Content uploaded by Dena Leshkowitz
Author content
All content in this area was uploaded by Dena Leshkowitz
Content may be subject to copyright.
Copyright © 2011 by the Genetics Society of America
DOI: 10.1534/genetics.111.128348
Wheat Hybridization and Polyploidization Results in Deregulation
of Small RNAs
Michal Kenan-Eichler,* Dena Leshkowitz,
†
Lior Tal,* Elad Noor,* Cathy Melamed-Bessudo,*
Moshe Feldman* and Avraham A. Levy*
,1
*
Department of Plant Sciences, Weizmann Institute of Science, Rehovot, 76100 Israel and
†
Bioinformatics Unit,
Weizmann Institute of Science, Rehovot, 76100 Israel
Manuscript received March 3, 2011
Accepted for publication April 4, 2011
ABSTRACT
Speciation via interspecific or intergeneric hybridization and polyploidization triggers genomic responses
involving genetic and epigenetic alterations. Such modifications may be induced by small RNAs, which
affect key cellular processes, including gene expression, chromatin structure, cytosine methylation and
transposable element (TE) activity. To date, the role of small RNAs in the context of wide hybridization and
polyploidization has received little attention. In this work, we performed high-throughput sequencing of
small RNAs of parental, intergeneric hybrid, and allopolyploid plants that mimic the genomic changes
occurring during bread wheat speciation. We found that the percentage of small RNAs corresponding to
miRNAs increased with ploidy level, while the percentage of siRNAs corresponding to TEs decreased. The
abundance of most miRNA species was similar to midparent values in the hybrid, with some deviations, as seen
in overrepresentation of miR168, in the allopolyploid. In contrast, the number of siRNAs corresponding to TEs
strongly decreased upon allopolyploidization, but not upon hybridization. The reduction in corresponding
siRNAs, together with decreased CpG methylation, as shown here for the Veju element, represent hallmarks of
TE activation. TE-siRNA downregulation in the allopolyploid may contribute to genome destabilization at the
initial stages of speciation. This phenomenon is reminiscent of hybrid dysgenesis in Drosophila.
INTERSPECIFIC or intergeneric hybridization and
whole-genome doubling provide a mechanism for
“overnight”speciation (Rieseberg and Willis 2007;
Leitch and Leitch 2008; Soltis and Soltis 2009;
Wood et al. 2009). Wheat, Spartina, Senecio, and Trag-
opogon are examples of recent speciation via wide hy-
bridization and polyploidization. It has been argued
that in nature, there are plenty of opportunities for in-
terspecific hybridization and genome doubling, with an
estimated 10% hybridization among animals and 25%
among plants (Mallet 2007). Moreover, unreduced
gametes, which are occasionally produced in most plant
species (Bretagnolle and Thompson 1995), were
shown to occur at a frequency of up to 50% in some
combinations of intergeneric hybrids of wheat (Kihara
and Lilienfeld 1949). Therefore, one might expect
new hybrid and polyploid species to be formed more
frequently than documented (Van DePeer et al. 2009).
This apparent paradox may be resolved by works dem-
onstrating the genome-wide genetic and epigenetic im-
pact of genome merging or doubling, consequently
challenging maintenance of genome functionality and
stability. While some intergenomic combinations show
hybrid incompatibility (Bomblies and Weigel 2007;
Ishikawa and Kinoshita 2009; Walia et al. 2009) or
hybrid dysgenesis (Malone and Hannon 2009), or fea-
ture reduced fitness, others show improved vigor (Chen
2010). The mechanisms dictating nascent hybrid and
polyploid survival are therefore of particular interest
when attempting to understand the opportunities and
bottlenecks of speciation.
A genetic model for such hybrid incompatibility was
proposed by Dobzhansky (1936) and thoroughly re-
viewed by Landry et al. (2007), whereby divergent loci
or alleles demonstrate incompatibility when merged in-
to the same nucleus. More recently, Tirosh et al. (2009)
performed a genome-wide analysis of gene expression
in yeast interspecific hybrids and analyzed interactions
between cis- and trans-acting regulatory factors and their
relation to gene expression rewiring in hybrid genomes.
Distinct expression patterns in the hybrid were shown
to account for both hybrid failure (Landry et al. 2007)
and hybrid vigor (Niet al. 2009; Birchler et al. 2010).
Whole-genome doubling of interspecific or interge-
neric hybrids gives rise to allopolyploid species, which
present the same type of novel intergenomic interac-
tions as those found in interspecific hybrids while also
providing fertility rescue. Plant allopolyploidy also offers
Supporting information is available online at http://www.genetics.org/
cgi/content/full/genetics.111.128348/DC1.
Sequence data from this article have been deposited with the GenBank
Data Libraries under accession no. GSE29243.
1
Corresponding author: Weizmann Institute of Science, Plant Sciences
Department, Rehovot, Israel, 76100. E-mail: avi.levy@weizmann.ac.il
Genetics 188: 263–272 ( June 2011)
an additional level of opportunities for the newly
formed species, such as mutation buffering, sub- and
neofunctionalization of duplicated genes, fixed hetero-
zygosity, and a broader range of dosage responses (Comai
2005; Doyle et al. 2008; Chen 2010). Most angiosperms
undergo one or more polyploidization events in their
lineage (Van DePeer et al. 2009) and 2–4% of all spe-
ciation events seem to occur via polyploidization (Otto
and Whitton 2000). Despite these potential advantages,
polyploidization events can lead to “genomic shock”due
to gene redundancy, imbalanced and antagonistic gene
expression, orchestration of DNA replication among the
multiple and sometimes different genomes, and pairing
between multiple homologous and homeologous chro-
mosomes. Studies in several species have shown a broad
range of adverse genetic and epigenetic responses, which
occur soon after hybridization and polyploidization, in-
cluding DNA deletions, rearrangements or cytosine meth-
ylation, gene silencing, activation of transposons, and
modification of parental imprinting (Comai 2005;
Doyle et al. 2008; Chen 2010). Small RNAs have been
associated with all of these events (Matzke and Birchler
2005) and therefore, changes in small RNA species in
hybrids and polyploids might provide mechanistic in-
sight into the control of genetic and epigenetic changes
that occur in response to polyploidization.
Endogenous plant small RNAs can be divided into
several classes (Ghildiyal and Zamore 2009), where two
of the most prominent classes include the 21-nucleotide
(nt)-long species, mostly corresponding to microRNAs
(miRNA), and the small interfering RNAs (siRNAs),
typically 24 nt in length. Several dsRNA-mediated path-
ways operating at the level of the nuclear genome have
been described in plants and include RNA-directed DNA
methylation (Matzke and Birchler 2005) and small
RNA-mediated DNA demethylation (Penterman et al.
2007). Small RNAs have been shown to be involved in
a broad range of functions including heterochromatin
formation and silencing (Lippman and Martienssen
2004). siRNAs seem to function as guardians against
transposable elements (TEs) during plant development
(Levy and Walbot 1990; Hsieh et al. 2009; Gehrin
et al. 2009; Mosher et al. 1990; Slotkin et al. 2009).
However, their role in transposon regulation in the con-
text of hybridization or polyploidization has received far
less attention.
