Article

A functionally characterized test set of human induced pluripotent stem cells

The Howard Hughes Medical Institute, Cambridge, Massachusetts, USA.
Nature Biotechnology (Impact Factor: 41.51). 02/2011; 29(3):279-86. DOI: 10.1038/nbt.1783
Source: PubMed

ABSTRACT

Human induced pluripotent stem cells (iPSCs) present exciting opportunities for studying development and for in vitro disease modeling. However, reported variability in the behavior of iPSCs has called their utility into question. We established a test set of 16 iPSC lines from seven individuals of varying age, sex and health status, and extensively characterized the lines with respect to pluripotency and the ability to terminally differentiate. Under standardized procedures in two independent laboratories, 13 of the iPSC lines gave rise to functional motor neurons with a range of efficiencies similar to that of human embryonic stem cells (ESCs). Although three iPSC lines were resistant to neural differentiation, early neuralization rescued their performance. Therefore, all 16 iPSC lines passed a stringent test of differentiation capacity despite variations in karyotype and in the expression of early pluripotency markers and transgenes. This iPSC and ESC test set is a robust resource for those interested in the basic biology of stem cells and their applications.

Full-text

Available from: John T Dimos
nature biotechnology volume 29 number 3 mArCH 2011 279
examine in parallel a sufficiently large set of cell lines. We derived a
set of iPSC lines that includes many sources of variation that might
be encountered in the course of modeling development or disease,
including age, sex, health status and donor identity. We then com-
pared the ability of the lines to undergo directed differentiation as a
stringent test of their pluripotency. We selected motor neurons as a
model system because they are an example of the many differentiated
human cell types that cannot be obtained by other means, and are
specifically affected in amyotrophic lateral sclerosis (ALS)
10
.
After all cell lines were extensively characterized, we found that,
like ESCs, most iPSCs were capable of generating functional motor
neurons under a standard differentiation protocol, whereas a few lines
required more efficient neuralization. The efficiency with which each
individual line generated motor neurons was highly reproducible
between two different laboratories, indicating that the collection can
function robustly as a shared resource. Potential sources of variation
between iPSC lines, such as donor age and transgene expression, did
not correlate with differentiation efficiency. Likewise, no significant
differences were found between three-factor and four-factor lines, or
between lines from healthy and ALS patients. However, we found that
two parameters may be associated with differing behavior of lines.
Donor identity and donor sex were both associated with variation in
Reprogramming of somatic cells to iPSCs presents an opportunity to
produce previously inaccessible cell types for disease-related studies
1
.
IPSCs can be made from patients and their healthy relatives, allowing
the genetic variants that either predisposed them to or protected them
from disease to be studied
2–5
. However, if patient-specific iPSCs are to
become a standard resource, it is vital to understand how reliably they
generate differentiated derivatives. Among the concerns raised about
iPSCs is that reprogramming may be incomplete, resulting in cell lines
with variable gene expression or DNA methylation
6–8
. Indeed, it was
reported that when human iPSC lines were differentiated toward a
motor neuron identity, they uniformly failed to produce this neural
subtype with the efficiency observed using ESCs
9
. Moreover, it has
been suggested that differentiated progeny of iPSCs that harbor repro-
gramming proviruses have a problematic gene expression signature
that can be resolved only by viral excision
5
. Another open question
is whether standard reprogramming, expansion and directed differ-
entiation processes are robust enough to minimize noise caused by
donor-to-donor variation, which could obscure disease-specific phe-
notypes. Finally, it has not been determined whether individual iPSC
lines behave similarly from laboratory to laboratory.
To address these questions and to determine whether cell-line vari-
ability might limit the utility of iPSCs, it is necessary to systematically
1
The Howard Hughes Medical Institute, Cambridge, Massachusetts, USA.
2
Harvard Stem Cell Institute, Department of Stem Cell and Regenerative Biology,
Harvard University, Cambridge, Massachusetts, USA.
3
Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA.
4
Project A.L.S./Jenifer Estess Laboratory for Stem Cell Research, Columbia University, New York, New York, USA.
5
Departments of Pathology, Neurology and
Neuroscience, Columbia University, Center for Motor Neuron Biology and Disease (MNC), and Columbia Stem Cell Initiative (CSCI), New York, New York,
USA.
6
Program in Neurobiology and FM Kirby Neurobiology Center, Children’s Hospital Boston, Boston, Massachusetts, USA.
7
Department of Neurobiology,
Harvard Medical School, Boston, Massachusetts, USA.
8
Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts General Hospital, Boston,
Massachusetts, USA.
9
Departments of Physiology and Cellular Biophysics, and Neuroscience, Columbia University, New York, New York, USA.
10
The New
York Stem Cell Foundation, Inc. (NYSCF), New York, New York, USA.
11
Present address: iPierian, Inc., South San Francisco, California, USA.
12
These authors
contributed equally to this work. Correspondence should be addressed to K.E. (keggan@scrb.harvard.edu) or H.W. (hw350@columbia.edu).
Received 28 October 2010; accepted 19 January 2011; corrected online 11 February 2011; published online 3 February 2011; doi:10.1038/nbt1783
A functionally characterized test set of human
induced pluripotent stem cells
Gabriella L Boulting
1–3,12
, Evangelos Kiskinis
1,2,12
, Gist F Croft
4,5,12
, Mackenzie W Amoroso
4,5,12
,
Derek H Oakley
4,5,12
, Brian J Wainger
6–8
, Damian J Williams
9
, David J Kahler
10
, Mariko Yamaki
1,2
,
Lance Davidow
2
, Christopher T Rodolfa
3
, John T Dimos
3,11
, Shravani Mikkilineni
2,3
, Amy B MacDermott
9
,
Clifford J Woolf
6,7
, Christopher E Henderson
4,5
, Hynek Wichterle
4,5
& Kevin Eggan
1–3
Human induced pluripotent stem cells (iPSCs) present exciting opportunities for studying development and for in vitro
disease modeling. However, reported variability in the behavior of iPSCs has called their utility into question. We established
a test set of 16 iPSC lines from seven individuals of varying age, sex and health status, and extensively characterized
the lines with respect to pluripotency and the ability to terminally differentiate. Under standardized procedures in two
independent laboratories, 13 of the iPSC lines gave rise to functional motor neurons with a range of efficiencies similar
to that of human embryonic stem cells (ESCs). Although three iPSC lines were resistant to neural differentiation, early
neuralization rescued their performance. Therefore, all 16 iPSC lines passed a stringent test of differentiation capacity
despite variations in karyotype and in the expression of early pluripotency markers and transgenes. This iPSC and ESC test
set is a robust resource for those interested in the basic biology of stem cells and their applications.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 1
280 volume 29
number 3
mArCH 2011 nature biotechnology
compact colonies with a morphology (Fig. 1a and Supplementary
Fig. 1a) and cell-cycle profile similar to those of ESC controls
(Fig. 1b and Supplementary Fig. 1b). We next determined that the
test set could differentiate into all three embryonic germ layers as
detected by expression of neuron-specific tubulin (TUJ1), smooth
muscle actin (αSMA) and endodermal α-fetoprotein (AFP) after
16 d of differentiation in vitro (Fig. 1c and Supplementary Fig. 1c).
Lastly, we tested the ability of several lines to generate teratomas in
immune-compromised mice. After injection, each line (14/14 tested)
formed teratomas containing complex tissue structures characteris-
tic of all three embryonic germ layers (Fig. 1d and Supplementary
Fig. 1d). Based on histological criteria these structures included
neuronal fibers, hair follicles, melanocytes, keratin pearls, muscle
cells, cartilage, glands and goblet cells. Thus our test set resource
contains lines that have been extensively characterized and meet the
most stringent criteria for pluripotency (Fig. 1e).
Most iPSC lines generate electrically active motor neurons
using standard procedures
To rigorously and quantitatively test the potential of iPSCs to undergo
terminal differentiation, we determined the efficiency with which
each line could generate spinal motor neurons (Fig. 2). In response
to standard procedures involving retinoic acid and induction of the
sonic hedgehog pathway
12,13
(Fig. 2a), the majority (19/22) of the
iPSC and ESC lines generated cells with a neuronal morphology
that expressed TUJ1 and the motor neuron marker ISLET 1/2 (ISL)
(Fig. 2b). To confirm the reliability of the lines as a resource for the
community, we transferred the entire test set from the laboratory
in which they were derived (Eggan laboratory) to a geographically
distinct laboratory (Project A.L.S. (PALS)/Jenifer Estess Laboratory
for Stem Cell Research, Columbia University), which then repeated
differentiation performance and warrant further study. The test set
reported here has already served as the basis for an analysis of the
epigenetic influences on stem cell differentiation potential
11
. The test
set cell lines are available for distribution and should prove to be a
valuable resource for many avenues of stem cell research.
