.ppat.1001337.s003 (1.98 MB EPS)
Figure S4 Dominant CDR3-lengths are detectable in tumors from
a further seven birds. Spectratype based CDR3-length distribution of
TCR Vb
1
(A) and Vb
2
(B) in liver, kidney, ovary, muscle tumors for
seven birds (B4-10). Spleen and peripheral blood lymphocytes
obtained at post mortem are included. Skewed distributions are
evident in all tumor sites compared with Vb
1
and Vb
2
profiles from
uninfected birds (X
2
,p,0.001). Some peaks are shared between
different tumors within a single host, some of which are also seen in
spleen and PBL. Li, liver; Kd, Kidney; Ov, ovary; Musl, muscle; Spl,
spleen; PBL, peripheral blood lymphocytes.
Found at: doi:10.1371/journal.ppat.1001337.s004 (2.18 MB EPS)
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 15 May 2011 | Volume 7 | Issue 5 | e1001337
Page 15
Figure S5 The spectratype profiles of TCRVb from eight tumor
sites in four birds. TCRVb
1
(left panel) and TCRVb
2
(right panel)
CDR3 length distribution within unsorted and CD4+ populations
of cells derived from tumors and spleen (Birds11–14). Samples from
these birds were used in analysis of CD8+ TCR repertoires
(Figure 7). The data confirms the presence of dominant clones in
CD4+ T cells derived from tumor sites (compared with profiles
obtained from uninfected birds) and that some dominant peaks were
shared between tumor sites (within a single individual) whilst others
were site-specific. The spectratype distributions of samples were
compared with the TCRVb
1
or TCRVb
2
reference profiles from
CD8b+ spleen cells obtained from uninfected birds by X
2
analysis;
statistical significance is indicated with each panel. NS = not
significant (at p.0.05). Li, liver; Kd, Kidney; Ov, ovary; Spl, spleen.
Found at: doi:10.1371/journal.ppat.1001337.s005 (2.37 MB EPS)
Figure S6 TCRVb
1
CDR3-sequence identity from tumor and
spleen samples for bird 11. CDR3 amino acid sequences obtained by
in silico translation of TCRb CDR3 nucleotide sequences, unsorted
tumors (left column) and CD4+ populations of cells (right column)
derived from tumors and spleen. Each sequence derives from cloned
RTPCR product picked from single transformed colonies of E. coli.
Alignments are made with TCRVb and Jb regions, where possible
remnants of the Db sequence are also used for alignment. For
simplicity the top sequence (bold) is derived from translation of the
genomic conformation of Vb,Db and Jb
3
. Translation of genomic
sequences of Jb segments are as follows: Jb
1
, SNMIFGDGTKLTVI;
Jb
2
, NVRLIFGTGTKLTVL; Jb
3
, NTPLNFGQGTRLTVL; Jb
4
,
YVNIQYFGEGTKVTVL.: The data confirms that the dominant
clones in MDV tumors lie within CD4+ cells and that within a single
bird some dominant clones are shared with more than one site while
others were site-specific. Samples from bird 11 were also used in
analysis of CD8+ TCR repertoires (Figure 7).
Found at: doi:10.1371/journal.ppat.1001337.s006 (1.74 MB EPS)
Figure S7 TCRVb
2
CDR3-sequence identity from tumor and
spleen samples for bird 11. CDR3 amino acid sequences obtained by
in silico translation of TCRb CDR3 nucleotide sequences, unsorted
tumors (left column) and CD4+ populations of cells (right column)
derived from tumors and spleen. Each sequence derives from cloned
RTPCR product picked from single transformed colonies of E. coli.
