Content uploaded by Elham Hosseini
Author content
All content in this area was uploaded by Elham Hosseini on Feb 05, 2018
Content may be subject to copyright.
Propionate as a health-promoting microbial metabolite
in the human gut
Elham Hosseini, Charlotte Grootaert, Willy Verstraete, and Tom Van de Wiele
Propionate is a major microbial fermentation metabolite in the human gut with
putative health effects that extend beyond the gut epithelium. Propionate is thought
to lower lipogenesis, serum cholesterol levels, and carcinogenesis in other tissues.
Steering microbial propionate production through diet could therefore be a potent
strategy to increase health effects from microbial carbohydrate fermentation. The
present review first discusses the two main propionate-production pathways and
provides an extended gene-based list of microorganisms with the potential to
produce propionate. Second, it evaluates the promising potential of arabinoxylan,
polydextrose, and L-rhamnose to act as substrates to increase microbial propionate.
Third, given the complexity of the gut microbiota, propionate production is
approached from a microbial-ecological perspective that includes interaction
processes such as cross-feeding mechanisms. Finally, it introduces the development
of functional gene-based analytical tools to detect and characterize
propionate-producing microorganisms in a complex community. The information in
this review may be helpful for designing functional food strategies that aim to
promote propionate-associated health benefits.nure_388 245..258
© 2011 International Life Sciences Institute
INTRODUCTION
The microbial community in the human gastrointestinal
tract plays a substantial role in health and disease.1This
intestinal microbiota elicits a beneficial relationship with
the human host by modulating immunological functions2
and by affecting the growth and functioning of host cells.1
On the other hand, the gut microbiota may negatively
affect the host through increased obesity,3inflammatory
bowel diseases,1and colorectal cancer.4
Short-chain fatty acids (SCFAs) are the major prod-
ucts of colonic bacterial fermentation of dietary carbohy-
drates. The main compounds are acetic, propionic, and
n-butyric acid, occurring roughly in molar ratios of
60:20:20 in the colon.5These anions play a crucial role in
both intestinal morphology and function.6Butyrate has
received much attention as an energy source for colono-
cytes.7Furthermore, it has been described as an anticarci-
nogenic agent preventing growth8,9 and stimulating
differentiation10 of the colon epithelial cells.Acetate is used
as a substrate for liver cholesterol and fatty acid synthe-
sis,11,12 increases colonic blood flow and oxygen uptake,
and enhances ileal motility by affecting ileal contractions.6
The present review focuses on the potential health
effects of just one SCFA – propionate. Although propi-
onate is less frequently studied compared to other micro-
bial metabolites, such as butyrate, it has some distinct
health-promoting properties. The objective of this review
is therefore to focus on the potential health effects of
propionate and provide more insight into the propionate
production mechanism in the gut and how one can
modulate propionate production with dietary substrates.
Possible microbial interactions between propionate
producers and other intestinal microorganisms are
discussed, as are some current and new strategies for the
detection and identification of propionate producers.
Affiliation: E Hosseini,C Grootaert,W Verstraete, and T Van de Wiele are with the Laboratory of Microbial Ecology and Technology (LabMET),
Ghent University, Ghent, Belgium.
Correspondence: T Van de Wiele, Laboratory Microbial Ecology and Technology, Coupure Links 653, B-9000 Gent, Belgium. E-mail:
tom.vandewiele@ugent.be, Phone: +32-9-264-5976, Fax: +32-9-264-6248.
Key words: cancer, colon, gastrointestinal, obesity, propionic acid, satiety
Lead Article
doi:10.1111/j.1753-4887.2011.00388.x
Nutrition Reviews® Vol. 69(5):245–258 245
POTENTIAL HEALTH EFFECTS ATTRIBUTED
TO PROPIONATE
Excess propionate and an inability for it to convert to
methylmalonyl CoA through propionyl-CoA causes pro-
pionic acidemia. Propionic acidemia, as the most fre-
quent disorder of organic acid metabolism in humans, is
an inborn error of metabolism caused by the genetic defi-
ciency of propionyl-CoA carboxylase.13 Despite this tox-
icity aspect, propionic acid has been shown to have
antilipogenic and cholesterol-lowering effects.14 It also
elicits strong effects towards weight control and feeding
behavior.15–17 Furthermore, there is evidence that propi-
onate exerts, just as butyrate, an antiproliferative effect
towards colon cancer cells.10,18 It must be stressed that
knowledge of in vivo colonic propionate concentrations
or SCFA concentrations in general is insufficient to
deduce health effects. Comparison of portal blood with
colon content shows that colonocyte sorption of SCFA is
highly efficient, with portal blood concentrations being a
minor fraction of the colonic concentrations. Yet, unlike
butyrate, which is used by the colonocytes as an energy
source, propionate is found in higher concentrations in
the circulation.19 For propionate, the effects of which in
the colonocyte are less known, physiological concentra-
tions are still found to have health effects in both human
and animal cell cultures.11,20 Therefore, the biological
activity of propionate may not be restricted to the colon
itself, but extend to other parts of the human body. The
specific health effects of propionate are summarized in
Table 1.
Propionate influences lipid synthesis by hepatocytes
Lipid synthesis by the liver includes the conversion of
diet-derived fatty acids and glycerol into cholesterol and
triglycerides with different fatty acid compositions. These
hepatic lipid molecules are then incorporated into lipo-
proteins, to allow distribution to various tissues through
the circulation. Interestingly, lipid synthesis in hepato-
cytes is strongly affected by the amounts and types of
SCFAs produced through fiber fermentation in the
gut.12,13 Propionate, in particular, has been determined
to play a substantial role in some of these processes;
however, debate remains about the exact mechanism of
its cholesterol-lowering and antilipogenic effects.
Early observations of dietary modulation of hepatic
lipid synthesis revealed a strong correlation with dietary
fiber intake. There is extensive in vivo information on the
correlation between plant fiber ingestion and the synthe-
sis of cholesterol and triglycerides in experimental
animalsaswellasinhumans.
21,22 These studies have
shown that oral administration of soluble fibers, such as
pectin or guar gum, significantly decreased serum choles-
terol concentrations. This effect was partially explained
by the following: 1) increased fecal excretion of choles-
Table 1 Health effects attributed to propionate.
