ArticlePDF Available

Isolation and characterization of 13 polymorphic nuclear microsatellite primers for the widespread Indo-Pacific three-spot damselfish, Dascyllus trimaculatus, and closely related D-auripinnis

Authors:
Matthieu Leray at Smithsonian Tropical Research Institute
Matthieu Leray
Ricardo Beldade at Pontificia Universidad Católica de Chile
Ricardo Beldade
Sally J Holbrook
Sally J Holbrook
Sally J Holbrook
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Russell J Schmitt at University of California, Santa Barbara
Russell J Schmitt
Show all 6 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract

A set of 13 simple sequence repeat markers was developed from D. trimaculatus genomic DNA, tested for D. auripinnis and characterized using 40 individuals per species. All the loci were polymorphic with a number of alleles ranging from three to 30. Observed heterozygosities varied from 0.23 to 0.89 for D. trimaculatus and from 0.11 to 0.85 for D. auripinnis. Early results show that these will be powerful markers for the study of ecological and evolutionary mechanism in this coral reef fish species complex.
Content uploaded by Matthieu Leray
Author content
All content in this area was uploaded by Matthieu Leray on May 20, 2019
Content may be subject to copyright.
Molecular Ecology Resources (2009) 9, 213–215 doi: 10.1111/j.1755-0998.2008.02380.x
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Blackwell Publishing Ltd
PERMANENT GENETIC RESOURCES
Isolation and characterization of 13 polymorphic nuclear
microsatellite primers for the widespread Indo-Pacific three-
spot damselfish, Dascyllus trimaculatus, and closely related
D. auripinnis
MATTHIEU LERAY*†, RICARDO BELDADE*, SALLY J. HOLBROOK‡, RUSSELL J. SCHMITT‡,
SERGE PLANES† and GIACOMO BERNARDI*
*Department of Ecology and Evolutionary Biology, University of California Santa Cruz, 100 Shaffer Road, Santa Cruz, CA 95060, USA,
†UMR 5244, CNRS-EPHE-UPVD, Centre de Biologie et d’Ecologie Tropicale et Méditerranéenne, Université de Perpignan, 66860
Perpignan Cedex, France, ‡Coastal Research Center, Marine Science Institute, and Department of Ecology, Evolution, and Marine
Biology, University of California Santa Barbara, Santa Barbara, CA 93106, USA
Abstract
A set of 13 simple sequence repeat markers was developed from D. trimaculatus genomic
DNA, tested for D. auripinnis and characterized using 40 individuals per species. All the
loci were polymorphic with a number of alleles ranging from three to 30. Observed heter-
ozygosities varied from 0.23 to 0.89 for D. trimaculatus and from 0.11 to 0.85 for D. auripinnis.
Early results show that these will be powerful markers for the study of ecological and
evolutionary mechanism in this coral reef fish species complex.
Keywords:Dascyllus auripinnis, Dascyllus trimaculatus, microsatellites, speciation
Received 31 July 2008; revision accepted 22 August 2008
The damselfish genus Dascyllus comprises 10 species
divided in three complexes (Godwin 1995; Bernardi & Crane
1999; McCafferty et al. 2002). One of them, the trimaculatus
complex (Bernardi et al. 2002), comprises four described
species, namely: D. trimaculatus, D. albisella, D. strasburgi,
and the recently described D. auripinnis (Randall & Randall
2001). In this study, we isolated 13 microsatellites from D.
trimaculatus, and tested cross-amplification in the closely
related D. auripinnis. Both species are reef-associated and
occur in parapatry in the central Pacific (Randall & Randall
2001). D. trimaculatus is widely distributed from the coast
of Eastern Africa and Red Sea to the Central Pacific,
whereas D. auripinnis is restricted to the Line and Phoenix
islands. Nuclear microsatellite markers are powerful
genetic markers because of their high level of variability
(Zane et al. 2002). In this note, we describe 13 highly
polymorphic microsatellite loci that cross-amplified D.
trimaculatus and D. auripinnis, thus providing valuable
tools to address questions of population structure, ecological
inferences, and connectivity.