Alignments are made with TCRVb and Jb regions, where possible
remnants of the Db sequence are also used for alignment. For
simplicity the top sequence (bold) is derived from translation of the
genomic conformation of Vb,Db and Jb
3
. Translation of genomic
sequences of Jb segments are as follows: Jb
1
, SNMIFGDGTKLTVI;
Jb
2
, NVRLIFGTGTKLTVL; Jb
3
, NTPLNFGQGTRLTVL; Jb
4
,
YVNIQYFGEGTKVTVL.: The data confirms that the dominant
clones in MDV tumors lie within CD4+ cells and that within a single
bird some dominant clones are shared with more than one site while
others were site-specific. Samples from bird 11 were also used in
analysis of CD8+ TCR repertoires (Figure 7).
Found at: doi:10.1371/journal.ppat.1001337.s007 (1.64 MB EPS)
Figure S8 TCRVb
1
CDR3-sequence identity from tumor and
spleen samples for bird 12.CDR3 amino acid sequences obtained
by in silico translation of TCRb CDR3 nucleotide sequences,
unsorted tumors (left column) and CD4+ populations of cells (right
column) derived from tumors and spleen. Each sequence derives
from cloned RTPCR product picked from single transformed
colonies of E. coli. Alignments are made with TCRVb and Jb
regions, where possible remnants of the Db sequence are also used
for alignment. For simplicity the top sequence (bold) is derived
from translation of the genomic conformation of Vb,Db and Jb
3
.
Translation of genomic sequences of Jb segments are as follows:
Jb
1
, SNMIFGDGTKLTVI; Jb
2
, NVRLIFGTGTKLTVL; Jb
3
,
NTPLNFGQGTRLTVL; Jb
4
, YVNIQYFGEGTKVTVL.: The
data confirms that the dominant clones in MDV tumors lie within
CD4+ cells and that within a single bird some dominant clones are
shared with more than one site while others were site-specific.
Samples from bird 12 were also used in analysis of CD8+ TCR
repertoires (Figure 7).
Found at: doi:10.1371/journal.ppat.1001337.s008 (1.64 MB EPS)
Figure S9 TCRVb
2
CDR3-sequence identity from tumor and
spleen samples for bird 12. CDR3 amino acid sequences obtained by
in silico translation of TCRb CDR3 nucleotide sequences, unsorted
tumors (left column) and CD4+ populations of cells (right column)
derived from tumors and spleen. Each sequence derives from cloned
RTPCR product picked from single transformed colonies of E. coli.
Alignments are made with TCRVb and Jb regions, where possible
remnants of the Db sequence are also used for alignment. For
simplicity the top sequence (bold) is derived from translation of the
genomic conformation of Vb,Db and Jb
3
. Translation of genomic
sequences of Jb segments are as follows: Jb
1
, SNMIFGDGTKLTVI;
Jb
2
, NVRLIFGTGTKLTVL; Jb
3
,NTPLNFGQGTRLTVL;Jb
4
,
YVNIQYFGEGTKVTVL.: The data confirms that the dominant
clones in MDV tumors lie within CD4+ cells and that within a single
bird some dominant clones are shared with more than one site while
others were site-specific. Samples from bird 12 were also used in
analysis of CD8+ TCR repertoires (Figure 7).
Found at: doi:10.1371/journal.ppat.1001337.s009 (1.70 MB EPS)
Acknowledgments
The authors wish to thank various colleagues for their contributions to
discussion of this data including Prof Jim Kaufman (University of
Cambridge), Dr John Young and Dr Colin Butter (IAH) as well as present
and former members of the Viral Oncogenesis Group and Enteric
Immunology Group at the Institute for Animal Health. We also wish to
acknowledge Dr Oliver Pybus (Oxford) for valuable guidance with
statistical analyses and the practical assistance provided by Miss Hazel
Murray (Oxford) and Dr Marylene Peroval (IAH) during the course of
these experiments.
Author Contributions
Conceived and designed the experiments: WNM VN ALS. Performed the
experiments: WNM LPS SJB. Analyzed the data: WNM LPS SJB VN
ALS. Contributed reagents/materials/analysis tools: LPS SJB RKB VN
ALS. Wrote the paper: WNM VN ALS. Codeveloped the avian repertoire
analysis system: WNM RKB ALS.