Study Effect Reference
Lipogenesis in hepatocytes
In vivo study with inulin-fed rats Decreased serum cholesterol levels Illman et al. (1988)23
In vitro study with isolated rat hepatocytes Inhibition of fatty acid synthesis Nishina and Freedland (1990)12
In vivo study with inulin-fed rats Decreased liver lipogenesis Delzenne and Williams (2002)14
In vivo rat study Decreased hepatic and plasma
cholesterol levels
Adam et al. (2001)24
Satiety
In vivo rodent study Upregulation of GLP-1 and PYY Zhou et al. (2008)17
In vivo rat study Increased levels of GLP-1 and PYY in
cecal pool, proximal colon, and portal
serum, decreased levels of ghrelin
Delzenne et al. (2005)29
In vivo study with lactating dairy cows Decreased energy intake and meal size,
increased intermeal interval
Oba and Allen (2001)15
In vivo human study Greater feeling of fullness, less hungry,
and reduced desire to eat
Ruijschop et al. (2008)16
In vivo mice study Doubled plasma levels of leptin Xiong et al. (2004)20
In vitro mice study Stimulated leptin expression in both a
mouse adipocyte cell line and mouse
adipocyte tissue in primary cultures
Xiong et al. (2004)20
In vitro study with human visceral
adipose tissue
Induced leptin production in both mRNA
and protein levels
Lahham et al. (2008)33
Cancer
In vitro study with colon cancer cell lines Antiproliferative effect Scheppach et al. (1995)34
In vitro study with colorectal carcinoma
cells
Induction of apoptosis Jan et al. (2002)18
Nutrition Reviews® Vol. 69(5):245–258246
terol and bile acids from the gut; 2) higher hepatic
conversion rate of cholesterol into bile acids; and 3) opti-
mized peripheral metabolism of lipoproteins by decreas-
ing the chylomicron size and lowering the incorporation
of cholesterol into chylomicrons.21
Further analysis of dietary fiber experiments pointed
to a specific role of SCFAs, as end products of microbial
carbohydrate fermentation, in hepatic lipid synthesis.12,13
Yet, the effect of SCFAs on fat synthesis and cholesterol
levels should be viewed in terms of the type of SCFA
produced. More specifically, propionate as a product of
intestinal fiber fermentation has been shown to reduce
serum cholesterol levels when fed to rats.23 In vitro
research with isolated rat hepatocytes showed an inhibi-
tory effect of propionate on fatty acid synthesis, but not
on cholesterol synthesis, although propionate decreased
the incorporation of [1-14C]acetate into sterols by 90%.13
In addition, propionate has been identified as a molecule
that decreases liver lipogenesis in inulin-fed rats.14 Other
rat experiments demonstrated that inclusion of whole-
flour diets decreased both hepatic and plasma cholesterol
levels, as well as cholesterol in plasma triglycerides,
whereas hepatic triglycerides were not affected. Besides
several mechanisms proposed in this study, the authors
also mentioned the effect of increased propionate con-
centration in the portal vein, associated with whole-fiber
diets, on cholesterol and fatty acid synthesis.24
The mechanism of propionate-induced inhibition of
lipid synthesis has been investigated by Lin et al11 using
rat hepatocytes and [14C]acetate. The researchers
observed a 50% inhibition in cholesterol and triglyceride
synthesis in the presence of a propionate concentration of
0.1 mmol/L. Using 10–100-fold higher levels of labeled
acetate, they rejected the possibility that propionate com-
peted with labeled acetate and decreased cholesterol and
fatty acid synthesis due to the dilution of the precursor
pool. It was therefore suggested that propionate may
affect the activity of a common key enzyme, such as
acetyl-CoA synthetase.12 Indeed, when acetate enters the
hepatocytes, it is mainly converted to acetyl-CoA by
acetyl-CoA synthetase and then enters the cholesterol
and fatty acid synthesis cycle. Propionate also has a com-
petitive effect towards the protein that is allocated at the
entry of acetate into liver cells. This inhibition would
thereby contribute to a decrease in cholesterol and fatty
acid synthesis.14
Despite the convincing results of these studies, it
was not always possible for other studies to confirm an
inhibitory effect of propionate on lipid metabolism. For
example, a daily dietary supplementation of 9.9 g sodium
propionate in bread did not change lipid metabolism in
six healthy volunteers and even resulted in increased
triglyceride concentrations in five of the subjects.25 In
another study, the effect of propionate towards lipid
metabolism was compared between human and rat hepa-
tocytes.12 An inhibitory effect of propionate was found, at
a concentration of 0.1 mmol/L, on lipid synthesis from
acetate in rats. However, in human hepatocytes, a higher
concentration of propionate, of about 10–20 mmol/L,
was required to obtain the same inhibitory effect. This
value is 100–200-fold higher than the concentration of
propionate in portal blood, indicating that the rat models
cannot be completely extrapolated to the human situa-
tion.12 In some other studies, the administration of pro-
pionate in the cecum of pigs, or perfusion of propionate
to the human colon, did not affect serum cholesterol
at all.26,27
Propionate as a molecule influencing satiety
In addition to having cholesterol-lowering and anti-
lipogenic effects, propionate may be involved in weight
control by stimulating satiety. The roles of SCFAs (acetic
acid, propionic acid,butyric acid) as satiety-inducing trig-
gers have been claimed in previous studies.17,28 There is
evidence that bacterial regulation of gut peptides such as
glucagon-like peptide 1 (GLP-1) and peptideYY (PYY) is
mediated by SCFAs produced from indigestible sub-
strates, such as inulin and oligofructose.29 In addition,
physiological concentrations of acetate, propionate, and
butyrate, but also a pH decrease from 7.5 to 6.0, signifi-
cantly increased proglucagon and PYY in the enteroen-
docrine colon cell line STC-1.17 GLP-1 and PYY are
satiety-stimulating hormones that are released in
response to nutrient intake by L-cells, mainly in the ileum
and colon. GLP-1 promotes insulin secretion and prolif-
eration of pancreatic b-cells in addition to controlling
glycogen synthesis in muscle cells,30 while PYY slows
down gastric emptying. In contrast, ghrelin stimulates
appetite and is mainly produced by P/D1 cells in the
stomach.31 Non-digestible carbohydrates, such as oligo-
fructose,32 lactitol,28 and resistant starch,17 areeffectivefor
inducing satiety by modulating production of the gut
peptides GLP-1, PYY, and ghrelin through a mechanism
that also involves modulation of the intestinal microbial
community.32
Among SCFAs, propionate, in particular, has been
investigated as a satiety-inducing agent with strong
effects on energy intake and feeding behavior. Human
and animal trials have shown that propionate administra-
tion (in a range of 130–930 mmol/L in vivo and 0.01–
10 mmol/L in vitro) results in a significantly greater
feeling of fullness and lower desire to eat.15–17,24
One of the satiety signals triggered by propionate, in
particular, is leptin, a potent anorexigenic hormone that
suppresses food intake through receptors expressed in
the central nervous system. Xiong et al.20 demonstrated
that the administration of sodium propionate at a dose of
Nutrition Reviews® Vol. 69(5):245–258 247
500 mmol/day almost doubled the plasma concentration
of leptin in mice. Furthermore, SCFAs, and propionate in
particular, stimulated leptin expression in both a mouse
adipocyte cell line and mouse adipose tissue in primary
culture.20 In another study, propionate at a concentration
of 3 mmol/L induced leptin production in human
visceral adipose tissue on both the mRNA and protein
levels.33 These data suggest that the modulating effect of
gut microbiota towards obesity may be partially mediated
by SCFAs, particularly propionic acid, which is derived
from microbial carbohydrate fermentation.
Potential role of propionate in cancer development
The effect of SCFAs on cancer, more specifically colon
cancer, has been investigated extensively.10,18,34 Butyrate is
able to modulate gene expression and has an impact on
the key regulators of apoptosis and cell cycle. Several
mechanisms contribute to the regulatory effect of
butyrate on gene expression. These include hyperacetyla-
tion of histones and non-histone proteins as well as
alteration of DNA methylation, resulting in enhanced
accessibility of transcription factors to nucleosomal
DNA.35 In another study by Jan et al.,18 propionate and
acetate (at levels of 26–40 and 9–16 mmol/L, respectively)
induced typical signs of apoptosis in human colorectal
carcinoma cell lines. This effect included a loss of mito-
chondrial trans-membrane potential, the generation
of reactive oxygen species, caspase-3-processing, and
nuclear chromatin condensation.
SCFAs have paradoxical effects on colonic epithelial
cell proliferation. While these anions stimulate prolifera-
tion of normal crypt cells, n-butyrate, and to a lesser
extent propionate,they inhibit growth in colon cancer cell
lines.34 Butyrate and propionate are also the most potent
fatty acids to induce differentiation36 and apoptosis.37
They are therefore protective against cancer development
in general10,36 and against colorectal cancer in particu-
lar.18,37 Although butyrate is more effective than propi-
onate,38 it is mainly taken up by the colonocytes as an
energy source.8In contrast, propionate and acetate each
reach the circulation in a much higher concentration than
butyrate, and they are significantly taken up by the liver
(about 60%).19 Because of the high concentrations of
these anions in the liver, it is not unlikely that they affect
liver cancer cells as well as other typical cancer cells
known to cause metastasis in the liver, such as breast and
colon cancer.39 Further uptake of SCFAs occurs in periph-
eral tissues, resulting in a 47% decrease of SCFAs in
peripheral venous blood. Yet, a study on sudden death
victims has shown that the amounts of SCFAs in periph-
eral blood are still quantifiable.19 Therefore, the anticarci-
nogenic effect of this circulating propionate, along with
acetate and butyrate, would be a matter of interest to
investigate; for example, to what extent might the effect
extend beyond the small or large intestine and the liver
and thus affect different tissues?
SUBSTRATES AFFECTING PROPIONATE PRODUCTION
Non-digestible carbohydrates resistant to enzymatic
digestion in the small intestine are further broken down
by the intestinal bacteria. Prebiotics are defined as indi-
gestible carbohydrates that beneficially affect host health
through selectively stimulating the growth and/or the
activity of one or a limited number of bacteria in the
colon.40 Although the effect of substrates on SCFA pro-
duction in the distal gut has been denied in some stud-
ies,41,42 many studies have demonstrated their SCFA-
increasing properties. Some actual and potential prebiotic
compounds influencing propionate production are
described in detail in the following section. Due to differ-
ences in the experimental setup, compound structure and
concentration, and intestinal microbial community of the
studies, the variability in the propionate modulatory
effects of these compounds is high and performing com-
parisons among different substrates is difficult. Impor-
tantly, a direct link between propionate production and
luminal propionate concentration can only be made in an
in vitro context in the absence of intestinal absorption. A
summary of the main substrates inducing propionate
production is given in Table 2.