In this work, we performed a high-throughput screen
of small RNAs in parental, hybrid, and allopolyploid
plants mimicking the events that shaped the genome
during the speciation of bread wheat. We show that
miRNAs and repeat-derived siRNAs respond differently
to changes in ploidy level. In addition, the siRNA pools
corresponding to transposons were significantly reduced
upon allopolyploidization. In parallel, we show that the
reduction or total disappearance of siRNAs correlated
with decreased CpG methylation of target transposons.
This deregulation of siRNAs, and the associated reduc-
tion in transposon methylation, may contribute to genome
instability and may hinder speciation via hybridization
and polyploidization.
MATERIALS AND METHODS
Plant material: Seeds were germinated on wet 3MM papers
in petri dishes. All seeds were imbibed for 24 hr at room
temperature under regular light. Seeds of Aegilops tauschii
then underwent 3–6 weeks of vernalization, at 4in the dark.
After germination, plantlets were placed in 5-liter pots and
grown in a greenhouse. All plants were grown during the
winter, at 20and under short-daylight conditions.
Pollen from the diploid wheat Aegilops tauschii, cultivar
TQ113 (genome DD, kindly provided by J. Dvorˇak), was used
to manually pollinate stigmas of the tetraploid wheat Triticum
turgidum ssp. durum, cultivar Langdon (TTR16, genome BBAA),
which served as the female parent, to generate BAD F1 hybrids.
Pollination was performed early in the morning, using freshly
collected pollen, 2–3 days after emasculation of the female-
parent flowers. The hybrid plants were mostly sterile. F1 spikes
were bagged to prevent outcrossing. Occasionally, seeds were
obtained from the spikes of F1 plants. Typically, spikes from
F1 plants spontaneously gave zero to one seed, corresponding
to an average frequency of 1%, consistent with reports of
frequent occurrence of unreduced gametes, in similar interge-
neric hybrids of wheat (Kihara and Lilienfeld 1949). Allopoly-
ploid plants derived from these seeds were then characterized
(see RESULTS for details).
Preparation of metaphase chromosomes from wheat root
tips: To count chromosomes in F1 hybrids and in newly
synthesized amphiploids, root tips of germinated seeds were
cut, subjected to 24 hr cold treatment in double-distilled water
to arrest mitosis, and then transferred to a 2% acetocarmine
staining solution for 2–3 days. Before squashing, root tips were
briefly heated in a solution containing 4 drops of 2% aceto-
carmine and 1 drop of 1 NHCl. Squashing was performed on
a preparative slide, in one drop of 2% acetocarmine.
RNA extraction: Total RNA was extracted from 2 g of whole
2-month-old plant tiller tissue, using 25 ml TRI reagent
(Molecular Research Center, Cincinnati, OH), according to
the manufacturer’s protocol, with the exception of isopropa-
nol precipitations and ethanol washes, which were performed
overnight, at 220. The plant material used in this study con-
sisted of six TTR16 plants, six TQ113 plants, three F1 hybrid
plants, and six newly synthesized S1 amphiploid plants, whose
polyploid nature had been previously confirmed by karyotype
analysis. Tissues from all genotypes were at the vegetative phase.
Small RNA library preparation: RNA quality of all samples
was verified using a bio-analyzer. Cloning of small RNAs was
performed by Illumina (San Diego, CA), using the DGE small-
RNA sample preparation kit protocol v1.0 (Illumina, Hayward,
CA). In brief, small RNAs (18–32 nt long) were size selected,
purified, and ligated with 39and 59adaptors. Four cDNA librar-
ies of size-selected RNA from the four pools of plants were
prepared by reverse-transcription PCR, followed by PCR.
Bioinformatic analysis of small RNA high-throughput se-
quencing data: Eighteen million reads were obtained from
high-throughput sequencing of small RNAs from the four
libraries. Within each library, the unique sequences were re-
ported as tags containing sequence information and frequency.
There were 9.8 million tags in total for all four libraries. A script
was developed to trim the 39adaptor: in the first step, the first 7
bases from the adaptor and any downstream sequence were
removed. Then the process was repeated allowing one mis-
match in the adaptor sequence. Sequences that contained
264 M. Kenan-Eichler et al.
more than 3 N’s were also eliminated. Tag frequencies were
recalculated after these steps and resulted in 8.9 million tags.
Following quality control, tags with a frequency of at least
30 reads were assembled into short contigs using the Staden
sequence analysis program’s(Staden 1996) “normal shotgun
assembly”module with a minimal initial match of 20 bases,
allowing 5% maximal mismatch, and then allowing additional
assembly with 17 bases with no mismatch. Eventually, 21,787
tags were assembled into 6892 contigs. The number of reads
and tags in each library is summarized in supporting informa-
tion,Table S1. The Staden program produces a file, which
reveals the relationship between the contigs and the sequen-
ces and thus helps determine the contigs composition and
library frequencies. Contigs were annotated using Eland ver-
sion 0.3 and BLAST 2.2.17 (Altschul et al. 1990). Searches
were performed against the following databases: NCBI nr/nt
( July 2008), the rice genome (ftp://ftp.plantbiology.msu.
edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/
pseudomolecules/version_5.0 and version_6.0), wheat repeats
(http://www.tigr.org/tdb/e2k1/tae1/wheat_downloads.shtml –
wheat repeat database), T. aestivum release 2 (ftp://ftp.tigr.
org/pub/data/plantta/Triticum_aestivum), T. turgidum release
1 (ftp://ftp.tigr.org /pub/data/plantta/Triticum_turgidum),
and mature miRNA (http://microrna.sanger.ac.uk/sequences/).
Specifically, for miRNA detection, Eland_21 (seed of 21 ba-
ses) was run against plant miRNAs using a script that slides
awindowof21basesalongthecontigsequence.OnlymiR-
NAs with no mismatches were reported. Using the output of
BLASTn table against the TIGR wheat repeat database, the
contig hits were divided into several subcategories: retroele-
ments, DNA transposons, repetitive element, and unclassi-
fied repeats.
Contig frequency was calculated by summing the frequency
of each tag comprising the contig. Interlibrary normalization
was performed by dividing the contig frequency count per
library, by a factor that was calculated by dividing by the total
number of reads from tags with more than 30 reads. Therefore,
the calculation represents the frequency per million reads. A
rigorous significance test was performed according to Audic
and Claverie (1997). For miRNA counting, all contigs with
the same seed sequence were summed.
Northern blot analyses: Northern blot analyses were per-
formed as previously described (Brown and Mackey 2001).
Briefly, 15 mg of total RNA was loaded on formamide-agarose
gels and later transferred to a Hybond N
1
nylon membrane
(Amersham) via the standard wet transfer method. The Wis2-
1A LTR probe was prepared using the forward primer 59
TGTTGGAAATATGCCCTAGAG 39and the reverse primer
59GCACAATCTCATGGTCTAAGG 39; the Veju LTR probe
was prepared using the forward primer 59TAGAATAAATC
CGAGGCATACC 39and the reverse primer 59TTAGGTTA
CAGTTGGACTTGG 39, for amplification from the T. aestivum
var. Chinese Spring genome.
