Decreased Oocyte DAZL Expression in Mice Results in Increased Litter Size by Modulating Follicle-Stimulating Hormone-Induced Follicular Growth

Article (PDF Available)inBiology of Reproduction 85(3):584-93 · August 2011with25 Reads
DOI: 10.1095/biolreprod.110.086264 · Source: PubMed
Abstract
While the germ cell-specific RNA binding protein, DAZL, is essential for oocytes to survive meiotic arrest, DAZL heterozygous (het) mice have an increased ovulation rate that is associated with elevated inhibin B and decreased plasma follicle-stimulating hormone (FSH). The relationship between decreased oocyte DAZL expression and enhanced follicular development in het mice was investigated using in vitro follicle cultures and in vivo modulation of endogenous FSH, by treating mice with inhibin and exogenous FSH. In vitro, follicles from het mice are more sensitive to FSH than those of wild-type (wt) mice and can grow in FSH concentrations that are deleterious to wild-type follicles. In vivo, despite no differences between genotypes in follicle population profiles, analysis of granulosa cell areas in antral follicles identified a significantly greater number of antral follicles with increased granulosa cell area in het ovaries. Modulation of FSH in vivo, using decreasing doses of FSH or ovine follicular fluid as a source of inhibin, confirmed the increased responsiveness of het antral follicles to FSH. Significantly more follicles expressing aromatase protein confirmed the earlier maturation of granulosa cells in het mice. In conclusion, it is suggested that DAZL expression represses specific unknown genes that regulate the response of granulosa cells to FSH. If this repression is reduced, as in DAZL het mice, then follicles can grow to the late follicular stage despite declining levels of circulating FSH, thus leading to more follicles ovulating and increased litter size.
BIOLOGY OF REPRODUCTION 85, 584–593 (2011)
Published online before print 26 January 2011.
DOI 10.1095/biolreprod.110.086264
Decreased Oocyte DAZL Expression in Mice Results in Increased Litter Size
by Modulating Follicle-Stimulating Hormone-Induced Follicular Growth
1
Judith R. McNeilly,
2,4
Elaine A. Watson,
4
Yvonne A.R. White,
3,4
Alison A. Murray,
5
Norah Spears,
5
and Alan S. McNeilly
4
Medical Research Council Human Reproductive Sciences Unit,
4
Queen’s Medical Research Institute,
Edinburgh, United Kingdom
Centre for Integrative Physiology,
5
University of Edinburgh, Edinburgh, United Kingdom
ABSTRACT
While the germ cell-specific RNA binding protein, DAZL, is
essential for oocytes to survive meiotic arrest, DAZL heterozy-
gous (het) mice have an increased ovulation rate that is
associated with elevated inhibin B and decrease d plasma
follicle-stimulating hormone (FSH). The relationship between
decreased oocyte DAZL expression and enhanced follicular
development in het mice was investigated using in vitro follicle
cultures and in vivo modulation of endogenous FSH, by treating
mice with inhibin and exogenous FSH. In vitro, follicles from het
mice are more sensitive to FSH than those of wild-type (wt) mice
and can grow in FSH concentrations that are deleterious to wild-
type follicles. In vivo, despite no differences between genotypes
in follicle population profiles, analysis of granulosa cell areas in
antral follicles identified a significantly greater number of antral
follicles with increased granulosa cell area in het ovaries.
Modulation of FSH in vivo, using decreasing doses of FSH or
ovine follicular fluid as a source of inhibin, confirmed the
increased responsiveness of het antral follicles to FSH. Signifi-
cantly more follicles expressing aromatase protein confirmed the
earlier maturation of granulosa cells in het mice. In conclusion,
it is suggested that DAZL expression represses specific unknown
genes that regulate the response of granulosa cells to FSH. If this
repression is reduced, as in DAZL het mice, then follicles can
grow to the late follicular stage despite declining levels of
circulating FSH, thus leading to more follicles ovulating and
increased litter size.
FSH, FSH receptor, follicular development, granulosa cells,
inhibin, ovulation rate
INTRODUCTION
The number of offspring born at any one time is determined
by the ovulation rate, defined as the number of follicles that
develop sufficiently to allow ovulation of competent fertiliz-
able oocytes. From the developing ovary in the fetus, when the
full complement of germ cells is defined, there is a fine balance
between survival and death of these germ cells throughout the
reproductive lifespan of the animal. While studies of inbred
mouse strains have indicated differences in follicle numbers in
the neonatal period due to different rates of activation and
atresia [1], these differences do not influence the final number
of ovulating follicles, and hence, the ovulation rate is sim ilar.
However, it has been shown in mice that genetic differences
are a major source of variation in ovarian responsiveness to
gonadotropins and hence ovulation rate [2].
Folliculogenesis is the highly regulated maturation process
initiated when primordial follicles are activated from the
quiescent pool laid down in fetal life, and either one or more,
depending on the species, complete their maturation and
ovulate. Therefore, factors that control the activation and
maturation of follicles determine ovulation rate. Furthermore,
ovulation rate is determined by selection of ovulatory follicles
from the initially large activated follicular cohort. As follicles
grow, they acquire facto rs at precise times, which determine
whether they are able to proceed in their development. Failure
to express the appropriate factors leads to loss of the follicle by
atresia [3].