Fin tissues were collected from fish sampled by hand net
or spear, and were stored in 90% ethanol. Genomic libraries
enriched for microsatellite motifs were constructed by
Genetic Identification Services (GIS, http://www.genetic-
id-services.com). Libraries were built using a sample
containing100 μg of genomic DNA extracted from muscle
tissue from one individual D. trimaculatus following a
standard phenol–chloroform procedure (Sambrook et al.
1989). Libraries were enriched for CA, CATC, TACA, and
TAGA motifs. GIS sequenced 70 microsatellite-containing
clones using universal M-13 primers.
We tested 13 of these microsatellites, which were deter-
mined to have flanking sequences of length sufficient for
primer design using Designer PCR version 1.03 (Research
Genetics, Inc.). The reaction volumes for the polymerase
chain reaction (PCR) was 13 μL containing: 12.25 μL of 1.1
PCR Mastermix (Thermo Scientific), 0.625 μL of both
20 mm primers forward and reverse and approximately
2 ng of DNA template. Using a fluorescently labelled
forward primer and an unlabelled reverse primer (Table 1),
Correspondence: Giacomo Bernardi, Fax: +1 831 459 33 83;
E-mail: bernardi@biology.ucsc.edu
214 PERMANENT GENETIC RESOURCES
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
35 PCR cycles were run in an Applied Biosystems Gene-
Amp PCR 9700 system, at denaturation and extension
temperatures of 94 and 72 °C, respectively. Annealing
temperatures are described in Table 1. The time of each
stage was 30 s for denaturation, 40 s for annealing and 30 s
for extension.
Forty individuals per species were scored using GeneM-
apper 3.7 (Applied Biosystems). Calculation of expected
and observed heterozygosity values as well as test of
linkage disequilibrium and deviation from Hardy–
Weinberg (HW) equilibrium were performed using Arlequin
(Excoffier et al. 2005). Results are summarized in Table 1.
All loci amplified and were polymorphic for both species
with a number of alleles ranging from three to 22. No
evidence of linkage disequilibrium was found. Expected
heterozygosity values ranged from 0.22 to 0.94 and from
0.35 to 92 for D. trimaculatus and D. auripinnis, respectively.
For D. trimaculatus, three loci displayed a significant
heterozygote deficit (A114, A103, C12) and for D. auripinnis,
four loci deviated from HW equilibrium (A101, A120,
B103, C12). Only one locus (C12) deviated from HW equi-
librium in both species. Hardy–Weinberg disequilibrium
can be driven by population substructure, inbreeding
or technical cause. Micro–Checker (Van Oosterhout et al.
2006) analysis suggested that the presence of null alleles
may explain the observed heterozygote deficit. However,
because strong population structure across the distribution
range of both species was previously described based on
mitochondrial DNA sequences (Bernardi et al. 2002), a
Wahlund effect may be causing that deficit. Our results
therefore indicate that this new set of microsatellite markers
will prove useful in parentage, population structure, and
connectivity analyses.
Acknowledgements
This research was supported by grant OCE 04–17412 from the
National Science Foundation and gifts from the Gordon and Betty
Moore Foundation. This is a contribution of the Moorea Coral Reef
(MCR) LTER site.
Tabl e 1 Characterization of microsatellite loci isolated from Dascyllus trimaculatus. Columns correspond to: microsatellite name (Locus), (F)
forward and (R) reverse primer sequence, optimal annealing temperature (Ta), repeat motif (Repeat), and amplification size of original clone
(Amp.). The next two sets of three columns pertain to D. trimaculatus and D. auripinnis, respectively. They correspond to: number of alleles
per locus (Na), amplifications range (Range size), and (HO) observed and (HE) expected heterozygosities. Asterisks (*) indicate loci departing
from Hardy–Weinberg equilibrium. GenBank Accession nos are EU781542 to EU781554.
