ArticlePDF Available

Differential expression of ruminant ZNF496 variants: Association with quantitative trait locus affecting bovine milk concentration and fertility1,2

Authors:

Abstract and Figures

A single nucleotide polymorphism in the intergenic region upstream of the ZNF496 gene on Bos taurus chromosome 7 displayed significant population-wide linkage disequilibrium with milk protein percentage in the Israeli Holstein population. The frequency of the allele associated with increased protein concentration was 10%. This single nucleotide polymorphism was located in the promoter region from which a 10-exon transcript of the bovine and the ovine ZNF496 genes are transcribed. The gene architecture was similar to the mouse ortholog Zkscan17. A 5-exon murine antisense transcript was complementary to the 5' untranslated Zkscan17 region that included a sequence domain conserved between mouse and ruminants, suggesting a regulatory function. In the bovine ZNF496 chromosomal region, segregation of a quantitative trait locus (QTL) for milk protein percentage was confirmed in a daughter design sire family. Concordance was not obtained between QTL status of bulls and any of the polymorphisms in the functional elements of ZNF496. This excludes these variations as the causative polymorphism under the assumption of no epigenetic effect for this locus. However, ZNF496 variants were differentially expressed in bovine ovaries, and only the paternal variant was expressed in liver and kidney in a sheep family with polymorphic ZNF496 sequence. Thus, the search for the mutation underlying the minor QTL allele, which is a top economically favorable allele in Israeli Holstein cattle, may be complicated by the presence of an imprinting center in this QTL confidence interval.
Content may be subject to copyright.
Differential expression of ruminant ZNF496 variants: Association with
quantitative trait locus affecting bovine milk concentration and fertility
1
,
2
M. Golik ,*† G. Glick ,*† S. Reicher ,*† A. Shirak ,* E. Ezra ,‡ Y. Zeron E. Gootwine ,* M. Ron ,* J. I. Weller ,*
and E. Seroussi *3
* Agricultural Research Organization, Institute of Animal Science, Bet-Dagan 50250, Israel
The Hebrew University of Jerusalem, The Robert H. Smith Faculty of Agriculture, Rehovot, 76100, Israel
Israel Cattle Breeders Association, Caesaria Industrial Park 38900, Israel
§ Sion, AI Institute, Shikmim 79800, Israel
ABSTRACT
A single nucleotide polymorphism in the intergenic
region upstream of the ZNF496 gene on Bos taurus
chromosome 7 displayed significant population-wide
linkage disequilibrium with milk protein percentage in
the Israeli Holstein population. The frequency of the al-
lele associated with increased protein concentration was
10%. This single nucleotide polymorphism was located
in the promoter region from which a 10-exon transcript
of the bovine and the ovine ZNF496 genes are tran-
scribed. The gene architecture was similar to the mouse
ortholog Zkscan17. A 5-exon murine antisense transcript
was complementary to the 5 untranslated Zkscan17
region that included a sequence domain conserved be-
tween mouse and ruminants, suggesting a regulatory
function. In the bovine ZNF496 chromosomal region,
segregation of a quantitative trait locus (QTL) for milk
protein percentage was confirmed in a daughter design
sire family. Concordance was not obtained between
QTL status of bulls and any of the polymorphisms in
the functional elements of ZNF496. This excludes these
variations as the causative polymorphism under the as-
sumption of no epigenetic effect for this locus. However,
ZNF496 variants were differentially expressed in bovine
ovaries, and only the paternal variant was expressed in
liver and kidney in a sheep family with polymorphic
ZNF496 sequence. Thus, the search for the mutation
underlying the minor QTL allele, which is a top eco-
nomically favorable allele in Israeli Holstein cattle, may
be complicated by the presence of an imprinting center
in this QTL confidence interval.
Key words: quantitative trait locus , linkage disequi-
librium mapping , ZNF496 , protein concentration
INTRODUCTION
Weller et al. (2008a,b) previously identified QTL af-
fecting economic traits on Bos taurus autosome (BTA)
7 in the Israeli Holstein cattle. Several QTL affecting
milk protein and fat yield and percentage were mapped
to the centromeric half of this chromosome. Popula-
tion-wide linkage disequilibrium (LD) was tested for
213 SNP in this chromosomal region by analysis of the
genetic evaluations of up to 696 bulls using a linear
model. Single nucleotide polymorphisms in the zinc fin-
ger protein 496 (ZNF496) promoter showed significant
LD for milk protein percentage (P < 10−10).
The ZNF496 promoter contains SCAN, Kruppel-
associated box (KRAB), and zinc finger domains, and
physically interacts with the NSD1 histone methyl-
transferase to form a transcriptional co-repressor. The
NSD1 histone methyltransferase is involved in the
gigantism disorders and childhood acute myeloid leu-
kemia (Nielsen et al., 2004; Losson and Nielsen, 2010).
The ZNF496 promoter also indirectly functions as a
transcriptional activator physically interacting with
Jumonji (JMJ)/Jarid2 and inhibiting the transcrip-
tional repression of JMJ, which plays important roles in
embryonic development (Mysliwiec et al., 2007). Other
physical associations with the arrestin 3, retinal (X-
arrestin, ARR3), and ZNF446 gene products have been
documented (http://thebiogrid.org/124291/summary/
homo-sapiens/znf496.html), suggesting involvement of
ZNF496 in the regulation of additional biological pro-
cesses.
In search for the polymorphism that underlies the
BTA7 QTL, we cloned the ZNF496 gene of cattle and
sheep, and demonstrated that this gene transcription
has a complex expression pattern typical of imprinted
genes, which complicates the uncovering of potential
causative mutations for a milk production QTL within
this gene.
J. Dairy Sci. 94 :2092–2102
doi: 10.3168/jds.2010-3655
© American Dairy Science Association®, 2011 .
2092
Received July 27, 2010.
Accepted December 10, 2010.
1
Nucleotide sequence data reported are available in the DDBJ/
EMBL/GenBank databases under the accession numbers BN001496;
FN908756; FN908757; FN908185; FN908186.
2
This article contains supplementary material, which is available at:
http://cowry.agri.huji.ac.il/Golik_et_al2010/Supplementary_Table1.
xls.
3
Corresponding author: Seroussi@agri.huji.ac.il
MATERIALS AND METHODS
Bioinformatics
The BLAST family of programs was used for database
searches on the NCBI/NIH server (http://www.ncbi.
nlm.nih.gov/BLAST/). Sheep sequences were also lo-
cated in the International Sheep Genomics Consortium
sequence data repository (https://isgcdata.agresearch.
co.nz/). Sequence of clones and draft contig sequences
were downloaded and assembled in a GAP4 database
(Staden et al., 2000), in which all the sequence data
relevant to this project were accommodated. This data-
base was used for comparison of PCR amplification of
the exon at genomic versus the transcript level. Repeti-
tive sequences were filtered out from the genomic se-
quence using Repeat Masker server (http://ftp.genome.
washington.edu/). Predicted amino acid sequences of
the 4 ZNF496 proteins were aligned using the ClustalW
(Thompson et al., 1994) and the output analyzed by
the Boxshade program. Cellular localization was pre-
dicted by PSORT (Nakai and Horton, 1999; http://
psort.nibb.ac.jp/).
Primer Design, PCR Amplification, and Sequencing
Oligonucleotide primers were designed using Primer
Designer 3.0 (Scientific & Educational Software). The
DNA templates were PCR amplified in 33 cycles of
92°C, 1 min; 63°C, 1min; 72°C, 2 min. Reverse-tran-
scription polymerase chain reaction (RT-PCR) and
sequencing of bovine and ovine mRNA was performed
as described previously (Golik et al., 2006; Reicher et
al., 2010, respectively), using PCR primers 1 and 2, or
3 and 4 for amplifying the 5 or 3 exons of the ZNF496
transcript, respectively, as detailed in Table 1. Tissue
sections were collected at the abattoir a few minutes
after slaughter and kept in liquid nitrogen. Ovaries
were stabilized in RNAlater (Qiagen GmbH, Hilden,
Germany). Total RNA extraction was carried out from
samples (50 mg) immediately following homogenization
in Trizol (Gibco-BRL, Gaithersburg, MD), according
to manufacturer’s instructions. Reverse transcription of
total RNA (1 μg) was performed using 1 U of avian
myeloblastosis virus reverse transcriptase (Promega,
Israel) as specified in the manufacturer’s protocol. The
PCR products were size-separated by electrophoresis
on 1.2% agarose gels stained with ethidium bromide
and were extracted from the gel using QIAquick gel
extraction kit (Qiagen, Hilden, Germany) according to
manufacturer’s instructions, and sequenced from both
directions with the ABI BigDye Terminator Sequencing
Kit (Applied Biosystems) on an ABI 3730.