Initial activation of primordial to primary follicles involves
complex oocyte –somatic cell signaling pathways and does not
require extraovarian factors; it is gonadotropin-independent ,
relying for development on intraovarian factors including
TGFB growth factor family members, especially oocyte-
specific growth differentiation factor 9 (GDF9) and bone
morphogenic protein 15 (BMP15), although studies in mice
and sheep have shown that the functions of BMP15 are
species-specific, exhibiting different roles within the develop-
ing follicle [4]. However, as the follicle matures, it must
acquire the ability to respond to en docrine factors such as the
pituitary gonadotropins, follicle-stimulating hormone (FSH),
and luteinizing hormone (LH). The subsequent secretion of
steroids and growth factors by the follicles crucially regulates
pituitary gonadotropin secretion, and only the follicles that are
now gonadotropin-dependent will survive and become pre-
ovulatory follicles. Hence, gonadotropins and the ability of the
follicles to respond to them are essential for follicle survival,
maturation, and ovulation [5, 6].
Whereas studies in sheep have shown that the growth of
follicles to an ovulatory size is dependent on FSH, with the
total number of follicles that develop determined by the amount
of FSH and the time of exposure [7, 8], there are no similar
studies in mice. However, in transgenic mice, which lack
functional FSH signaling, i.e., the Fshb knockout gene [9], the
FSH receptor (Fshr) knockout genes [10, 11], or the naturally
occurring hypogonadal (hpg) mutant mouse [12] gene, which
lacks both LH and FSH, follicles arrest at the preantral stage,
confirming that further development is gonadotropin-depen-
dent. Furthermore, treatment with exogenous FSH in the hpg
1
Supported by the United Kingdom Medical Research Council (WBS
G7.002.00007.01).
2
Correspondence: FA X: 44 131 242 6231;
e-mail: j.mcneilly@hrsu.mrc.ac.uk
3
Current address: Vincent Center for Reproductive Biology, Massachu-
setts General Hospital, Boston, MA.
Received: 4 June 2010.
First decision: 16 July 2010.
Accepted: 19 January 2011.
Ó 2011 by the Society for the Study of Reproduction, Inc.
This is an Open Access article, freely available through Biology of
Reproduction’s Authors’ Choice option.
eISSN: 1529-7268 http://www.biolreprod.org
ISSN: 0006-3363
584
Downloaded from www.biolreprod.org.
mutant mouse will induce growth and maturation to produce
preovulatory follicles, with the number of follicles ovulating
dependent on the amount of FSH [13]. In the wild-type (wt)
mouse, it is known that survival and subsequent maturation of
follicles depend on the acquisition of functional receptors at the
appropriate time. Hence, the number of foll icles that remain
sensitive to FSH and, hence, acquire LH receptors and express
aromatase and, thus, are resistant to apoptosis will determine
the number of oocytes that will ovulate [5, 14].
Previous studies have shown that the oocyte plays a crucial
role in regulating follicular growth, with oocyte-specific GDF9
and BMP genes implicated at various stages of development [4,
14, 15]. However, no DAZL-associated oocyte-specific genes
that regulate follicular sensitivity to gonadotropins have been
identified. The RNA binding protein, DAZL, is expressed
specifically in germ cells. In our female DAZL null mouse,
fetal germ cells proliferate and enter meiosis normally, but
there is substantial loss of oogonia from Embryonic Day (ED)
17.5 onward, and by Postnatal Day (PND) 4, there are no germ
cells remaining in the ovaries due to failure to progress through
meiotic prophase [16, 17]. Timing of the loss of germ cells is
affected by strain background and inbreeding. Significant germ
loss occurred by ED14.5 both in an inbred line of mice [18, 19]
and in a different DAZL null mouse line [20]. Despite this total
loss of oocytes, we have previously reported the presence in the
remaining ovarian tissue of steroidogenically active cells that
secrete inhibins A and B and sufficient estrogen to induce
uterine hypertrophy in adult mice at 12 weeks of age [21]. Mice
heterozygous (het) for the Dazl gene were reported to have
similar numbe rs of germ cells in fetal life, and there was a
minimal effect on meiosis compared with that of wt mice [20].
Unexpectedly, in female Dazl het mice, a significant increase
in litter size was noted together with increased plasma inhibin
B and decreased plasma FSH, suggesting the apparent survival
of more small follicles. The aim of the present study was to
determine how decreased oocyte DAZL expression could
enhance follicle development in heterozygous ovaries despite
the presen ce of physiologically reduced plasma FSH concen-
trations. Our in vitro and in vivo results show that follicl es in
het mice are more sensitive to FSH. This sensitivity results in
more rapid follicle maturation and reduced atresia rates of
preovulatory follicles, resulting in increased ovulation rates and
litter sizes.
MATERIALS AND METHODS
Animals
The Dazl knockout (KO) MF1 mouse line was generated as described
previously [16] and maintained by het male-to-female matings. Ear notches
were collected for genotyping and identification as previously described [17,
21]. These wt matings, using siblings generated by the DAZL line, were set up
as controls for litter size studies. To determine the robustness of the increased
litter size phenotype, the MF1 line was backcrossed for four generations and
was also rederived onto a 129 background and litter sizes were assessed.