L-rhamnose
L-rhamnose or 6-deoxy-L-mannose is a naturally occur-
ring deoxy sugar. It is found in several animal, plant, and
bacterial polysaccharides. Commercially available rham-
nose is produced by chemical hydrolysis of arabic and
karaya gums, or from rutin or citrus fruits that contain,
by weight, 10–30% rhamnose. In short-term in vitro
experiments, L-rhamnose has been shown to increase
propionate production by four times the amount pro-
duced by lactulose.43 Similar results were obtained in a
human in vivo study in which subjects were given 25 g of
L-rhamnose, lactulose, or D-glucose on three different
occasions. Serum propionic acid was measured 24 h
after ingestion and was significantly higher after
L-rhamnose than after lactulose or D-glucose.44 The
propionate-inducing effect of L-rhamnose has also been
confirmed in one longer-term study in which ingestion
of 25 g of sugar significantly increased serum propionate
in humans over 28 days as compared to ingestion of
D-glucose as a control.45
D-tagatose
D-tagatose is a stereoisomer of D-fructose, which is nor-
mally used as an alternative to sucrose because of its low
Nutrition Reviews® Vol. 69(5):245–258248
Table 2 Substrates affecting propionate production.
Substrate Study Effect* Treatment
duration
Reference
L-rhamnose In vitro study with human feces Selective increase of propionate production 24 h Fernandes et al. (2000)43
In vivo human study Selective increase of serum propionate compared to
control
28 days Vogt et al. (2004)44
D-tagatose In vivo pig study Proportional increase of propionate in different
segments of large intestine
18 days Laerke and Jensen (1999)47
Resistant starch In vivo rat study Selective increase of serum propionate levels
associated with decreased hepatic triglyceride
and cholesterol levels
4 weeks Cheng and Lai (2000)49
Inulin In vitro study with human
gut simulator
Higher SCFA production, particularly propionate and
butyrate
5 weeks Van De Wiele et al. (2004)50
In vivo rat study Proportional increase of luminal concentration of
propionate, decreased plasma triglyceride levels
21 days Brouns et al. (2002)48
Levrat at al. (1991)52
Polydextrose In vitro study with 4-stages
colon-simulator
Increased SCFA production, particularly propionate 48 h Makelainen et al. (2007)53
Arabinoxylans (AX) In vivo rat study Dropped cecal pH, SCFA accumulation (particularly
propionate), decreased cholesterol absorption
Variable between
subjects
Lopez et al. (1999)54
Arabinoxylan
oligosaccharides
(AXOS)
In vitro study with human
gut simulator
Higher SCFA production, particularly propionate in
transverse compartment of the colon,
concomitant decreased lactate production in the
same compartment indicating probable
production of propionate through acrylate
pathway
3 weeks Grootaert et al. (2009)56
Ispaghula In vivo rat study Higher SCFA production, particularly propionate in
the cecum, proximal and distal colon and feces
28 days Edwards and Eastwood (1992)58
Manno-oligosaccharides
(MOS)
In vitro study with human feces Selective increase of propionate production 24 h Asano et al. (2003)60
In vivo rat study Higher cecal SCFAs, particularly propionate 28 days Asano et al. (2004)61
Oligo-laminarans In vitro study with human feces Higher propionate production, anticarcinogenic
effect on several cancer cell lines
NA Michel et al. (1999)62
* The term“selective”is used when an absolute increase in propionate production occurred. “Proportional increase” is used in case of a higher increase in propionate production compared to
other SCFAs.
Abbreviation: NA, no information available.
Nutrition Reviews® Vol. 69(5):245–258 249
energy content.46 The indigestibility of this carbohydrate
in the small intestine and its high fermentability in the
large intestine of pigs was studied by Laerke and Jensen.47
Besides some other metabolic effects, such as lower pH
levels and higher ATP concentrations in the cecum
and proximal colon, significant increases of up to
34.5 mmol/L of propionate were observed in the cecum
and in several segments of the large intestines of the pigs
that were fed D-tagatose (100 g/kg diet) compared to a
sucrose-fed control group.
Resistant starch
Resistant starch consists of a large number of glucose
units linked together by a-(1,4) or a-(1,6) glycosidic
bonds and is resistant to amylase degradation.Depending
on the origin of the starch, it is fermented to butyrate48 or
propionate.49 In particular, resistant starch from rice is
associated with increased propionate production. Fer-
mentation of this compound in different proportions was
investigated in rats by Cheng and Lai.49 Hepatic triglycer-
ide and total cholesterol concentrations in rats fed rice
starch (630 g/kg feed) were found to be significantly
lower (1.5 fold) than in the control group without starch.
This was in parallel with a significant increase in serum
propionate concentration.
Inulin
This oligosaccharide belongs to the fructan family and
mainly consists of b-(2,1)-linked fructosyl-fructose. It
naturally occurs in flowering plants such as chicory and
Jerusalem artichoke as storage carbohydrate. As a prebi-
otic, inulin has been demonstrated to be very effective for
increasing both butyrate and propionate production.The
propionate-increasing effect of inulin has been investi-
gated in vitro using the simulator of human intestinal
microbial ecosystem (SHIME). A metabolic shift for
SCFA production was observed after 1 week of inulin
supplementation (5 g/d). The higher concentration of
SCFAs originated from increased production of propi-
onate and butyrate.50 When administered to the same
SHIME reactor, oligofructose and inulin with different
degrees of polymerization (DP) (2–20 and 3–60 for oli-
gofructose and inulin, respectively), resulted in 2 times
greater propionate production for inulin compared to the
start-up period.51 An in vivo study with rats fed with
inulin (10%) also resulted in a considerable increase in
propionate production of up to 58.4 mmol/L.52
Polydextrose
Polydextrose is a branched, randomly polymerized
polysaccharide (DP, 6–32), which is synthesized mainly
from dextrose and is not digested in the upper part of the
gastrointestinal tract. Modulation of the colon microbial
composition and metabolic activity by this substrate was
investigated using a four-stage colon simulator.53 Asig-
nificant increase in SCFA production was observed, espe-
cially for propionate (22.9 mmol/L) compared to the
control sugar xylitol (8.3 mmol/L).
Arabinoxylans and arabinoxylan oligosaccharides
Arabinoxylans are the main non-starch polysaccharides
found in many cereals and are part of dietary fiber.Arabi-
noxylans consist of b-(1,4)-linked D-xylopyranosyl resi-
dues to which a-L-arabinofuranose units are linked as side
chains. Some arabinoses can be substituted with ferulic
acid. In the in vivo study by Lopez et al.,54 rats fed with a
control diet (containing 710 g/kg wheat), an arabinoxylan-
supplemented diet (610 g/kg wheat starch plus 100 g/kg
maize arabinoxylan),and a cholesterol-supplemented diet
(without or with 2 g/kg cholesterol) were compared. The
cecal pH level dropped from 7 to 6 due to the accumulation
of SCFAs, especially propionic acid (>45% in molar
percentage). The butyrate production, however, was
unaffected.
Arabinoxylan oligosaccharides are derived from
hydrolysis of highly polymerized arabinoxylans. They are
characterized by their DP and the average degree of ara-
binose substitution (DS).55 In a study by Grootaert et al.56
the prebiotic potential of arabinoxylan oligosaccharides
was compared with inulin in two SHIME reactors.
Arabinoxylan oligosaccharides and inulin degradation
mostly occurred in the transverse and ascending com-
partment of the reactor, respectively. Lactate levels
(5.5 mM/L) increased in the ascending colon during
supplementation with arabinoxylan oligosaccharides,
while propionate levels (5.1 mM/L) increased signifi-
cantly in the transverse colon. The concomitant decrease
in lactate in the transverse colon suggested that propi-
onate was partially formed over the acrylate pathway.
Inulin treatment had moderate effects on lactate, propi-
onate, and butyrate levels.