Detection and Genotyping of SNP
Large-scale genotyping was performed using matrix-
assisted laser desorption/ionization time-of-flight
(MALDI-TOF) mass spectrometer (MassARRAY,
Sequenom Inc.), and the amplification primers are
given in Supplementary Table 1 (available online; see
footnote 2 on page 2092). This table also describes the
SNP identity, genomic position, the number of bulls
genotyped, the minimum allele frequency, and whether
the allele distribution corresponded to Hardy-Weinberg
equilibrium.
For SNP array analysis, DNA was extracted from
the semen of 912 Holstein bulls used for artificial
insemination in Israel (http://www.icba-israel.com/
cgi-bin/bulls/en/bl_main.htm). Twelve young bulls
were excluded from LD analyses, as they have not yet
completed their progeny tests. The sample included
sires born in Israel, as well as international sires origi-
2093
DIFFERENTIAL EXPRESSION OF ZNF496 VARIANTS
Journal of Dairy Science Vol. 94 No. 4, 2011
Table 1. PCR primer pairs for ZNF496 amplicons
Target1# Forward 5–>3# Reverse 5–>3
E2-E6 1 GGTTTTCTGGATGAGCAGGA 2 CGCTTCCTGAAGAATGGAAG
E5-E10 3 ACCTTGCAAAGAGCCAGGAT 4 GGGGAGTCTGAAACCAGTCA
P 5 AAGACCACCTTGCCTCCTCT 6 TTCCCAGGAAACTGCAAAAC
P 7 TCAACTCCTATTGCGTGCTG 8 AGTTAGTGAGGGCCATGGTG
P 9 GTACCTTCCCATGGTCTCCA 10 TACCCCTTTCTCAGGAGCAC
P 11 AGTCTGACCTGCCTTGGCTA 12 TCCTGAGCAGAGCTGATTGA
P-E1 13 TCAATCAGCTCTGCTCAGGA 14 GTCTCCGCATCTCAGTGGTT
P-I2 15 CAAGGCGGAGAACAGAGAAG 16 TACCGTATGCCAAGGAAAGG
I2-I3 17 AGCAAGGCTTACTCGCTCTG 18 AGAAGGAACAACCCCATTCC
I3-I4 19 TCCCAAAGGCTGATCTCTGT 20 AGCCCCACTCTCTCCCTTT
I4-I5 21 AATTGCTGGTCCTCATCTGG 22 CAGCTGTCTCCAAACCAACA
I5-I6 23 TGACATGTCTTAAAGCAAAGCAAT 24 TTCCCACAAGATGCATATCAA
I6-I8 25 ACATCCCTCCCCTAGCTTGT 26 CTGGTTGAAAGAGGGCAATC
I8-I9 27 AGTACCACCAGGCCTCCTTT 28 CACACATACACGGATGCACA
I9-E10 29 TTCTTGGGTAGGGTTTGCAG 4 GGGGAGTCTGAAACCAGTCA
1E = exon, P = promoter region, I = intron.
nating from France (4), Germany (2), the Netherlands
(26), and the United States (27). The sire DNA was
genotyped using the BovineSNP50 BeadChip (Illumina,
Inc., San Diego, CA), which included 54,001 SNP as
described previously (Weller et al., 2010). Smaller-scale
characterization of SNP within the candidate genes was
also performed by DNA sequencing of PCR products as
described previously (Golik et al., 2006). It should be
noted that positions of 27 SNP overlapped between the
mass spectrometry and the BeadChip methods.
Statistical Analysis of SNP Effects
on Economic Traits
A total of 696 AI Israeli Holstein bulls were geno-
typed for SNP of bovine ZNF496. Estimated breeding
values for milk, fat, and protein were computed by a
multitrait animal model analysis of the entire Israeli
Holstein population (Weller and Ezra, 2004). These were
the standard industry evaluations computed in June
2009. The current EBV are available from http://www.
icba-israel.com/cgi-bin/bulls/en/bl_main.htm. Evalu-
ations for fat and protein percent were derived from
the evaluations for the production traits, as described
previously (Weller and Ezra, 2004). The following fixed
linear model was used to estimate the effect associated
with this SNP for each of 5 traits analyzed:
Yijk = aSij + bBk + c(Bk)2 + eijk, [1]
where Yijk is the genetic evaluation of sire i with SNP
genotype j and birth year k for each trait; Sij is the
number of “A” alleles of the SNP (j = 0, 1, or 2) for sire
i; Bk is the sire birth year k; a, b, and c are regression
effects; and eijk is the random residual for sire i. The
linear and quadratic effects of the sire birth year were
included to account for genetic trends in the popula-
tion.
All 225 SNP (Supplementary Table 1; available on-
line; see footnote 2 on page 2092) were also analyzed
individually for the 5 milk production traits and fer-
tility by the multiple-trait canonical transformation
program (MTC) animal model REML program of I.
Misztal (University of Georgia, Athens, GA). In addi-
tion to bulls with valid genotypes, all known parents,
grandsires, and paternal granddams of these bulls were
included in the analysis model. The analysis model
was:
Yijk = aSij + gij + eijk, [2]
where gij is the additive genetic effect of animal i, and
the other terms are as defined for equation [1]. Two
groups were determined for animals with unknown par-
ents. All effects were assumed to be random, and the
additive genetic effects were computed with inclusion of
the relationship matrix. The substitution effect was
computed as σapp
205
21
()
{}
.
, where σa
2 = the vari-
ance of the SNP effect and p = the minor allele fre-
quency.
Nominal 5 and 1% significance levels were deter-
mined empirically for the effect of the SNP at position
39,956,467 bp on BTA7 by permutation analysis. One
thousand samples were generated from the data with
the relationships and genetic evaluations for protein
percent intact, but with genotypes assigned randomly
among the genotyped bulls. In addition to individual
testing of each SNP, the false discovery rate was com-
puted based on the nominal 1% significance level.
Determination of concordance between a polymor-
phism and the QTL is based on comparing the marker
genotypes to the QTL genotypes for individuals with
known QTL genotypes. Quantitative trait loci genotypes
for AI bulls can be determined by application of either
a daughter or granddaughter design. Eleven Israeli Hol-
stein sires were analyzed previously in the QTL region
by the daughter design (Ron et al., 2004). None of these
bulls were heterozygous for the QTL affecting protein
concentration, and only sire 2283 was heterozygous for
the SNP at position 38,243,702. The daughter design
was applied to 2 additional sire families, 3652 and
3881, heterozygous for the SNP at position 38,243,702.
Regression-based interval mapping was performed by
the program of R. Spelman (Spelman et al., 1996). The
estimated breeding values of the daughters from the
standard June 2009, evaluation were analyzed for the 5
milk production traits and female fertility. All records
were weighted equally. Each family was analyzed sepa-
rately for each trait with the genetic markers on BTA7
as described previously (Weller et al., 2008a). Because
these results were used to confirm the results of the
LD analysis, significance of the within family contrasts
were determined by one-tailed t-tests.
RESULTS
Allele Substitution Effects and Interval Mapping
Population-wide LD for economic traits was tested
for 225 SNP located on BTA7 by analysis of the genetic
evaluations of up to 696 Holstein bulls by the linear
model. Genotyping was performed using Sequenom
mass spectrometer. A SNP (A → T, build 4.0 posi-
tion 39,956,467), in the intergenic region upstream the
ZNF496 gene (GeneID: 526480), displayed significant
LD with milk production traits, using the linear model
for analysis (Table 2). The lowest LD probability (P <
Journal of Dairy Science Vol. 94 No. 4, 2011
GOLIK ET AL.
2094
10−10) was observed for milk protein percentage. The
REML analyses for protein percent did not converge
for 12 SNP, leaving 213 SNP with valid results. The
nominal 1% significance level for the SNP effect based
on the permutation analysis was 4% of the variance.
Thirteen SNP with effects greater than this were found,
for a false discovery rate of 0.16 (2.13/16). Of these, 5
were within 1 Mbp of the SNP at position 39,956,467.