Probes were labeled with [a-
32
P]dCTP (Amersham) using
Klenow DNA polymerase (Fermentas). The membranes were
blotted overnight with 20 pmol of the labeled probe and then
exposed overnight to a phosphorimager screen, and images
were visualized using the Image Gauge program. Membranes
were stripped for reuse, in 0.1% SDS and verified to give no
signal.
Bisulfite sequencing: Hybrid and polyploid genomic DNA
was extracted from 100 mg of leaf tissue, using the GeneElute
Plant genomic DNA miniprep kit (Sigma). Two micrograms of
genomic DNA suspended in 0.5 ml double-distilled water was
sheared on ice by ultrasound (Microson sonicator, Misonix)
set at 3 W output power, four pulses of 10 sec each with 50-sec
intervals between pulses. Sheared DNA was concentrated to
afinal volume of 20 ml, using a speed vacuum set at 60for
2 hr. The genomic DNA was then subjected to bisulfite conver-
sion and purification using the EpiTect Bisulfite kit (Qiagen),
according to the manufacturer’s instructions. Bisulfite ions
convert nonmethylated cytosine residues to uracil residues.
Fifty nanograms of purified DNA were then subjected to
PCR, using degenerate primers (Metabion), designed to am-
plify the Veju retrotransposon LTR (Veju degenerate forward
primer, 59AGTGAATGTYAAGTTGTTGGTG 39;Veju degener-
ate reverse primer, 59TCRAACAACCTARCTCATRATAC 39).
The PCR products were then separated on a 2% agarose gel
and purified using a PCR purification kit (RBC). Cleaned PCR
products were ligated to a pGem-T easy vector (Promega),
which were then used to transform Escherichia coli (top 10
strain); transformed bacteria were then plated on selective
plates. Plasmid DNA was extracted from 25 bacterial colonies
for each plant and then sequenced. Sequences were analyzed
using the Sequencher 4.9 program, and methylation patterns
were analyzed using the Kismeth program http://katahdin.
mssm.edu/kismeth/revpage.pl (Gruntman et al. 2008).
RESULTS
Phenotypic analysis of hybrid and polyploid wheat:
To gain insight into the molecular mechanisms leading
to the genetic and epigenetic changes occurring upon
hybrid and polyploid formation, the small RNA profiles
of parental wheat lines were compared to those of the
derived hybrid and the first allopolyploid generation.
More specifically, the four wheat species analyzed
included the parental tetraploid T. turgidum ssp. durum
(genome BBAA) and the diploid Ae. tauschii (genome
DD), their synthetic triploid hybrid (genome BAD),
and their derived hexaploid (genome BBAADD). This
synthetic hexaploid is analogous in genome structure to
bread wheat T. aestivum ssp. aestivum. Parental lines were
self-pollinated for several generations, with spike bag-
ging to prevent cross-pollination, and were thus consid-
ered inbred. Hybrid seeds were obtained by crossing
T. turgidum and Ae. tauschii. The hybrid F1 seeds were
obtained from the female tetraploid plants and were
found to be very small and shriveled compared to their
parents (Figure 1). Upon germination, F1 seeds gave rise
to F1 plants bearing necrotic leaves (Figure 1), a typical
hybrid incompatibility phenotype (Bomblies and Weigel
2007). Some F1 plants died shortly after germination.
Nevertheless, those that survived were vigorous and fea-
tured spikes larger than their parents (Figure 1), but
most were sterile. Occasionally, seeds were spontaneously
obtained from the spikes of F1 plants (See materials
and methods) and were termed “S1.”While these
seeds were slightly shriveled, they were larger in size
than the seeds of either parent (Figure 1). Plants ger-
minating from S1 seeds has a duplicated genome as
confirmed by karyotype analysis (Figure S1). The result-
ing S1 plants were fertile and bore spikes that yielded S2
seeds, which were less shriveled than, but similar in size
to, S1 seeds. While S1 plant leaves were highly necrotic,
the plants were vigorous and featured spikes larger than
those in the hybrid or in the parents and leaves similar
in size to those of the tetraploid parent (Figure 1).
Deregulation of Small RNAs 265
High-throughput sequencing of small RNAs: Total
RNA was isolated from tillers of 2-month-old wheat
plants, which primarily included somatic tissues, namely
leaves and stems and some meristematic tissues. A small
RNA library was prepared for each of the analyzed
wheat types and was composed of a pool of RNA col-
lected from three to six plants of each genotype. Eigh-
teen million reads were obtained from small RNA
sequencing of the four libraries (Table S1). The unique
sequences within each library were reported as tags
(containing sequence information and frequency).
These tags underwent strict quality checks (Figure S2
and materials and methods), and only tags that had
30 reads or more were included in the analysis, due to
lack of a fully sequenced reference genome. As the
data from a number of small RNA sequencing experi-
ments proved highly reproducible (with a correlation of
Spearman’sr¼0.95–0.98) for tags with $30 reads
(Fahlgren et al. 2009), this number was set as the thresh-
old for data analysis. Of the 18 million reads obtained, 6
million high-quality reads, corresponding to 21,787
unique sequence tags, were analyzed. The small RNA
sizes ranged between 18 and 35 nt and included the
two prominent classes of 21 nt- and 24 nt-long small RNAs
(Figure 2). The 21-nt class corresponds mainly to miRNA,
while the 24-nt class corresponds most likely to siRNAs
(Ghildiyal and Zamore 2009). The 24-nt-long small
RNAs were most abundant within the two parental and
and the hybrid libraries, whereas, the 21-nt-long small
RNAs were most prevalent in the allopolyploid library.
The various small RNAs obtained from tags with $30
reads were categorized according to sequence similarity
(Figure S3). miRNAs were one of the most abundant
small RNA species (21–44%, depending on the geno-
type). Small RNAs that matched repeats, which were
largely TEs, represented 12% of the total reads for
all libraries, aside from the allopolyploid library, where
a significant decrease (P(x
2
),0.0001) to only 6% was
observed. Surprisingly, tRNAs comprised 9% of total
hits in the parental and hybrid libraries and rose to 20%
(P(x
2
),0.0001) in the allopolyploid library (Figure S3).
Small RNA contigs matching tRNA genes ranged in size
between 18 and 36 bases. However, 55% of the small
RNA tags corresponding to tRNAs showed distinct peaks
at 19, 20, and 21 nt, suggesting that they were not deg-
radation products of larger tRNA molecules. No excep-
tional RNA degradation was observed in any of the
samples, hence degradation could not explain the higher
tRNA frequency observed in allopolyploid samples.
Abundance of miRNAs in parent, hybrid and allo-
polyploid libraries: Twenty-one known plant miRNA
sequences were identified with high certainty, i.e., with
$30 reads each, and were identical to known miRNAs
from other plant species (Table S2). For example,
miR168, the most abundant miRNA in rice (Luet al.
2008), was the most abundant in the present data. In-
terestingly, the amount of miRNA, relative to total small
RNA, increased with increasing levels of ploidy, being
the lowest (21%) in the diploid Ae. tauschii DD genome,
33% in the triploid hybrid genome (BAD), 38% in the
tetraploid T. turgidum BBAA genome, and 44% in the
synthetic hexaploid BBAADD genome (Figure 3).