References
1. Epstein MA (2001) Historical background. Philos Trans R Soc Lond B Biol Sci
356: 413–420.
2. Young LS, Rickinson AB (2004) Epstein-Barr virus: 40 years on. Nat Rev
Cancer 4: 757–768.
3. Ishitsuka K, Tamura K (2008) Treatment of adult T-cell leukemia/lymphoma:
past, present, and future. Eur J Haematol 80: 185–196.
4. Morrow CaFF (2004) Marek’s disease:a worldwide problem. In: Davison TF,
Nair V, eds . Marek’s disease An evolving Problem. London: Elsevier Academic
Press. pp 49–61.
5. Burgess SC, Young JR, Baaten BJ, Hunt L, Ross LN, et al. (2004) Marek’s
disease is a natural model for lymphomas overexpressing Hodgkin’s disease
antigen (CD30). Proc Natl Acad Sci U S A 101: 13879–13884.
6. Schat KA (1987) Marek’s disease: a model for protection against herpesvirus-
induced tumours. Cancer Surv 6: 1–37.
7. Weiss RA (1998) The oncologist’s debt to the chicken. Avian Pathology 27:
S8–S15.
8. Calnek BW (1986) Marek’s disease–a model for herpesvirus oncology. Crit Rev
Microbiol 12: 293–320.
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 16 May 2011 | Volume 7 | Issue 5 | e1001337
Page 16
9. Burgess SC, Basaran BH, Davison TF (2001) Resistance to Marek’s disease
herpesvirus-induced lymphoma is multiphasic and dependent on host genotype.
Vet Pathol 38: 129–142.
10. Burgess SC, Davison TF (2002) Identification of the neoplastically transformed
cells in Marek’s disease herpesvirus-induced lymphomas: recognition by the
monoclonal antibody AV37. J Virol 76: 7276–7292.
11. Nazerian K, Sharma JM (1975) Detection of T-cell surface antigens in a Marek’s
disease lymphoblastoid cell line. J Natl Cancer Inst 54: 277–279.
12. Parcells MS, Dienglewicz RL, Anderson AS, Morgan RW (1999) Recombinant
Marek’s disease virus (MDV)-derived lymphoblastoid cell lines: regulation of a
marker gene within the context of the MDV genome. J Virol 73: 1362–1373.
13. Schat KA, Chen CL, Calnek BW, Char D (1991) Transformation of T-
lymphocyte subsets by Marek’s disease herpesvirus. J Virol 65: 1408–1413.
14. Schat KA, Chen CL, Shek WR, Calnek BW (1982) Surface antigens on Marek’s
disease lymphoblastoid tumor cell lines. J Natl Cancer Inst 69: 715–720.
15. Brown AC, Baigent SJ, Smith LP, Chattoo JP, Petherbridge LJ, et al. (2006)
Interaction of MEQ protein and C-terminal-binding protein is critical for
induction of lymphomas by Marek’s disease virus. Proc Natl Acad Sci U S A
103: 1687–1692.
16. Ross N, O’Sullivan G, Rothwell C, Smith G, Burgess SC, et al. (1997) Marek’s
disease virus EcoRI-Q gene (meq) and a small RNA antisense to ICP4 are
abundantly expressed in CD4+ cells and cells carrying a novel lymphoid marker,
AV37, in Marek’s disease lymphomas. J Gen Virol 78(Pt 9): 2191–2198.
17. Xie Q , Anderson AS, Morgan RW (1996) Marek’s disease virus (MDV) ICP4,
pp38, and meq genes are involved in the maintenance of transformation of
MDCC-MSB1 MDV-transformed lymphoblastoid cells. J Virol 70: 1125–1131.
18. Delecluse HJ, Hammerschmidt W (1993) Status of Marek’s disease virus in
established lymphoma cell lines: herpesvirus integration is common. J Virol 67:
82–92.
19. Delecluse HJ, Schuller S, Hammerschmidt W (1993) Latent Marek’s disease
virus can be activated from its chromosomally integrated state in herpesvirus-
transformed lymphoma cells. EMBO J 12: 3277–3286.