The REML analysis, which, unlike the linear model
analysis, accounts for the family relationships, estimat-
ed a similar substitution effect for protein percentage
for this SNP (0.12%). This SNP explained 14% of the
variance among the bull genetic evaluations (Table 2),
which was more than any of the other SNP analyzed,
except one. No effect was found for protein yield in the
REML analysis. The frequency of the allele with posi-
tive effects on fat and protein concentration was 10%.
Daughters of 3 bulls heterozygous for this SNP (2283,
3652, and 3881) were analyzed by the daughter design
(Weller et al., 1990; Ron et al., 2001). The effect associ-
ated with this chromosomal region was significant by
interval mapping (P < 0.05 for the single-tailed t-test)
for the protein percentage trait only within the smaller
family of sire 3652 (n = 51, Table 2), and neither sig-
nificant effect nor trend was detected within the 2283
(n = 325) and 3881 (n = 109) families. It is expected
that the effects detected by a daughter design should
be smaller, because the genetic evaluations of cows are
more highly regressed, as compared with bulls.
Population-wide LD for economic traits in this
critical region on BTA7 was also analyzed by the linear
model using the BovineSNP50 BeadChip (Weller et al.,
2010) and the breeding values of 900 Holstein bulls.
Although SNP located near the ZNF496 locus did not
display significant effects on milk production traits,
a more centromeric SNP (A → C, build 4.0 position
38,243,702) displayed significance at P < 10−12 (Table
2). The frequency of the C allele was 10%, which is
typical of the rare haplotype associated with increase of
protein percentage in milk (see the haplotype described
in the section entitled “Isolation and genotyping of
bovine ZNF496 sequence variations”). These results
correspond to the fact that most of the SNP genotyped
by the Sequenom mass spectrometer near this gene
did not display significant LD for the milk production
traits, and did not have allelic frequencies similar to
the SNP at position 39,956,467. Segregation status for
the SNP at position 38,243,702 was identical to the
SNP at position 39,956,467 in 97% of the 655 sires that
were analyzed by both the mass spectrometry and the
BeadChip methods. Thus, it is not surprising that the
magnitude of the effects were also very similar. In the
REML analysis, a substitution effect for protein per-
centage similar to the linear model was detected, and
this SNP explained 13% of the variance among the bull
EBV (Table 2). Hence, based on the REML and linear
model analyses, we were able to confirm segregation of
a QTL for protein percentage near the ZNF496 gene.
Estimated effects by the REML analysis for milk, fat,
and protein production, and fertility were not consis-
tent for the 2 SNP, and also differed from the linear
model analyses. This is apparently due to the fact that
more animals were included in the analysis of Bead-
Chip SNP, and confidence intervals for effects from the
2095
DIFFERENTIAL EXPRESSION OF ZNF496 VARIANTS
Journal of Dairy Science Vol. 94 No. 4, 2011
Table 2. Substitution effect of genetic markers on sire genetic evaluations for economical traits using a linear model, REML, and the daughter
design analyses
Analysis
ZNF496 promoter SNP BTA7:39,956,467
Daughter
design, sire
3652 (n = 51)
BeadChip SNP BTA7:38,243,702
Linear model
(n = 696) REML1 (n = 696)
Linear model
(n = 900) REML2 (n = 900)
Substitution
effect ± SE
Substitution
effect3% of the total
variance
Substitution
effect
Substitution
effect ± SE3Substitution
effect3
% of the
total
variance
kg of milk −169 ± 60* 355.0 4.5* −110 −116 ± 51* ND4ND
kg of fat 6.4 ± 2.1* 12.1 3.6* 0.8 6.7 ± 1.9* 0.0 0.0
kg of protein 4.0 ± 1.5* 0.0 0.0 1.5 4.5 ± 1.3* 14.0 8.8
% of fat 0.12 ± 0.02** 0.20 10.3** 0.04 0.10 ± 0.02** 0.20 8.2
% of protein 0.09 ± 0.01** 0.12 13.7** 0.05* 0.08 ± 0.01** 0.11 12.6
Fertility −1.9 ± 0.4** 2.4 5.3* 0.6 1.8 ± 0.4** 0.5 0.2
1This analysis also included 782 ancestors without genotypes.
2This analysis also included 951 ancestors without genotypes.
3The sign is consistent throughout all the analyses and refers to the favorable allele, except REML, which does not indicate the direction of the
effect. For the REML analysis, the substitution effect was computed as σapp
205
21
()
{}
.
, where σa
2 = the variance of the SNP effect and p
= the minor allele frequency.
4Not done.
*P < 0.05; **P < 0.0001.
REML analyses are greater, because the analysis model
also included the additive polygenic effect.
Cloning of Long Variants of the ZNF496 Gene
BLASTN search of ruminant dbEST using human
ZNF496 mRNA (GenBank Accession No. NM_032752)
and its orthologous bovine genomic sequence identi-
fied 41 expressed sequence tags (GenBank Accession
Nos. EE805798, DY516712, DY148335, DN515039,
CB168685, DY465768, BM090220, GO719870,
GO715741, EH168881, EE854440, GO682070,
GO684854, BF654452, DN514372, DY466869,
DN534605, EE222597, DY476627, BG691593,
EE377856, DV916651, DV933966, EH126093, CX952359,
CK727881, DY166125, CU653278, DY165480,
GO744973, BG694264, BP111411, GO351570,
CB434683, CB418460, GO767834, GO739593,
BE487172, DY126130, BE668425, AW430191), which
indicated that the transcript described for this bovine
gene (GenBank Accession No. XM_002689056.1) was
missing exons in its 5 end. Following these findings,
we predicted the existence of a long ZNF496 transcript
and submitted this putative transcript as a third-party
annotation (TPA; Table 3, GenBank Accession No.
BN001496). Ten exons formed this transcript, and all
exon-intron borders displayed typical donor and accep-
tor sequence motifs (Table 3). This assembled cDNA
was of 5,017 bp, and the fifth ATG codon was the puta-
tive initiator of translation according the orthologous
human protein (Figure 1). This codon was located on
the fourth exon. The last exon had a stop codon (TGA)
in orthology to the human transcript and had a typi-
cal polyadenylation site (AATAAA at base 4994). The
bovine transcript could encode a polypeptide of 587 AA
with the predicted molecular mass of 66.4 kDa. To cor-
roborate the TPA prediction, we designed PCR primers
(#1–4, Table 1) and were able to RT-PCR amplify a
transcript spanning exons 2 to 10 (GenBank Accession
Nos. FN908756; FN908757; FN908185), using total
mRNA extracted from bovine mammary gland biopsy
and ovine ovary as the cDNA templates (Golik et al.,
2006). The SNP in position 39,956,467, which is associ-
ated with protein percentage (Table 2), is located 1,846
bp upstream of the transcription start site of the long
bovine ZNF496 transcript and, therefore, is within its
predicted promoter region.
Alignment of the ZNF496 orthologs (Figure 1) from
different species indicated that the closely related bovine
and ovine orthologs (98% identity, 99% similarity) were
more similar to the human (83–84% identity, 88–89%
similarity) than to murine ortholog (72% identity, 79%
similarity). Ruminant orthologs shared sequence motifs
that suggest nuclear localization: a bipartite nuclear
localization signal (NLS) and 2 shorter Pat4 and Pat7
sequence motifs (Figure 1), and the PSORT computer
program predicted nuclear localization of these or-
thologs with scores of 76%. Three types of domains
typical to the ZNF496 architecture (Nielsen et al., 2004;
Mysliwiec et al., 2007) were conserved in all orthologs
(Figure 1): 1) SCAN, which is a leucine-rich N-terminal
motif that plays an important role in controlling the
assembly of complexes of transcriptional regulators;
2) Kruppel-associated box (KRAB) that functions to
repress transcription by recruiting a transcriptional co-
repressor; and 3) C2H2-type zinc fingers of the DNA-
binding motif.
Mouse Noncoding RNA From the Opposite Strand
is Overlapping a Conserved Sequence Element
in the First Exon Within the Untranslated
Region of the Bovine ZNF496 Transcript
To investigate the function of the 5 noncoding region
of the long ZNF496 transcript, we BLASTN-searched
Journal of Dairy Science Vol. 94 No. 4, 2011
GOLIK ET AL.