RESULTS
A test set of iPSC lines
We assembled a test set of 16 human iPSC lines, including 14 new
lines and 2 previously reported lines
2
(Table 1). This set comprised
lines from seven individuals of both sexes whose ages ranged from
29 to 82 years. All iPSCs were derived by retroviral transduction of
skin fibroblasts. Most lines were produced using only three factors
(OCT4, KLF4, SOX2) but two lines derived using the additional fac-
tor c-MYC
2
were included for comparison.. To allow evaluation of the
effects of individual genetic background, we included independent
lines derived from the same subjects (two lines from each of two
donors, three lines from each of two donors and four lines from
one donor). Finally, we included lines from both healthy controls
(n = 10) and patients with ALS (n = 6), all of which carried mutations
in the superoxide dismutase 1 gene (SOD1). To determine whether
reprogramming systematically influences stem cell properties, we
compared the performance of these iPSC lines to that of six ESC
lines (Table 1).
To verify that the newly derived iPSC lines were indeed pluripo-
tent stem cells, we assessed expression of the pluripotency markers
alkaline phosphatase, NANOG, OCT4, SSEA3, SSEA4, TRA-1-60
and TRA-1-81. In addition to exhibiting cell-surface staining pat-
terns for both SSEA and TRA-1 proteins, all colonies showed distinct
nuclear staining when assayed for NANOG and OCT4 immunoreac-
tivity (Fig. 1a and Supplementary Fig. 1a). All iPSC lines generated
Table 1 Human stem cell lines used for comparative study
Cell type Donor fibroblast Cell line ALS diagnosis Reprogramming factors Sex Donor age Reference
iPS 11 11a Healthy control OCT4/SOX2/KLF4 M 36 This report
iPS 11 11b Healthy control OCT4/SOX2/KLF4 M 36 This report
iPS 11 11c Healthy control OCT4/SOX2/KLF4 M 36 This report
iPS 15 15b Healthy control OCT4/SOX2/KLF4 F 48 This report
iPS 17 17a Healthy control OCT4/SOX2/KLF4 F 71 This report
iPS 17 17b Healthy control OCT4/SOX2/KLF4 F 71 This report
iPS 18 18a Healthy control OCT4/SOX2/KLF4 F 48 This report
iPS 18 18b Healthy control OCT4/SOX2/KLF4 F 48 This report
iPS 18 18c Healthy control OCT4/SOX2/KLF4 F 48 This report
iPS 20 20b Healthy control OCT4/SOX2/KLF4 M 55 This report
iPS 27 27b SOD1G85S OCT4/SOX2/KLF4 F 29 This report
iPS 27 27e SOD1G85S OCT4/SOX2/KLF4 F 29 This report
iPS 29 29A SOD1L144F OCT4/SOX2/KLF4/c-MYC F 82 2
iPS 29 29B SOD1L144F OCT4/SOX2/KLF4/c-MYC F 82 2
iPS 29 29d SOD1L144F OCT4/SOX2/KLF4 F 82 This report
iPS 29 29e SOD1L144F OCT4/SOX2/KLF4 F 82 This report
ES HuES-3 M 23
ES HuES-6 F 23
ES HuES-9 F 23
ES HuES-13 M 23
ES HuES-3 hb9:GFP M 12
ES RUES1 M 24
Sixteen human iPSC lines were used for comparison with each other and with six ESC lines. IPSC lines include 14 newly generated three-factor lines from two ALS patients and
five controls, and two previously published four-factor lines from one ALS patient. This cohort of human stem cell lines allows comparisons to be made between ESCs and iPSCs,
between three-factor and four-factor iPSC lines, between male and female lines, between lines derived from the same donor and those derived from another donor, and between
cells derived from ALS patients and control donors.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 2
nature biotechnology volume 29 number 3 mArCH 2011 281
(Fig. 2f and Supplementary Table 1). Moreover, four-factor lines
did not underperform relative to three-factor lines (Supplementary
Tabl e 1). Therefore, most (13/16) iPSC lines in the resource could
generate spinal motor neurons with a reproducible efficiency that is
equivalent to that of gold standard ESC lines.
To demonstrate that the motor neurons we produced were func-
tional, we compared the electrophysiological properties of motor
neurons from four iPSC lines with motor neurons from two ESC
lines (Fig. 3). We first monitored intracellular Ca
2+
dynamics using
the Ca
2+
-sensitive dyes Fura Red AM (Fig. 3a–b) and Fluo-4 AM
(Fig. 3c). This was done both in the absence of exogenous stimulation
(Fig. 3c,h,j) to monitor spontaneous activity, and after application
of either kainate to activate ionotropic glutamate receptors, or KCl
to depolarize the membrane and open voltage-gated Ca
2+
channels
(Fig. 3d–g,i,k). Spontaneous calcium transients were visible in the cell
the directed differentiation experiments. Consistent with the conclu-
sion that the properties of each cell line are reproducible, the same
lines were found to generate ISL
+
neurons (Fig. 2c). Indeed, the dif-
ferentiation efficiency for each line (ranging from 4–15% ISL
+
/total
nuclei) showed no difference between the two laboratories (Fig. 2c;
ANOVA f = 1.132, P = 0.301, Supplementary Table 1). Thus, the test
set will also serve as a robust resource for research in other centers.
To confirm that the ISL
+
neurons were motor neurons, we quantified
the expression of other markers indicative of this neural subtype. We
found that the iPSC lines producing the highest percentage of ISL
+
neu-
rons also produced the highest percentage of cells expressing the motor
neuron–specific transcription factor HB9 (ref. 14; Fig. 2d). On average,
iPSC lines generated HB9
+
neurons as efficiently as did the established
ESC line HuES-13 (Fig. 2h). In addition, in a tested subset of lines, ISL
+
neurons were immunopositive for ChAT, the enzyme required for ace-
tylcholine synthesis (Fig. 2e). These differenti-
ated cultures, which also contained a variety of
motor neuron progenitors, expressed the neu-
ral marker NCAM (Supplementary Fig. 2a),
and expressed substantial levels of mRNA
encoding the markers HB9, ChAT and CHT1
(Supplementary Fig. 2b). Finally, unlike
PAX6
+
progenitors in these cultures, ISL
+
neurons were never observed to be actively
cycling as measured by Ki67 immunostain-
ing (Supplementary Fig. 2c). Although there
were quantitative differences in motor neu-
ron generation among the lines (Fig. 2i and
Supplementary Table 2), they did not reflect
overall differences between iPSC and ESC
lines (Fig. 2g and Supplementary Table 1) or
between healthy control and ALS iPSC lines
iPSC 11a
c
e
HuES-13
α-SMA /
DNA
TUJ1/DNA AFP/DNA
EBs-phase
iPSC 11a
Phase
a
b
HuES-13 FB no.11
TR
A-1-60
/ DNA NANOG/ DNA
d
iPSC 11b
Endoderm Mesoderm Ectoderm
iPSC 27e
11a11b 11c 15b 17a 17b 18a 18b 18c20b 27b27e 29A29B 29d 29e
++++++++++++++++
++++++++++++++++
++++++++++++++++
++++++++++++++++
++++++++++++++++
++++++++++++++++
++++++++++++++++
++ +++++++++++
++++++++++++++
++++++++++++++
++++++ ++++ ++
+++++++++
+
++++++
++++++++++++++++
++++ ++++++
+++
++ ++++++++ +
++++
++
iPSC
n = 13
HuES Fibroblasts
***
0
20
40
60
80
100
−−
−−−−
−−−−−−
−−
−−
−−
−−
++
−−
−−
−−−−
−−−−
−−
iPS- alkaline phosphatase
iPS- NANOG
iPS- OCT4
iPS- SSEA3
iPS- SSEA4
iPS- TRA-1-60
iPS- TRA-1-81
iPS- cell cycle analysis
iPS- in vitro three-germ layer assay
iPS- teratoma formation
iPS- FC analysis
iPS- transgene expression
iPS- standard neuronal differentiation
iPS- differentiation in both labs
iPS- neuralizing differentiation
Neurons- transgene expression
Neurons- calcium imaging
Neurons- patch clamp assays
n = 3 n = 7
Cells in S/G2/M (%)
S/G2/M
55.8
55.2
5.3
Figure 1 Characterization of pluripotency in the
test set of iPSC lines. (a) iPSC colonies were
morphologically identical to ESC colonies and
expressed the pluripotency markers NANOG and
TRA-1-60, unlike the patient fibroblasts from
which they were derived. FB, fibroblasts. Scale
bars, 200 μm. (b) iPSC lines showed cell cycle
profiles similar to those of ESCs and different
from their parental fibroblasts. The percentage
of cells at different stages of the cell cycle
was determined by propidium iodide staining
and flow cytometry. The percentage of cells in
S, G2 and M phase was determined for each
cell line and then averaged for each category.