Animals were kept on a 14L:10D cycle in temperature- and humidity-controlled
rooms and had free access to food and water. All studies were approved by the
University of Edinburgh’s Biological Services Ethical Review Committee and
were performed under a Project Licence as required by the United Kingdom
Animals (Scientific procedures) Act 1986.
DAZL Expression, Ovulation Rates, and Pregnancy
The level of Dazl mRNA was determined initially by PCR in three separate
pools of 10 ovaries (n ¼ 5 mice) from Day 10 (D10) wt, het, and KO mice.
Initial PCR assays confirmed there was no Dazl mRNA in the KO ovaries.
Subsequently, the levels of Dazl mRNA in wt mice were compared with those
in het mice by using QuantiTect SYBR Green PCR (Qiagen, Crawley, U.K.) in
these pools of D10 ovaries and in three separate pools of 50 oocytes from D21
wt and het mice. The forward primer used in both PCR assays was
TCCAAATGCTGAGACTTACATG; and the reverse primer was
GTCTGTCTGCTTCGGTCCAC.
The relationship between the number of implantation sites and the number
of fresh corpora lutea (CLs) in wt and het Dazl females was determined.
Following timed mating of female mice (n ¼ 10 for each genotype), the animals
were culled at ED8, and the numbers of implantation sites and CLs were
counted at collection. All ovaries were then fixed in Bouin fixative, processed
to paraffin wax, and serially sectioned at 5-lm thicknesses, and every 30th
section was counterstained with hematoxylin. The number of CLs was then
counted by an independent assessor, and the correlation with the implantation
sites was determined for each genotype.
Ovarian Follicle Cultures
Ovaries were removed from D21 wt and het female mice and placed in
Leibovitz L-15 (Gibco-BRL, Irvine, U.K.) medium supplemented with 3 mg of
bovine serum albumin (BSA)/ml (Fraction V; Sigma, Poole, U.K.) at 378C.
Individual preantral follicles (180 6 10 mm) were microdissected using fine
acupuncture needles and placed in individual wells of a 96-well plate (U wells;
Iwaki, Sterilin, Caerphilly, U.K.) containing 30 ml of minimum essential
medium (aMEM; Invitrogen, Renfrew, U.K.) supplemented with 5% (v/v)
mature F1 (adult female) mouse serum and 140 mM ascorbic acid (Sigma,
Poole, U.K.) as described previously [22]. Recombinant human FSH (rhFSH)
(300 IU, Puregon, batch 311209; N.V. Organon, The Netherlands) was added
from the start of culture at 1.0, 0.1, or 0.01 IU/ml, giving an FSH concentration
of 3.0, 0.3, or 0.03 mU per well. Each well was covered with 75 ll of silicon oil
(Dow Corning, VWR, U.K.) and incubated at 378Cin5%CO
2
for 6 days.
Follicle morphology was noted daily, and growth was determined by
measuring the diameter with a calibrated ocular micrometer at 403
magnification. Each follicle was then transferred to a new well with fresh
medium containing FSH at the appropriate concentration. No culture lasted
more than 6 days, and all cultures contained FSH as the absence of FSH leads
to follicle death at approximately 2 days of culture [22]. Medium samples were
collected from each well at transfer and frozen at 208C for measurement of
estradiol and inhibins A and B. The number of cultures performed was 16,
using 24 wt and 21 het D21 mice, which yielded 168 and 166 follicles,
respectively.
In Vivo Studies
Morphology. Animals (D21 and 10- to 12-week-old adult wt and het
females [n ¼ 6 mice for each group and age]) were killed by CO
2
asphyxiation,
and ovaries were collected, weighed, and then fixed in Bouin fixative and
processed to paraffin wax stage. All ovaries were serially sectioned (5-mm
slices), and every 10th serial section was stained with hematoxylin prior to
assessment. Follicles containing a nucleus within the oocyte were classified
[23] and counted using an Olympus BH-2 microscope fitted with a Prior
automatic stage (Prior Scientific Instruments Ltd., Cambridge, U.K.), and the
area of granulosa cells was measured using Image-Pro Plus version 4.5.1
software with Stereologer-Pro plug-in software (Media Cybernetics U.K.,
Wokingham, Berkshire, U.K.). In addition, ovaries were collected and weighed
from all transgenic females culled during routine breeding.
At culling, blood samples were collected by cardiac puncture following
CO
2
asphyxiation and centrifuged at 8000 3 g for 15 min, and plasma was
collected and stored at 208C for measurement of FSH, LH, estradiol,
progesterone, and inhibins A and B.
Treatment with FSH and inhibin. The wt and het D21 females (n ¼ 5 per
group) were injected intraperitoneally twice daily for 3 days with either FSH
(10 or 1 IU of rhFSH in 0.1 ml of phosphate-buffered saline) or charcoal-
stripped ovine follicular fluid (oFF) as a source of steroid-free inhibin. We have
previously demonstrated that administering o FF i n thi s regi men will
significantly suppress plasma FSH concentrations in mice [24]. Animals were
culled 24 h after the final injection, and ovaries were collected and processed to
paraffin wax stage. Follicles were classified and counted as previously
described.
Immunoassays
Plasma FSH and LH concentrations were measured by radioimmunoassay
using reagents supplied by the National Hormone and Peptide Program (Dr.