2096
Table 3. Genomic organization of the ZNF496 gene on BTA71
Intron Exon Intron
Sequence No. Size Sequence Size
1 180 GAGGAGgtgagtgcggcccgggcggc 168
acgacacaaatgtttttcagGCGCCT 2 226 TGTGAGgtgaggagccgggagctggc 1,380
gtctgtctttgtcttttcagCTCATT 3 117 TCGAAGgtaccacagagtgttaatta 348
tgatttctgtttggaaatagGGTCGT 4 427 CAATGGgtgagcagagggggctgggc 411
agccctctctgggattgcagCTCAAG 5 184 ACCCAGgtagggtgcccatgggagtg 6,161
tcttttctgatctctttcagTCCTGC 6 77 CCCCCGgtgagtgatttctggggcag 25,468
tacttgttctgtggtttcagAACCGG 7 133 CTCCAAgtaagacttaactcagctct 500
ccttccctttctgtgaatagATGATG 8 108 ACTTGGgtgaggaatgataccagaac 1,083
tcattttcttctctggaaagACTTTC 9 114 GCCCAGgtaaaggaattcttaggagg 5,936
accttgttgctttctggtagTGGGAG 10 3,451 AGGTGCAAAATAAAAATTTGACTTGC
TGAATT+poly (A) tail
1Exon and intron sizes are given in base pairs. Intron and exon sequences are written in lowercase and uppercase letters, respectively. The first
and last 2 bases of introns (gt and ag for donor and acceptor splice sites, respectively) are in bold type. The polyadenylation site (AATAAA) is
in bold and underlined type. The genomic size of the gene was 46,472 bp.
the fRNAdb database of noncoding RNA (ncRNA)
sequences using exons 1 to 3 of the bovine ZNF496
mRNA as a query. We found 4 murine sequences pro-
ducing significant alignments (88–92% identity, Gen-
Bank Accession Nos. AK011602, AK017115, AK030920,
AK163429) with a 113-bp element in the first exon of
the 5 untranslated region (UTR) of the bovine ZNF496
transcript. Examination of these murine transcripts in-
dicated that their 5-exon genomic structure has typical
donor and acceptor sequence motifs (Table 4), which
indicated that they are transcribed from the strand
opposite to that of Zkscan17 with an overlap over the
first 2 exons of the 5 UTR of the reference Zkscan17
transcript (GenBank Accession No. NM_001130529).
Mouse and cattle ZNF496 orthologs share a similar
10-exon genomic structure with nontranslated exons
at their 5 ends. This genomic structure, including its
representative cis-antisense transcripts, is viewable in
the FANTOM3 interface (http://fantom3.gsc.riken.jp/
db/annotate/main.cgi?masterid = F630207M06).
Isolation and Genotyping of the Bovine
ZNF496 Sequence Variations
The promoter region and the exons of bovine ZNF496
of 5 heterozygotes (sires 2283, 3259, 3652, 3881, and
5190) and 2 homozygotes (sires 3883, 7185) for the rare
allele of the SNP (BTA7:39,956,467) upstream of bovine
ZNF496 were sequenced. The PCR primers are given in
lines 5 to 29 of Table 1. All of these sires also carried
an 18-bp indel in exon 2. Twenty-three variations were
detected in these sires. In total, 15 polymorphisms were
segregating in all of the heterozygotes, of which 11 were
located in the promoter region (Table 5). The rare hap-
lotype that consisted of these variations was evident
from the 2 homozygotes and was possibly present in
all heterozygotes. Haplotype analysis indicated that the
insertion of 18 bp in the second exon (+ allele) was in
gametic association with the QTL allele increasing the
protein percentage. The rare haplotypes of sires 2283,
3652, and 3881 were identical, even though only sire
3652 was segregating for the QTL as determined by the
daughter design analysis. Thus, concordance with the
QTL could not be established for any of the polymor-
phisms detected so far.
Differential Expression of ZNF496 Variations
The observed lack of concordance between the QTL
and the 18-bp indel in exon 2 of bovine ZNF496 should
have excluded the insertion allele as the causative QTL
mutation, assuming Mendelian inheritance without
2097
DIFFERENTIAL EXPRESSION OF ZNF496 VARIANTS
Journal of Dairy Science Vol. 94 No. 4, 2011
Figure 1. Alignment of predicted amino acid sequences of the ZNF496 proteins. The human and mouse reference sequences were aligned
with the ovine and bovine orthologs (GenBank Accession Nos. NP_116141; NP_766529; CBM42648; CBM43246, respectively). Black and gray
boxes indicate identity and similarity between the amino acid sequences, respectively. White boxes indicate nonconservative amino acid changes
between the proteins. Dots indicate gaps introduced by the alignment program. SCAN, KRAB, and zinc fingers domains are delineated. Nuclear
localization signals (pat4 pat7 NLS and a bipartite NLS) are annotated in light gray.
epigenetic effects. However, sequence analysis of tran-
scripts derived from ovaries of 5 cows with nucleotide
polymorphisms in the last exon indicated that the vari-
ations observed in the genomic DNA were not equally
expressed in the 3 cows that were heterozygous for the
genomic sequence of ZNF496 exon 10. In the case of
c.2234C > T, although the homozygous cow expressed
the common “C” variant (Figure 2A), the heterozygous
cow expressed only the rare (allele frequency 5%, SNP
genomic position 39,910,492) “T” variant (Figure 2B).
This differential expression may indicate the existence
of a complex mechanism, such as classical imprinting
or copy number variation (CNV), and is typical of
situations in which the missing variation is either not
expressed or quickly degraded.
Conservation of the differential expression in other
ruminates may point to the general importance of this
mechanism in controlling ZNF496 transcription. To
determine if such pattern of expression is conserved
in other ruminants, we investigated the expression of
genomic variations in the last exon of ovine ZNF496 in
a sheep family (Figure 2C). A chromatogram of the ge-
nomic DNA sequences of heterozygote revealed an am-
biguous trace at position corresponding to the c.1719G
> A mutation and at the positions that followed an in-
del. The short variant of this indel had a 3-bp deletion
Journal of Dairy Science Vol. 94 No. 4, 2011
GOLIK ET AL.
2098
Table 4. Genomic organization of the ZNF496 cis-antisense transcript on MMU111
Intron Exon Intron
Sequence No. Size Sequence Size
1 1,225 GTCCTGgtgagtacggagagagaagg 304
acgacacaaatgtttttcagGCGCCT 2 122 TAGTAGgtatggagttaagggtcgag 518
tctgtgtttcttctgcatagAACCTG 3 108 CTTCAGgtacctccctcatacaggag 1,715
tgattcttccacatttgcagGGATCG 4 97 TGGCAGgtacgggatactcaaagtat 535
gtctactgagtgagttccagGACAGC 5 1,100 GATGCCTGAATAAAACTCCATTTTGT
1Exon and intron sizes are given in base pairs and correspond to GenBank Accession No. AK163429. Intron and exon sequences are written in
lowercase and uppercase letters, respectively. The first and last 2 bases of introns (gt and ag for donor and acceptor splice sites, respectively) are
in bold type. A putative polyadenylation site (AATAAA) is in bold and underlined type. The genomic size of the gene was 5,724 bp.
Table 5. Genotypes and QTL status of the SNP 39,956,467 rare allele carriers
Genetic marker Position1
Bull number and QTL status2
5190
ND
3881
NS
3259
ND
2283
NS
3652
S
7185
ND
3883
ND
BeadChip SNP BTA7 38,243,702 CACACACACACC CC
SNP, ZNF496 intron8 39,917,453 C CCCCTCCCCCC CC
SNP, ZNF496 intron8 39,917,570 CCCCCCCTCCCC CC
SNP, ZNF496 intron8 39,918,152 CCCACCCCCACC CC
SNP, ZNF496 intron7 39,918,469 CCCCCCCAAACC CC
SNP, ZNF496 intron6 39,944,866 G AGAGAGAGGGG GG
SNP, ZNF496 intron5 39,951,114 C CCGCCCGCCCC CC
SNP, ZNF496 intron3 39,952,525 GCGCGCGCGCGG GG
SNP, ZNF496 intron2 39,952,728 C GCCCCCCCCCC CC
18 bp indel, ZNF496 exon2 39,954,067-85 +++++++ ++
9 bp indel, ZNF496 intron1 39,954,414–23 +++++–– ––
SNP, ZNF496 promoter 39,955,084 A GAGAGAGAGAA AA
SNP, ZNF496 promoter 39,955,129 AGAGAGAGAGAA AA
SNP, ZNF496 rs43517615 39,955,354 C TCTCCCTCTCC CC
SNP, ZNF496 promoter 39,955,427 TCTCTCTCTCTT TT
SNP, ZNF496 rs29013512 39,955,552 A GAGAGAGAGAA AA
SNP, ZNF496 promoter339,956,467 T ATATATATATT TT
SNP, ZNF496 promoter 39,956,729 CACACACACACC CC
SNP, ZNF496 promoter 39,957,657 C TCTCTCTCTCC CC
SNP, ZNF496 promoter 39,957,713 CCCACCCACACC CC
SNP, ZNF496 promoter 39,958,123 T ATATATATATT TT
SNP, ZNF496 promoter 39,958,187 C ACACACACACC CC
SNP, ZNF496 promoter 39,958,372 ND ND TCTCTCTCTT TT
SNP, ZNF496 rs29013511 39,958,639 G CGCGCGCGCGG GG
1The positions (bp on build 4) in bold type were analyzed both by sequencing and MS.