Figure 1.—Parents, hybrids, and allopolyploid plant mate-
rial. Triticum turgidum durum (female parent, genome BBAA)
and Aegilops tauschii (male parent, genome DD) leaves, spikes,
and seeds are shown at the top left and top right, respectively.
Plant crossing yielded small and shriveled hybrid (F1) seeds
(genome BAD, in the center), from which hybrid F1 plants
were grown. F1 plants featured necrotic leaves and were mostly
sterile, occasionally and spontaneously giving rise to allopoly-
ploid (S1) seeds (middle), with a doubled chromosome num-
ber. S1 seeds were larger than the seeds of both parents and
were somewhat shriveled. S1 plants (bottom), derived from S1
seeds, bore leaves as broad as the maternal plant, spikes larger
than those of both parents, and yielded S2 seeds (bottom left),
which were as large as S1 seeds, and a little less shriveled. Scale
bar, 0.5 cm.
266 M. Kenan-Eichler et al.
To assess the changes in the abundance and profile
of miRNAs expressed as a result of hybridization and
polyploidization, we compared the normalized number
of hits (in reads per million) found in the hybrid and
the polyploid libraries to the average number of hits in
the two parental libraries, namely the midparent value
(MPV). Under the assumption of additive expression,
the number of hits in F1 or S1 should be similar to the
midparent value: log
2
(F1/MPV) or log
2
(S1/MPV) ¼0.
Positive log
2
values indicate that the number of small
RNAs for a given tag is higher in the hybrid or the
polyploid than in the parent average; negative values
indicate the opposite. When applying a cutoff value in
which jlog
2
j,0.5 is considered similar to MPV, most
miRNAs were expressed to similar degrees as the MPV
(Figure 4). However, miR390a was underrepresented
(log
2
(F1/MPV) ¼24.8), and miR160f was overrepre-
sented (log
2
(F1/MPV) ¼4.86) when comparing hybrid
miRNA expression profiles to those of the parent librar-
ies. Interestingly, both miR390 and miR160 play key
roles in auxin regulation, via regulation of TAS3, a
trans-acting siRNA involved in auxin signaling (Fahlgren
et al. 2006) by the former and via targeting of ARF10
(Liu et al. 2007) by the latter. In the allopolyploid
plants, several miRNA expression patterns significantly
deviated from those observed in the parental lines.
miR157a, miR160f, miR159a, miR396d, and miR168
were significantly overrepresented relative to MPV, while
miR156b, miR165a, and miR1135 were significantly un-
derrepresented. miR168 had the highest number of
reads in almost all libraries, amounting to 25% of the
polyploid library reads and 119,710 and 79,244 reads in
T. turgidum and Ae. tauschii libraries, respectively (Table
S2). It was overrepresented by 1.27-fold in the hybrid
and by 2.46-fold in the synthetic polyploid, relative to
the midparent value (MPV ¼99,477) and is suggested
to have genome-wide effects on small RNA species (see
discussion). miR156 was the second-highest tag ex-
pressed in the model, while miR1135 was only moderately
expressed (Table S2). miR156a was overrepresented by
2.4-fold in the polyploid relative to the MPV. miR156
and its related sequence is of particular interest, as its
overexpression has been suggested to prolong the vegeta-
tive phase and to delay flowering in Arabidopsis (Schwarz
et al. 2008) and may explain the heterotic effects seen here
in the allopolyploid plants.
siRNAs that correspond to repeats: Small 24-nt-long
RNAs were abundant in all the libraries, where a large
percentage of these siRNAs corresponded to repeats:
1113 Staden contigs out of a total of 6892 correspond
to transposons and retrotransposons. An additional
130 contigs corresponded to ribosomal RNA genes and
telomeric and centromeric repeats. siRNAs matching
known genes often corresponded to repeats as well.
Here, we focused on repeats, using the complete wheat
repeat database (http://wheat.pw.usda.gov/ITMI/Repeats/
flatfile.total) as reference.
Transposons, which make up approximately 80% of
the wheat genome (Charles et al. 2008), comprise a
major class of repeats. Recently, small RNAs have been
mapped to the repeat sequences of the Triticeae repeats
database (Cantu et al. 2010). This work demonstrates
the changes in TE-related small RNAs following hybrid-
ization and polyploidization and confirms that TEs are
targets of small RNAs, particularly at their termini. In
contrast to miRNAs, the amount of siRNAs correspond-
ing to transposons decreased with increased ploidy (Fig-
ure 3). In the hybrid, 42% of siRNAs corresponding to
transposons were represented similarly to the MPV (de-
fined here as jlog
2
j,0.5), while 39% were underrepre-
sented and 19% were overrepresented. In the allopolyploid,
a massive reduction and significant shift (P(x
2
),0.0001)
in the relative abundance of siRNAs corresponding to
transposons was observed, with 85% of the hits below
the MPV (Figure 5). This underrepresentation affected
Figure 2.—Length distribution of small RNAs. Length dis-
tribution of small RNAs in the four libraries. Small RNAs
ranged in size from 18 to 35 nucleotides, with two prominent
peaks at 21 and 24 nucleotides. Note that the x-axis is not
linear at the end.
Figure 3.—Changes in small RNA expression levels as
a function of plant ploidy. Percentage of siRNAs correspond-
ing to repeats, and of miRNA reads, as a function of genome
ploidy (where X is a haploid genome) and genomic compo-
sition. The percentage of reads was determined from the total
number of small RNA reads in each library, thus enabling
a comparison between the different ploidy groups.
Deregulation of Small RNAs 267
both DNA elements and retroelements (Table 1). Small
RNA matching to the sequenced and annotated T. aestivum
BAC genome region (GenBank accession no. CT009735),
using IGB (Integrative Genome Browser), confirmed the
massive reduction of small RNAs corresponding to trans-
posons, in the polyploid compared to the parental lines
(Figure 6). Note that in the data used by Cantu et al.
(2010), the number of reads corresponding to Veju in
natural hexaploid wheat was very low (1/400,000), sim-
ilar to the data shown here for the synthetic hexaploid,
but contrasting with the present data collected from
natural tetraploid and diploid wheat.
We then examined whether the reduction in TE-
related siRNAs correlated with hallmarks of transposons
activation. Table 1 summarizes several examples of ret-
rotransposons and DNA transposons for which small
RNAs were underrepresented in the polyploid com-
pared to the parental lines. We then tested whether
siRNA underrepresentation correlated with transcrip-
tional activation of the copia-like retrotransposon Wis2-
1A and of Veju,a“terminal-repeat retrotransposon in
miniature”(TRIM) element (Sanmiguel et al. 2002).
In both cases, the allopolyploid expressed higher tran-
script levels than the hybrid, further substantiating the
observed reduction in corresponding siRNAs. However,
the tetraploid parent also expressed high transcript lev-
els, thus, no straightforward correlation can be drawn
between small RNA and corresponding mRNA levels,
detected by Northern hybridization (Figure S4).