Locus Primer (5′– 3′)Ta (°C) Repeat Amp.
D. trimaculatus D. auripinnis
Na
Range
size (bp) HO (HE)Na
Range
size (bp) HO (HE)
DTR_A7 F: AAGTGCTGAATAAGAGATGAGG 57.0 (CA)11 246 6 238–245 0.49 (0.55) 4 237–245 0.64 (0.65)
R: CTCCTGTTACCTGTTTTGTTCT
DTR_A101 F: CTGGGTTGTGGTTCAACATTAG 56.8 (CA)27 150 17 113–187 0.67 (0.73) 22 113–179 0.72* (0.92)
R: ATAGGGTTGCTCCTCTGAAGAC
DTR_A103 F: GCTTACTGTAGCAAAGCACATG 57.3 (CA)14 199 21 193–247 0.78* (0.81) 22 195–237 0.85 (0.87)
R: ATCCTTACAACTGTCCGTTGAG
DTR_A105 F: AGGGTAGATAACGTCTGATTTG 56.4 (CA)27 194 15 178–198 0.76 (0.81) 13 176–200 0.83 (0.87)
R: TCAGGTTTCTGAGTCTGACAG
DTR_A111 F: CACGAGTGCTGTGTTTGAG 56.8 (CA)27 289 8 283–292 0.63 (0.75) 7 283–292 0.78 (0.74)
R: ACCACTACATGCCGTTAGATC
DTR_A114 F: GGATGGATGTGTAATGGTAATG 57.1 (TC)19(CA)22 217 16 189–220 0.63* (0.87) 20 187–248 0.82 (0.92)
R: GCTGAATGATGTTTATCACGAG
DTR_A115 F: CATTTACTGATGCTGTGATCTG 56.3 (CA)29 166 10 122–160 0.73 (0.81) 15 122–174 0.8 (0.87)
R: GAGCCATCTTTGTCTTCACTC
DTR_A120 F: GCATAAATGGCTACACCTGAAC 57.6 (CA)15 210 14 200–240 0.7 (0.82) 19 200–268 0.68* (0.82)
R: ACTTTGGTCCAGCAGAGTAGTG
DTR_B103 F: CAGAACCAGAACGATTTCTAAT 57.1 (CATC)15 272 30 266–380 0.89 (0.94) 22 253–372 0.78* (0.92)
R: CGTGTGCCAATATCATATAGAG
DTR_B105 F: AGAAAGTCAAAGGAACCATCTG 57.5 (CATC)11 236 7 234–246 0.57 (0.6) 10 226–256 0.81 (0.83)
R: TGGGCTTACTCTTCAAGATAGC
DTR_B109 F: TAGGCAGTGAAGCCATTGTATT 58.0 (CATC)9244 13 238–344 0.4 (0.39) 14 224–332 0.79 (0.71)
R: AGCCAGAGACACAACATGAAAG
DTR_B113 F: CCAGGTGGAGCTAGAAATATG 57.6 (ACCC)3(CATC)9294 3 255–290 0.23 (0.22) 7 252–290 0.68 (0.65)
R: GGAAACTTCCTTTGGAGGTAT
DTR_C12 F: TGAGTTATGGTGCGGACATAG 56.3 (TACA)8(ACAG)6130 17 165–248 0.59* (0.9) 6 177–224 0.11* (0.35)
R: CAGCCATGTACTGGTGAAGAT
PERMANENT GENETIC RESOURCES 215
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
References
Bernardi G, Crane N (1999) Molecular phylogeny of the humbug
damselfishes inferred from mtDNA sequences. Journal of Fish
Biology, 5, 1210–1217.
Bernardi G, Holbrook SJ, Schmitt RJ, Crane NL, DeMartini E (2002)
Species boundaries, populations, and colour morphs in the
coral reef three-spot damselfish (Dascyllus trimaculatus) species-
complex. Proceedings of the Royal Society B: Biological Sciences, 269,
599–605.