2Alleles in bold type correspond to the rare haplotype. ND = not determined, NS = non-segregating, S = segregating for the QTL.
3The SNP analyzed in Table 2.
(GenBank Accession No. FN908186), which resulted
in the deletion of the serine residue at position 407
similarly to the human and mouse orthologs. Analysis
of the mother genomic DNA (Dam DNA) revealed only
the short variant. However, sequence analysis of tran-
scripts from kidney and liver of the daughter revealed
only the sequence of the paternal long variant (Figure
2C). In another unrelated individual, only the short
variant was detected, indicating that this variant tran-
script could be expressed in liver (data not shown). An
ambiguous base in the cDNA (Figure 2C, dashed arrow)
showed that this position does not match the sequence
of the genomic DNA obtained from lymphocytes, which
may be explained either by somatic mutation or RNA
editing (Farajollahi and Maas, 2010). Hence, a complex
mechanism of regulation of ZNF496 variants was also
observed in the sheep mRNA expression.
DISCUSSION
Milk production traits are determined by the contri-
butions of a large number of genes and environmental
factors. Nevertheless, the size of the effect of the QTL
we describe on BTA7 places this locus in the top 10
QTL detected in the Holstein cattle genome. Three
independent analyses validate this QTL. Two of them
were population-wide LD analyses of SNP, including
mass spectrometry for 225 SNP in a sample of 696 sires
and BovineSNP50 BeadChip analysis for 900 sires. The
third line of evidence was based on the daughter de-
2099
DIFFERENTIAL EXPRESSION OF ZNF496 VARIANTS
Journal of Dairy Science Vol. 94 No. 4, 2011
Figure 2. Differential expression of ZNF496 variations in cattle and sheep. Chromatograms of genomic and cDNA sequences of bovine (A,
B) and ovine (C) ZNF496. The sequences around SNP 39,910,998 for DNA expressed in the ovaries (cDNA) and genomic (DNA) sequences in
cow were compared for a cow homozygous for the common variation (A) and a cow heterozygous for the rare variation (B). The arrow below
the chromatogram of the polymorphic DNA points to this SNP position. Only the rare allele was detected in the cDNA of the heterozygous cow.
Sequence chromatograms derived from the last exon of ovine ZNF496 (C) were compared between the genomic DNA extracted from daughter
(DNA) and mother (Dam DNA) blood lymphocytes and transcripts expressed in the daughter tissues (kidney and liver cDNA). Solid arrow and
line annotate the c.1719G > A mutation and the positions that followed an indel variation, respectively. The dashed arrow indicates the position
where the cDNA sequence differs from the genomic DNA sequence. Color version available in the online PDF.
sign (Ron et al., 2001). In both REML analyses, based
on both the mass spectrometry and the BeadChip
SNP, a similar substitution effect for protein percent-
age was detected, and the 2 SNP analyzed (Table 2)
explained about 13% of the variance among the bull
EBV. Discrepancies between LD and REML analyses
are expected, because the LD analysis does not include
the polygenic effect. Related animals will tend to have
similar genotypes for a specific marker, but will also
have a common polygenic effect. The reason that the
magnitude of the LD effect was lower in the daughter
design analyses was due to the fact that EBV of cows
are much more regressed than the genetic evaluations
of bulls (Ron et al., 2001). Of all genomic effects we ob-
served in BovineSNP50 BeadChip analysis, when sorted
according to their fraction of total variance of protein
percentage as calculated by REML analysis (data not
shown), this BTA7 QTL was the eighth in importance
following BTA6 (Cohen-Zinder et al., 2005), BTA14
(Weller et al., 2003), BTA3 (36 Mb), BTA19 (14 Mb),
BTA9 (25 Mb), BTA18 (56–63 Mb), and BTA1 (1 Mb).
However, unlike most of these other effects, the minor
QTL allele was the economically favorable allele. With
10% frequency of the minor allele, selection for this
allele should have a significant economical effect.
Various studies have suggested that daughter yield
deviations (DYD) or deregressed evaluations should be
analyzed for estimation of QTL effects (e.g., Bolormaa
et al., 2010), because QTL effects estimated by analysis
of EBV will be biased. Israel and Weller (1998) dem-
onstrated by simulation that QTL estimates derived by
analysis of DYD are also biased, and that probability
values of the effects obtained were equal for EBV and
DYD. Therefore, following Ron et al. (2004) we decided
to analyze EBV throughout.
Our initial LD observation pointed to the significant
effect (P < 10−10) for SNP in the ZNF496 promoter,
which prompted us to examine this candidate gene,
taking into account that such LD was expected to de-
crease the QTL confidence interval to less than one
map unit (Ron and Weller, 2007). Our recent results
from BovineSNP50 BeadChip analysis indicated that
the LD peak extends 2 map units further toward the
centromere, which places a large number of candidate
genes within the confidence interval. Nevertheless, the
ZNF496 remains an attractive candidate, because the
differential expression of its variants, which is typical of
imprinted genes, may explain the lack of concordance
between the suggested QTL haplotype and the QTL sta-
tus observed in the daughter design. The ZNF496 gene
product represses transcription by recruiting the tran-
scriptional co-repressor NSD1 that was also implicated
in genomic imprinting (Baujat et al., 2004). Another
important developmental gene interacting with ZNF496
is JMJ, which has essential roles in the development of
multiple tissues and in cell proliferation during develop-
ment (Takeuchi et al., 2006). Thus, the interactions of
ZNF496 with chromatin regulators and developmental
genes make this gene a likely candidate to affect mor-
phogenesis of organs (http://func.med.harvard.edu/
human/genes/list_functional_scores/162714). Indeed,
Zkscan17 expression changes during mammary gland
development. The pattern of Zkscan17 expression was
analyzed by Ron et al. (2003) during different physi-
ological stages of the mouse mammary gland at virgin
(d 42), pregnancy (d 14), lactation (d 10), and involu-
tion (d 4) using a DNA array (Tanaka et al., 2000). The
UTR of 5-end of Zkscan17 transcript was represented
by clone H3126E03 in this array. The expression of this
gene changed significantly (P < 0.01) during this gland
development and differentiation. The maximal 2.2-fold
change of the normalized intensities of this clone was
detected between the lactation and involution stages.
The genomic structure we reported for the bovine
and ovine ZNF496 genes uncovered a complex 5 UTR
that stretched over 4 exons and contained a 113-bp
element conserved in other mammals. Hence, the mu-
rine antisense transcript that overlapped this element
suggests 5 UTR involvement in antisense regulation of
ZNF496 in other mammals as well. Imprinted genes are
associated with antisense transcripts (Reik and Wal-
ter, 2001), and this antisense transcription, therefore,
may correspond to the differential expression of vari-
ants typical of imprinted genes that we observed in the
bovine and ovine ZNF496 loci. The 18-bp insertion in
exon 2 that was part of the rare haplotype associated
with the QTL allele of increased protein concentration
is a variation that may play a role in 5 UTR regula-
tion.