***P < 0.001, mean ± s.d. (c,d) Like ESCs, iPSC
lines generated cell types of all three embryonic
germ layers (endoderm, AFP; mesoderm, α-SMA;
ectoderm, TUJ1) in vitro, as embryoid bodies (c,
EBs; scale bars, 100 μm), and when injected
into mouse kidney capsules and allowed to
form teratomas in vivo (d; scale bars, 50 μm).
Representative images of H&E-stained sections
are shown for lines 11b and 27e. Glands and
goblet cells (endoderm), cartilage and muscle
(mesoderm), pigmented neural epithelium and
neural rosettes (ectoderm) are shown in the top
and bottom panels, respectively, for both lines.
(e) Summary chart depicting assays by which
iPSC lines in the test set were characterized.
Pluripotency assays for 29A and B were
previously published
2
.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 3
282 volume 29
number 3
mArCH 2011 nature biotechnology
stimuli in current-clamp mode elicited single action potentials in
both ESC-derived (n
=
2) and iPSC-derived neurons (n
=
2), as well
as repetitive firing in a neuron derived from iPSC line 18a (Fig. 3o).
Therefore, we conclude that both ESC- and iPSC-derived neurons
generated from the cell lines in the resource are similarly functional
at a physiological level.
Contribution of other variables to differentiation
Although all cell lines were capable of generating motor neurons, we
systematically examined some parameters that have been implicated
in differentiation efficiency and so would be of interest to potential
users of this resource. The majority of iPSC lines (9 out of 15 tested;
Supplementary Fig.
4) exhibited genomic stability at both early
(p13) and late (p42) passages. The other six lines (29d, 27b, 29e, 11a,
11b, 15b) acquired disparate abnormalities of varying severity at later
passages. However, lines that became karyotypically abnormal did
not produce motor neurons with a significantly different efficiency
compared with normal lines (P
=
0.932; Supplementary Table
1).
bodies and processes of multiple cells from each line, even without
treatment (Fig. 3c,h,j; Supplementary Fig.
3a and Supplementary
Video
1). Upon exposure to kainate, increases in Ca
2+
levels were
observed in 78% of cells with neuronal morphology (n
=
132
cells).
Many kainate-responsive cells also exhibited Ca
2+
transients upon
exposure to KCl (Fig. 3i,k). Immunostaining confirmed that many
of the cells that responded to kainate and KCl in these mixed cultures
were ISL
+
motor neurons (Fig. 3b,i and Supplementary Fig.
3b).
To further demonstrate that iPSC-derived neurons express the
repertoire of voltage-gated ion channels characteristic of active
neurons, we made electrophysiological recordings using whole-cell
patch clamping. All cells with a neuronal morphology, derived from
HuES-3 hb9:GFP (n
=
9 cells), iPSC line
18a (n
=
10 cells) and iPSC
line
27b (n
=
10 cells), showed fast voltage-activated inward currents
followed by slow outward currents, consistent with voltage-activated
sodium and potassium currents, respectively (Fig. 3l,m). Inward cur-
rents (n
=
5/5) were blocked by tetrodotoxin (TTX), an inhibitor of
voltage-gated sodium channels (Fig. 3n). In addition, depolarizing
e
d
c
ISL ( %)
iPSC 18c
HuES-6
ISL
ISL / TUJ1 / DNA
b
iPSC 18cHuES-13
HB9
HB9
/ TUJ1 / DNA
Cell lines
a
ESC/iPSC
Embryoid bodies
Adherent cells
NIM medium
Day 4
Day 10
RA + HAg
Neurobasal medium
Day 25
BDNF + GDNF + CNTF
ESC medium
Day 0 Day 29
Fixed and
stained
Day 32
f
AL
S
iP
SC
ISL ( %)
ISL ( %)
g
16
12
8
4
0
i
Cell lines
HB9 (%)
6
5
4
3
2
1
0
n = 3 n = 3n = 2 n = 2 n = 2 n = 2 n = 2n = 1 n = 1 n = 1 n = 1
11a15b 17a 17b18a 18b18c 29A29B 29d HuES-13
h
iPSC 29AHuES-13
ISL / ChAT / DNA
0
5
10
15
20
25
HuE
S
iPSC
0
4
8
12
**
ISL ( %)
Cell lines
0
5
10
15
20
25
Eggan laboratory
PALS laboratory
11a Hu-1329e29d29b29a27e27b18c18b18a Hu-3
n = 9 n = 5n = 13n = 4
11a Hu3Hu13Hu6Hu929e29d29b29a27e27b20b18c18b18a17b17a15b11c11b Hu3-
hb9
GFP
Embryoid bodies
dissociated into
single cells
Figure 2 iPSCs show similar capacity for
directed motor neuron differentiation compared
to ESCs. (a) Protocol for directed differentiation
of human stem cell lines into motor neurons.
Cells were differentiated as embryoid bodies
from day 0–29 in media formulations
containing morphogens, including retinoic acid
(RA), a small molecule agonist of the sonic
hedgehog pathway (HAg) and neurotrophic
factors BDNF, GDNF and CNTF. Embryoid
bodies were dissociated and single cells plated
for adherent culture on day 29. On day 32
cultures were analyzed. NIM, neural induction
medium. (b) Representative immunostaining
results for iPSC (18c) and ESC (HuES-6)
cultures show many ISL
+
TUJ1
+
motor neurons
(scale bars, 50 μm). (c) The percentage of
all nuclei that were ISL
+
was quantified from
differentiations performed independently in
the Eggan and PALS laboratories. Data sets
from lines differentiated in both laboratories
are compared here, are highly similar and
have reproducible, characteristic percent ISL
+
efficiencies. 29e and 27e did not differentiate
efficiently in either laboratory. Hu-13, HuES-
13; Hu-3, HuES-3. (d) Efficiency of motor
neuron differentiation was also measured by
an alternative marker of motor neuron identity,
HB9 (scale bars, 50 μm). (e) Many ISL
+
motor neurons were also ChAT
+
, indicating
proper maturation toward a cholinergic
transmitter phenotype (scale bar, 50 μm).
(f,g) iPSC lines from control and ALS patients
differentiated into ISL
+
motor neurons with
similar efficiencies (f), as did ESCs and
iPSCs (g). (h) The percentages of HB9
+
nuclei
were compared for a subset of iPSC lines
and HuES-13. Although comparisons again
suggest donor- or line-specific differences,
iPSC lines were overall equally capable of
generating HB9
+
motor neurons as HuES-13
(mean ± s.d.). (i) Percent ISL
+
data from both
laboratories were pooled for each iPSC and ESC
line, and comparisons between lines showed
generally similar performance, with significant
differences between iPSC line 18c and iPSC
lines 11a and 11c (P < 0.05). Hu, HuES.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 4
nature biotechnology volume 29 number 3 mArCH 2011 283
by the percentage of ISL
+
neurons (R
2
= 0.1687). In addition, we car-
ried out immunofluorescence staining for OCT4 and the motor neu-
ron marker ISL (Fig. 4b and Supplementary Fig. 5e). Remarkably,
a line such as 15b, which showed persistent transgene expression,
generated motor neurons with high abundance, even though many
of the motor neurons expressed nuclear OCT4. Therefore, although
examples of lines that display karyotypic variation and persistent
transgene expression are available in the test set, these phenomena
had no detectable effect on rates of motor neuron differentiation.
Finally, we looked at the contribution of age, sex and donor geno-
type to the outcome of differentiation in our test set. There was no
correlation between donor age and the percentage of ISL
+
neurons
generated (R
2
= 0.0084). However, there was a significant difference
in differentiation efficiency between male and female lines (ANOVA
P = 0.048, Supplementary Table 3). These sex-specific differences
could result from variable processes such as X-chromosome inactiva-
tion. Lastly, we compared the ability of independent lines from several
of the donors to differentiate into motor neurons. Southern blot analy-
sis (Supplementary Fig. 6ac) confirmed that lines from donors 11,
18 and 29 arose from distinct reprogramming events. Subsequently,
As it is not known how these chromosomal changes may affect the
behavior of any given cell type, these lines should be used with cau-
tion in studies making phenotypic comparisons.