20. Bublot MaSJ (2004) Vaccination against Marek’s disease. In: Davison TF,
Nair V, eds . Marek’s disease An evolving Problem. London: Elsevier Academic
Press. pp 168–182.
21. Davison F, Nair V (2005) Use of Marek’s disease vaccines: could they be driving
the virus to increasing virulence? Expert Rev Vaccines 4: 77–88.
22. Witter RL (1998) Control strategies for Marek’s disease: a perspective for the
future. Poult Sci 77: 1197–1203.
23. Morimura T, Ohashi K, Sugimoto C, Onuma M (1998) Pathogenesis of Marek’s
disease (MD) and possible mechanisms of immunity induced by MD vaccine.
J Vet Med Sci 60: 1–8.
24. Wu C, Gan J, Jin Q, Chen C, Liang P, et al. (2009) Revaccination with Marek’s
disease vaccines induces productive infection and superior immunity. Clin
Vaccine Immunol 16: 184–193.
25. Bacon LD, Crittenden LB, Witter RL, Fadly A, Motta J (1983) B5 and B15
associated with progressive Marek’s disease, Rous sarcoma, and avian leukosis
virus-induced tumors in inbred 15I4 chickens. Poult Sci 62: 573–578.
26. Bacon LD, Witter RL (1993) Influence of B-haplotype on the relative efficacy of
Marek’s disease vaccines of different serotypes. Avian Dis 37: 53–59.
27. Bacon LD, Witter RL (1994) B haplotype influence on the relative efficacy of
Marek’s disease vaccines in commercial chickens. Poult Sci 73: 481–487.
28. Bacon LD, Witter RL, Crittenden LB, Fadly A, Motta J (1981) B-haplotype
influence on Marek’s disease, Rous sarcoma, and lymphoid leukosis virus-
induced tumors in chickens. Poult Sci 60: 1132–1139.
29. Briles WE, Briles RW, Taffs RE, Stone HA (1983) Resistance to a malignant
lymphoma in chickens is mapped to subregion of major histocompatibility (B)
complex. Science 219: 977–979.
30. Buscaglia C, Calnek BW (1988) Maintenance of Marek’s disease herpesvirus
latency in vitro by a factor found in conditioned medium. J Gen Virol 69(Pt 11):
2809–2818.
31. Kaiser P, Underwood G, Davison F (2003) Differential cytokine responses
following Marek’s disease virus infectio n of chickens differing in resistance to
Marek’s disease. J Virol 77: 762–768.
32. Levy AM, Heller ED, Leitner G, Davidson I (1999) Effect of native chicken
interferon on MDV replication. Acta Virol 43: 121–127.
33. Volpini LM, Calnek BW, Sekellick MJ, Marcus PI (1995) Stages of Marek’s
disease virus latency defined by variable sensitivity to interferon modulation of
viral antigen expression. Vet Microbiol 47: 99–109.
34. Xing Z, Schat KA (2000) Expression of cytokine genes in Marek’s disease virus-
infected chickens and chicken embryo fibroblast cultures. Immunology 100:
70–76.
35. Schat KA (1991) Importance of cell-mediated immunity in Marek’s disease and
other viral tumor diseases. Poult Sci 70: 1165–1175.
36. Schat KA, Markowski-Grimsrud CJ (2001) Immune responses to Marek’s
disease virus infection. Curr Top Microbiol Immunol 255: 91–120.
37. Markowski-Grimsrud CJ, Schat KA (2002) Cytotoxic T lymphocyte responses to
Marek’s disease herpesvirus-encoded glycoproteins. Vet Immunol Immuno-
pathol 90: 133–144.
38. Omar AR, Schat KA (1996) Syngeneic Marek’s disease virus (MDV)-specific
cell-mediated immune responses against immediate early, late, and unique
MDV proteins. Virology 222: 87–99.