Psyllium or ispaghula is a source of soluble fiber
providing polysaccharides comparable to wheat bran ara-
binoxylans but with a higher variability in side-chain
composition and linkage.57 In an in vivo rat study, the
effect of ispaghula (5%) on cecal and colon fermentation
was compared with that of wheat bran (10%). It was
noticed that is paghula fermentation resulted in higher
SCFA production, particularly more propionic acid in the
cecum and in all the colon fragments.58
Mannooligosaccharides
Mannan is one of the water-insoluble hemicelluloses
comprised of linear or branched polymers derived from
Nutrition Reviews® Vol. 69(5):245–258250
sugars such as D-mannose, D-galactose, and D-glucose.59
Mannooligosaccharides (MOSs) are fractionated through
thermal hydrolysis of mannan. These carbohydrates are
resistant to human salivary a-amylase, artificial gastric
juice, porcine pancreatic enzymes, and rat intestinal
mucous enzymes.60 Using in vitro digestion methods,
MOS (10%) fermentation by human fecal bacteria was
examined. A significantly higher level of propionate was
found to be produced from MOSs compared to fructo-
oligosaccharides and b-1,4-mannobiose.60 Similar results
for coffee MOSs were obtained in an in vivo rat study.61
The addition of 5% MOSs to the diet for 28 days resulted
in a proportional increase of up to 36.5 mmol/L of pro-
pionate in the cecum.
Others
Laminarans are a group of water-soluble b-(1,3)-D-
glucan polysaccharides with low molecular weight
isolated from seaweeds. The biological activities and fer-
mentation characteristics of oligosaccharides obtained
from laminarans were examined by Michel et al.62 Oligo-
laminarans (as a potential prebiotic) induced propionate
production and demonstrated an antiproliferative effect
on colorectal cancer (Caco-2), monocytic (THP1), and
lymphocytic T (Jurkat) cell lines.62
MECHANISMS OF PROPIONATE FORMATION
Propionate produced as a result of microbial fermenta-
tion of indigestible carbohydrates in the gut is the major
source of propionate available in the body. Numerous
studies have focused on this metabolite as a product of
intestinal fermentation7,45,49,52,54,63,64 rather than from
dietary intake.16,25 Therefore, the next section of this
review includes a detailed discussion of the two major
pathways of propionate production in the intestine and
the main microbial species involved in these specific
pathways. Interactions between bacteria in the propi-
onate pathways and new and current strategies to detect
and identify propionate-producing bacteria are also
illustrated.
Succinate or randomizing pathway
The first pathway suggests that propionate is formed
through decarboxylation of the symmetrical compound,
succinate. First, oxaloacetate is formed by pyruvate car-
boxylase from pyruvate. Then, oxaloacetate is reduced to
malate by malate dehydrogenase followed by dehydration
of malate to fumarate by fumarate hydratase. Fumarate is
then reduced to succinate by the action of succinate dehy-
drogenase. It is hypothesized that further metabolism of
succinate to propionate occurs through the decarboxyla-
tion of methylmalonyl-CoA, which is converted to
propionyl-CoA by methylmalonyl-CoA mutase activity
(Figure 1).
Pathways of succinate and propionate production
were extensively examined in Bacteroides fragilis,an
important anaerobe in the human intestine. Normally,
between 1010 and 1011 cells of this species are found per
gram of feces.65 For Bacteroides fragilis,aCO
2-dependent
mechanism for propionate production was suggested by
Macy et al.66 Enzyme assays performed with Bacteroides
fragilis revealed that oxaloacetate formation is catalyzed
by phosphoenolpyruvate carboxykinase (PEP carboxyki-
nase) and is energy independent. Therefore, the high
energy of the phosphate bond in PEP is conserved in the
form of ATP during the CO2-dependent formation of
oxaloacetate. This is in contrast with other species such
as Propionibacterium shermanii and Veillonella spp. in
which oxaloacetate formation is catalyzed by transcar-
boxylase and pyruvate kinase (both ATP-dependent
enzymes), respectively. In culture, succinate dehydroge-
nase activity (Figure 1, enzyme 4) was dependent on the
presence of hemin, an iron-containing compound essen-
tial for the growth of Bacteroides spp.64
Propionibacterium spp. is another common propi-
onate producer that uses the succinate pathway. Decar-
boxylation of succinate is the main method of propionate
Figure 1 Propionate formation through succinate or
randomizing pathway based on Macy et al.66 Enzymes
involved in the above reactions: 1) pyruvate carboxylase,
2) malate dehydrogenase, 3) fumarate hydratase,
4) succinate dehydrogenase, 5) succinyl-CoA synthetase,
6) methylmalonyl-CoA mutase, 7) methylmalonyl-CoA epi-
merase, 8) methyl malonyl-CoA decarboxylase, 9) propi-
onate CoA-transferase.
Nutrition Reviews® Vol. 69(5):245–258 251
production in Propionibacteria, since the amount of pro-
pionic acid formed depends on the concentration of CO2
in the medium. Higher ratios of propionate:acetate due to
increased CO2concentration was explained by bacterial
secretion of succinic acid at pH values above 6.5, but until
the pH drops below that level, cellular uptake is impos-
sible. In the case of increasing CO2concentrations, more
succinic acid is formed, with the excess being released
into the medium, and decarboxylated only when the pH
decreases with glucose as substrate, resulting in a higher
propionate:acetate ratio.67
The mechanism of propionate formation in Propi-
onibacterium pentosaecum was investigated by Del-
wiche.68 In this study, propionate production from
succinate was higher than that from pyruvate, and
equimolar amounts of CO2and propionate were formed.
In the same study, at the presence of 0.3 mol/L malonate,
propionate production was inhibited by 90%. Con-
sidering these observations, it becomes evident that
Propionibacterium pentosaecum possesses a succinate
decarboxylase system sufficiently effective to be consid-
ered as the main factor for propionate production.
Decarboxylation of succinate is found in cell-free
extracts of Micrococcus lactilyticus in the presence of
specific cofactors, such as biotin and adenylic acid.
Micrococcus lactilyticus or Veillonella gazogenes are
strictly anaerobic bacterium producing acetic acid,
propionic acid, CO2, and H2through the fermentation of
lactate. They fail to ferment glucose, fructose, arabinose,
and some other sugars, which might be due to a lack
of the enzyme necessary to carry out the primary phos-
phorylation of the glucose in this species.69 However,
washed suspensions of this microorganism grown on
lactate were able to convert pyruvate, oxaloacetate,
L-malate, fumarate, and succinate under anaerobic
conditions.
Acrylate pathway
Although the succinate pathway is well described for
some of the most prevalent bacteria in the gut, it was
suggested that the differences observed in labeled carbon
distribution patterns are the result of another fermenta-
tion mechanism that is different from the succinate path-
way.70 This pathway is defined as the acrylate pathway and
is presented in Figure 2. Unlike the pathway of propionate
formation in Propionibacterium shermanii and Veillonella
spp., where fumarate and succinate are symmetrical inter-
mediates, none of the intermediates of the acrylate
pathway are symmetrical.71 In the acrylate pathway, pyru-
vate is reduced to lactate by lactate dehydrogenase.
Lactate is converted to lactyl-CoA, which is then dehy-
drated to acrylyl-CoA by l-CoA dehydratase. Acrylyl-
CoA is reduced to propionyl-CoA by acyl-CoA
dehydrogenase. Phosphorylation of propionyl-CoA by
phosphate acetyltransferase results in propionyl-
phosphate, which is eventually converted to propionate
by propionate kinase.
Live Clostridium neopropionicum X4 is able to
ferment [1-13C]ethanol and CO2to [2-13C]propionate,
[1-13C]acetate and [2-13C]propanol. Because the labeled
positions did not change and the molecular skeleton was
preserved through the synthesis of propionate, it was sug-
gested that propionate was not formed by the succinate or
randomizing pathway, but by the acrylate or non-
randomizing pathway.71
The same pathway was also used by Megasphaera
elsdenii (cluster IX of Clostridia). The latter is an impor-
tant obligatory anaerobic bacterium of the rumen of
cattle and sheep,72 accounting for 21% of lactate con-
sumption by rumen bacteria; it is also found in the
human intestine.73 Megasphaera elsdenii utilized lactate in
preference to glucose when these two substrates were
present for propionate production.74
MICROBIAL INTERACTIONS
In a complex mixed microbial community, cooperation
between different microorganisms to produce a certain
end product is not uncommon. For instance, Falony
et al.75 demonstrated that substantial cooperation exists
between Bifidobacteria and Roseburia species for the fer-
Figure 2 Acrylate pathway in Clostridium neopropionicum X4 based on Tholozan et al.71 Enzymes involved in the above
reactions: 1) L-lactate dehydrogenase, 2) propionate CoA-transferase, 3) lactoyl-CoA dehydratase, 4) acyl-CoA dehydrogenase,
5) phosphate acetyltransferase, 6) propionate kinase.