We and others have reported that reprogramming transgenes can
continue to be expressed in patient-specific iPSC lines, but whether
they interfere with differentiation has not been fully studied
2,5
. We
therefore used quantitative real time (qRT)-PCR to quantify relative
levels of transcription of the reprogramming transgenes from both
their endogenous loci and from the integrated retrovirus (Fig. 4a).
In most cases, levels of viral transcription were either undetectable
or very low compared with levels of transcripts from the endog-
enous loci; indeed, viral SOX2 was never detected (Supplementary
Fig.
5a). However, a subset of iPSC lines (11b, 11c, 15b, 18b, 18c,
27b, 27e and 29e) continued to express varying levels of viral KLF4
both in the undifferentiated state and after differentiation to motor
neurons (Fig. 4a and Supplementary Fig.
5bd). Moreover, viral
OCT4 transcripts were present in three of the iPSC lines (15b, 18c
and 27b) both before and after differentiation. Notably, there was no
correlation between the total level of aggregated transgene expression
in iPSCs and the efficiency of motor neuron differentiation as judged
ln
om
HuES-3
hb9:GFP
iPSC 18a iPSC 27b iPSC 18a
27b + TTX27b − TTXHuES-3
hb9:GFP
20 ms
2 nA
2 ms
200 ms
1 nA
40 mV
5 nA
20 ms
de
iPSC 11a
Fluo-4
Fluo-4 + wash
Fluo-4 + KA
Fluo-4 + KCl
0
0.5
1.0
1.5
2.0
2.5
0 18060 120
0
1.00
0.75
0.50
0.25
KA KCl
RUES1
11a
18a
18c
27b
NR
0
1.00
0 180
KA KCl
0
0.5
1.0
1.5
2.0
2.5
60 120
0.75
0.50
0.25
Signal intensity
(515 nm/650 nm)
hi jk
abc
fg
Fura Red
iPSC 11a
ISL/Fura Red Fluo-4
Δ
Signal intensity
(515 nm/650 nm)
Signal intensity
(515 nm/650 nm)
Signal intensity
(515 nm/650 nm)
Time (s) Time (s)Time (min) Time (min)
0302010 40 0302010 40
Figure 3 ESC- and iPSC-derived neurons
are physiologically active. (a) Images of
iPSC 11a–derived neurons filled with Fura
Red AM and Fluo-4 AM dyes. The Fura Red
channel is shown. The field illustrated is that
imaged in b–g. Activity of labeled cells is
represented in h and
i. Scale bar, 100
μm.
(b) ISL immunostaining of 11a field in a–g
showing ISL
+
neurons (star) and ISL
neurons
(arrow). (c) Spontaneous electrical activity in
cultured iPSC-derived neurons visualized by a
‘subtracted image’ that shows the difference in
pixel intensities between two images acquired
1.7 s apart in the Fluo-4 channel. Higher gray
values represent increased pixel intensity.
(dg) Identically exposed pseudocolored
averages of ten Fluo-4 AM images taken during
the control period before addition of kainic acid
(KA) (d), after treatment with 100 μM KA (e),
after washing following KA administration
(f)
and after treatment with 50
μM KCl (g).
Warmer colors represent increased fluorescence
intensity. (h) Plot of Fluo-4/Fura Red intensity
ratio in the somata of the two cells indicated
by the star and arrow in ac; only starred cell
shows spontaneous activity. (i) Fluo-4/Fura Red
intensity ratio of cells in ac during sequential
administration of KA and KCl indicated by bars
above graph. (j) Examples of Fluo-4/Fura Red
ratios from cell bodies of single spontaneously
active cells in cultures of ESC RUES1–derived
neurons, and iPSC 11a–, 18a–, 18c– and
27b–derived neurons as well as one example
of a nonresponsive (NR), nonactive cell in
an RUES1 culture. (k) Response of cells in j
to KA and KCl. (lm) Sample voltage-clamp
traces from ESC (l) and iPSC 18a–derived (m)
neurons. (n) Blowup of an iPSC 27b–derived
neuron recording reveals typical sodium
currents (left), which are blocked by 500
nM TTX (right). (o) Current-clamp recordings
of single action potentials in ESC and iPSC
27b–derived neurons as well as multiple action
potentials in an iPSC 18a–derived neuron.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 5
284 volume 29
number 3
mArCH 2011 nature biotechnology
phology but less than 10% of differentiated cells were TUJ1
+
neurons
(Fig. 5b). This was significantly lower compared with 18a (Holm-Sidak,
T = 5.037, P = 0.002; Supplementary Table 6), and was in contrast to the
results of lines that differentiated appropriately, which produced in excess of
25% TUJ1
+
cells (Supplementary Fig. 7b). An indication that early block-
ade of differentiation might occur in some lines was obtained when we used
expression of the antigens SSEA3 and TRA-1-60 to quantify the relative
proportion of pluripotent cells within each iPSC line by flow cytometry
(Supplementary Fig. 8). One of the recalcitrant iPSC lines (27e) showed
higher median fluorescence intensity of TRA-1-60 staining than all others
(Supplementary Fig. 8d,e and Supplementary Table 7), suggesting that
it might be less prone to spontaneous differentiation.
As the three recalcitrant lines were nevertheless able to initially
form embryoid bodies, we tested whether they could be coaxed into
the motor neuron differentiation pathway by pushing them toward a
more neural fate at the beginning of the differentiation process. We
combined our embryoid body protocol with dual SMAD inhibition,
similar to a previous report
15
, for the first 9 d using SB431542, an inhib-
itor of transforming growth factor-β1 activin receptor-like kinase, and
LDN193189, a structural analog of the bone morphogenetic protein
inhibitor dorsomorphin
15,16
. Comparing the three underperforming
iPSC lines (11b, 27e, 29e) to two ESC lines, we found that the previously
defective lines were all neuralized in this optimized protocol and gave
rise to the same high abundance of TUJ1
+
cells as did the ESC lines
(>75%; Fig. 5c,d). Notably, the three iPSC
lines that previously could not generate neu-
rons now robustly produced ISL
+
(Fig. 5c,e)
and HB9
+
(Fig. 5f) motor neurons by day 21 at
levels indistinguishable from those of both the
control ESCs (Fig. 5d–f) and the other 13 iPSC
lines (Fig. 2h,i). Thus, although three lines
in our human stem cell resource underper-
formed using a basal differentiation protocol,
they could be rescued through a neuralizing
protocol to efficiently generate spinal motor
neurons.
DISCUSSION
To evaluate iPSCs as a research tool, we gen-
erated a large panel of cell lines from multiple
donors and examined aspects of the cell lines
pluripotency and ability to generate terminally
differentiated motor neurons. The results of
our comparisons confirm the remarkable
value of iPSC lines for in vitro studies and
demonstrate that they can perform as well
as standard ESC lines. This observation held
true for experiments carried out using stan-
dardized procedures in two geographically
distinct laboratories. The analyses presented
here serve as a quality control for this stem
cell resource, while also providing sufficient
data on specific aspects of variability to allow
investigators to select lines of particular rel-
evance to their research.
Our study is not the first to compare
human iPSC and ESC lines, but it is the
most extensive comparison of their ability to
generate a specific terminally differentiated
cell thus far. Most studies have used panels
of four or fewer iPSC lines
17–22
, limiting the
inspection of the differentiation data (Fig. 2c,h,i) showed that all three
iPSC lines from donor 18 produced many motor neurons, whereas
the lines from donor 11 performed less well. The difference in dif-
ferentiation efficiency between line 18c, the best of the three from
that donor, and the two lines from donor 11 that generated motor
neurons was indeed significant (P < 0.05; Fig. 2i; Supplementary
Tabl e 2), and when comparisons between averaged differentiation
efficiencies of multiple lines from each donor were made, a significant
difference was found (ANOVA P = 0.006; Supplementary Table 4 and
Supplementary Fig. 6d). These results further demonstrate that the
cell lines included in the test set may provide an opportunity for other
researchers to investigate the effects that sex and other donor-specific
phenomenon have in directed differentiation.
Suboptimal lines are rescued by active neuralization
Although the majority of our cell lines reproducibly generated motor neu-
rons, there were three lines (11b, 27e and 29e) that uniformly failed to do
so in both laboratories. All three formed embryoid bodies (Fig. 5a, n = 3–7
independent experiments per line), but the embryoid bodies from two
lines—27e and 29e—became cystic and disaggregated (Fig. 5a). This defect
was reflected in a significant decrease in total yield of differentiated cells
(P < 0.05; Supplementary Fig. 7a and Supplementary Table 5) and by
the failure of these two lines to generate TUJ1
+
neurons (Supplementary
Fig. 7b). A third line—11b—formed embryoid bodies with normal mor-
a
iPSC lines
iPSC lines
Relative mRNA levels
Relative mRNA levels
Relative mRNA levels
Relative mRNA levels
ISL/OCT4/DNA
HuES-3iPSC 17a iPSC 15b
b
vKLF4
eKLF4
vKLF4
eKLF4
vOCT4
eOCT4
vOCT4
eOCT4
3.0
2.5
2.0
1.5
1.0
0.5
0.0
2.5
2.0
1.5
1.0
0.5
0.0
8
6
4
2
0
16.0
14.0
12.0
10.0
8.0
6.0
4.0
2.0
0.0
11a29d27e20b18c18b18a17b11a17a15b11c11b29e HuES FB
11aHuAvg29d27b20b18c18b18a17b17a15b11b HuES FB
avg. avg.
avg. avg.