39. Omar AR, Schat KA (1997) Characteriza tion of Marek’s disease herpesvirus-
specific cytotoxic T lymphocytes in chickens inoculated with a non-oncogenic
vaccine strain of MDV. Immunology 90: 579–585.
40. Morimura T, Cho KO, Kudo Y, Hiramoto Y, Ohashi K, et al. (1999) Anti-viral
and anti-tumor effects induced by an attenuated Marek’s disease virus in CD4-
or CD8-deficient chickens. Arch Virol 144: 1809–1818.
41. Day EK, Carmichael AJ, ten Berge IJ, Waller EC, Sissons JG, et al. (200 7)
Rapid CD8+ T cell repertoire focusing and selection of high-affinity clones into
memory following primary infection with a persistent human virus: human
cytomegalovirus. J Immunol 179: 3203–3213.
42. Sacre K, Carcelain G, Cassoux N, Fillet AM, Costagliola D, et al. (2005)
Repertoire, diversity, and differentiation of specific CD8 T cells are associated
with immune protection against human cytomegalovirus disease. J Exp Med
201: 1999–2010.
43. Callan MF, Tan L, Annels N, Ogg GS, Wilson JD, et al. (1998) Direct
visualization of antigen-specific CD8+ T cells during the primary immune
response to Epstein-Barr virus In vivo. J Exp Med 187: 1395–1402.
44. Hislop AD, Ressing ME, van Leeuwen D, Pudney VA, Horst D, et al. (2007) A
CD8+
T cell immune evasion protein specific to Epstein-Barr virus and its close
relatives in Old World primates. J Exp Med 204: 1863–1873.
45. Mwangi WN, Beal RK, Powers C, Wu X, Humphrey T, et al. (2010) Regional
and global changes in TCRalphabeta T cell repertoires in the gut are dependent
upon the complexity of the enteric microflora. Dev Comp Immunol 34:
406–417.
46. Cooper MD, Chen CL, Bucy RP, Thompson CB (1991) Avian T cell ontogeny.
Adv Immunol 50: 87–117.
47. McCormack WT, Tjoelker LW, Stella G, Postema CE, Thompson CB (1991)
Chicken T-cell receptor beta-chain diversity: an evolutionarily conserved D
beta-encoded glycine turn within the hypervariable CDR3 domain. Proc Natl
Acad Sci U S A 88: 7699–7703.
48. Shigeta A, Sato M, Kawashima T, Horiuchi H, Matsuda H, et al. (2004)
Genomic organization of the chicken T-cell receptor beta chain D-J-C region.
J Vet Med Sci 66: 1509–1515.
49. Tjoelker LW, Carlson LM, Lee K, Lahti J, McCormack WT, et al. (1990)
Evolutionary conservation of antigen recognition: the chicken T-cell receptor
beta chain. Proc Natl Acad Sci U S A 87: 7856–7860.
50. Schat KA, Calnek BW, Fabricant J (1982) Characterisation of two highly
oncogenic strains of Marek’s disease virus. Avian Pathol 11: 593–605.
51. Petherbridge L, Brown AC, Baigent SJ, Howes K, Sacco MA, et al. (2004)
Oncogenicity of virulent Marek’s disease virus cloned as bacterial artificial
chromosomes. J Virol 78: 13376–13380.
52. Petherbridge L, Howes K, Baigent SJ, Sacco MA, Evans S, et al. (2003)
Replication-competent bacterial artificial chromosomes of Marek’s disease virus:
novel tools for generation of molecularly defined herpesvirus vaccines. J Virol
77: 8712–8718.
53. Chan MM, Chen CL, Ager LL, Cooper MD (1988) Identification of the avian
homologues of mammalian CD4 and CD8 antigens. J Immunol 140:
2133–2138.
54. Akiyama Y, Kato S (1974) Scanning electron microscopy of lymphoid cell lines
and lymphocytes from thymus, bursa and blood of chickens. Biken J 17:
193–197.