Nutrition Reviews® Vol. 69(5):245–258252
mentation of inulin to butyrate. This cooperation is
accomplished by means of cross-feeding, in which one
species metabolizes the products of another species. The
following examples suggest similar cooperation between
rumen bacteria accounts for propionate production. In
the rumen, several bacterial species are found to be
capable of performing all of the steps in the propionate
pathways, using carbohydrates as a substrate for propi-
onate formation. Examples include Megasphaera elsdenii
and Selenomonas ruminantium, which produce propi-
onate from carbohydrates and lactate through the acry-
late and the succinate pathway, respectively.74,76 On the
other hand, several rumen bacterial species, such as
Ruminococcus flavefaciens and Bacteroides succinogenes,
only produce succinate as a major fermentation end
product when cultivated in pure culture. With such
species, it was seen that succinate did not accumulate in
the rumen, but was decarboxylated to propionate. There-
fore, it was suggested that succinate produced by a species
like Bacteroides succinogenes was converted to propionate
by succinate-consuming species, such as Selenomonas
ruminantium.64
Another example of microbial interaction between
two species was provided by Hino et al.74 When grown
separately in a glucose-containing medium, a monocul-
ture of Streptococcus bovis grew faster than Megasphaera
elsdenii, but the final cell yield was lower for Streptococcus
bovis than for Megasphaera elsdenii. However, when these
two species were cultured together, the growth rate and
cell concentration of Streptococcus bovis were higher than
those of Megasphaera elsdenii. Significant propionate
production in this co-culture indicated that Megasphaera
elsdenii consumed the lactate produced by Streptococcus
bovis. The stronger growth of Streptococcus bovis sug-
gested that glucose was mostly fermented by this species
and that Megasphaera utilized little glucose when lactate
was available. This implies that the growth and propi-
onate production in Megasphaera elsdenii is highly
affected by glucose fermentation and lactate production
of Streptococcus bovis.
Competition for an essential nutrient is one of the
negative interactions that occur between microorganisms
in a mixed community. Hydrogen (H2) is a major inter-
mediate in intestinal fermentation. It is utilized by hydro-
genotrophic microorganisms belonging mainly to the
methanogens, acetogens, and sulphate-reducing bacteria.
These microorganisms therefore compete for H2and
influence each other’s growth and activity. Methanogens
utilize hydrogen to reduce CO2and produce methane
(CH4). The latter is considered as energy loss for the host
and a contributor to global warming.77 Using bacterial
interactions has already been a strategy for reducing
methanogenesis in in vitro as well as in vivo studies. One
way to decrease methanogenesis is to induce the pathways
of fermentation in which H2is utilized by other microor-
ganisms. Acetogenesis seems to be a possible alternative
to reduce CH4production by methanogens. In a study by
Morvan et al.,78 in vitro interactions between a rumen
H2-producing microorganism, Ruminococcus flavefa-
ciens,andaH
2-utilizing bacteria belonging to the cluster
XIV of Clostridia, resulted in higher acetate production
by Clostridium in the coculture media. This indicated an
interspecies H2transfer resulting in less H2availability for
methanogens. The second possibility for CH4reduction is
through propionate formation.Some propionate produc-
ers form propionate through the succinate pathway, in
which intermediates such as malate and fumarate are
involved. In a study of Lopez et al.,79 it was demonstrated
that an addition of sodium fumarate (6.25 mmol/d) to the
fermentation media with rumen microbiota significantly
decreased, by 6%, the amount of CH4produced. The
decrease corresponded well to the fraction of fumarate
that was converted to propionate. More evidence for an
inverse relationship between propionate production and
methanogenesis, as well as some strategies for methane
mitigation in rumen, are reviewed by Boadi et al.77
However, the main information about the effect of pro-
pionate on methanogenesis appears to be provided by
animal studies and mostly in rumen. Therefore, it would
be interesting to investigate this effect in the human intes-
tine as well.
Sulfate-reducing bacteria utilize H2to reduce sulfur
from unabsorbed amino acids and dietary sulfate. Sulfide
is mainly detoxified in the colon and red blood cells
through methylation by thiol methyl transferase.80 Ye t , a n
important role for colonic sulfide in the pathogenesis of
ulcerative colitis (UC) has been found.Higher production
of hydrogen sulfide and growth characteristics of sulfate-
reducing bacteria is noticed in patients with UC com-
pared to control subjects.80 This is due to selectively
impaired oxidation of butyrate, which has an essential
role in maintaining the health of the colonic epithelial cell
barrier. So far, strategies for reducing hydrogen sulfide
include antibiotics against sulfate-reducing bacteria,
methyl donors, dietary reduction of sulfide intake, and
promotion of colonic methanogenesis.80 Besides these
strategies, the potential effect of propionate on hydrogen
sulfide mitigation through dietary management would be
a matter of interest to investigate.
MOLECULAR MONITORING OF
PROPIONATE-PRODUCING BACTERIA
More than 90% of bacteria annotated in the human intes-
tine are unculturable.81 Molecular techniques using 16S
ribosomal RNA-targeted probes82 or polymerase chain
reaction primers83 have been used as powerful culture-
independent techniques to detect predominant bacterial
Nutrition Reviews® Vol. 69(5):245–258 253
groups present in the human intestine. For propionate
producers as well as other bacterial groups, the 16S ribo-
somal RNA gene has mainly been used to design gene-
targeted species-specific primers. An overview of primers
that are suitable to detect several known propionate pro-
ducers are listed in Table 3. More recently, genes involved
in the metabolic pathways, such as the production of
SCFAs by bacteria, have become new targets in molecular
analysis. To exemplify this point, a study of Louis et al.84
reported the design of polymerase chain reaction primers
using genes encoding the final enzymes of butyrate syn-
thesis in the human large intestine. Genes encoding
butyrate kinase, phosphotransbutyrylase, and butyryl-
CoA:acetate CoA-transferase were used to assess the
potency of bacteria to produce enzymes involved in
butyrate production. In addition, the predominant route
for butyrate formation in the gut could be examined.
Using a similar approach, Asanuma and Hino85
elucidated the regulatory mechanism for propionate pro-
duction in Selenomonas ruminantium by targeting phos-
phoenolpyruvate carboxykinase and pyruvate kinase
genes, which are both involved in the early steps of pro-
pionate synthesis. Such a research strategy may also
apply to the detection of other propionate-producing
bacteria. In addition, the final enzymes in the pathways
of propionate formation (Figures 1 and 2) may be used
to 1) screen for a wider range of phylogenetically diverse
propionate-producing bacteria from the human large
intestine and 2) determine the extent to which the path-
ways of propionate production are employed in this
ecosystem.
Further research is needed to expand the primer set
for detecting genes encoding for the enzymes that are
involved in the propionate production pathways, and
for determining and quantifying propionate-producing
microorganisms. To aid in the development of such a
molecular analytical strategy, an overview of the enzymes
involved in either the succinate or acrylate pathways of
propionate production is provided here. One can query
these enzymes in the Gene Bank DNA sequence database
from the National Center for Biotechnology Information
(NCBI) to look for coding genes. To illustrate, a search
was performed based on the enzyme commission
number (EC number) and with exclusion of archaea.
Except for one enzyme that is involved in the acrylate
pathway, lactoyl-CoA dehydratase, the query for the dif-
ferent enzymes resulted in a large number of species pos-
sessing genes, including putative genes, expressing these
enzymes (Table 4). Interestingly, the number of bacterial
species possessing specific enzymes was highly variable.
For the enzymes involved in the succinate pathway, an
increasing number of species that possess the enzymes
involved in the electron transport chain was observed
(Table 4; Figure 1, enzymes 1, 2, 3, 4, and 5). Further
downstream, a decreasing number of species would have
the potency to produce enzymes involved in the last steps
of propionate formation (Table 4; Figure 1, enzymes 6, 7,
8, and 9). One possible explanation for this trend is
an information gap concerning the bacterial species
involved in the initial or final steps of propionate produc-
tion. Alternatively, it is probable that only a limited
number of bacterial species are capable of performing the
Table 3 PCR primers for detection of propionate-producing bacteria.