11a29d27e20b18c18b18a17b11a17a15b11c11b29e HuES FB
11aHuAvg29d27b20b18c18b18a17b17a15b11bHuESFB
avg. avg.
avg. avg.
d32 neurons
d32 neurons
Figure 4 Persistent transgene expression does not inhibit differentiation. (a) qRT-PCR was used
to measure relative levels of transcript from endogenous genes ‘e’ and viral transgenes ‘v’ of the
reprogramming factors OCT4 and KLF4 in undifferentiated iPSCs and ESCs, and in day 32 neuron
cultures. Transgene expression or silencing in the undifferentiated cells is maintained after differentiation.
Relative levels in undifferentiated HuES-3 were set as 1. FB, fibroblasts. (b) Day 32 motor neuron
cultures were co-stained for ISL and OCT4. HuES-3– and iPSC 17a–derived cultures, which do not
express viral OCT4, did not stain for OCT4. However, iPSC 15b–derived cultures, which do express viral
OCT4, contained many OCT4
+
ISL
+
motor neurons and OCT4
+
ISL
cells. Arrow, OCT4
+
ISL
+
; arrowhead,
OCT4
+
ISL
; chevron, OCT4
ISL
+
. Scale bars, 50 μm.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 6
nature biotechnology volume 29 number 3 mArCH 2011 285
that, once ALS-related phenotypic differences are discovered, they
will prove sufficiently reproducible to serve as a foundation for
research on ALS.
METHODS
Methods and any associated references are available in the online ver-
sion of the paper at http://www.nature.com/naturebiotechnology/.
Note: Supplementary information is available on the Nature Biotechnology website.
ACKNOWLEDGMENTS
We thank H. Mitsumoto, J. Montes, P. Kaufmann and J. Andrews for collecting
skin biopsies; K. Koszka, A. Sproul, A. Hon and A. Garcia-Diaz for technical
assistance; M. Park, A. Meissner and C. Bock for manuscript assistance, as well
as S. Brenner-Morton and T. Jessell for providing Islet antibodies. This work was
possibilities for understanding variability
between cell lines or for drawing general
conclusions about functional similarities
between iPSCs and ESCs. Similar to a pre-
vious report that examined four iPSC lines
and one ESC line for generation of terminally
differentiated motor neurons
9
, we found that
the differentiation efficiencies of individual
iPSC lines vary. However, the earlier study
showed that the differentiation capacity of
iPSCs was inferior to that of ESCs, whereas
we found that iPSC lines could be made to
differentiate on average as well as ESC lines.
Whether the difference in the conclusions
of the two studies is due to differences in
the protocols for reprogramming and motor
neuron differentiation, or whether it reflects
differences in the numbers of samples ana-
lyzed, remains to be determined.
Although all cell lines in our test set were
capable of generating motor neurons, appli-
cation of the standard protocol for motor
neuron production did reveal significant
quantitative differences in the propensity of
the lines for terminal differentiation. These
differences were highly reproducible, sug-
gesting that they represent intrinsic charac-
teristics of the lines. Our initial hypothesis
was that the poorly performing lines would
be identified by anomalies in standard tests
for stem cell quality. However, all cell lines
tested expressed pluripotency markers and
could form the three germ layers in vitro and
in teratomas. Moreover, although variations
in karyotype and transgene expression were
observed, they were not accurate predictors
of differentiation capacity. Fortunately, a
solution for identifying such predictors has
now been proposed by a laboratory that used
our test set to search for epigenetic and tran-
scriptional differences that correlate with
differentiation potential
11
. Using the lines
we describe here, they developed a scorecard
for stem cell quality that predicted our motor
neuron differentiation results (Fig. 2i) with
remarkable precision.
We anticipate that one of the major uses
of the cell lines provided through this resource will be to model
ALS. Notably, our data demonstrate that several conditions that
are necessary for reliable disease modeling are met. First, because
ALS is not a developmental disease, our finding that iPSCs carrying
an ALS-triggering mutation differentiated similarly to those from
healthy controls is as expected. Second, although lines from different
healthy donors, taken together, showed donor-related variation in
differentiation efficiency, the pairwise comparisons did not reach sig-
nificance. This increases the chances that phenotypic differences we
may eventually observe between ALS cases and controls are related
to disease. Nevertheless, as we found real line-to-line differences, it
will be essential to confirm that any phenotypes are ALS-related by
silencing the mutant SOD1. Lastly, the strong concordance between
the results from two different laboratories reported here suggests
cd
e
f
Day 18 embryoid bodies
HuES-3 hb9:GFP iPSC 11biPSC 29e
Day 22 TUJ1/ISL
11bHuES-3 HuES-3
hb9:GFP
27e 29e
11bHuES-3 HuES-3
hb9:GFP
27e29e
11bHuES-3 HuES-3
hb9:GFP
27e29e
0
4
8
0
10
20
0
40
80
120
a
Phase
DNA
Day 32
Day 4
Day 29
Day 32
b
iPSC 29d HuES-3
iPSC 27e
iPSC 18a HuES-13
iPSC 11b
TUJ1
DNA
Figure 5 Suboptimal iPSC lines can be rescued using SMAD inhibition. (a) During standard
differentiation, iPSC lines 27e and 29e showed abnormal embryoid body morphology and survival
compared to lines that behaved normally (HuES-3 and 29d shown); phase scale bar, 500 μm; DNA
scale bar, 129 μm. (b) Although embryoid bodies from iPSC line 11b had typical morphology, day
32 cultures showed decreased neuronal TUJ1 staining compared to all other normal lines (HuES-13
and iPSC 18a shown), scale bar, 129 μm. (c) Representative phase and immunostaining images for
previously defective iPSC lines 29e, 11b, and control ESC lines HuES-3 and HuES-3-hb9:GFP. Phase
image scale bars are 500 μm, immunostaining image scale bars are 100 μm. (d–f) Quantification of
immunostaining in differentiated cultures derived from the three previously problematic iPSC lines
(11b, 27e, 29e) and ESC controls; percentage of TUJ1+ cells (d); percentage of ISL+ cells (e); and
percentage of HB9+ cells (f). Mean ± s.e.m.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 7
286 volume 29
number 3
mArCH 2011 nature biotechnology
8. Stadtfeld, M. et al. Aberrant silencing of imprinted genes on chromosome 12qF1 in
mouse induced pluripotent stem cells. Nature 465, 175–181 (2010).
9. Hu, B.Y. et al. Neural differentiation of human induced pluripotent stem cells follows
developmental principles but with variable potency. Proc. Natl. Acad. Sci. USA 107,
4335–4340 (2010).
10. Kanning, K.C., Kaplan, A. & Henderson, C.E. Motor neuron diversity in development
and disease. Annu. Rev. Neurosci. 33, 409–440 (2010).
11. Bock, C. et al. Reference maps of human ES and iPS cell variation enable high-through-
put characterization of pluripotent cell lines. Cell published online, doi:10.1016/j.
cell.2010.12.032 (3 February 2011).
12. Di Giorgio, F.P., Boulting, G.L., Bobrowicz, S. & Eggan, K.C. Human embryonic stem
cell-derived motor neurons are sensitive to the toxic effect of glial cells carrying an
ALS-causing mutation. Cell Stem Cell 3, 637–648 (2008).
13. Wichterle, H., Lieberam, I., Porter, J.A. & Jessell, T.M. Directed differentiation of embry-
onic stem cells into motor neurons. Cell 110, 385–397 (2002).
14. Arber, S. et al. Requirement for the homeobox gene Hb9 in the consolidation of motor
neuron identity. Neuron 23, 659–674 (1999).
15. Chambers, S.M. et al. Highly efficient neural conversion of human ES and iPS cells by
dual inhibition of SMAD signaling. Nat. Biotechnol. 27, 275–280 (2009).
16. Zhou, J. et al. High-efficiency induction of neural conversion in human ESCs and human
induced pluripotent stem cells with a single chemical inhibitor of transforming growth
factor beta superfamily receptors. Stem Cells 28, 1741–1750 (2010).