55. Nazerian K, Witter RL (1975) Properties of a chicken lymphoblastoid cell line
from Marek’s disease tumor. J Natl Cancer Inst 54: 453–458.
56. Payne LN, Howes K, Rennie M, Bumstead JM, Kidd AW (1981) Use of an agar
culture technique for establishing lymphoid cell lines from Marek’s disease
lymphomas. Int J Cancer 28: 757–766.
57. Nazerian K, Steph ens EA, Sharma JM, Lee LF, Gailitis M, et al. (1977) A
nonproducer T lymph oblastoid cell line from Marek’s disease transplantable
tumor (JMV). Avian Dis 21: 69–76.
58. Yao Y, Zhao Y, Smith LP, Lawrie CH, Saunders NJ, et al. (2009) Differential
expression of microRNAs in Marek’s disease virus-transformed T-lymphoma cell
lines. J Gen Virol 90: 1551–1559.
59. Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, et al. (2008) MicroRNA profile of
Marek’s disease virus-transformed T-cell line MSB-1: predominance of virus-
encoded microRNAs. J Virol 82: 4007–4015.
60. Dunon D, Schwager J, Dangy JP, Cooper MD, Imhof BA (1994) T cell
migration during development: homing is not related to TCR V beta 1
repertoire selection. EMBO J 13: 808–815.
61. Agresti A, Coull B (1998) Approximate is better than ’exact’ for interval
estimation of binomial proportions. Am Stat 52: 119–126.
62. Nazerian K (1987) An updated list of avian cell lines and transplantable tumours.
Avian Pathol 16: 527–544.
63. Parvizi P, Read LR, Abdul-Careem MF, Sarson AJ, Lusty C, et al. (2009)
Cytokine gene expression in splenic CD4+ and CD8+ T cell subsets of
genetically resistant and susceptible chickens infected with Marek’s disease virus.
Vet Immunol Immunopathol 132: 209–217.
64. Callan MF, Annels N, Steven N, Tan L, Wilson J, et al. (1998) T cell selection
during the evolution of CD8+ T cell memory in vivo. Eur J Immunol 28:
4382–4390.
65. Hislop AD, Taylor GS, Sauce D, Rickinson AB (2007) Cellular responses to viral
infection in humans: lessons from Epstein-Barr virus. Annu Rev Immunol 25:
587–617.
66. Collette A, Cazenave PA, Pied S, Six A (2003) New methods and software tools
for high throughput CDR3 spectratyping. Application to T lymphocyte
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 17 May 2011 | Volume 7 | Issue 5 | e1001337
Page 17
repertoire modifications during experimental malaria. J Immunol Methods 278:
105–116.
67. Kedzierska K, La Gruta NL, Stambas J, Turner SJ, Doherty PC (2008) Tracking
phenotypically and functionally distinct T cell subsets via T cell repertoire
diversity. Mol Immunol 45: 607–618.
68. Long SA, Khalili J, Ashe J, Berenson R, Ferrand C, et al. (2006) Standardized
analysis for the quantification of Vbeta CDR3 T-cell receptor diversity.
J Immunol Methods 317: 100–113.
69. Ohshima K, Suzumiya J, Kato A, Tashiro K, Kikuchi M (1997) Clonal HTLV-
I-infected CD4+ T-lymphocytes and non-clonal non-HTLV-I-infected giant
cells in incipient ATLL with Hodgkin-like histologic features. Int J Cancer 72:
592–598.
70. Okayama A, Stuver S, Matsuoka M, Ishizaki J, Tanaka G, et al. (2004) Role of
HTLV-1 proviral DNA load and clonality in the development of adult T-cell
leukemia/lymphoma in asymptomatic carriers. Int J Cancer 110: 621–625.
71. Parcells MS, Burgess SC (2008) Immunolgical Aspects of Marek’s Disease Virus
(MDV)-Induced Lymphoma Progression. Selected Aspects of Cancer Progres-
sion: Metastasis, Apoptosis, and Immune Response. pp 169–191.