Candidate Primer sequence Product
size (bp)
Annealing
temperature (°C)
Reference
Bacteroides fragilis
subgroup
ATACGGAGGATCCGAGCGTTA
CTGTTTGATACCCACACT
293 65 Vanhoutte et al. (2006)86
Bacteroides fragilis group ATAGCCTTTCGAAAGRAAGAT
CCAGTATCAACTGCAATTTTA
501 50 Matsuki et al. (2002)83
Prevotella ruminicola GGTTATCTTGAGTT
CTGATGGCAACTAAAGAA
485 53 Tajima et al. (2001)87
Prevotella ruminicola 23 GAAAGTCGGATTAATGCTCTATGTTG
CATCCTATAGCGGTAAACCTTTGG
74 53 Stevens and Weimer
(2007)88
Selenomonas
ruminantium D
CAATAAGCATTCCGCCTGGG
TTCACTCAATGTCAAGCCCTGG
138 56 Stevens and Weimer
(2007)88
Megasphaera elsdenii
T81
AGATGGGGACAACAGCTGGA
CGAAAGCTCCGAAGAGCCT
95 54 Stevens and Weimer
(2007)88
Bacteroides vulgatus GCATCATGAGTCCGCATGTTC
TCCATACCCGACTTTATTCCTT
287 50 Wang et al. (1996)89
Escherichia coli GACCTCGGTTTAGTTCACAGA
CACACGCTGACGCTGACCA
585 50 Wang et al. (1996)89
Propionibacterium
freudenreichii
CTTTCATCCATGACGAAGCGCAAG
TGGGGTCGAGTTGCAGACCCCAAT
867 69 Rossi et al. (1999)90
Propionibacterium
acidipropionici
GACGAAGGCATTCTTTTAGGGTGT
TGGGGTCGAGTTGCAGACCCCAAT
868 68 Rossi et al. (1999)90
Nutrition Reviews® Vol. 69(5):245–258254
final metabolic steps in the propionate production
pathway. In contrast, no such trend was observed for the
enzymes involved in the acrylate pathway.As for the suc-
cinate pathway, information on the number of species
that possess the relevant enzymes may be incomplete.
In addition to performing the search, the bacterial
genera were ranked based on the total number of enzymes
that can be linked to either the succinate or the acrylate
pathway. This provides a better view of the particular
bacterial genera that have a higher probability of produc-
ing propionate. All of the bacterial genera that possess
enzymes for the succinate and the acrylate pathways are
presented as Tables S1 and S2, which are available online as
Supporting Information. The entire categorized list of
bacterial genera with the total number of enzymes can be
consulted in those tables. In addition, the supporting tables
present the number of species for each specific enzyme.
Repetitions of the same bacterial genus and species do
occur, due to the presence of several strains of the same
species, or due to the presence of a different nomenclature
for the same gene within one species.Some of these genera
are well known to be present in the human intestine, such
as, Veilonella,Lactobacillus,Bacteroides,andPropionibac-
terium. However, many other genera exist for which the
functional genes are determined but further investigation
is needed to elucidate whether the species can be detected
in the human intestine.
CONCLUSION
Propionate of gut microbial origin is known to possess
biological activity at the level of the intestine and intes-
tinal epithelium. Yet, due to its efficient transport across
the gut epithelium, it may affect other organs and tissues
in addition to the intestinal epithelium. This opens up
the potential for the health effects of this metabolite to
be modulated through the gut. The selective changes in
serum propionate concentration are obtained by feeding
specific fermentable substrates. These changes reflect dif-
ferences in colonic production and microbial composi-
tion. Therefore, selective alteration of the colonic
fermentation pattern using functional foods could yield
a new strategy for modulating propionate-derived health
effects. Although many prebiotic compounds have been
reported to promote propionate production by gut
microorganisms, the mechanisms behind propionate
production need to be elucidated further. Due to the
large inter-individual differences in the composition and
associated metabolism of the gut microbial community,
knowledge of carbohydrate structure is insufficient to
predict whether propionate will be a major fermentation
metabolite following prebiotic consumption. It is there-
fore proposed that research be directed towards the
study of the microbial metabolic pathways that result in
propionate production. Cross-feeding reactions between
gut microorganisms must be fully uncovered and the
importance of the succinate pathway and/or acrylate
pathway for propionate production in a microbial con-
sortium must be assessed. These goals can be obtained
by applying novel molecular tools that are based on
species-specific primers. In addition, a functional gene
approach to the detection and quantification of
propionate-producing microbiota in the complexity of
the gut environment is a challenging but promising step
when validating the potential of novel functional foods
(probiotics and prebiotics) to increase gut propionate
production.
Table 4 Results of NCBI search for enzymes involved in pathways of propionate production.
Enzyme EC number No. of bacterial
species
Succinate pathway
1. Pyruvate carboxylase 6.4.1.1 243
2. Malate dehydrogenase 1.1.1.37 656
3. Fumarate hydratase 4.2.1.2 834
4. Succinate dehydrogenase 1.3.99.1 1,443
5. Succinyl-CoA synthetase 6.2.1.5 1,133
6. Methylmalonyl-CoA mutase 5.4.99.2 466
7. Methylmalonyl-CoA epimerase 5.1.99.1 99
8. Methyl malonyl-CoA decarboxylase 4.1.1.41 47
9. Propionate CoA-transferase 2.8.3.1 25
Acrylate pathway
1. L-lactate dehydrogenase 1.1.1.27 245
2. Propionate CoA-transferase 2.8.3.1 25
3. Lactoyl-CoA dehydratase – –
4. Acyl-CoA dehydrogenase 1.3.99.3 424
5. Phosphate acetyltransferase 2.3.1.8 625
6. Propionate kinase 2.7.2.15 34
Nutrition Reviews® Vol. 69(5):245–258 255
Acknowledgments
The authors thank Massimo Marzorati, Pieter Van den
Abbeele, and Benny Pycke for critical revision of this
manuscript and Frank Rubben for further scientific
discussion.
Declaration of interest. Charlotte Grootaert is funded by a
PhD grant of the Agency for Innovation by Science and
Technology (IWT). Tom Van de Wiele is a postdoctoral
research fellow from the FWO-Vlaanderen.
REFERENCES
1. Guarner F, Malagelada JR. Gut flora in health and disease.
Lancet. 2003;361:512–519.
2. Noverr MC, Huffnagel GB. Does the microbiota regulate
immune responses outside the gut? Trends Microbiol.
2004;12:562–568.
3. Backhed F, Ding H, Wang T, et al. The gut microbiota as an
environmental factor that regulates fat storage. Proc Natl
AcadSciUSA.2004;101:15718–15723.
4. Lim CC, Ferguson LR, Tannock GW. Dietary fibers as “prebiot-
ics”: implications for colorectal cancer. Mol Nutr Food Res.
2005;49:609–619.
5. Cummings JH. Short chain fatty-acids in the human-colon.
Gut. 1981;22:763–779.
6. Scheppach W. Effects of short-chain fatty-acids on gut mor-
phology and function. Gut. 1994;35:35–38.
7. Roediger WEW. Role of anaerobic-bacteria in the metabolic
welfare of the colonic mucosa in man. Gut. 1980;21:793–798.
8. Milovic V, Teller IC, Turchanowa L, Caspary WF, Stein J. Effect
of structural analogues of propionate and butyrate on colon
cancer cell growth. Int J Colorectal Dis. 2000;15:264–270.
9. Vecchia MG, Carnelos M, Fellipe CRC, Curi R, Newsholme EA.
Acetate and propionate potentiate the antiproliferative effect
of butyrate on RBL-2H3 growth. Gen Pharmacol. 1997;29:
725–728.
10. Li CJ, Elsasser TH. Butyrate-induced apoptosis and cell cycle
arrest in bovine kidney epithelial cells: involvementof caspase
and proteasome pathways. J Anim Sci. 2005;83:89–97.
11. Lin YG, Vonk RJ, Slooff MJH, Kuipers F, Smit MJ. Differences in
propionate-induced inhibition of cholesterol and triacylglyc-
erol synthesis between human and rat hepatocytes in
primary culture. Br J Nutr. 1995;74:197–207.
12. Nishina PM, Freedland RA. Effects of propionate on lipid bio-
synthesis in isolated rat hepatocytes. J Nutr. 1990;120:668–
673.
13. Miyazaki T, Ohura T, Kobayashi M, et al. Fatal propionic aci-
demia in mice lacking propionyl-CoA carboxylase and its
rescue by postnatal, liver-specific supplementation via a
transgene. J Biol Chem. 2001;276:35995–35999.