Cytosine methylation represents an additional hall-
mark of transposon activity and has been reported to be
reduced in active and hypermethylated in silent trans-
posons (Chandler and Walbot 1986). As a case study,
we performed bisulfite sequencing of the LTR of a Veju
element, using the available sequence from a transposon-
rich region in the T. aestivum genome (GenBank acces-
sion no. CT009735, coordinates 38,989–39,363). Seven
different small RNAs, corresponding to hundreds of
reads, were mapped along the LTR sequence (Figure
7, middle) and shown to derive from both strands. All
seven were almost fully suppressed in the allopolyploid
line (Figure 7, top). Sequencing of 25 different Veju-
LTR clones per plant type, following bisulfite conver-
sion, enabled us to determine the average methylation
of Veju elements similar in sequence to the T. aestivum
LTR (GenBank accession no. CT009735; see meth-
ods). A decrease in CG methylation (Figure 7, bottom)
but not in CHG or CHH methylation (data not shown),
was observed in the allopolyploid line and correlated
with decreased abundance of Veju LTR small RNAs in
Figure 4.—miRNA abundance in the
hybrid and polyploid lines. miRNA
abundance in the hybrid (F1, gray)
and the polyploid (S1, black) relative
to the midparent value (MPV) is shown
as a logarithmic cumulative distribution
function (n¼21). Positive values indi-
cate higher abundance in the hybrid or
polyploid compared to the MPV, nega-
tive values indicate the opposite and
values close to zero indicate similar
abundance between the analyzed and
parental lines.
Figure 5.—Abundance of small RNAs correspond-
ing to transposons. The abundance in the hybrid (F1,
gray) and the polyploid (S1, black) relative to the
midparent value is shown as a logarithmic cumulative
distribution function (n¼1113). The box on the top
left summarizes the abundance relative to the midpar-
ent value. In the hybrid, 42% of the small RNAs cor-
responding to transposons had an abundance similar
to the midparent (jlog
2
j,0.5), 19% were overrepre-
sented (log
2
.0.5), and 39% were underrepresented
(log
2
,20.5). In the polyploid, 12% of the small RNAs
corresponding to transposons had an abundance simi-
lar to the midparent value, 3% were overrepresented,
and 85% were underrepresented, compared to
the midparent value. This underrepresentation
was highly significant P(x
2
),0.0001.
268 M. Kenan-Eichler et al.
the polyploid. These results are consistent with and fur-
ther elucidate data reported by Kraitshtein et al.
(2010) with regard to AFLP-based Veju methylation.
DISCUSSION
Small RNAs are involved in a number of key cellular
processes, and perturbations in their steady-state ex-
pression levels can lead to genome-wide changes in
gene expression or in chromatin and genome structure.
Modified small RNA expression levels have been widely
reported in the context of developmental regulation of
plants, but to a lesser extent in the context of speciation
via interspecific hybridization and allopolyploidization
(Haet al. 2009). Haet al. (2009) describe an allotetra-
ploid hybrid, analogous to Arabidopsis suecica, formed
between a synthetic Arabidopsis autotetraploid line
and the natural Arabidopsis tetraploid, A. arenosa, and
report significant deviations in hybrid miRNA expres-
sion from MPV. In this study, most hybrid miRNA ex-
pression profiles did not deviate from their MPVs
(Figure 4). However, a number of deviations were found
in the allopolyploid (Table S2). In addition, some classes,
such as miR156 and miR166, included several sequence
variants, each demonstrating differential expression pat-
terns. However, in the absence of the wheat genome
sequence, it is difficult to associate changes in miRNA
levels to the expression of target genes or to plant
phenotypes.
Another difference between the present model and
that described in the Arabidopsis allopolyploid analysis
(Haet al. 2009) lies in the nature of the genetic material
analyzed, where the Arabidopsis work involved plants
of the same ploidy level (parents and hybrid were all
tetraploids), while this study encompassed lines of
different ploidy levels (parents [2·and 4·], hybrid
[3·], and a derived allohexaploid [6·] analogous to
natural bread wheat). The wheat material offered
unique and novel insight into an unexpected response
to changes in ploidy levels. Remarkably, and unexpect-
edly, the relative amount of small RNAs corresponding
to miRNAs increased with ploidy (Figure 3). Inversely,
the relative amount of 24-nt small RNAs corresponding
to transposons decreased with increased ploidy (Figure
3). Similarly, in the work of Cantu et al. (2010), the
count per basepair of small RNAs corresponding to
transposons was lower in hexaploid than in tetraploid
wheat varieties (Cantu et al. 2010). This ploidy depen-
dence seems to be insensitive to genomic composition,
but sensitive to dosage. Indeed, while the diploid, tetra-
ploid, and hexaploid wheat had different genomic
TABLE 1
Number of reads (normalized to reads per million) of siRNAs
corresponding to TEs, in parents, hybrid, and first-generation
allopolyploid (S1)
TEs
a
durum
BBAA
tauschii
DD F1 BAD
S1
BBAADD
Wis2-1A 756 528 475 0
Latidu 1267 486 747 94
Veju 326 211 400 6
WHAM 83 2646 420 69
Caspar 701 315 472 8
Thalos 532 656 753 5
a
Caspar and Thalos are DNA transposons, and other TEs are
retroelements.
Figure 6.—Viewing of small RNAs on a BAC sequence. A view of small RNAs mapped to the T. aestivum BAC CT009735, using
the IGB tool from Affymetrix, with coordinates indicating the nucleotide number (nt). Horizontal gray bars correspond to trans-
posable elements, and vertical black lines indicate the abundance of corresponding small RNAs in each library.
Deregulation of Small RNAs 269
composition, the triploid (hybrid) and allohexaploid,
which both featured the same three wheat genomes
(A, B, and D) but at varying doses (3·vs. 6·), expressed
divergent small RNAs profiles.
Mechanistically, a correlation can be drawn between
specific miRNA overrepresentation and repressed siR-
NAs formation. More specifically, miR168 overrepresen-
tation in polyploids may account for ARGONAUTE 1 (AGO1)
suppression (Mallory and Vaucheret 2009), which
in turn reduces the production of siRNAs (Vaucheret
2008). Although, the regulation of AGO1 is quite com-
plex (Mallory and Vaucheret 2009), it is conceivable
that affecting regulatory loops responsible for AGO1 ac-
tivity, e.g., via alterations in miR168, may bear genome-
wide effects on siRNAs. In fact, the novel intergenomic
interactions and novel dosage effects demonstrated in
the allopolyploid lines may account for the disruption
of the activity of several genes related to small RNA
expression and stability. Previously, we have shown that
novel interactions between cis- and trans-acting regula-
tory elements can lead to overexpression or, alterna-
tively, to suppression of 10% of the genes of an
interspecific hybrid (Tirosh et al. 2009). Deregulation
of central genes involved in the gene silencing machin-
ery could account for some of the alterations in small
RNA profiles reported here, which in turn can affect TE
activities, as discussed below.
siRNAs play a critical role in heterochromatin mainte-
nance and in transposable element silencing (Zaratiegui
et al. 2007). The strong decrease in the percentage of
siRNAs corresponding to TEs reported here could thus
lead to transposon activation. Transposons, notoriously
responsive to “genomic shocks”(Mcclintock 1984),
may be responsive to hybridization- and polyploidization-
induced “shocks,”linked with downregulation of small
RNAs. Indeed, it has been reported that silent trans-
posons and retrotransposons may become transcrip-
tionally and sometime transpositionally active upon
hybrid and polyploid formation (Kashkush et al. 2003;
Madlung et al. 2005; Chen and Ni2006; Kraitshtein
et al. 2010). The correlation between small RNAs cytosine
methylation and transposon silencing (Matzke et al.