17. Taura, D. et al. Adipogenic differentiation of human induced pluripotent stem cells:
comparison with that of human embryonic stem cells. FEBS Lett. 583, 1029–1033
(2009).
18. Tokumoto, Y., Ogawa, S., Nagamune, T. & Miyake, J. Comparison of efficiency of terminal
differentiation of oligodendrocytes from induced pluripotent stem cells versus embryonic
stem cells in vitro. J. Biosci. Bioeng. 109, 622–628 (2010).
19. Xi, J. et al. Comparison of contractile behavior of native murine ventricular tissue and
cardiomyocytes derived from embryonic or induced pluripotent stem cells. FASEB J.
24, 2739–2751 (2010).
20. Armstrong, L. et al. Human induced pluripotent stem cell lines show stress defense
mechanisms and mitochondrial regulation similar to those of human embryonic stem
cells. Stem Cells 28, 661–673 (2010).
21. Ghosh, Z. et al. Persistent donor cell gene expression among human induced pluripotent
stem cells contributes to differences with human embryonic stem cells. PLoS ONE 5,
e8975 (2010).
22. Grigoriadis, A.E. et al. Directed differentiation of hematopoietic precursors and func-
tional osteoclasts from human ES and iPS cells. Blood 115, 2769–2776 (2010).
23. Cowan, C.A. et al. Derivation of embryonic stem-cell lines from human blastocysts. N.
Engl. J. Med. 350, 1353–1356 (2004).
24. James, D., Noggle, S.A., Swigut, T. & Brivanlou, A.H. Contribution of human embryonic
stem cells to mouse blastocysts. Dev. Biol. 295, 90–102 (2006).
funded by Project A.L.S., P
2
ALS, NYSTEM and the National Institutes of Health
(NIH) GO grant 1RC2 NS069395-01. G.L.B. is a Harvard Stem Cell Institute/NIH
Trainee. E.K. is an EMBO Postdoctoral Fellow. B.J.W. is supported by NIH Training
Grant 5T32GM007592. C.J.W. is supported by grants from the National Institute of
Neurological Disorders and Stroke and the National Institute of Child Health and
Development. K.E. is a Howard Hughes Medical Institute early career scientist.
AUTHOR CONTRIBUTIONS
G.F.C., M.W.A. and D.H.O. maintained human fibroblasts. C.T.R. and J.T.D.
reprogrammed all iPSC lines. G.L.B. and E.K. expanded all iPSC lines. G.L.B. and
E.K. led and contributed equally to all other experiments and analyses in the Eggan
laboratory. G.F.C., M.W.A. and D.H.O. led and contributed equally to all other
experiments and analyses in the Project ALS laboratory. D.J.K. did FC analysis.
A.B.M., D.J.W. and D.H.O. designed and carried out Ca
2+
imaging. B.J.W., G.L.B. and
C.J.W. did recordings. M.Y. assisted with teratomas. L.D. assisted with quantitative
analysis. S.M. assisted with stem cell culture. G.L.B., E.K., K.E., G.F.C., M.W.A.,
D.H.O., C.E.H. and H.W. conceived the experiments and wrote the manuscript.
COMPETING FINANCIAL INTERESTS
The authors declare no competing financial interests.
Published online at http://www.nature.com/naturebiotechnology/.
Reprints and permissions information is available online at
http://npg.nature.com/reprintsandpermissions/.
1. Kiskinis, E. & Eggan, K. Progress toward the clinical application of patient-specific
pluripotent stem cells. J. Clin. Invest. 120, 51–59 (2010).
2. Dimos, J.T. et al. Induced pluripotent stem cells generated from patients with ALS can
be differentiated into motor neurons. Science 321, 1218–1221 (2008).
3. Park, I.H. et al. Disease-specific induced pluripotent stem cells. Cell 134, 877–886
(2008).
4. Lee, G. et al. Modelling pathogenesis and treatment of familial dysautonomia using
patient-specific iPSCs. Nature 461, 402–406 (2009).
5. Soldner, F. et al. Parkinson’s disease patient-derived induced pluripotent stem cells free
of viral reprogramming factors. Cell 136, 964–977 (2009).
6. Chin, M.H. et al. Induced pluripotent stem cells and embryonic stem cells are distin-
guished by gene expression signatures. Cell Stem Cell 5, 111–123 (2009).
7. Doi, A. et al. Differential methylation of tissue- and cancer-specific CpG island shores
distinguishes human induced pluripotent stem cells, embryonic stem cells and fibro-
blasts. Nat. Genet. 41, 1350–1353 (2009).
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 8
nature biotechnology
doi:10.1038/nbt.1783
ONLINE METHODS
Cells and cell culture. All cell cultures were maintained at 37 °C, 5% CO
2
. Human
fibroblasts were cultured in KO-DMEM (Invitrogen), supplemented with 20%
Earl’s salts 199 (Gibco) and 10% hyclone (Gibco), 1× GlutaMax, penicillin/strep-
tomycin (Invitrogen) and 100 μM 2-mercaptoethanol (Gibco). HuES and iPSCs
were maintained on gelatinized tissue culture plastic on a monolayer of irradiated
CF-1 mouse embryonic fibroblasts (MEFs) (GlobalStem), in hES media
23
, with
substitution of plasmanate (Talechris) by an additional 10% knockout serum
replacement (Invitrogen) in PALS laboratory only supplemented with 20 ng/ml
of bFGF. Media was changed every 24 h and lines were passaged by trypsiniza-
tion (0.5% trypsin EDTA, Invitrogen) or dispase (Gibco, 1 mg/ml in hES media
for 30 min at 37 °C).
Derivation of human fibroblasts and iPSC generation. Human fibroblasts
were generated from 3 mm forearm dermal biopsies after informed consent was
obtained, as reported previously
2
. The murine leukemia retroviral vector pMXs
containing the human cDNAs for KLF4, SOX2 and OCT4 (ref. 2) were modified
to produce higher titer virus by including the Woodchuck Post-transcriptional
Responsive Element (WPRE) of FUGW (Addgene plasmid 14883) downstream
of the cDNA. Vesicular stomatitis virus (VSV)-g pseudotyped viruses were
packaged and concentrated by the Harvard Gene Therapy Initiative at Harvard
Medical School. To produce iPSCs, 30,000 human fibroblasts were transduced
at an multiplicity of infection of 10–15 with viruses containing all three genes in
hES medium with 8 μg/ml polybrene (Sigma-Aldrich). Cells were incubated with
virus for 24 h before medium was changed to standard fibroblast medium for
48 h. Cells were subsequently cultured in standard hES medium and iPSC colo-
nies were manually picked based on morphology within 2–4 weeks.
Southern blot analysis. Genomic DNA was extracted from day 21 or day 29
motor neuron differentiation samples for each line using QiaAMP DNA Mini kit
(Qiagen) according to manufacturer’s protocols, including RNase digestion. 8 μg
gDNA was restricted with BglII overnight according to standard protocols and 6.5
μg run on a 0.8% agarose gel. Neutral Southern capillary transfer was performed
overnight, using Amersham Ny
+
membrane. OCT4 and SOX2 probes were gen-
erated by PCR amplification from OCT4 and SOX2 cDNA plasmids
2
using the
following primers (OCT4 primer forward: GAGAAGGAGAAGCTGGAGCA,
reverse: GTGAAGTGAGGGCTCCCATA, 620 bp product; SOX2, primer forward:
AGAACCCCAAGATGCACAAC, reverse: TGGAGTGGGAGGAAGAGGTA,
600 bp product) and Roche PCR DIG Probe Synthesis Kit following manufac-
turers instructions. DNA was bound to membrane by UV, then probe was hybrid-
ized overnight (45 °C for OCT4, 55 °C SOX2) using DIG Easy Hyb, followed
by immunolabeling with anti-digoxigenin–alkaline phosphatase Fab fragments
and detection with CPD-Star chemiluminescent substrate (Roche, following
manufacturers protocols). After hybridization with OCT4 probe, the blot was
stripped in 0.4 M NaOH, 0.1% SDS for 40 min at 65 °C, then washed twice in 2×
SSC (Fisher) at 25 °C for 15 min, and reprobed with SOX2 specific probe. Blots
were imaged on a KODAK Image Station 4000MM Pro.