Concordance between QTL status of segregation and
heterozygosity of the candidate variation is considered
to be a critical test for identifying the polymorphism
that underlies a QTL (Ron and Weller, 2007; Seroussi,
2009). For the 18-bp insertion, as well as for all other
variations on the haplotype associated with increased
milk protein concentration, concordance was not ob-
tained, and lack of concordance is expected to extend to
the other candidate genes along the rare haplotype that
is associated with the favorable QTL allele. This would
have excluded them from underlying the QTL under
the model of simple Mendelian inheritance. However,
the differential expression pattern we observed for the
ZNF496 gene complicated this analysis. Imprinted genes
are often part of imprinted clusters (Reik and Walter,
2001). The potential existence of an imprinting center
in the confidence interval of the QTL we described on
BTA7 should, therefore, be taken into consideration in
the search of the underlying mutation, and may explain
Journal of Dairy Science Vol. 94 No. 4, 2011
GOLIK ET AL.
2100
why carriers of the QTL haplotypes that were expected
to be inherited from the same familial background did
not segregate using the daughter design analysis. When
considering imprinting models for the ZNF496 chromo-
somal region, maternal imprinting was the model that
was concordant with the data. In case of paternal im-
printing, no segregating QTL effect would be detected
in heterozygous sires. This was also in concordance with
the observation in sheep that on the mRNA level only
the paternal allele was expressed (Figure 2B). However,
this simple model cannot explain the observation that 2
bulls were heterozygous for the rare haplotype and did
not display QTL segregation by the daughter design
analysis. This lack of segregation may be explained
either by existence of an identical haplotype that is not
associated with the favorable QTL allele, or by a com-
plex epigenetic model that confers partial imprinting to
this allele by interacting with unknown factors.
CONCLUSIONS
In the bovine ZNF496 chromosomal region on BTA7,
the presence of a QTL affecting economic traits of
dairy cattle was demonstrated by population-wide LD
analysis and by analysis of a sire family by the daugh-
ter design. Whole genome analysis using BovineSNP50
BeadChip indicated that the less frequent QTL allele
is an important economically favorable allele in Israeli
Holstein cattle. The 5 UTR of the ZNF496 gene tran-
script consisted of 3 exons, which included a conserved
element involved in anti-sense transcription. A 18-bp
insertion in this UTR was observed in the ZNF496 gene
variant that was associated with the favorable allele.
However, concordance was not obtained between QTL
status of bulls and any of the polymorphisms we detect-
ed in this gene. This excludes these variations as the
causative polymorphism under the assumption of no
epigenetic effect for this locus. Nevertheless, ZNF496
variants were differentially expressed in bovine ovaries,
and only the paternal variant was expressed in liver
and kidney in a sheep family with polymorphic ZNF496
sequence. Thus, the search for the mutation underlying
may be complicated by the presence of an imprinting
center in the QTL confidence interval.
ACKNOWLEDGMENTS
Contribution from the Agricultural Research Or-
ganization, Institute of Animal Science, Bet Dagan,
Israel, No. 569/10 is acknowledged. This research was
supported by a grant from the Israel Milk Marketing
Board and the European Sixth Research and Techno-
logical Development Framework Programme, Proposal
No. 016250-2 SABRE. We thank I. Misztal and R.
Spelman for use of their computed programs. Mas-
sArray genotyping of SNP was performed by T. Koch
and E. Ben-Asher (Genome Knowledge Center, the
Weizmann Institute of Science, and the Crown Human
Genome Center, Rehovot, Israel). BeadChip genotyp-
ing of SNP was performed by A. Schein and N. Avidan
(Pharmacogenetics and Translation Medicine Center,
The Rappaport Institute for Research in the Medical
Sciences, Technion, Haifa, Israel).
REFERENCES
Baujat, G., M. Rio, S. Rossignol, D. Sanlaville, S. Lyonnet, M. Le Mer-
rer, A. Munnich, C. Gicquel, V. Cormier-Daire, and L. Colleaux.
2004. Paradoxical NSD1 mutations in Beckwith-Wiedemann syn-
drome and 11p15 anomalies in Sotos syndrome. Am. J. Hum.
Genet. 74:715–720.
Bolormaa, S., J. E. Pryce, B. J. Hayes, and M. E. Goddard. 2010.
Multivariate analysis of a genome-wide association study in dairy
cattle. J. Dairy Sci. 93:3818–3833.
Cohen-Zinder, M., E. Seroussi, D. M. Larkin, J. J. Loor, A. Everts-van
der Wind, J. H. Lee, J. K. Drackley, M. R. Band, A. G. Hernan-
dez, M. Shani, H. A. Lewin, J. I. Weller, and M. Ron. 2005. Identi-
fication of a missense mutation in the bovine ABCG2 gene with a
major effect on the QTL on chromosome 6 affecting milk yield and
composition in Holstein cattle. Genome Res. 15:936–944.
Farajollahi, S., and S. Maas. 2010. Molecular diversity through RNA
editing: A balancing act. Trends Genet. 26:221–230.
Golik, M., M. Cohen-Zinder, J. J. Loor, J. K. Drackley, M. R. Band,
H. A. Lewin, J. I. Weller, M. Ron, and E. Seroussi. 2006. Acceler-
ated expansion of group IID-like phospholipase A2 genes in Bos
taurus. Genomics 87:527–533.
Israel, C., and J. I. Weller. 1998. Estimation of candidate gene effects
in dairy cattle populations. J. Dairy Sci. 81:1653–1662.
Losson, R., and A. L. Nielsen. 2010. The NIZP1 KRAB and C2HR do-
mains cross-talk for transcriptional regulation. Biochim. Biophys.
Acta 1799:463–468.
Mysliwiec, M. R., T. Kim, and Y. Lee. 2007. Characterization of zinc
finger protein 496 that interacts with Jumonji/Jarid2. FEBS Lett.
581:2633–2640.
Nakai, K., and P. Horton. 1999. PSORT: A program for detecting sort-
ing signals in proteins and predicting their subcellular localization.
Trends Biochem. Sci. 24:34–36.
Nielsen, A. L., P. Jørgensen, T. Lerouge, M. Cerviño, P. Chambon, and
R. Losson. 2004. Nizp1, a novel multitype zinc finger protein that
interacts with the NSD1 histone lysine methyltransferase through
a unique C2HR motif. Mol. Cell. Biol. 24:5184–5196.
Reicher, S., E. Seroussi, and E. Gootwine. 2010. A mutation in gene
CNGA3 is associated with day blindness in sheep. Genomics
95:101–104.
Reik, W., and J. Walter. 2001. Genomic imprinting: Parental influence
on the genome. Nat. Rev. Genet. 2:21–32.
Ron, M., M. Band, M. Shani, J. P. Gregg, H. A. Lewin, and J. F. Me-
drano. 2003. Gene expression patterns in murine mammary devel-
opment and involution. Poster presentation in Plant and Animal
Genomes XI Conference. San Diego, CA.
Ron, M., E. Feldmesser, M. Golik, I. Tager-Cohen, D. Kliger, V. Reiss,
R. Domochovsky, O. Alus, E. Seroussi, E. Ezra, and J. I. Weller.
2004. A complete genome scan of the Israeli Holstein population
for quantitative trait loci by a daughter design. J. Dairy Sci.
87:476–490.
Ron, M., D. Kliger, E. Feldmesser, E. Seroussi, E. Ezra, and J. I.
Weller. 2001. Multiple quantitative trait locus analysis of bovine
chromosome 6 in the Israeli Holstein population by a daughter
design. Genetics 159:727–735.
Ron, M., and J. I. Weller. 2007. From QTL to QTN identification in
livestock—Winning by points rather than knock-out: A review.
Anim. Genet. 38:429–439.
2101
DIFFERENTIAL EXPRESSION OF ZNF496 VARIANTS
Journal of Dairy Science Vol. 94 No. 4, 2011
Seroussi, E. 2009. The concordance test emerges as a powerful tool for
identifying quantitative trait nucleotides: Lessons from BTA6 milk
yield QTL. Anim. Genet. 40:230–234.
Spelman, R. J., W. Coppieters, L. Karim, J. A. M. van Arendonk,
and H. Bovenhuis. 1996. Quantitative trait loci analysis for five
milk production traits on chromosome six in the Dutch Holstein-
Friesian population. Genetics 144:1799–1808.
Staden, R., K. F. Beal, and J. K. Bonfield. 2000. The Staden package,
1998. Methods Mol. Biol. 132:115–130.
Takeuchi, T., Y. Watanabe, T. Takano-Shimizu, and S. Kondo. 2006.
Roles of jumonji and jumonji family genes in chromatin regulation
and development. Dev. Dyn. 235:2449–2459.