A.F. Parlow, Harbor-UCLA Medical Center, CA), with all samples for each
hormone assayed in duplicate in one assay. The reference preparations were rat
FSH RP-3 and rat LH RP-1, and the minimum detectable concentrations were
1.0 and 0.1 ng/ml, respectively. The intra-assay coefficients of variation were
,6% [21, 25].
OOCYTE DAZL AFFECTS FOLLICLE FSH SENSITIVITY 585
Downloaded from www.biolreprod.org.
Inhibins A and B were measured using two-site ELISA [26, 27], previously
validated for mouse plasma (21). All samples were measured in a single assay
with medium samples diluted in culture medium. The minimum detectable
concentrations were 1 pg/ml (inhibin A) and 8 pg/ml (inhibin B), and the intra-
assay coefficients of variation were ,10%.
Estradiol and progesterone in plasma were assayed following solvent
extraction using sensitive radioimmunoassay methods modified for mouse
plasma as previously described [28, 29]. All samples were assayed in a single
assay with intra-assay coefficients of variation of ,8%. The minimum
detectable concentrations for estradiol and progesterone were 4.6 and 100 pg/
ml, respectively. Estradiol in culture medium was measured by a sensitive
ELISA without solvent extraction, using an antiestradiol antibody that had been
previously validated [30].
Immunohistochemistry
Ovaries were collected from D21 wt, het, and KO females (n ¼ 5 mice per
group) and processed to paraffin wax stage and then serially sectioned at 5-mm
thicknesses, and every 10th section was analyzed as previously described.
Following antigen retrieval using 0.01 M citrate, pH 6, all sections were
incubated with 1 ) methanol-hyd rogen peroxide to bl ock endogenous
peroxidases; 2) avidin biotin (Vector Laboratories, Inc., Burlingame, CA) to
block endogenous biotin; and then 3) serum (normal goat serum at 1:5 dilution
in Tris-buffered saline containing 5% BSA). Sections were then incubated
overnight at 48C with primary antibody (mouse monoclonal antibody to DAZL
[clone 311/A] or aromatase [31] at 1:50 dilution [kindly provided by Prof. N.
Groome, Oxford Brookes University, U.K.]). Positive staining was detected by
biotinylated goat anti-mouse secondary antibody (DAKO Corp., Copenhagen,
Denmark), followed by streptavidin-horseradish peroxidase (Vector Laborato-
ries, Inc., Burlingame, CA), and visualized by using a diaminobenzidine
detection kit (DAKO Corp., Copenhagen, Denmark). Sections were counter-
stained with hematoxylin and then dehydrated and mounted in Pertex (Cell
Path, Hemel Hempstead, U.K.). Sections were photographed using an Olympus
Corp. Provis model microscope (New Hyde Park, NY) and a Kodak digital
camera (Eastman Kodak, Inc., Rochester, NY). For each ovary, the number of
follicles in each section with positive aromatase staining was counted.
Statistical Analysis
All data shown are expressed as means 6 SEM and were analyzed using
GraphPad Prism 5 software (GraphPad Software, Inc., San Diego, CA). Plasma
hormone concentrations, litter sizes, and ovarian weights were log transformed
prior to comparison between two genotypes by using unpaired one-way
ANOVA. Parametric one-way ANOVA followed by Tukey post hoc test was
used to determine differences in follicle count, granulosa cell area data, and
estradiol and inhibin A and B concentrations between genotypes, following
follicle incubation. A P value of ,0.05 was considered significant.
RESULTS
DAZL Expression, Litter Size, and Plasma Hormones
DAZL expression. In an initial screen, Dazl mRNA was
detected by PCR in ovaries from wt and het mice, but no signal
was detected in KO ovaries. Quantitation of DAZL mRNA by
SYBR Green quantitative PCR in both D10 ovaries and D21
oocyte pools is shown in Figure 1A and confirms that
expression was decreased to 45% in het compared to that in
wt ovaries and oocytes (Fig. 1A). Furthermore, while there
were no quantified subjective differences between levels of
DAZL expression in wt and those in het oocy tes after
immunohistochemistry testing for DAZL (data not shown),
there were no oocytes and no DAZL protein present in KO
ovaries (Fig. 1, B and C). Several attempts were made to
quantify levels of DAZL protein by Western blotting using up
to 60 lg of protein from pools of D10 ovaries and D21 oocytes
(n . 500), with D10 and adult testis (20 lg of protein) used as
a control. While a band of the correct size for DAZL (33 kDa)
was easily detected in both testis extracts, no signal was present
in any of the ovary extracts (n ¼ 3 pools of D10 ovaries and
D21 oocytes).
Litter size. The numbers of pups born per litter from wt 3 wt
and het 3 het matings (n ¼ 35 and 105, respectively) are shown
in Figure 2A. Significantly (P , 0.01) greater numbers of pups
per litter were born to het females following both first and
subsequent matings. All animals were between 8 and 10 weeks
of age at first mating, and males were left with females until
final culling after 6–7 litters. In randomly selected groups of 10
wt and 10 hets culled during pregnancy, the number of CLs
(7.5 6 0.5, wt; and 12.3 6 0.6, het) and implantation sites (6.9
6 0.4, wt; and 11.5 6 0.5, het) were directly correlated within
each animal in both wt and het genotypes (n ¼ 10 per group; r
2
¼ 0.91 for wt and 0.94 for het; P , 0.001). The increased litter
size phenotype was confirmed after backcrossing the MF1 line
for four generations (wt mice had 8.1 6 0.4 pups per litter, and
DAZL het mice had 12.4 6 0.9 pups per litter; n ¼ 13; P ,
0.001). Furthermore the MF1 line was rederived onto a 129
background and, despite the lower litter size in this in-bred line,
the increased litter size was maintained (wt mice had 4.2 6
0.37 pups per litter versus 8.83 6 1.14 pups per litter for het
mice; P , 0.001).