Excoffier L, Laval G, Schneider S (2005) Arlequin, version 3.0: an
integrated software package for population genetics data analysis.
Evolutionary Bioinformatics Online, 1, 47–50.
Godwin J (1995) Phylogenetic and habitat influences on the mating
system structure in the humbug damselfishes (Dascyllus, Poma-
centridae). Bulletin of Marine Science, 57, 637–652.
McCafferty S, Bermingham E, Quenouille B, Planes S, Hoelzer G,
Asoh K (2002) Historical biogeography and molecular systematics
of the Indo-Pacific genus Dascyllus (Teleostei: Pomacentridae).
Molecular Ecology, 11, 1377–1392.
Randall JE, Randall HA (2001) Dascyllus auripinnis, a new poma-
centrid fish from atolls of the central Pacific Ocean. Zoological
Studies, 40, 61–67.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A
Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York.
Van Oosterhout CD, Weetman D, Hutchinson WF (2006) Estimatio n
and adjustment of microsatellite null alleles in non-equilibrium
populations. Molecular Ecology Notes, 6, 255–256.
Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite
isolation: a review. Molecular Ecology, 11, 1–16.

Supplementary resources (13)

Dascyllus trimaculatus clone C12 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone B109 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A105 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A7 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A103 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone B105 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A101 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A114 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone B113 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A120 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A111 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone A115 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
Dascyllus trimaculatus clone B103 microsatellite sequence
Nucleotide Sequence
June 2008
M. Leray · Ricardo Beldade · S.J. Holbrook · Russell J Schmitt · Giacomo Bernardi
... The analysis of microsatellites in adult populations of Dascyllus trimaculatus has shown that the markers that we used in this study are in Hardy-Weinberg equilibrium and do not show signs of linkage disequilibrium [28,29]. Here we used the twelve microsatellites to analyze relatedness in 181 newly settled individuals. ...
... Number of haplotypes and haplotype diversity were calculated using the software package DNAsp [42]. Twelve microsatellites [28,29] were used for relatedness analysis. Data were tested for Hardy-Weinberg equilibrium, linkage disequilibrium, and the presence of null alleles, large-allele dropout or stuttering using Arlequin 3.5 [43] and Micro-checker [44]. ...
Full-Sibs in Cohorts of Newly Settled Coral Reef Fishes
Article
Full-text available
Reef fishes exhibit a bipartite life cycle where a benthic adult stage is preceded by a pelagic dispersal phase during which larvae are presumed to be mixed and transported by oceanic currents. Genetic analyses based on twelve microsatellite loci of 181 three-spot dascyllus (Dascyllus trimaculatus) that settled concurrently on a small reef in French Polynesia revealed 11 groups of siblings (1 full sibs and 10 half-sibs). This is the first evidence that fish siblings can journey together throughout their entire planktonic dispersal phase (nearly a month long for three-spot dascyllus). Our findings have critical implications for the dynamics and genetic structure of fish populations, as well as for the design of marine protected areas and management of fisheries.
View
... Microsatellites for all samples were amplified using the following primers: Da593, Da590, Da479, Da565, Da589, and Da360 (Fauvelot et al. 2009); DTR B109, DTR A115, DTR A105, DTR B105, DTR B113, and DTR A120 (Leray et al. 2009); 2Al2 and 2AL13 (Carvalho et al. 2000); and Dmar07, Dmar11, Dmar14, Dmar17, Dmar23, Dmar25, and Dmar29 (Alpermann et al. unpublished). The QIAGEN Multiplex PCR Kit (Qiagen, Hilden, Germany) was used for the PCR. ...