14. Delzenne NM, Williams CM. Prebiotics and lipid metabolism.
Curr Opin Lipidol. 2002;13:61–67.
15. Oba M, Allen MS. Intraruminal infusion of propionate alters
feeding behavior and decreases energy intake of lactating
dairy cows. Paper presented at: Annual Meeting of the
American-Dairy-Science-Association; Indianapolis, Indiana;
Jul, 2001.
16. RuijschopR, Boelrijk AEM, Giffel MC T. Satiety effects of a dairy
beverage fermented with propionic acid bacteria. Int Dairy J.
2008;18:945–950.
17. Zhou J, Martin RJ, Tulley RT, et al. Dietary resistant starch
upregulates total GLP-1 and PYY in a sustained day-long
manner through fermentation in rodents. Am J Physiol Endo-
crinol Metab. 2008;295:1160–1166.
18. Jan G, Belzacq AS, Haouzi D, et al. Propionibacteria induce
apoptosis of colorectal carcinoma cells via short-chain fatty
acids acting on mitochondria. Cell Death Differ. 2002;9:179–
188.
19. Cummings JH, Pomare EW, Branch WJ, Naylor CPE,
Macfarlane GT. Short chain fatty-acids in human large-
intestine, portal, hepatic and venous-blood. Gut. 1987;
28:1221–1227.
20. Xiong YM, Miyamoto N, Shibata K, et al. Short-chain fatty
acids stimulate leptin production in adipocytes through the
G protein-coupled receptor GPR41. Proc Natl Acad SciUSA.
2004;101:1045–1050.
21. Anderson JW, Chen WJL. Plant fiber-carbohydrate and lipid-
metabolism. Am J Clin Nutr. 1979;32:346–363.
22. Story JA. The role of dietary fiber in lipid metabolism. Adv
Lipid Res. 1981;18:229–246.
23. Illman RJ, Topping DL, McIntosh GH, et al. Hypocholester-
olemic effects of dietary propionate-studies in whole
animals and perfused rat-liver. Ann Nutr Metab. 1988;32:
97–107.
24. Adam A, Levrat-Verny MA, Lopez HW, Leuillet M,
Demigne C, Remesy C. Whole wheat and triticale flours with
differing viscosities stimulate cecal fermentations and lower
plasma and hepatic lipids in rats. J Nutr. 2001;131:1770–
1776.
25. Todesco T, Rao AV, Bosello O, Jenkins DJA. Propionate lowers
blood-glucose and alters lipid-metabolism in healthy-
subjects. Am J Clin Nutr. 1991;54:860–865.
26. Beaulieu KE, McBurney MI. Changes in pig serum-lipids, nutri-
ent digestibility and sterol excretion during cecal infusion of
propionate. J Nutr. 1992;122:241–245.
27. Wolever TMS, Spadafora P, Eshuis H. Interaction between
colonic acetate and propionate in humans. Am J Clin Nutr.
1991;53:681–687.
28. Gee JM, Johnson IT. Dietary lactitol fermentation increases
circulating peptide YY and glucagon-like peptide-1 in rats
and humans. Nutrition. 2005;21:1036–1043.
29. Delzenne NM, Cani PD, Daubioul C, Neyrinck AM. Impact of
inulin and oligofructose on gastrointestinal peptides. Br J
Nutr. 2005;93:157–161.
30. Delzenne NM, Daubioul C, Neyrinck A, Lasa M, Taper HS.
Inulin and oligofructose modulate lipid metabolism in
animals: review of biochemical events and future prospects.
Br J Nutr. 2002;87:255–259.
31. Meier U, Gressner AM. Endocrine regulation of energy
metabolism: review of pathobiochemical and clinical chemi-
cal aspects of leptin, ghrelin, adiponectin, and resistin. Clin
Chem. 2004;50:1511–1525.
32. Cani PD, Delzenne NM. Gut microflora as a target for energy
and metabolic homeostasis. Curr Opin Clin Nutr. 2007;
10:729–734.
33. Lahham SH, Weening D, Rezaee F, Roelofsen H, Venema K,
Vonk RJ. Propionic acid stimulates leptin production in
human adipose tissue through G-protein coupled recep-
tor(s). Paper presented at: 10th Annual Gutday, 2008; Univer-
sity Medical Centre Utrecht and Gut flora Fundation, The
Netherlands. 2008.
34. Scheppach W, Bartram HP, Richter F. Role of short-chain
fatty-acids in the prevention of colorectal-cancer. Eur J
Cancer. 1995;31A:1077–1080.
Nutrition Reviews® Vol. 69(5):245–258256
35. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ,
Brummer RJ. Review article: the role of butyrate on colonic
function. Aliment Pharmacol Ther. 2008;27:104–119.
36. Kosaka M, Takeda M, Matsumoto K, Nishimune Y. F9-cells can
be differentiated toward 2 distinct, mutually exclusive path-
ways by retinoic acid and sodium-butyrate. Dev Growth
Differ. 1994;36:223–230.
37. Hague A, Elder DJ, Hicks DJ, Paraskeva C. Apoptosis in col-
orectal tumour cells: induction by the short chain fatty acids
butyrate, propionate and acetate and by the bile salt deoxy-
cholate. Int J Cancer. 1995;60:400–406.
38. MatthewsGM. Shor t-Chain Fatty Acid Modulation of Apoptosis
in Gastric and Colon Cancer Cells. Adelaide, SA: Department of
Philosophy, The University of Adelaide; 2007.
39. Chambers AF, Groom AC, MacDonald IC. Dissemination and
growth of cancer cells in metastatic sites. Nat Rev Cancer.
2002;2:563–572.
40. Gibson GR, Roberfroid MB. Dietary modulation of the human
colonic microbiota-introducing the concept of prebiotics. J
Nutr. 1995;125:1401–1412.
41. Kien CL, Blauwiekel R. Cecal infusion of butyrate does not
alter cecal concentration of butyrate in piglets fed inulin.
JPEN J Parenter Enteral Nutr. 2008;32:439–442.
42. Janczyk P, Pieper R, Smidt H, Souffrant WB. Effect of alginate
and inulin on intestinal microbial ecology of weanling pigs
reared under different husbandry conditions. FEMS Microbiol
Ecol. 2009;72:132–142.
43. Fernandes J, Rao AV, Wolever TMS. Different substrates and
methane producing status affect short-chain fatty acid pro-
files produced by in vitro fermentation of human feces. J Nutr.
2000;130:1932–1936.
44. Vogt JA, Pencharz PB, Wolever TMS. L-rhamnose increases
serum propionate in humans. Am J Clin Nutr. 2004;80:89–
94.
45. Vogt JA, Ishii-Schrade KB, Pencharz PB, Wolever TMS.
L-rhamnose increases serum propionate after long-term
supplementation, but lactulose does not raise serum acetate.
Am J Clin Nutr. 2004;80:1254–1261.
46. Levin GV, Zehner LR, Saunders JP, Beadle JR. Sugar substi-
tutes – their energy values, bulk characteristics, and potential
health benefits. Am J Clin Nutr. 1995;62:1161–1168.
47. Laerke HN, Jensen BB. D-tagatose has low small intestinal
digestibility but high large intestinal fermentability in pigs. J
Nutr. 1999;129:1002–1009.
48. Brouns F, Kettlitz B, Arrigoni E. Resistant starch and
“the butyrate revolution.” Trends Food Sci Technol.
2002;13:251–261.
49. Cheng HH, Lai MH. Fermentation of resistant rice starch pro-
duces propionate reducing serum and hepatic cholesterol in
rats. J Nutr. 2000;130:1991–1995.
50. Van De Wiele T, Boon N, Possemiers S, Jacobs H, Verstraete W.
Prebiotic effects of chicory inulin in the simulator of the
human intestinal microbial ecosystem. FEMS Microbiol Ecol.
2004;51:143–153.
51. Van De Wiele T, Boon N, Possemiers S, Jacobs H, Verstraete W.
Inulin-type fructans of longer degree of polymerization exert
more pronounced in vitro prebiotic effects. J Appl Microbiol.
2007;102:452–460.
52. Levrat MA, Remesy C, Demigne C. High propionic-acid fer-
mentations and mineral accumulation in the cecum of rats
adapted to different levels of inulin. J Nutr. 1991;121:1730–
1737.
53. Makelainen HS, Makivuokko HA, Salminen SJ, Rautonen NE,
Ouwehand AC. The effects of polydextrose and xylitol on
microbial community and activity in a 4-stage colon simula-
tor. J Food Sci. 2007;72:153–159.