Plasma hormones. Plasma FSH concentrations in adult wt
and het 10–1 2-week-old females are shown in Figure 2B.
While there were no differences in plasma LH levels between
the genotypes (data not shown), plasma FSH levels were
significantly (P , 0.01) lower in het females than in wt
females. Plasma inhibin B levels were significantly (P , 0.05)
elevated in het females compared to that in wt females (Fig.
2F). No significant differences in plasma estradiol, progester-
one, or inhibin A concentrations were observed between wt and
het females (Fig. 2, C, D, and F, respectively).
In Vitro Follicle Cultures
Follicle growth. The growth rates of wt and het follicles,
cultured with decreasing concentrations of rhFSH for 6 days,
FIG. 1. Levels of expression of Dazl mRNA in pools of oocytes from D21
wt and het ovaries (A), the presence of DAZL in oocytes in a D21 het ovary
(B), and the absence of oocytes and DAZL staining in a D21 KO ovary (C)
are shown. ***Statistical significance of P , 0.001.
586 MCNEILLY ET AL.
Downloaded from www.biolreprod.org.
are shown in Figure 3, A–C. When follicles were cultured
with 1.0 IU of FSH (Fig. 2A), there were no significant
differences in follicle diameters on Days 2 and 3, but het
follicles on Day 4 were significantly (P , 0.05) larger than wt
follicles. However, this difference was not maintained on
Days 5 and 6. The final diameters of both wt and het follicles
in this treatment group were the same (.350 m m ). In
contrast, in cultures treated with 0.1 I U of FSH (Fig. 3B), het
follicles grew f aster and by Day 3 had significantly (P ,
0.05) greater diameters than wt follicles. These differences
had increased by Day 4 (P , 0.01) and were maintained over
the next 2 days. The maximum follicle diameters in both wt
and het on Day 6 were 314 6 4.1 mm and 343 6 3.3 mm,
respectively. At the lowest concentration of rhFSH, 0.01 IU
(Fig. 3C), all follicles grew at a similar rate for the first 24 h
(D2). Thereafter, the rate of growth of het follicles was greater
than that of wt follicles, with het follicles continuing to grow
throughout the culture period. However, by Day 4, wt
follicles reached their maximum diameters, which were
maintained over the next 2 days. On Days 5 and 6, het
follicles were signifi cantly ( P , 0.001) larger than wt
follicles, achieving final diameters of 304 6 3.8 mm and
254 6 6.3 mm, respectively. The final diameters of both wt
and het follicles after 6 days of culture in the lowest
concentration of rhFSH (0.01 IU) were significantly (P ,
0.001) smaller than follicles cultured with either 1.0 or 0.1 IU
rhFSH.
Interestingly, it was noted that a number of follicles had
ruptured by Day 3 when cultured with either 1.0 IU or 0.1 IU
of rhFSH, with a significantly (P , 0.05) greater proportion of
wt follicle rupture (15%) than het follicle rupture (5%). When
follicles were cultured with 0.01 IU of rhFSH, there was no
difference in the rate of follicular rupture between genotypes.
Inhibin A and B and steroids . Inhibin A and B
concentrations in culture medium on D6 of follicle culture
are shown in Figure 3, D and E. While there were no
differences in inhibin A concentrations between genotypes
following c ulture with either 1.0 or 0.1 IU rhFSH, medium
from het follicles incubated w ith 0.01 IU rhFSH had
significantly (P , 0.05) increased inhibin A compared to wt
follicles (Fig. 3D).
In contrast, inhibin B concentrations in medium on D6 were
significantly (P , 0.05) higher in het than in wt follicles
following culture with 1.0 and 0.1 IU rhFSH. However, in
cultures with the lowest concentration of FSH (0.01 IU), there
was significantly less inhibin B in the culture medium from het
follicles (P , 0.05) (Fig. 3E). In order to determine whether
the significant differences in inhibin secretion were related to
the differences in rate of growth of follicles, inhibin A and B
concentrations in media from wt and het follicles of equivalent
sizes (348–350 mm), cultured with 1.0 IU rhFSH, were
measured. No differences in either inhibin A or B concentra-
tions were observed for equivalent sized wt and het follicles
(Fig. 3F).
In all treatment groups at D6, there were no differences in
estradiol and progesterone between genotypes (data not
shown).
FIG. 2. Phenotypic data from adult wt and
het DAZL mice are shown. A) The numbers
of pups born per litter from wt 3 wt and het
3 het matings (n ¼ 35 and 105, respec-
tively) are shown. Mean plasma concentra-
tions of (B) FSH, (C) estradiol, (D)
progesterone, ( E) inhibin A, and (F) inhibin
B are shown. All data are expressed as
means 6 SEM. *Statistical significance of at
least P , 0.05.