Flow cytometry for TRA-1-60, SSEA3 and NCAM. Trypsinized suspensions of
~1 M single cells, at day 0 or day 29 of differentiation, were fixed in 4% PFA for 30
min at 4 °C. After washing in PBS, cell suspensions were incubated with the fol-
lowing antibodies obtained from BD Biosciences: SSEA3 PE (1:100, 560237), Tra-
1-60 AlexaFluor647 (1:100, 560219) or the neural differentiation marker NCAM
(CD56 V450 BD biosciences 1:100, 560361) for 30 min protected from light at
4 °C. Stained cells were washed once with PBS and analyzed immediately there-
after on a 5 laser ARIA-IIu ROU Cell Sorter configured with a 100 mm ceramic
nozzle and operating at 20 p.s.i. SSEA3
+
Tra-1-60
+
populations were analyzed first
by forward and side-scatter properties (FSC, SSC) then analysis gates were set
using a combination of fluorescence minus one (FMO) and isotype controls.
Cell cycle analysis. Fibroblasts, ESCs and iPSCs were trypsinized to single cells,
fixed overnight in cold 70% ethanol, treated with RNaseA (Qiagen) and stained
with propidium iodide (PI; 50 μg/ml, Invitrogen) in 0.1% BSA for at least 30 min.
Cells were analyzed using the BD Biosystem LSRII FACS analyzer by doublet dis-
crimination, giving rise to a histogram of PI signal with clear 2n and 4n peaks.
Spontaneous in vitro three-germ layer differentiation. Whole stem cell colonies
were isolated by dispase treatment and plated in suspension in low-cluster 6-well
plates (Corning) in hES media without bFGF and plasmanate. Cells aggregated
to form embryoid bodies within 24 h. Media was replaced every 48 h, and on day
16 embryoid bodies were trypsin and/or mechanically dissociated and plated on
gelatin-coated tissue culture plastic for another 2–7 d of adherent culture before
fixation and staining.
Teratoma assay. IPSC lines were trypsinized to single cells, washed and resus-
pended in a minimal volume of CMF-PBS (Cellgro), supplemented with 10%
FCS (Invitrogen). At least 1 × 10
6
cells were injected into the left kidneys of 5- to
6-week-old, severe combined immunodeficient hairless outbred (SHO) mice (3–5
mice/cell line). Xenograft tissue masses formed within 62–131 d, which were
extracted, fixed, paraffin-embedded, sectioned and H&E stained. Cells repre-
senting all three germ layers were identified after careful examination under the
microscope. Further staining images and individual cell line details available
upon request.
qRT-PCR. Total RNA was isolated using Trizol LS (Invitrogen), 1 μg was treated
with DNase (Invitrogen) and was subsequently used to synthesize cDNA with
iScript (Bio-Rad). qRT-PCR was then performed using SYBR green (Bio-Rad)
and the iCycler system (Bio-Rad). Quantitative levels for all genes were nor-
malized to endogenous GAPDH. For pluripotency genes, levels were expressed
relative to the levels in human ES line HuES-3, for motor neuron genes, levels
are expressed relative to human ES line HuES-3 hb9-GFP. Standard curves were
run to ensure equal efficiency of all primers, and RNA from 293 cells transfected
with the plasmids encoding the transgenes was used as a positive control for viral
transgene detection. Primer sequences are available upon request.
Immunocytochemistry. Pluripotency marker, three-germ layer and OCT3/4–
ISL1 stains were applied after fixation overnight in 4% paraformaldehyde at 4 °C,
as previously described
2
. Neuronal cultures were fixed in 4% PFA for 15–30 min
at 4 °C, permeabilized and quenched with 0.1–0.2% Triton-X in PBS (wash buf-
fer) and 100 mM glycine (Sigma) for 20 min. Cells were blocked in wash with
10% donkey serum for 30 min and then incubated in primary antibody over-
night, secondary antibodies for 1 h. Primary antibodies used in this study are
SSEA-3 (1:2, Developmental Studies Hybridoma Bank (DSHB)), SSEA-4 (1:2,
DSHB), TRA1-60 (1:500, Chemicon), TRA1-81 (1:500, Chemicon), NANOG
(1:500, R&D), OCT3/4 (1:500, Santa Cruz), AFP (1:500, DAKO), α-SMA (1:500,
Sigma), ISL (1:200, DSHB, 40.2D6 or 39.4D5, both of which detect Islet1 and
Islet2 in the identical pattern in vivo in mouse and chick, Susan Morton, personal
communication), HB9 (1:100, DSHB), ChAT (1:100, Chemicon), TUJ1 (1:1,000,
Sigma), Ki67 (1:400, Abcam), and Pax6 (1:50, DSHB). Alkaline phosphatase
activity was detected in live cultures using the alkaline phosphatase substrate
kit (Vector) according to the manufacturer’s instructions. Secondary antibod-
ies used in the Eggan laboratory were AlexaFluor 488, 555, 594 and 647 conju-
gated (1:300, Invitrogen) and images were acquired on the Opera High-Content
Screening System (PerkinElmer) for ISL and HB9 quantifications, and otherwise
using an Olympus 1X51 epi-fluorescence microscope, or an LSM 510 META
confocal microscope (Zeiss). Secondary antibodies used in the PALS laboratory
were DyLight 488, 549, 647 conjugated (1:1,000, Jackson ImmunoResearch) and
images (9, 10× fields/sample) were acquired on a fully automated Zeiss Observer
Z1 epi-fluorescence microscope.
Motor neuron differentiation. Pluripotent stem cell colonies were treated with
dispase (1 mg/ml) to separate colonies from feeder cells, then with 10 μM ROCK
inhibitor Y-27632 (Sigma) for 1 h in suspension, then followed by trypsinization
to single cells, and seeded in low-adherence dishes at 0.2–0.4 million cells/ml in
hES medium with 20 ng/ml of bFGF and 10 M Y-27632 for the first 3 d. At day 4
embryoid bodies were switched to a neural induction medium (DMEM/F12 with
-glutamine, NEAA, penicillin/streptomycin, heparin (2 μg/ml), N2 supplement
(Invitrogen) and bFGF (20 ng/ml). At day 10, retinoic acid (RA) (0.1 μM, Sigma),
ascorbic acid (0.4 g/ml, Sigma), db-cAMP (1 μM, Sigma) and 0.1 M HAg were
added. At day 17 the concentration of HAg was increased to 1 M. At day 25 the
base medium was changed to Neurobasal (Invitrogen), with all previous factors
and with the addition of 10 ng/ml each of BDNF, GDNF and CNTF (R&D). At
day 29 embryoid bodies were dissociated with 0.05% trypsin (Invitrogen), and
plated onto poly--lysine laminin-coated chamber slides (BD Biosciences) at 0.2–
0.5 million cells/well. Plated neuron cultures were cultured in the same medium
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 9
doi:10.1038/nbt.1783
nature biotechnology
with the addition of B27 (Invitrogen), 25 μM β-mercaptoethanol (Millipore) and
25 μM glutamic acid (Sigma), and fixed 3 d later.
Neuralizing motor neuron differentiation. IPSCs and ESCs were differenti-
ated as described above, but with the following modifications: differentiations
were started from dispased colonies triturated to become ~50-cell aggregates of
iPSCs, and from days 1–9 were cultured in the presence of SB431542 (10 μM,
Sigma-Aldrich) and LDN193189 (0.2 μM, Stemgent) to neuralize the cultures.
From day 5 onward, BDNF (10 ng/ml, R&D), ascorbic acid (0.4 g/ml, Sigma)
and RA (Sigma) were added. From day 7 onward, Smoothened agonist 1.3 (SAG)
(Calbiochem) was added at 0.5 μM to replace HAg. Aggregates were dissociated,
plated and assayed as described above on day 21.
Quantitative image analysis. Quantitative image analysis of differentiated
neuronal cultures, for DAPI, TUJ1, ISLET and HB9, was done using the multi-
wavelength cell scoring module in MetaMorph (Molecular Devices) software by
the PALS laboratory, or Opera/Acapella software (PerkinElmer) by the Eggan
laboratory. In brief, intensity thresholds were set, blinded to sample identity, to
selectively identify as positive cells, which displayed unambiguous signal inten-
sity above local background. These parameters were used on all samples, and
only minimally adjusted for different staining batches as necessary. Script and
Parameter files available upon request. Eggan: a minimum of 20,000–160,000 cells
per sample were analyzed from 60–180 20× fields per sample. PALS: a minimum
of 4,000 cells per sample were analyzed from nine 10× fields per sample.
Total cell number analysis. As different image field sizes were used in different
laboratories, total cells/field were normalized as follows. For all cell lines differen-
tiated in parallel in both laboratories, the mean value for each line was averaged
with the mean value of the other lines in this set. These values then generated a
ratio (mean cells/field in PALS laboratory/mean cells/field in Eggan laboratory),
which was then used to normalize the values from the Eggan laboratory to those
from the PALS laboratory.