Molecular confirmation of hybridization between Dascyllus reticulatus × Dascyllus aruanus from the Great Barrier Reef
Article
Full-text available
  • Nov 2017
To date, more than 81 species of tropical coral reef fish have been reported to hybridize in nature, spanning multiple families, including the Chaetodontidae, Pomacanthidae, and Labridae. Hybridization, however, is seemingly rare among benthic nesting species that engage in pair spawning, such as the Pomacentridae. Here, we present evidence for the first molecularly confirmed record of hybridization within the genus Dascyllus; D. aruanus and D. reticulatus. Interestingly, although many hybridization events are attributed to peripheral range effects or areas of limited overlap among otherwise allopatric species, this hybrid individual was collected from the northern Great Barrier Reef, centrally located within the distribution ranges of both species. The hybrid exhibited coloration and meristic counts intermediate between D. aruanus and D. reticulatus. Diagnostic genetic markers and subsequent microsatellites analysis confirmed that this individual was a hybrid offspring of D. aruanus and D. reticulatus, with the latter providing the maternal contribution. The occurrence of the D. aruanus × D. reticulatus hybrid on the Great Barrier Reef represents an exception to the otherwise species-specific haplotypes. The nuclear diagnostic marker which was identified during this study could serve as a hybrid indicator and benefit future hybrid investigations for hybridization between these two species.
View
... Genomic DNA was extracted using a chloroform-based protocol (Sambrook et al. 1989). Microsatellite loci were originally isolated and developed for Amphiprion chrysopterus and Amphiprion polymnus (Quenouille et al. 2004;Beldade et al. 2009) and for D. trimaculatus (Leray et al. 2008). From the existing libraries, we chose 20 microsatellites per species to test for variability on 32 individuals. ...
Life history, larval dispersal, and connectivity in coral reef fish among the Scattered Islands of the Mozambique Channel
Article
Full-text available
  • Sep 2016
The Western Indian Ocean harbors one of the world’s most diverse marine biota yet is threatened by exploitation with few conservation measures in place. Primary candidates for conservation in the region are the Scattered Islands (Îles Éparses), a group of relatively pristine and uninhabited islands in the Mozambique Channel. However, while optimal conservation strategies depend on the degree of population connectivity among spatially isolated habitats, very few studies have been conducted in the area. Here, we use highly variable microsatellite markers from two damselfishes (Amphiprion akallopisos and Dascyllus trimaculatus) with differing life history traits [pelagic larval duration (PLD), adult habitat] to compare genetic structure and connectivity among these islands using classic population structure indices as well as Bayesian clustering methods. All classical fixation indexes FST, RST, G′ST, and Jost’s D show stronger genetic differentiation among islands for A. akallopisos compared to D. trimaculatus, consistent with the former species’ shorter PLD and stronger adult site attachment, which may restrict larval dispersal potential. In agreement with these results, the Bayesian analysis revealed clear genetic differentiation among the islands in A. akallopisos, separating the southern group (Bassas da India and Europa) from the center (Juan de Nova) and northern (Îles Glorieuses) islands, but not for D. trimaculatus. Local oceanographic patterns such as eddies that occur along the Mozambique Channel appear to parallel the results reported for A. akallopisos, but such features seem to have little effect on the genetic differentiation of D. trimaculatus. The contrasting patterns of genetic differentiation between species within the same family highlight the importance of accounting for diverse life history traits when assessing community-wide connectivity, an increasingly common consideration in conservation planning.
View
... Of these, 13 successfully amplified all samples and were found to be highly polymorphic. Leray et al. (2009) provide a full description of amplification procedures and microsatellite characteristics. GENEMAPPER3.7 Applied Biosystems (Foster City, CA) was used for scoring microsatellite genotypes. ...