OOCYTE DAZL AFFECTS FOLLICLE FSH SENSITIVITY 587
Downloaded from www.biolreprod.org.
In Vivo Studies
Follicle populations in wt and het ovaries. There were no
differences in individual ovary weights between genotypes or
with age (data not shown). The number of follicles containing a
nucleus within the oocyte in every 10th section of each ovary
(n ¼ 6/genotype) were counted and then multiplied by 10 and
classified according to their granulosa cell morphology [23, 32,
33]. Distribution of follicle populations at Day 21 is illustrated
in Figure 4. No differences were identified between the
genotypes. A similar population profile was noted in 10- to 12-
week-old adult ovaries (data not shown).
Follicle morphology. As there were no differences in follicle
numbers between genotypes, the morphology of individual
follicles at all stages of development was assessed. As follicle
maturation is dependent on granulosa cell proliferation,
granulosa cell number was used as an indicator of maturity.
A prelimin ary study demonstrated that the relationship between
granulosa cell area, excluding oocyte and antral cavity areas,
and granulosa cell numbers was highly correlated in both
genotypes (r
2
¼ 0.98 for wt and 0.92 for het; P , 0.001; data
not shown), and, hence, granulosa cell area was used as a
marker of granulosa cell number. No differences in follicle size
or granulosa cell area were observed in primary, transitionary,
or secondary follicles (data not shown), nor were there any
differences between oocyte area or volume of follicular fluid in
antral follicles between genotypes (data not shown). Analysis
of granulosa cell areas in wt and het antra l follicles is shown in
Figure 5A. It can be seen that the distribution of granulosa cell
areas in wt antral follicles ranges from 2 3 10
4
to 7 3 10
4
mm
2
,
with the majority (.90%) of follicle areas between 2 3 10
4
and
5 3 10
4
mm
2
. However, in het antral follicles, whereas the
majority (.80%) of follicles were in t he same range,
approximately 9% were larger, up to 10.1 3 10
4
to 11 3 10
4
mm
2
, than only 1% in this range in wt ovaries.
Modulation of FSH
Treatment with oFF. The distribution of granulosa cell area
in antral follicles following the inhi bition of secretion of
endogenous FSH by oFF, a rich source of inhibin, is shown in
Figure 5B. The population profiles of both genotypes showed
similar distribution patterns, with the exception of follicles with
granulosa areas in the range of 5.1 3 10
4
to 6 3 10
4
mm
2
,
where there was a significantly higher percentage of follicles in
het ovaries than in wt ovaries (P , 0.05). However, the
absence of follicles with granulosa cell areas of .8 3 10
4
mm
2
in het ovaries indicates that their growth beyond this size, as
seen in the untreated het mice, is FSH dependent.
Treatment with rhFSH. The distribution profiles of antral
granulosa cell areas in wt and het ovaries following treatment
with 1 IU and 10 IU of rhFSH are shown in Figure 5, C and D,
respectively. As expected, treatment with 10 IU of FSH in both
genotypes significantly (P , 0.01) increased the number of
large follicles compared with that of untreated controls. Apart
from small antral follicles with a granulosa cell area in the
range 5.1 3 10
4
to 6 3 10
4
mm
2
, where there were significantly
(P , 0.01) more in wt than in het, no other significant
differences were observed between the genoty pes.
FIG. 3. In vitro cultures of follicles from
DAZL wt and het ovaries are shown. Follicle
diameter measurements (lm) from Day 1 to
Day 6 of culture in medium containing 1.0
(A), 0.1 (B), and 0.01 (C) IU of rhFSH (wt, n
¼ 78 [1.0 IU]; n ¼ 58 [0.1 IU], and n ¼ 32
[0.01 IU]; het, n ¼ 82 [1.0 IU], n ¼ 45 [0.1
IU], and n ¼ 39 [0.01 IU]). All data are
shown as means 6 SEM. *Statistical signif-
icance of at least P , 0.05. Inhibin A and B
concentrations on D6 of culture in media
samples containing 1.0, 0.1, and 0.01 IU
rhFSH are shown in D and E, respectively. F)
Concentrations of inhibin A and B in media
samples from wt and het follicle cultures
where the follicle diameters are similar
(348–350 lm) following culture in 1.0 IU
rhFSH are shown (wt, n ¼ 13; het, n ¼ 18).
All data are shown as means 6 SEM.
*Statistical significance of at least P , 0.05.
588 MCNEILLY ET AL.
Downloaded from www.biolreprod.org.
Following their treatment with 1 IU of FSH, a distribution
pattern of granulosa cell areas was observed that was similar to
the in vivo control nontreated mice with endogenous FSH (Fig.
5C). The majority of follicles in both genotypes had granulosa
cell areas in the range of 2.1 3 10
4
to 7 3 10
4
mm
2
, with no
differences in percentages of follicles between genotypes at any
point, apart from those with a granulosa cell areas of 5.1 3 10
4
to 6 3 10
4
mm
2
, where there were significantly (P , 0.01)
more wt than het follicles. Similarly, there were significantly
(8% het versus 1% wt; P , 0.01) more follicles with granulosa
cell areas greater than 7 3 10
4
mm
2
in het ovaries than in wt
ovaries. There were no follicles with granul osa cell areas of
.9.1 3 10
4
to 10 3 10
4
mm
2
in ovaries from either genotype.