54. Lopez HW, Levrat MA, Guy C, Messager A, Demigne C,
Remesy C. Effects of soluble corn bran arabinoxylans on cecal
digestion, lipid metabolism, and mineral balance (Ca, Mg) in
rats. J Nutr Biochem. 1999;10:500–509.
55. Swennen K, Courtin CM, Lindemans G, Delcour JA. Large-
scale production and characterisation of wheat bran arabi-
noxylooligosaccharides. J Sci Food Agric. 2006;86:1722–
1731.
56. Grootaert C, Van den Abbeele P, Marzorati M, et al. Compari-
son of prebiotic effects of arabinoxylan oligosaccharides and
inulin in a simulator of the human intestinal microbial eco-
system. FEMS Microbiol Ecol. 2009;69:231–242.
57. Edwards S, Chaplin MF, Blackwood AD, Dettmar PW. Primary
structure of arabinoxylans of ispaghula husk and wheat bran.
Proc Nutr Soc. 2003;62:217–222.
58. Edwards CA, Eastwood MA. Comparison of the effects of ispa-
ghula and wheat bran on rat cecal and colonic fermentation.
Gut. 1992;33:1229–1233.
59. Moreira LRS, Filho EXF. An overview of mannan structure and
mannan-degrading enzyme systems. Appl Microbiol Bio-
technol. 2008;79:165–178.
60. Asano I, Hamaguchi K, Fujii S, Iino H. In vitro digestibility and
fermentation of mannooligosaccharides from coffee
mannan. Food Sci Technol Res. 2003;9:62–66.
61. Asano I, Ikeda Y, Fujii S, Iino H. Effects of mannooli-
gosaccharides from coffee on microbiota and short chain
fatty acids in rat cecum. Food Sci Technol Res. 2004;10:273–
277.
62. Michel C, Benard C, Lahaye M, et al. Algal oligosaccharides as
functional foods: in vitro study of their cellular and fermen-
tative effects. Sci Aliments. 1999;19:311–332.
63. Campbell JM, Fahey GC, Wolf BW. Selected indigestible oli-
gosaccharides affect large bowel mass, cecal and fecal short-
chain fatty acids, pH and microflora in rats. J Nutr.
1997;127:130–136.
64. Scheifin CC, Wolin MJ. Propionate formation from cellulose
and soluble sugars by combined cultures of Bacteroides suc-
cinogenes and Selenomonas ruminantium. Appl Microbiol.
1973;26:789–795.
65. Macy J, Probst I, Gottschalk G. Evidence for cytochrome
involvement in fumarate reduction and adenosine
5`-triphosphate synthesis by Bacteroides fragilis grown in
presence of hemin. J Bacteriol. 1975;123:436–442.
66. Macy JM, Ljungdahl LG, Gottschalk G. Pathway of succinate
and propionate formation in Bacteroides fragilis. J Bacteriol.
1978;134:84–91.
67. Johns AT. The mechanism of propionic acid formation by Pro-
pionibacteria. J Gen Microbiol. 1951;5:337–345.
68. Delwiche EA. Mechanism of propionic acid formation by
Propionibacterium pentosaceum. J Bacteriol. 1948;56:811–
820.
69. Whiteley HR. The mechanism of propionic acid formation by
succinate decarboxylation. I. The activation of succinate. Bio-
chemistry. 1953;39:772–779.
70. Wood HG, Stjernholm R, Leaver FW. The Role of succinate as
a precursor of propionate in the propionic acid fermentation.
J Bacteriol. 1956;72:142–152.
71. Tholozan JL, Touzel JP, Samain E, Grivet JP, Prensier G,
Albagnac G. Clostridium neopropionicum sp nov, a strict
anaerobic bacterium fermenting ethanol to propionate
through acrylate pathway. Arch Microbiol. 1992;157:249–
257.
Nutrition Reviews® Vol. 69(5):245–258 257
72. Marounek M, Fliegrova K, Bartos S. Metabolism and some
characteristics of ruminal strains of Megasphaera elsdenii.
Appl Environ Microbiol. 1989;55:1570–1573.
73. Brancaccio M, Legendre GG. Megasphaera elsdenii endocardi-
tis. J Clin Microbiol. 1979;10:72–74.
74. Hino T, Shimada K, Maruyama T. Substrate preference in a
strain of Megasphaera elsdenii, a ruminal bacterium, and its
implications in propionate production and growth competi-
tion. Appl Environ Microbiol. 1994;60:1827–1831.
75. Falony G, Vlachou A, Verbrugghe K, DeVuyst L. Cross-feeding
between Bifidobacterium longum BB536 and acetate-
converting, butyrate-producing colon bacteria during
growth on oligofructose. Appl Environ Microbiol. 2006;72:
7835–7841.
76. Paynter MJB, Elsden SR. Mechanism of propionate formation
by Selenomonas ruminantium, a rumen microorganism. J Gen
Microbiol. 1970;61:1–7.
77. Boadi D, Benchaar C, Chiquette J, Masse D. Mitigation strate-
gies to reduce enteric methane emissions from dairy cows:
update review. Can J Anim Sci. 2004;84:319–335.
78. Morvan B, RieuLesme F, Fonty G, Gouet P. In vitro interactions
between rumen H2-producing cellulolytic microorganisms
and H2-utilizing acetogenic and sulfate-reducing bacteria.
Anaerobe. 1996;2:175–180.
79. Lopez S, Valdes C, Newbold CJ, Wallace RJ. Influence of
sodium fumarate addition on rumen fermentation in vitro. Br
J Nutr. 1999;81:59–64.
80. Roediger WEW, Moore J, Babidge W. Colonic sulfide in patho-
genesis and treatment of ulcerative colitis. Dig Dis Sci.
1997;42:1571–1579.
81. Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI.
Host-bacterial mutualism in the human intestine. Science.
2005;307:1915–1920.
82. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quan-
tification of bacterial groups within human fecal flora by oli-
gonucleotide probe hybridization. Appl Environ Microbiol.
2000;66:2263–2266.
83. Matsuki T, Watanabe K, Fujimoto J, et al. Development of 16S
rRNA-gene-targeted group-specific primers for the detection
and identification of predominant bacteria in human feces.
Appl Environ Microbiol. 2002;68:5445–5451.
84. Louis P, Duncan SH, McCrae SI, Millar J, Jackson MS, Flint HJ.
Restricted distribution of the butyrate kinase pathway
among butyrate-producing bacteria from the human colon. J
Bacteriol. 2004;186:2099–2106.
85. Asanuma N, Hino T. Molecular characterization, enzyme
properties and transcriptional regulation of phospho-
enolpyruvate carboxykinase and pyruvate kinase in a ruminal
bacterium, Selenomonas ruminantium. Microbiology. 2001;
147:681–690.
86. Vanhoutte T, De Preter V, De Brandt E, Verbeke K, Swings J,
Huys G. Molecular monitoring of the fecal microbiota of
healthy human subjects during administration of lactulose
and Saccharomyces boulardii. Appl Environ Microbiol.
2006;72:5990–5997.
87. Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M,
Benno Y. Diet-dependent shifts in the bacterial population of
the rumen revealed with real-time PCR. Appl Environ Micro-
biol. 2001;67:2766–2774.
88. Stevenson DM, Weimer PJ. Dominance of Prevotella and low
abundance of classical ruminal bacterial species in the bovine
rumen revealed by relative quantification real-time PCR. Appl
Microbiol Biotechnol. 2007;75:165–174.
89. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantifi-
cation of predominant anaerobic bacteria in human and
animal fecal samples. Appl Environ Microbiol. 1996;62:1242–
1247.
90. Rossi F, Torriani S, Dellaglio F. Genus- and species-specific
PCR-based detection of dairy Propionibacteria in environ-
mental samples by using primers targeted to the genes
encoding 16S rRNA. Appl Environ Microbiol. 1999;65:4241–
4244.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the
online version of this article:
Tab le S1 Bacterial ranking based on the total number of
encoding genes for the enzymes involved in the succi-
nate pathway. Numbers of species possessing the
enzymes for each genus are presented.
Tab le S2 Bacterial ranking based on the total number of
enzymes involved in acrylate pathway. Numbers of
species possessing the enzymes for each genus are
presented.
Please note: Wiley-Blackwell is not responsible for the
content or functionality of any supporting materials sup-
plied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
Nutrition Reviews® Vol. 69(5):245–258258