72. Parvizi P, Read L, Abdul-Careem MF, Lusty C, Sharif S (2009) Cytokine gene
expression in splenic CD4(+) and CD8(+) T-cell subsets of chickens infected with
Marek’s disease virus. Viral Immunol 22: 31–38.
73. Abdul-Careem MF, Hunter DB, Lambourne MD, Read LR, Parvizi P, et al.
(2008) Expression of cytokine genes following pre- and post-hatch immunization
of chickens with herpesvirus of turkeys. Vaccine 26: 2369–2377.
74. Abdul-Careem MF, Hunter DB, Shanmuganathan S, Haghighi HR, Read L,
et al. (2008) Cellular and cytokine responses in feathers of chickens vaccinated
against Marek’s disease. Vet Immunol Immunopathol 126: 362–366.
75. Abdul-Careem MF, Hunter BD, Sarson AJ, Parvizi P, Haghighi HR, et al.
(2008) Host responses are induced in feathers of chickens infected wit h Marek’s
disease virus. Virology 370: 323–332.
76. Kattan T, MacNamara A, Rowan AG, Nose H, Mosley AJ, et al. (2009) The
avidity and lytic efficiency of the CTL response to HTLV-1. J Immunol 182:
5723–5729.
77. Moss P, Khan N (2004) CD8(+) T-cell immunity to cytomegalovirus. Hum
Immunol 65: 456–464.
78. Beverley PC (2004) Kinetics and clonality of immunological memory in humans.
Semin Immunol 16: 315–321.
79. van Stipdonk MJ, Lemmens EE, Schoenberger SP (2001) Naive CTLs require a
single brief period of antigenic stimulation for clonal expansion and
differentiation. Nat Immunol 2: 423–429.
80. Kaufman J, Milne S, Gobel TW, Walker BA, Jacob JP, et al. (1999) The chicken
B locus is a minimal essential major histocompatibility complex. Nature 401:
923–925.
81. Venturi V, Price DA, Douek DC, Davenport MP (2008) The molecular basis for
public T-cell responses? Nat Rev Immunol 8: 231–238.
TCR Repertoire Analysis during Infection with MDV
PLoS Pathogens | www.plospathogens.org 18 May 2011 | Volume 7 | Issue 5 | e1001337
Page 18
  • Source
    • "The result was mixed; a majority of tumors exhibited profiles indicating monoclonal tumor origins, yet in other cases polyclonal tumors were detected (Robinson et al., 2010). By another method, T lymphocyte spectratyping of MD lymphomas, limited clonality was indicated (Mwangi et al., 2011). MD is well known to be a highly individualistic disease with a great degree of inter-individual variation; thus, these results are not entirely surprising for a virally-induced cancerous condition. "
    [Show abstract] [Hide abstract] ABSTRACT: Marek's Disease Virus (MDV) is a chicken alphaherpesvirus that causes paralysis, chronic wasting, blindness, and fatal lymphoma development in infected, susceptible host birds. This disease and its protective vaccines are highly relevant research targets, given their enormous impact within the poultry industry. Further, Marek's disease (MD) serves as a valuable model for the investigation of oncogenic viruses and herpesvirus patterns of viral latency and persistence—as pertinent to human health as to poultry health. The objectives of this article are to review MDV interactions with its host from a variety of genomic, molecular, and cellular perspectives. In particular, we focus on cytogenetic studies, which precisely assess the physical status of the MDV genome in the context of the chicken host genome. Combined, the cytogenetic and genomic research indicates that MDV-host genome interactions, specifically integration of the virus into the host telomeres, is a key feature of the virus life cycle, contributing to the viral achievement of latency, transformation, and reactivation of lytic replication. We present a model that outlines the variety of virus-host interactions, at the multiple levels, and with regard to the disease states.