Interestingly, treatment with 1 I U of FSH al tered the
distribution profile only in the wt ovaries, shifting the median
point of the curve from 3.1 3 10
4
to 4 3 10
4
mm
2
(for control,
nontreated ovaries) to 5.1–6 mm
2
. This area of granulosa cells
is in the same size range as that of small antral follicles, 240–
280 mm in diameter, with an equivalent area of follicular fluid
and the same size of oocytes in wt and het mice (wt, 66.1 6 1.1
mm; het, 66.7 6 1.5 mm).
Aromatase immunohistochemistry. The number and distri-
bution of aromatase-positive follicles in wt and het D21 ovaries
are shown in Figure 5. While there are aromatase-positive
follicles in ovaries from both genotypes (Fig. 6, A and B), there
are significantly (P , 0.001) more positive follicles in het than
in wt ovaries at this age (Fig. 6C).
DISCUSSION
In the present study, we have shown reduced oocyte Dazl
mRNA expression in het females, and this is related to in an
increase in the sensitivity of granulosa cells to FSH. This
change could account for the increase in litter size found in the
study published previously [21] and is confirmed in the
present, much larger study.
During the follicular phase of the cycle, FSH levels decrease
as a result of increased estrogen and inhibin B secretion from
FIG. 4. Follicle population classification in
D21 DAZL wt and het ovaries are shown
according to reference [19]. All data are
shown as means 6 SEM (n ¼ 6 for each
genotype).
FIG. 5. Distribution profiles of granulosa
cell areas (310
4
lm
2
)in(A) antral follicles
from untreated DAZL D21 wt and het
ovaries, (B) following treatment with oFF,
and (C and D) following treatment with 1
and 10 IU rhFSH, respectively. All data are
expressed as mean percentages of antral
follicles 6 SEM. *Statistical significance of
at least P , 0.05. Dashed line indicates the
granulosa cell area above which there are
few (1%) larger follicles in wt ovaries. This is
indicated for clarity only.
OOCYTE DAZL AFFECTS FOLLICLE FSH SENSITIVITY 589
Downloaded from www.biolreprod.org.
the growing cohort of small follicles [27]. Only follicles that
can survive this decrease in circulating FSH in the follicular
phase of the cycle, through additional utilization of LH via
FSH-induced LH receptor s on granulosa cells [14], will
continue to grow and mature to become preovulatory foll icles.
Therefore, the ability to respond to FSH and then LH to
enhance, e.g., cAMP production, at the appropriate time
regulates the number of follicles attaining ovulatory compe-
tence. The ovary and, particularly, the developing follicles
finely control FSH secretion by producing inhibin B from the
small follicles and subsequently inhibin A and estradiol from
the larger preantral and antral follicles [26]. Manipulation of
FSH by abolishing secretion, using transgenic technology,
resulted in infertility with a block in folliculogenesis at the
preantral stage [9]. Similar ovarian morphology was demon-
strated in the FSH receptor KO mouse, although lack of
ovarian feedback at the pituitary resulted in elevated plasma
gonadotropins and consequently severe ovarian pathologies in
old mice [10, 11, 34]. In addition, reducing FSH with GnRH
antiserum or hypophysectomy followed by an increase in
plasma FSH levels has a dramatic effect on the number of
follicles ovulating in rodents and sheep [35, 36].
However, in the Dazl het females, increased plasma inhibin
B, not estradiol, appears to be associated with low FSH. For
this to occur in the het ovary, it must either have more small
preantral follicles secreting similar amounts of inhibin B per
follicle or a similar number of follicles with each follicle
producing more inhibin B. In fact, our in vitro study has
demonstrated that the increased plasma inhibin B observed in
het females is due to accelerated follicle maturation and not to
the secreted product of additional follicles. Culturing preantral
wt and het follicles in decreasing FSH concentrations show ed
that het follicles grow faster than wt follicles at each FSH dose
and, crucially, have the ability to survive in FSH concentrations
that are detrimental to equivalent wt follicl es. This indicates
that DAZL het follicles in which the oocytes express reduced
DAZL protein (Y.A. Brown, unpublished results) are more
sensitive to FSH at all concentrations investigated. As each het
follicle grows faster, they secrete significantly more inhibin B,
suggesting they are developmentall y more advanced than the
corresponding wt cohort, with no differences in estradiol
output, data that concur with our previously reported
preliminary in vivo results [21]. This result indicates that in
the DAZL het ovary, FSH enhances granulosa cell prolifera tion
and differentiation as demonstrated by increased inhibin B
secretion. Further confirmation that the increase in inhibin B in
het follicles is due to their significantly greater size is
demonstrated by the observation that wt and het follicles of
equivalent size secrete similar amounts of inhibin A and B and
estradiol.