Tanaka, T. S., S. A. Jaradat, M. K. Lim, G. J. Kargul, X. Wang, M. J.
Grahovac, S. Pantano, Y. Sano, Y. Piao, R. Nagaraja, H. Doi, W.
H. Wood III, K. G. Becker, and M. S. H. Ko. 2000. Genome-wide
expression profiling of mid-gestation placenta and embryo using a
15,000 mouse developmental cDNA microarray. Proc. Natl. Acad.
Sci. USA 97:9127–9132.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Improved
sensitivity of profile searches through the use of sequence weights
and gap excision. Comput. Appl. Biosci. 10:19–29.
Weller, J. I., and E. Ezra. 2004. Genetic analysis of the Israeli Holstein
dairy cattle population for production and nonproduction traits
with a multitrait animal model. J. Dairy Sci. 87:1519–1527.
Weller, J. I., G. Glick, E. Ezra, Y. Zeron, E. Seroussi, and M. Ron.
2010. Paternity validation and estimation of genotyping error rate
for the BovineSNP50 BeadChip. Anim. Genet. 41:551–553.
Weller, J. I., M. Golik, S. Reikhav, R. Domochovsky, E. Seroussi, and
M. Ron. 2008a. Detection and analysis of quantitative trait loci af-
fecting production and secondary traits on chromosome 7 in Israeli
Holsteins. J. Dairy Sci. 91:802–813.
Weller, J. I., M. Golik, E. Seroussi, E. Ezra, and M. Ron. 2003. Popu-
lation-wide analysis of a QTL affecting milk-fat production in the
Israeli Holstein population. J. Dairy Sci. 86:2219–2227.
Weller, J. I., M. Golik, E. Seroussi, M. Ron, and E. Ezra. 2008b. De-
tection of quantitative trait loci affecting twinning rate in Israeli
Holsteins by the daughter design. J. Dairy Sci. 91:2469–2474.
Weller, J. I., Y. Kashi, and M. Soller. 1990. Power of daughter and
granddaughter designs for determining linkage between mark-
er loci and quantitative trait loci in dairy cattle. J. Dairy Sci.
73:2525–2537.
Journal of Dairy Science Vol. 94 No. 4, 2011
GOLIK ET AL.
2102
... JMJ also interacts physically with a transcriptional activator, ZNF496 (zinc finger protein 496), which inhibits the transcriptional repression of JMJ, which plays important roles in embryonic development. Golik et al found that a SNP in bovine ZNF496 gene displayed significant population-wide linkage disequilibrium with milk protein percentage in the Israeli Holstein population [17], so the interaction between ZNF496 and JMJ as well as our results indicate that JARID2 also has value to be investigated in further research. SNP ARS-BFGL-NGS-111443 associated with both fat percentage and protein percentage is located between the DERA (deoxyribosephosphate aldolase) gene and the SLC15A5 (solute carrier family 15, member 5) gene. ...
Article
Full-text available
The multiple-SNP analysis has been studied by many researchers, in which the effects of multiple SNPs are simultaneously estimated and tested in a multiple linear regression. The multiple-SNP association analysis usually has higher power and lower false-positive rate for detecting causative SNP(s) than single marker analysis (SMA). Several methods have been proposed to simultaneously estimate and test multiple SNP effects. In this research, a fast method called MEML (Mixed model based Expectation-Maximization Lasso algorithm) was developed for simultaneously estimate of multiple SNP effects. An improved Lasso prior was assigned to SNP effects which were estimated by searching the maximum joint posterior mode. The residual polygenic effect was included in the model to absorb many tiny SNP effects, which is treated as missing data in our EM algorithm. A series of simulation experiments were conducted to validate the proposed method, and the results showed that compared with SMMA, the new method can dramatically decrease the false-positive rate. The new method was also applied to the 50k SNP-panel dataset for genome-wide association study of milk production traits in Chinese Holstein cattle. Totally, 39 significant SNPs and their nearby 25 genes were found. The number of significant SNPs is remarkably fewer than that by SMMA which found 105 significant SNPs. Among 39 significant SNPs, 8 were also found by SMMA and several well-known QTLs or genes were confirmed again; furthermore, we also got some positional candidate gene with potential function of effecting milk production traits. These novel findings in our research should be valuable for further investigation.
... Some of the genes found in this window of chromosome 7 have been identified in studies analyzing selection signatures in different cattle breeds, such as the MGAT1 gene [28] involved in the production of gametes [29], or have been detected in fine mapping studies, such as the ZNF496 gene associated with fertility in dairy cattle [30]. One group of genes identified in another window of chromosome 7 (Chr07/3.12-3.85Mb) ...
Article
Full-text available
The objective of this study was to perform a genome-wide association study (GWAS) to detect chromosome regions associated with indicator traits of sexual precocity in Nellore cattle. Data from Nellore animals belonging to farms which participate in the DeltaGen® and Paint® animal breeding programs, were used. The traits used in this study were the occurrence of early pregnancy (EP) and scrotal circumference (SC). Data from 72,675 females and 83,911 males with phenotypes were used; of these, 1,770 females and 1,680 males were genotyped. The SNP effects were estimated with a single-step procedure (WssGBLUP) and the observed phenotypes were used as dependent variables. All animals with available genotypes and phenotypes, in addition to those with only phenotypic information, were used. A single-trait animal model was applied to predict breeding values and the solutions of SNP effects were obtained from these breeding values. The results of GWAS are reported as the proportion of variance explained by windows with 150 adjacent SNPs. The 10 windows that explained the highest proportion of variance were identified. The results of this study indicate the polygenic nature of EP and SC, demonstrating that the indicator traits of sexual precocity studied here are probably controlled by many genes, including some of moderate effect. The 10 windows with large effects obtained for EP are located on chromosomes 5, 6, 7, 14, 18, 21 and 27, and together explained 7.91% of the total genetic variance. For SC, these windows are located on chromosomes 4, 8, 11, 13, 14, 19, 22 and 23, explaining 6.78% of total variance. GWAS permitted to identify chromosome regions associated with EP and SC. The identification of these regions contributes to a better understanding and evaluation of these traits, and permits to indicate candidate genes for future investigation of causal mutations.
Preprint
Full-text available
Background: Reproductive performance and body weight are of the utmost economic importance in determining the efficiency of sheep production. Simultaneous selection for increased reproductive performance and early growth traits is a common strategy in many flocks, but ambiguous results regarding the relationship between reproduction and body weight have been reported. The objective of this study was to perform a genome-wide association study (GWAS) in two South African Merino flocks and an Afrino sheep flock that were selected for both reproduction and body weight over decades. The GWAS aimed to identify SNPs associated with genes affecting the traits number of lambs born (NLB), number of lambs weaned (NLW), total weight of lamb weaned (TWW) and body weight (BW) and thus to ascertain which genes were targeted through directional selection. Results: In the GWAS, 16 SNP markers associated with reproductive traits were identified among the three populations, while 15 SNPs were associated with body weight. These SNPs were linked respectively to 26 and 21 documented genes in the sheep genome. Most of these genes were previously associated in literature with reproduction related, as well as with growth related traits in various farm animal species. This study, supported by results from previous studies performed on sheep and cattle, identified the following genes that warrant further investigation as to their functions and processes relating to growth and reproduction in sheep: MAP7D1, TRAPPC3, THRAP3, TRMP8, SPP2, HDAC9, ZFHX3, SIX6, C14orf39, TAF4B, TRSP1 EYA2, RBMS3, STL38L, BSPH1, LIG1, CABP5 and ELSPBP1. Conclusions: Long-term selection in the flocks for both body weight and reproductive traits, and especially on the composite trait TWW, have favoured genes with pleiotropic effects influencing both groups of traits. SNPs associated with these pleiotropic genes were detected in the association analyses for the various traits.
Article
Full-text available
cDNA microarray technology has been increasingly used to monitor global gene expression patterns in various tissues and cell types. However, applications to mammalian development have been hampered by the lack of appropriate cDNA collections, particularly for early developmental stages. To overcome this problem, a PCR-based cDNA library construction method was used to derive 52,374 expressed sequence tags from pre- and peri-implantation embryos, embryonic day (E) 12.5 female gonad/mesonephros, and newborn ovary. From these cDNA collections, a microarray representing 15,264 unique genes (78% novel and 22% known) was assembled. In initial applications, the divergence of placental and embryonic gene expression profiles was assessed. At stage E12.5 of development, based on triplicate experiments, 720 genes (6.5%) displayed statistically significant differences in expression between placenta and embryo. Among 289 more highly expressed in placenta, 61 placenta-specific genes encoded, for example, a novel prolactin-like protein. The number of genes highly expressed (and frequently specific) for placenta has thereby been increased 5-fold over the total previously reported, illustrating the potential of the microarrays for tissue-specific gene discovery and analysis of mammalian developmental programs.