    Full-text · Article · Jan 2016 · Poultry Science
  • Source
    • "We propose that this breadth of antigen presentation leads to a breadth of T cell response that is the basis of MHC-determined resistance to Marek's disease. Conversely, a narrow T cell response to Marek's disease would be the basis for MHC-determined susceptibility, and there is already evidence for a limited repertoire of CD8 T cell clones infiltrating tumours in susceptible B19 chickens (Mwangi et al., 2011). Parenthetically, if true this model suggests that the narrowing of CD8 T cell clonality characteristic of responses in humans and mice (Yewdell and Bennink, 1999; Yewdell and Del Val, 2004; Akram and Inman, 2012) may not be a feature of responses involving promiscuous class I molecules in chickens. "
    [Show abstract] [Hide abstract] ABSTRACT: Highly polymorphic MHC molecules are at the heart of adaptive immune responses, playing crucial roles in many kinds of disease and in vaccination. We report that breadth of peptide presentation and level of cell surface expression of class I molecules are inversely correlated in both chickens and humans. This relationship correlates with protective responses against infectious pathogens including Marek's disease virus leading to lethal tumours in chickens and HIV infection progressing to AIDS in humans. We propose that differences in peptide binding repertoire define two groups of MHC class I molecules strategically evolved as generalists and specialists for different modes of pathogen resistance. We suggest that differences in cell surface expression level ensure the development of optimal peripheral T cell responses. The inverse relationship of peptide repertoire and expression is evidently a fundamental property of MHC molecules, with ramifications extending beyond immunology and medicine to evolutionary biology and conservation.
    Full-text · Article · Apr 2015 · eLife Sciences
  • Source
    • "In addition, a rapid amplification of the 60-bp repeat obtained with the clonal BAC occurred, generating a pattern of two to nine repeats after as few as three serial passages in CEFs following transfection with BAC DNA (Fig. 4), consistent with the rapid variations observed in nucleotide stretches [43]. We again observed a pattern in the number of 60-bp repeats in PBLs from chickens infected with BACRB-1B, with variability until day 21 pi, followed by selection at 35 days pi (Fig. 4), probably reflecting an evolutionary bottleneck phenomenon at the time of lymphomagenesis, consistent with a clonal origin of MD lymphomas444546. The rapid amplification of the 60-bp repeat obtained with the clonal BAC strongly suggests that recombination events commonly occurring during replication of the DNA of viruses of the family Herpesviridae [47, 48] may be involved in generating the genetic diversity of the 5 0 LAT region in GaHV-2 strains. "
    [Show abstract] [Hide abstract] ABSTRACT: Gallid herpesvirus 2 (GaHV-2) is the alphaherpesvirus responsible for Marek's disease (MD), a T-cell lymphoma of chickens. The virulence of the GaHV-2 field strain is steadily increasing, but MD is still controlled by the CVI988/Rispens vaccine. We tried to determine distinguishing traits of the CVI988/Rispens vaccine by focusing on the 5' end region of the latency-associated transcript (5'LAT). It includes a variable number of 60-bp tandem repeats depending on the GaHV-2 strain. By analyzing six batches of vaccine, we showed that CVI988/Rispens consisted of a population of 5'LAT molecular subtypes, all with deletions and lacking 60-bp tandem repeat motifs, with two major subtypes that probably constitute CVI988/Rispens markers. Serial passages in cell culture led to a substantial change in the frequency of CVI988/Rispens 5'LAT subtypes, with non-deleted subtypes harboring up to four 60-bp repeats emerging during the last few passages. Dynamic changes in the distribution of 5'LAT-deleted subtypes were also detected after infection of chickens. By contrast, the 5'LAT region of the oncogenic clonal RB-1B strain, which was investigated at every step from the isolation of the clonal bacmid RB-1B DNA to the isolation of the ovarian lymphoma cell line, consisted of non-deleted 5'LAT subtypes harboring at least two 60-bp repeats. Thus, vaccine and oncogenic GaHV-2 strains consist of specific populations of viral genomes that are constantly evolving in vivo and in vitro and providing potential markers for epidemiological surveys.
    Full-text · Article · Oct 2014 · Archives of Virology
Show more