Allopatric divergence and speciation in coral reef fish: The three-spot dascyllus, Dascyllus trimaculatus, species complex
Article
Full-text available
  • Dec 2009
  • EVOLUTION
Long pelagic larval phases and the absence of physical barriers impede rapid speciation and contrast the high diversity observed in marine ecosystems such as coral reefs. In this study, we used the three-spot dascyllus (Dascyllus trimaculatus) species complex to evaluate speciation modes at the spatial scale of the Indo-Pacific. The complex includes four recognized species and four main color morphs that differ in distribution. Previous studies of the group using mitochondrial DNA revealed a noncongruence between color morphs and genetic groupings; with two of the color morphs grouped together and one color morph separated into three clades. Using extensive geographic sampling of 563 individuals and a combination of mitochondrial DNA sequences and 13 nuclear microsatellites, we defined population/species boundaries and inferred different speciation modes. The complex is composed of seven genetically distinct entities, some of which are distinct morphologically. Despite extensive dispersal abilities and an apparent lack of barriers, observed genetic partitions are consistent with allopatric speciation. However, ecological pressure, assortative mating, and sexual selection, were likely important during periods of geographical isolation. This study therefore suggests that primarily historical factors later followed by ecological factors caused divergence and speciation in this group of coral reef fish.
View
Chromosome-level genome of the three-spot damselfish, Dascyllus trimaculatus
Article
Full-text available
  • Mar 2023
Damselfishes (Family: Pomacentridae) are a group of ecologically important, primarily coral reef fishes that include over 400 species. Damselfishes have been used as model organisms to study recruitment (anemonefishes), the effects of ocean acidification (spiny damselfish), population structure, and speciation (Dascyllus). The genus Dascyllus includes a group of small-bodied species, and a complex of relatively larger bodied species, the Dascyllus trimaculatus species complex that is comprised of several species including D. trimaculatus itself. The three-spot damselfish, D. trimaculatus, is a widespread and common coral reef fish species found across the tropical Indo-Pacific. Here, we present the first-genome assembly of this species. This assembly contains 910 Mb, 90% of the bases are in 24 chromosome-scale scaffolds, and the Benchmarking Universal Single-Copy Orthologs score of the assembly is 97.9%. Our findings confirm previous reports of a karyotype of 2n = 47 in D. trimaculatus in which one parent contributes 24 chromosomes and the other 23. We find evidence that this karyotype is the result of a heterozygous Robertsonian fusion. We also find that the D. trimaculatus chromosomes are each homologous with single chromosomes of the closely related clownfish species, Amphiprion percula. This assembly will be a valuable resource in the population genomics and conservation of Damselfishes, and continued studies of the karyotypic diversity in this clade.
View
Arlequin (version 3.0): An integrated software package for population genetics data analysis
Article
Full-text available
Arlequin ver 3.0 is a software package integrating several basic and advanced methods for population genetics data analysis, like the computation of standard genetic diversity indices, the estimation of allele and haplotype frequencies, tests of departure from linkage equilibrium, departure from selective neutrality and demographic equilibrium, estimation or parameters from past population expansions, and thorough analyses of population subdivision under the AMOVA framework. Arlequin 3 introduces a completely new graphical interface written in C++, a more robust semantic analysis of input files, and two new methods: a Bayesian estimation of gametic phase from multi-locus genotypes, and an estimation of the parameters of an instantaneous spatial expansion from DNA sequence polymorphism. Arlequin can handle several data types like DNA sequences, microsatellite data, or standard multilocus genotypes. A Windows version of the software is freely available on http://cmpg.unibe.ch/software/arlequin3.
View
View
Molecular phylogeny of the humbug damselfishes inferred from mtDNA sequences
Article
Full-text available
The damselfish genus Dascyllus comprises nine species of both large- and small-bodied fishes distributed over the entire Indo-West Pacific. Most members of the genus have polygynous mating systems with protogynous sex change, while others are promiscuous with no sex change. Hypotheses linking presumed phylogenetic relationships with body size, sex change and mating structure have been proposed previously. However, lack of a strong phylogenetic hypothesis has prevented the careful testing of such hypotheses. In this study, the phylogenetic relationships between Dascyllus species based on mitochondrial DNA sequences (cytochrome b and 16SrRNA) have been established. The data also shed light on the relationship between mating structure and body size, as well as on the complex biogeographical patterns of the genus.