Voltage-clamp and current-clamp recordings. Differentiated d44 embryoid
bodies were dissociated, plated at 8,000 cells/cm
2
on lysine/laminin-coated cov-
erslips, and allowed to mature for 6 d. Whole-cell voltage-clamp or current-clamp
recordings were made using a Multiclamp 700B (Molecular Devices) at 21–23 °C.
Data were digitized with a Digidata 1440A A/D interface, and recorded and ana-
lyzed using pCLAMP 10 software (Molecular Devices). Data were sampled at 20
kHz and low-pass filtered at 2 kHz. Patch pipettes were pulled from borosilicate
glass capillaries on a Sutter Instruments P-97 puller and had resistances of 2–4
MΩ. The pipette capacitance was reduced by wrapping the shank with Parafilm
and compensated for using the amplifier circuitry. Series resistance was typi-
cally 5–10 MΩ, always <15 MΩ, and compensated by at least 80%. Linear leak-
age currents were digitally subtracted using a P/4 protocol. Leak currents were
typically <100 pA, but occasionally leak currents up to 500 pA were tolerated to
accurately document the percentage of cells with voltage-activated sodium cur-
rents. Voltages were elicited from a holding potential of –90 mV to test potentials
ranging from –90 mV to 20 mV in 10 mV increments. The intracellular solution
was a potassium-based solution and contained (mM) KCl, 135; MgCl
2
, 2; HEPES,
10 (pH 7.4 with KOH). The extracellular was sodium-based and contained NaCl,
135; KCl, 5; CaCl
2
, 2; MgCl
2
, 1; glucose, 10; HEPES, 10, pH 7.4 with NaOH).
Tetrodotoxin was purchased from Tocris Bioscience.
Ca
2+
imaging. ES and iPSCs were differentiated under the neuralizing motor
neuron differentiation protocol above, dissociated at day 21, cryopreserved,
seeded on 15–25 mm diameter coverslips at a density of 125,000–250,000 cells
per coverslip in standard media, and matured 12–14 d before Ca
2+
imaging. Cells
were loaded with 5 μM Fura Red AM and 3 μM Fluo-4 AM (Invitrogen) dissolved
in 0.2% dimethyl sulfoxide/0.04% pluronic acid (Sigma-Aldrich) in HEPES-
buffered physiological salt solution (PSS) for 1 h at 25 °C. PSS contained (mM):
NaCl 145, KCl 5, HEPES 10, CaCl
2
2, MgCl
2
2 and glucose 5.5, pH 7.4. Cultures
were continuously superfused with PSS at a rate of ~0.5 ml/minute. The cultures
were imaged on a C-1 inverted confocal microscope (Nikon Instruments). The
fluorescent Ca
2+
indicators were excited using a 488 nm solid-state laser and
emitted light from the Fluo-4 and Fura-Red recorded in separate channels using
500–530 nm band-pass and 650 nm long-pass filters, respectively. We acquired
256 × 256 pixel images using a 20× 0.7 NA air objective (Nikon). For imaging
spontaneous Ca
2+
transients, single sets of 300 images were acquired at a rate of
~2 Hz from each coverslip. For the kainate and KCl experiments, 36 images were
acquired at a rate of 0.033 Hz and the superfusing PSS was replaced with PSS con-
taining kainate (100 M) or KCl (50 mM). The NaCl concentration of the PSS was
reduced to maintain a constant osmolality and Cl
concentration. Image analy-
sis was performed using ImageJ (http://rsb.info.nih.gov/ij/) and custom-written
macros. Ca
2+
transients were determined from regions of interest encompassing
the soma of individual cells, using the ratio of intensities from the Fluo-4 and Fura
Red channels. Two cultures obtained from a single differentiation of each cell line
were used for the kainate and KCl Ca
2+
imaging experiments.
Statistical analyses. All quantitative data were analyzed using SigmaPlot. Sample
groups were subject to One Way ANOVA, with Holm-Sidak post hoc pairwise
comparisons, or, if equal variance tests failed, by Kruskal-Wallis ANOVA on
ranks, with Dunns post hoc pairwise comparisons. Alpha was set at 0.05 for all
ANOVAs, ANOVAs on ranks and post hoc tests.
RESOURCE
© 2011 Nature America, Inc. All rights reserved.
Page 10
  • Source
    • "Aging impairs, albeit not drastically , the ability of human cells to reprogram into iPSCs (Mahmoudi and Brunet, 2012). Although several studies (especially in mouse models) have shown an age-dependent decline in the reprogramming efficiency (Cheng et al., 2011; Kim et al., 2010; Li et al., 2009; Schnabel et al., 2012; Wang et al., 2011), other research groups have successfully obtained bona fide iPSC lines from old humans (Boulting et al., 2011; Ohmine et al., 2012; Prigione et al., 2011; Somers et al., 2010; Suhr et al., 2009; Yagi et al., 2012), including centenarians (Yagi et al., 2012 ). Reprogramming has the remarkable ability to reverse some cellular and molecular characteristics associated with aging, suggesting that numerous age-associated characteristics are in fact reversible and rejuvenation can actually occur at the cellular level (Freije and Lopez-Otin, 2012; Mahmoudi and Brunet, 2012). "
    [Show abstract] [Hide abstract] ABSTRACT: The main biological hallmarks of the aging process include stem cell exhaustion and cellular senescence. Consequently, research efforts to treat age-related diseases as well as anti-aging therapies in general have recently focused on potential 'reprogramming' regenerative therapies. These new approaches are based on induced pluripotent stem cells (iPSCs), including potential in vivo reprogramming for tissue repair. Another possibility is targeting pathways of cellular senescence, eg, through modulation of p16INK4a signaling and especially inhibition of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). Here, we reviewed and discussed these recent developments together with their possible usefulness for future treatments against sarcopenia, a major age-related condition.
    Full-text · Article · Feb 2016 · Ageing Research Reviews
  • Source
    • "In addition to cell morphology, many cellular and molecular methods are used. One of these methods includes the assessment of the presence of pluripotency marker proteins (e.g., Oct4, Nanog, SSEA3, SSEA4, TRA-1-60 and TRA-1-81), which are expressed in pluripotent stem cells [15]. Since these markers are not necessarily specific to pluripotent stem cells, the expression of multiple of the markers should be assessed in combination to determine the presence of pluripotent stem cells. "
    [Show abstract] [Hide abstract] ABSTRACT: The ability to generate human induced pluripotent stem cells (iPSCs) from somatic cells provides tremendous promises for regenerative medicine and its use has widely increased over recent years. However, reprogramming efficiencies remain low and chromosomal instability and tumorigenic potential are concerns in the use of iPSCs, especially in clinical settings. Therefore, reprogramming methods have been under development to generate safer iPSCs with higher efficiency and better quality. Developments have mainly focused on the somatic cell source, the cocktail of reprogramming factors, the delivery method used to introduce reprogramming factors and culture conditions to maintain the generated iPSCs. This review discusses the developments on these topics and briefly discusses pros and cons of iPSCs in comparison with human embryonic stem cells generated from somatic cell nuclear transfer.
    Full-text · Article · Oct 2015 · Stem Cell Reviews and Reports
  • Source
    • "These precursors are in turn terminally differentiated into dopaminergic neurons under the effect of other signals (Fig. 1D). Similarly, spinal cord identity can be induced through the combinatorial addition of the 'caudal morphogens' RA, Wnts and FGFs (Amoroso et al., 2013; Boulting et al., 2011; Dimos et al., 3139 REVIEW Development (2015) 142, 3138-3150 doi:10.1242/dev.120568 DEVELOPMENT 2008; Li et al., 2005; Maury et al., 2015; Takazawa et al., 2012; Wichterle et al., 2002), again similar to the mechanisms operating in vivo (Liu et al., 2001; Nordström et al., 2002; Nordström et al., 2006). "
    [Show abstract] [Hide abstract] ABSTRACT: The human brain is arguably the most complex structure among living organisms. However, the specific mechanisms leading to this complexity remain incompletely understood, primarily because of the poor experimental accessibility of the human embryonic brain. Over recent years, technologies based on pluripotent stem cells (PSCs) have been developed to generate neural cells of various types. While the translational potential of PSC technologies for disease modeling and/or cell replacement therapies is usually put forward as a rationale for their utility, they are also opening novel windows for direct observation and experimentation of the basic mechanisms of human brain development. PSC-based studies have revealed that a number of cardinal features of neural ontogenesis are remarkably conserved in human models, which can be studied in a reductionist fashion. They have also revealed species-specific features, which constitute attractive lines of investigation to elucidate the mechanisms underlying the development of the human brain, and its link with evolution.
    Full-text · Article · Sep 2015 · Development
Show more