Article
Full-text available
Multiple-trait genome-wide association study (GWAS) analyses were compared with single-trait GWAS for power to discover and subsequently validate genetic markers (single nucleotide polymorphisms; SNP) associated with dairy traits. The SNP associations were discovered in 1 Holstein population and validated in both a Holstein population consisting of bulls younger than those in the discovery population and a Jersey population. The multivariate methods used were a principal component analysis and a series of bivariate analyses. The statistical power of detecting associations using multiple-trait GWAS was as good as or better than that of the best single-trait GWAS. Additional SNP associations were found with the multivariate methods that had not been discovered in the single-trait analyses; this was achieved without an increase in the false discovery rate. From the multivariate analysis, 4 common pleiotropic patterns were identified among the putative quantitative trait loci (QTL) affecting the Australian selection index. These patterns could be interpreted as a primary effect of the putative QTL on 1 or more milk components and secondary effects on other components. The multivariate analysis did not appear to increase the precision with which putative QTL were mapped.
Article
Full-text available
There is considerable interest in bovine DNA-level polymorphic marker loci as a means of mapping quantitative trait loci (QTL) of economic importance in cattle. Progeny of a sire heterozygous for both a marker locus and a linked QTL, which inherit different alleles for the marker, will have different trait means. Based on this, power to detect QTL, as a function of QTL effect, heritability of the trait, and number of animals tested was determined for 1) daughter design, marker genotype and quantitative trait values assessed on daughters of sires heterozygous for the markers; and 2) granddaughter design, a newly devised alternative design in which marker genotype is determined on sons of heterozygous sires and quantitative trait value measured on daughters of the sons. For equal numbers of assays, power increased with the number of daughters per sire (design 1) and sons per grandsire (design 2). For equal power and heritability less than or equal to .2, design 2 required half as many marker assays as design 1, e.g., with heritability of .2, QTL effect of .2 SD units, and type 1 error of .01, power was .70 if 400 daughters of each of 10 sires were assayed for the markers and .95 if markers were assayed on 100 sons of each of 20 sires with 50 granddaughters per son.
Article
Twenty Dutch Holstein-Friesian families, with a total of 715 sires, were evaluated in a granddaughter experiment design for marker-QTL associations. Five traits—milk, fat and protein yield and fat and protein percent—were analyzed. Across-family analysis was undertaken using multimarker regression principles. One and two QTL models were fitted. Critical values for the test statistic were calculated empirically by permuting the data. Individual trait distributions of permuted test statistics differed and, thus distributions, had to be calculated for each trait. Experimentwise critical values, which account for evaluating marker-QTL associations on all 29 autosomal bovine chromosomes and for five traits, were calculated. A QTL for protein percent was identified in one and two QTL models and was significant at the 1 and 2% level, respectively. Extending the multimarker regression approach to an analysis including two QTL was limited by families not being informative at all markers, which resulted in singularity. Below average heterozygosity for the first and last marker lowered information content for the first and last marker bracket. Highly informative markers at the ends of the mapped chromosome would overcome the decrease in information content in the first and last marker bracket and singularity for the two QTL model.
Article
RNA editing by adenosine deamination fuels the generation of RNA and protein diversity in eukaryotes, particularly in higher organisms. This includes the recoding of translated exons, widespread editing of retrotransposon-derived repeat elements and sequence modification of microRNA (miRNA) transcripts. Such changes can bring about specific amino acid substitutions, alternative splicing and changes in gene expression levels. Although the overall prevalence of adenosine-to-inosine (A-to-I) editing and its specific functional impact on many of the affected genes is not yet known, the importance of balancing RNA modification levels across time and space is becoming increasingly evident. In particular, transcriptome instabilities in the form of too much or too little RNA editing activity, or misguided editing, manifest in several human disease phenotypes and can disrupt that balance.
Article
Incorrect paternity assignment in cattle can have a major effect on rates of genetic gain. Of the 576 Israeli Holstein bulls genotyped by the BovineSNP50 BeadChip, there were 204 bulls for which the father was also genotyped. The results of 38 828 valid single nucleotide polymorphisms (SNPs) were used to validate paternity, determine the genotyping error rates and determine criteria enabling deletion of defective SNPs from further analysis. Based on the criterion of >2% conflicts between the genotype of the putative sire and son, paternity was rejected for seven bulls (3.5%). The remaining bulls had fewer conflicts by one or two orders of magnitude. Excluding these seven bulls, all other discrepancies between sire and son genotypes are assumed to be caused by genotyping mistakes. The frequency of discrepancies was >0.07 for nine SNPs, and >0.025 for 81 SNPs. The overall frequency of discrepancies was reduced from 0.00017 to 0.00010 after deletion of these 81 SNPs, and the total expected fraction of genotyping errors was estimated to be 0.05%. Paternity of bulls that are genotyped for genomic selection may be verified or traced against candidate sires at virtually no additional cost.
Article
The NSD1 histone methyltransferase is involved in the outgrowth disorders Sotos and Weaver syndromes and childhood acute myeloid leukemia. NSD1 is a bona fida transcriptional co-repressor for Nizp1 which is a protein including SCAN, KRAB, C2HR and zinc-finger domains. In this study the Nizp1 KRAB-domain was identified to possess an intrinsic transcriptional activation capacity suppressed in cis by the presence of the C2HR domain. Oppositely, the KRAB-domain supported C2HR domain mediated transcriptional repression. The presence of the KRAB-domain resulted in increased NSD1 co-repressor association with the C2HR domain. This study shows a new function of the KRAB-domain, C2HR-domain, and the associated factors to confer Nizp1 mediated transcriptional regulation.
Article
Lambs with congenital day blindness show diminished cone function, which is characteristic of achromatopsia, a congenital disorder described in humans and dogs. To identify gene(s) associated with sheep day blindness, we investigated mutations in the CNGA3, CNGB3, and GNAT2 genes which have been associated with achromatopsia. Sequencing the coding regions of those genes from four affected and eight non-affected lambs showed that all affected lambs were homozygous for a mutation in the CNGA3 gene that changes amino acid R236 to a stop codon. By PCR-RFLP-based testing, homozygosity for the stop codon mutation was detected in another 19 affected lambs. Non-affected individuals (n=386) were non-carriers or heterozygous for the mutation. While a selection program has been launched to eradicate the day blindness mutation from Improved Awassi flocks, a breeding nucleus of day-blind sheep has been established to serve as animal models for studying human achromatopsia.
Article
The lack of conventions for confirming the discovery of quantitative trait nucleotides in livestock was evidenced by the proposals of mutations in two different genes (SPP1 and ABCG2) as the underlying functional mutation for a major quantitative trait locus (QTL) for milk concentration on bovine chromosome 6 (BTA6). Of these conflicting candidates, SPP1 was excluded by follow-up studies and by the data described here. A simple test for concordance of the zygosity state between QTL segregation status and the candidate polymorphism was shown, in this case, to be a critical step towards establishing the proof. If a given sample effectively represents the genetic variation across the QTL region, haplotype-based concordance may further enhance the functionality and resolution power of this test, allowing identification of the causative gene.
Article
Position-specific substitution matrices, known as profiles, derived from multiple sequence alignments are currently used to search sequence databases for distantly related members of protein families. The performance of the database searches is enhanced by using (i) a sequence weighting scheme which assigns higher weights to more distantly related sequences based on branch lengths derived from phylogenetic trees, (ii) exclusion of positions with mainly padding characters at sites of insertions or deletions and (iii) the BLOSUM62 residue comparison matrix. A natural consequence of these modifications is an improvement in the alignment of new sequences to the profiles. However, the accuracy of the alignments can be further increased by employing a similarity residue comparison matrix. These developments are implemented in a program called PROFILEWEIGHT which runs on Unix and Vax computers. The only input required by the program is the multiple sequence alignment. The output from PROFILEWEIGHT is a profile designed to be used by existing searching and alignment programs. Test results from database searches with four different families of proteins show the improved sensitivity of the weighted profiles.