View
Dascyllus auripinnis, a new pomacentrid fish from atolls of the central Pacific Ocean
Article
  • Jan 2001
  • ZOOL STUD
A new damselfish (Pomacentridae) is described from 18 specimens from the Line Islands, one from the Phoenix Islands, and its presence in the northern Cook Islands is revealed by underwater photographs. It is distinctively colored with bright orange-yellow pelvic, anal, and caudal fins. Previously believed to be a color variant of D. trimaculatus, it differs, in addition to color, by having modally 1 fewer gill rakers and a shorter average length of the paired fins. There is also an indication that it attains a larger maximum size (largest, 115.2 mm SL).
View
Molecular phylogeny of the humbug damselfishes inferred from mtDNA sequences
Article
The damselfish genus Dascyllus comprises nine species of both large- and small-bodied fishes distributed over the entire Indo-West Pacific. Most members of the genus have polygynous mating systems with protogynous sex change, while others are promiscuous with no sex change. Hypotheses linking presumed phylogenetic relationships with body size, sex change and mating structure have been proposed previously. However, lack of a strong phylogenetic hypothesis has prevented the careful testing of such hypotheses. In this study, the phylogenetic relationships between Dascyllus species based on mitochondrial DNA sequences (cytochrome b and 16SrRNA) have been established. The data also shed light on the relationship between mating structure and body size, as well as on the complex biogeographical patterns of the genus.
View
View
View
Phylogenetic and Habitat Influences on Mating System Structure in the Humbug Damselfishes (Dascyllus, Pomacentridae)
Article
  • Nov 1995
  • B MAR SCI
The darnselfish genus Dascyllus contains nine species and exhibits protogynous sex change and/or functional gonochorism with variation both interspecifically and possibly intraspecifically between habitats. The genus can be divided into three species complexes and along lines of both descent and body size: 1) five species in two species complexes (complexes 1 and 2) are relatively small-bodied, closely associate with branching coral throughout life, and commonly exhibit resource defense polygyny and associated protogynous sex change, 2) three species in a third species complex (complex 3) reach larger body size, closely associate with branching coral only as juveniles, and do not exhibit resource defense polygyny, and 3) D. flavicaudus, a large-bodied member of the otherwise small-bodied species complex 2. Dascyllus flavicaudus and D. albisella (complex 3) are both large bodied, but differ in their responses to habitat type. Dascyllus flavicaudus shows differences in sex ratio, space use and mating system between a discontinuous coral cover habitat (female-biased sex ratio, resource defense polygyny) and continuous coral cover habitat (non-biased sex ratio, no resource defense polygyny) while D. albisella does not (non-biased sex ratio, no apparent resource defense polygyny in either habitat type), suggesting that both ecological factors and phylogenetic history influence these characters.
View
Van Oosterhout C, Weetman D, Hutchinson WF. Estimation and adjustment of microsatellite null alleles in nonequilibrium populations. Mol Ecol Notes 6: 255-256
Article
  • Mar 2006
  • MOL ECOL NOTES
Nonamplified (null) alleles are a common feature of microsatellite genotyping and can bias estimates of allele and genotype frequencies, thereby hindering population genetic analyses. The frequency of microsatellite null alleles in diploid populations can be estimated for populations that are in Hardy–Weinberg equilibrium. However, many microsatellite data sets are from nonequilibrium populations, often with known inbreeding coefficients (F) or fixation indices (FIS or FST). Here, we propose a novel null allele estimator that can be used to estimate the null allele frequency and adjust visible allele frequencies in populations for which independent estimates of F, FIS or FST are available. The algorithm is currently available as an Excel macro that can be downloaded at no cost from http://www.microchecker.hull.ac.uk/ and will be incorporated into the software micro-checker.
View
View