2007) may further explain transposon activation follow-
ing small RNAs-related demethylation, as reported here
for the Veju TE.
A fascinating aspect of TE regulation involves their
capacity to transit between inactive and active states.
Remarkably, a hypomethylated TE can become reme-
thylated within one generation, as shown here for a
specific element (Figure 7) and as shown on a genome-
wide scale for the Veju element (Kraitshtein et al.
2010). An attractive model for such kinetics is demon-
strated via the disappearance of small RNAs, as seen
here in S1 for several elements, including Wis2-1A (Table
1), which then leads to transcription of otherwise silent
TEs. As a result, high levels of aberrant and dsRNAs
may be generated, as many TEs are nested within each
other in opposite orientations (Sanmiguel et al. 1996).
In the subsequent generation, small RNAs produced
by such transcriptional activation, might reverse the
element to its original methylated and silenced state.
This proposed mechanism may account for the
reported maintenance silencing of repeats by small
RNAs produced by RNA polymerases IV and V
(Pikaard et al. 2008; Matzke et al. 2009). In other
words, TE activation may catalyze TE silencing via up-
regulation of small RNA production.
However, the association between small RNAs and TE
transcription still remains elusive. In an earlier work
(Kashkush et al. 2003), we analyzed an allopolyploid
resulting from a cross between two diploid parents and
measured S1 transcriptional activation of transposons
that were silent in the parents. The present model, us-
ing different parental species, is a bit more complex
Figure 7.—Veju-related small RNAs and CpG methylation.
Top: The abundance of small RNAs that correspond to the
Veju retrotransposon LTR found on BAC CT009735 for the
midparent value, the hybrid (F1), and the polyploid (S1).
gDNA: The coordinates of small RNAs on the Veju LTR geno-
mic DNA. Bottom: The percentage of CpG methylation was
determined by bisulfite sequencing for the Veju LTR region. A
decrease in CpG methylation in the first generation of the
polyploid (S1), compared to Ae.s tauschii (genome DD), was
observed. In the second polyploid generation (S2), CpG meth-
ylation increased. A natural hexaploid (Genome BBAADD,
variety Chinese Spring) is shown for comparison.
270 M. Kenan-Eichler et al.
(Figure S4), where S1 transposon transcript levels were
higher than those in F1, substantiating an earlier report
of transcriptional activation in the S1 generation
(Kashkush et al. 2003). However, high levels of both
small RNAs and TE transcripts were found in the tetra-
ploid parent (Figure S4), which may be due to transcrip-
tion of a divergent subfamily of transposons, not targeted
by the small RNAs, or to alteration in small RNA mobil-
ity, processing, or other unknown phenomenon.
Another intriguing question remaining relates to the
changes measured in allopolyploid small RNA species,
and to a lesser extent in the hybrid. This observation
may be linked to polyploidy per se. Alternatively, this may
be a result of the kinetics of small RNA alterations,
which begin in the hybrid and peak in the S1 genera-
tion. Another interesting possibility is that global deme-
thylation and activation of TEs may occur through
disruption of developmentally regulated processes in
the germline. Such modifications may occur during
meiosis, or gametogenesis, or during the development
of an embryo derived from “deregulated”gametes. In
such cases, massive changes would be found in the S1
only, and not in the F1.
In summary, the data reported here, together with
previous findings, suggest that deregulation of small
RNAs may stimulate TE activation in interspecific
hybrids and allopolyploids. This phenomenon is remi-
niscent of hybrid dysgenesis in Drosophila (Malone
and Hannon 2009), a mechanism of incompatibil-
ity that can hinder speciation via hybridization and
polyploidization. The correlation between the different
hallmarks of transposon activation (small RNAs, hypome-
thylation, transcription, and transposition) is complex,
as they undergo rapid changes between generations. In
addition, it is important to note that this study was per-
formed on plants that survived hybridization and allo-
polyploidization. The events of seedling death and seed
abortion, which were observed in the hybrid and allo-
polyploid lines, may have occurred as a result of severe
transposon activation and were not considered in our
analysis.
We thank Naomi Avivi-Ragolski and other members of the Levy
laboratory for their help and discussions; Idan Efroni for help in data
analysis; Yehudit Posen for editing the manuscript; and members of
the bioinformatics unit, especially Jaime Prilusky for writing the quality-
control script and Ester Feldmesser for help with statistical analysis. This
work was funded by a grant from the Israeli Science Foundation, no.
616/09, to A.A.L.
LITERATURE CITED
Altschul,S.F.,W.Gish,W.Miller,E.W.Myers and D. J. Lipman,
1990 Basic local alignment search tool. J. Mol. Biol. 215: 403–410.
Audic, S., and J. M. Claverie, 1997 The significance of digital gene
expression profiles. Genome Res. 7: 986–995.
Birchler, J. A., H. Yao,S.Chudalayandi,D.Vaiman and R. A.
Veitia, 2010 Heterosis. Plant Cell 22: 2105–2112.
Bomblies, K., and D. Weigel, 2007 Hybrid necrosis: autoimmunity
as a potential gene-flow barrier in plant species. Nat. Rev. Genet.
8: 382–393.
Bretagnolle, F., and J. D. Thompson, 1995 Tansley Review No. 78:
gametes with the somatic chromosome number: mechanisms of
their formation and role in the evolution of autopolyploid plants.
New Phytol. 129: 1–22.
Brown, T., and K. Mackey, 2001 Analysis of RNA by northern blot
hybridization. Curr. Protoc. Hum. Genet. 3(Appendix): 3K.
Cantu, D., L. S. Vanzetti,A.Sumner,M.Dubcovsky,M.Matvienko
et al., 2010 Small RNAs, DNA methylation and transposable ele-
ments in wheat. BMC Genomics 11: 408.
Chandler, V. L., and V. Walbot, 1986 DNA modification of a maize
transposable element correlates with loss of activity. Proc. Natl.
Acad. Sci. USA 83: 1767–1771.
Charles, M., H. Belcram,J.Just,C.Huneau,A.Viollet et al.,
2008 Dynamics and differential proliferation of transposable
elements during the evolution of the B and A genomes of wheat.
Genetics 180: 1071–1086.
Chen, Z. J., 2010 Molecular mechanisms of polyploidy and hybrid
vigor. Trends Plant Sci. 15: 57–71.
Chen, Z. J., and Z. F. Ni, 2006 Mechanisms of genomic rearrange-
ments and gene expression changes in plant polyploids. Bioessays
28: 240–252.
Comai, L., 2005 The advantages and disadvantages of being poly-
ploid. Nat. Rev. Genet. 6: 836–846.
Dobzhansky, T., 1936 Studies on hybrid sterility. II. Localization of ster-
ility factors in Drosophila pseudoobscura hybrids. Genetics 21: 113–135.
Doyle, J. J., L. E. Flagel,A.H.Paterson,R.A.Rapp,D.E.Soltis
et al., 2008 Evolutionary genetics of genome merger and dou-
bling in plants. Annu. Rev. Genet. 42: 443–461.
Fahlgren, N., T. A. Montgomery,M.D.Howell,E.Allen,S.K.
Dvorak et al., 2006 Regulation of AUXIN RESPONSE FACTOR3
by TAS3 ta-siRNA affects developmental timing and patterning in
Arabidopsis. Curr. Biol. 16: 939–944.
Fahlgren, N., C. M. Sullivan,K.D.Kasschau,E.J.Chapman,J.S.
Cumbie et al., 2009 Computational and analytical framework for
small RNA profiling by high-throughput sequencing. RNA 15:
992–1002.
Gehring, M., K. L. Bubb and S. Henikoff, 2009 Extensive deme-
thylation of repetitive elements during seed development under-
lies gene imprinting. Science 324: 1447–1451.
Ghildiyal, M., and P. D. Zamore, 2009 Small silencing RNAs: an
expanding universe. Nat. Rev. Genet. 10: 94–108.
Gruntman, E., Y. Qi,R.K.Slotkin,T.Roeder,R.A.Martienssen
et al., 2008 Kismeth: analyzer of plant methylation states
through bisulfite sequencing. BMC Bioinformatics 9: 371.
Ha, M., J. Lu,L.Tian,V.Ramachandran,K.D.Kasschau et al.,
2009 Small RNAs serve as a genetic buffer against genomic
shock in Arabidopsis interspecific hybrids and allopolyploids.
Proc. Natl. Acad. Sci. USA 106: 17835–17840.
Hsieh, T. F., C. A. Ibarra,P.Silva,A.Zemach,L.Eshed-Williams
et al., 2009 Genome-wide demethylation of Arabidopsis endo-
sperm. Science 324: 1451–1454.
Ishikawa, R., and T. Kinoshita, 2009 Epigenetic programming: the
challenge to species hybridization. Mol. Plant 2: 589–599.
Kashkush, K., M. Feldman and A. A. Levy, 2003 Transcriptional
activation of retrotransposons alters the expression of adjacent
genes in wheat. Nat. Genet. 33: 102–106.
Kihara, H., and F. Lilienfeld, 1949 A new synthesized 6x-wheat,
pp. 307–319 in Proceedings of Eighth International Congress of Genet-
ics, edited by G. B. A. R. Larsson. Hereditas Supplement, Stock-
holm, Sweden.
Kraitshtein, Z., B. Yaakov,V.Khasdan and K. Kashkush,
2010 Genetic and epigenetic dynamics of a retrotransposon
after allopolyploidization of wheat. Genetics 186: 801–812.
Landry, C. R., D. L. Hartl and J. M. Ranz, 2007 Genome clashes in
hybrids: insights from gene expression. Heredity 99: 483–493.
Leitch, A. R., and I. J. Leitch, 2008 Genomic plasticity and the
diversity of polyploid plants. Science 320: 481–483.
Levy, A. A., and V. Walbot, 1990 Regulation of the timing of trans-
posable element excision during maize development. Science
248: 1534–1537.
Lippman, Z., and R. Martienssen, 2004 The role of RNA interfer-
ence in heterochromatic silencing. Nature 431: 364–370.
Deregulation of Small RNAs 271
Liu,P.P.,T.A.Montgomery,N.Fahlgren,K.D.Kasschau,H.
Nonogaki et al., 2007 Repression of AUXIN RESPONSE
FACTOR10 by microRNA160 is critical for seed germination
and post-germination stages. Plant J. 52: 133–146.
Lu, C., D. H. Jeong,K.Kulkarni,M.Pillay,K.Nobuta et al.,
2008 Genome-wide analysis for discovery of rice microRNAs re-
veals natural antisense microRNAs (nat-miRNAs). Proc. Natl.
Acad. Sci. USA 105: 4951–4956.
Madlung, A., A. P. Tyagi,B.Watson,H.M.Jiang,T.Kagochi et al.,
2005 Genomic changes in synthetic Arabidopsis polyploids.
Plant J. 41: 221–230.
Mallet, J., 2007 Hybrid speciation. Nature 446: 279–283.
Mallory, A. C., and H. Vaucheret, 2009 ARGONAUTE 1 homeo-
stasis invokes the coordinate action of the microRNA and siRNA
pathways. EMBO Rep. 10: 521–526.
Malone, C. D., and G. J. Hannon, 2009 Small RNAs as guardians of
the genome. Cell 136: 656–668.
Matzke, M. A., and J. A. Birchler, 2005 RNAi-mediated pathways
in the nucleus. Nat. Rev. Genet. 6: 24–35.
Matzke, M., T. Kanno,B.Huettel,L.Daxinger and A. J. Matzke,
2007 Targets of RNA-directed DNA methylation. Curr. Opin.
Plant Biol. 10: 512–519.
Matzke, M., T. Kanno,L.Daxinger,B.Huettel and A. J. Matzke,
2009 RNA-mediated chromatin-based silencing in plants. Curr.
Opin. Cell Biol. 21: 367–376.
McClintock, B., 1984 The significance of responses of the genome
to challenge. Science 226: 792–801.
Mosher,R.A.,C.W.Melnyk,K.A.Kelly,R.M.Dunn,D.J.Studholme
et al., 2009 Uniparental expression of PolIV-dependent siRNAs
in developing endosperm of Arabidopsis. Nature 460: 283–286.
Ni, Z., E. D. Kim,M.Ha,E.Lackey,J.Liu et al., 2009 Altered
circadian rhythms regulate growth vigour in hybrids and allopo-
lyploids. Nature 457: 327–331.
Otto, S. P., and J. Whitton, 2000 Polyploid incidence and evolu-
tion. Annu. Rev. Genet. 34: 401–437.
Penterman, J., D. Zilberman,J.H.Huh,T.Ballinger,S.Henikoff
et al., 2007 DNA demethylation in the Arabidopsis genome.
Proc. Natl. Acad. Sci. USA 104: 6752–6757.
Pikaard,C.S.,J.R.Haag,T.Ream and A. T. Wierzbicki, 2008 Roles of
RNA polymerase IV in gene silencing. Trends Plant Sci. 13: 390–397.
Rieseberg, L. H., and J. H. Willis, 2007 Plant speciation. Science
317: 910–914.
SanMiguel,P.,A.Tikhonov,Y.K.Jin,N.Motchoulskaia,D.
Zakharov et al., 1996 Nested retrotransposons in the inter-
genic regions of the maize genome. Science 274: 765–768.
SanMiguel, P. J., W. Ramakrishna,J.L.Bennetzen,C.S.Busso and
J. Dubcovsky, 2002 Transposable elements, genes and recom-
bination in a 215-kb contig from wheat chromosome 5A(m).
Funct. Integr. Genomics 2: 70–80.
Schwarz,S.,A.V.Grande,N.Bujdoso,H.Saedler and P.
Huijser, 2008 The microRNA regulated SBP-box genes
SPL9 and SPL15 control shoot maturation in Arabidopsis. Plant
Mol. Biol. 67: 183–195.
Slotkin, R. K., M. Vaughn,F.Borges,M.Tanurdzic,J.D.Becker
et al., 2009 Epigenetic reprogramming and small RNA silencing
of transposable elements in pollen. Cell 136: 461–472.
Soltis, P. S., and D. E. Soltis, 2009 The role of hybridization in
plant speciation. Annu. Rev. Plant Biol. 60: 561–588.
Staden, R., 1996 The Staden sequence analysis package. Mol. Bio-
technol. 5: 233–241.
Tirosh, I., S. Reikhav,A.A.Levy and N. Barkai, 2009 A yeast
hybrid provides insight into the evolution of gene expression
regulation. Science 324: 659–662.
Van de Peer, Y., S. Maere and A. Meyer, 2009 The evolutionary
significance of ancient genome duplications. Nat. Rev. Genet. 10:
725–732.
Vaucheret, H., 2008 Plant ARGONAUTES. Trends Plant Sci. 13:
350–358.
Walia, H., C. Wilson,A.M.Ismail,T.J.Close and X. Cui,
2009 Comparing genomic expression patterns across plant spe-
cies reveals highly diverged transcriptional dynamics in response
to salt stress. BMC Genomics 10: 398.
Wood, T. E., N. Takebayashi,M.S.Barker,I.Mayrose,P.B.
Greenspoon et al., 2009 The frequency of polyploid speciation
in vascular plants. Proc. Natl. Acad. Sci. USA 106: 13875–13879.
Zaratiegui, M., D. V. Irvine and R. A. Martienssen, 2007 Non-
coding RNAs and gene silencing. Cell 128: 763–776.
Communicating editor: J. Schimenti
272 M. Kenan-Eichler et al.
GENETICS
Supporting Information
http://www.genetics.org/cgi/content/full/genetics.111.128348/DC1
Wheat Hybridization and Polyploidization Results in Deregulation
of Small RNAs
Michal Kenan-Eichler, Dena Leshkowitz, Lior Tal, Elad Noor, Cathy Melamed-Bessudo,
Moshe Feldman and Avraham A. Levy
Copyright ©2011 by the Genetics Society of America
DOI: 10.1534/genetics.111.128348
M. Kenan-Eichler et al. 2 SI
FIGURE S1.—Metaphase chromosomes from a root tip of an S1 allopolyploid plant, spontaneously derived from
a TTR16XTQ113 F1 hybrid. The expected 42 chromosomes are shown.
M. Kenan-Eichler et al. 3 SI
:2(.131%!$2
:()'(04!+)381%!$2
4!+)38#(%#*
1),,)-'.&;/1),%1
+),)-!3)-'1%!$26)3(,.1%3(!-;2
22%,"+)-'!++1%!$26)3()$%-3)#!+2%04%-#%2)-3.4-)04%3!'2
+),)-!3)-'!++3!'26)3(+%223(!-1%!$2
).)-&.1,!3)#!-!+82)2
.-3)'#.-2314#3).-42)-'3!$%-
),)+!1)382%!1#(.&2%+%#3%$-4#+%.3)$%$!3!"!2%242)-'!(!2(!+'.1)3(,
+!23-1-3$!3!"!2%
.1,!+)9!3).-.&3(%+)"1!18#.4-323.1%!$2/%1,)++).-
!1%-35!1!-'$.-3%31!/+.)$
!1%-35!1$)/+.)$
8"1)$ 31)/+.)$
.+8/+.)$ (%7!/+.)$
:!--.3!3%$#.-3)'2:#.-3)'26)3(-.()32
FIGURE S2.—Flow chart of small RNA high-throughput sequencing data analysis.
M. Kenan-Eichler et al. 4 SI
"$ "#
$"#
"$
"$
%"
%!
FIGURE S3.—Abundance of small RNA classes in the four analyzed libraries, namely, the tetraploid parent
(genome BBAA), the diploid parent (genome DD), their hybrid and derived allopolyploid (first generation= S1),
and the calculated mid-parent value (MPV). The total number of reads in each library is shown at the top of each
column.
M. Kenan-Eichler et al. 5 SI
FIGURE S4.—Northern blot analyses of Wis2-1A (left) and Veju (right) retrotransposon LTR regions in the
tetraploid parent (genome BBAA), the diploid parent (genome DD), their hybrid and derived allopolyploid.
Methylene blue staining of the membranes shows equal loading of RNA samples. Probes were derived from a
consensus sequence from wheat Wis2-1A LTRs (a 354bp fragment) and from Veju1_TM_LTR entry at TREP (a
339 bp fragment).
M. Kenan-Eichler et al. 6 SI
TABLE S1
Number of small RNA reads and tags in the various libraries: TTR16 –tetraploid parent
(Genome BBAA), TQ113 – diploid parent (Genome DD), F1 – triploid hybrid (genome BAD),
S1 – first generation of synthetic hexaploid (Genome BBAADD).
Libraries: TTR16 TQ113 Hybrid Polyploid Total
Total reads 5,633,938 3,064,285 6,421,516 3,458,759 18,578,498
Total tags 3,726,879 1,879,921 3,068,481 1,092,783 -
Tags after QCa 991,936 2,829,480 3,423,567 1,627,189 -
Tags with >30
reads
7967 4292 6756 2772 -
Reads from
tags with >30
reads
1,576,108 1,202,651 1,689,159 1,561,663 6,029,581
aQC: Quality Control process including 1. Trimming of 3’ PCR primer; 2. Elimination of reads with
>3Ns; 3. Assembly of reads with identical sequences into unique tags.
M. Kenan-Eichler et al. 7 SI
TABLE S2
Micro RNAs in high-throughput small RNA sequencing data
Librarires
miRNA name miRNA target TTR16 TQ113 Hybrid Polyploid
ath-miR156a SBP protein family 80003 36175 53344 140378
bna-miR156a SBP protein family 125499 69857 101207 58
ath-miR157a SBP protein family 0 0 0 115
osa-miR159a GAMYB transcription factor 854 969 1142 5102
osa-miR160f auxin reponse factor 0 0 21 56
ath-miR164a NAC1 transcription factor 1432 595 1634 2302
ath-miR165a classIII hd-leu zipper 43 0 40 0
ath-miR166a class III hd-leu zipper 17463 7565 18397 8228
osa-miR166g class III hd-leu zipper 1746 552 1378 366
osa-miR166k class III hd-leu zipper 5983 3095 5893 1777
ath-miR167d auxin reponse factor 8 19877 7066 12782 9790
osa-miR168a Argonaute 1 regulation 119710 79244 126428 245051
ath-miR169b CCAAT-binding tf 18 66 74 91
osa-miR171b scarecrow-like protein 36 0 34 98
ath-miR172a Apetala 2 5633 3540 4350 10126
ath-miR390a not found 0 32 0 18
ath-miR393a transport inhibitor protein 1 923 907 1022 1349
ath-miR396b not found 136 136 197 258
osa-miR396d not found 2259 1711 3771 12121
osa-miR528 not found 2020 2311 1003 2925
tae-miR1135 early light-inducible protein 312 0 186 26
Total counts 383956 213833 332913 440247
The number of reads are normalized to reads per million for comparison between the libraries. TTR16 –tetraploid
parent (Genome BBAA), TQ113 – diploid parent (Genome DD), F1 – triploid hybrid (genome BAD), S1 – first
generation of synthetic hexaploid (Genome BBAADD).