In vivo, this increased sensitivity to FSH per se could have
increased the numbers or sizes of follicles in the DAZL het
ovaries. Analysis of all size classes of follicles in D21 and adult
ovaries from both genotypes showed no differences in the
numbers of follicles at any stage in folliculogenesis, indicating
that increased sensitivity to FSH has no effect on follicle
activation. However, by using the highly correlated relation-
ship between granulosa cell numbe r and area, we could
determine the number of granulosa cells in antral follicles and
classify antral follicles by granulosa cell area. Consequently,
the presence of significantly larger follicles in het ovaries than
in wt follicles confirms our in vitro results that D21 DAZL het
ovaries have antral follicles that are larger than those present in
wt ovaries of the same age due to significantly increased
numbers of granulosa cells. These follicles are more develop-
mentally advanced as confirmed by the expression of
FIG. 6. Aromatase expression in D21 wt (A) and in het (B) ovaries is
shown as detected by immunohistochemistry. Bars ¼ 50 lm. C) Total
number of aromatase-positive follicles are shown in untreated DAZL D21
wt and het ovaries (n ¼ 5 for each genotype). Data are expressed as the
mean number of positive staining follicles per ovary 6 SEM when every
10th 5-lm section was analyzed. *Statistical significance of at least P ,
0.05.
590 MCNEILLY ET AL.
Downloaded from www.biolreprod.org.
aromatase in significantly more follicles at D21. Furthermore,
the effect of significantly reduced DAZL mRNA and protein is
only in the granulosa cells and has no effect on the size of the
oocyte or area of the antrum (data not shown), despite the fact
that the Dazl gene is oocyte-specific. Hence, it is suggested that
the increased sensitivity to FSH allows accelerated maturation
of granulosa cells. This, together with more follicles being able
to respond to low FSH concentrations, reduces the rate of
atresia compared with that of wt, leading to more follicles
becoming preovulatory. Interestingly, a similar increase in
ovulation rate in Booroola sheep heterozygous for the
BMPR1B mutation, otherwise known as ALK6, has been
extensively s tudied, but, in that case, fol licles attained
ovulatory competence at a smaller follicle size due to a
reduction in granulosa cell numbers associated with accelerated
differentiation [37].
If the accelerated maturation of granulosa cells in antral
follicles from DAZL het ovaries is entirely mediated by FSH,
then manipulation of FSH should alter the distribution of these
follicles, classified by size. Decreasing endogenous FSH by
treatment with oFF completely abolished the large follicles,
which were observed in the untreated het ovaries, demonstrat-
ing that this increase in the number of larger follicles is entirely
dependent on their enhanced response to FSH. However, it
should be noted that the actual decrease in plasma FSH
following oFF treatment in the het mice is less drastic than in
wt mice, as the levels of endogenous FSH in the het mice are
significantly lower than that in the wt mice. Therefore, it would
appear that the ability of the het ovary to respond to a narrow
range of plasma concentrations of FSH is very finely tuned. In
addition, following oFF treatment, similar granulosa cell area
classification profiles confirmed that all differences between
the genotypes are dependent on FSH.
Treatment of DAZL het mice with exogenous FSH did not
perturb the enhanced granulosa cell maturation by increasing
either the size or number of the large follicles. Low FSH
concentrations had no effect on the distribution of follicular
granulosa cell areas in het ovaries, which still had more large
follicles than the wt ovaries. In contrast, in the wt mice,
treatment with low FSH levels altered the population profile by
increasing the median size of the follicles. Higher FSH levels
increased the proportion of larger follicles in both het and wt
ovaries bu t did not increase the size of the largest follicles. This
suggests that a granul osa cell area of 10.1 3 10
4
to 11 3 10
4
mm
2
is the maximum area achievable in mouse follicles. In
DAZL wt ovaries, the higher FSH level treatment was
sufficient to transform the granulosa cell distribution profile
to that of the het follicles. Our results also suggest that antral
follicles with a granulosa cell area of 5.1 3 10
4
to 6 3 10
4
mm
2
appear to be most responsive either to increasing or reducing
FSH. The reason for this is not known, but it is not related to
differences in the sizes of the follicle, antrum, or oocyte, which
are the same in both het and wt follicles with this granulosa cell
area.
In this mouse model, the difference between wt and het
ovaries is a single copy of the Dazl gene expressed in the
oocytes. Therefore, the relationship between a single Dazl copy
in oocytes and accelerated granulosa cell proliferation, which
we have shown is FSH-dependent , must involve FSH receptors
(FSHR) expression, activation, and subsequent signaling. KO
experiments have shown that follicular growth is arrested in
mice with no FSH [9] or FSHR [10, 11], which are present on
granulosa cells. Simplistically, reduced DAZL expression
could alter FSHR numbers expressed, but this does not appear
to be the case, as preliminary data (Y.A. Brown, unpublished
results) have shown no differences in FSHR mRNA expression
between the two genotypes. However, this does not determine
receptor functionality. FSH is known to regulate granulosa cell
proliferation through multiple signaling pathways [38] such as
the induction of cell cycle regulatory protein cyclin D2
expression, while simultaneously reducing t he cell cycle
inhibitor protein p27 kip [39, 40]. In our model, significantly
reduced plasma FSH is the result of increased inhibin B
feedback from developing small follicles. This must be an
indirect effect of reduced DAZL, as DAZL proteins are germ-
cell-specific RNA binding proteins affecting mRNA transla-
tional regulation [41].
In oogenesis, where the temporal regulation of gene
expression is crucial, there are periods of increased mRNA
expression when entering meiosis, followed by quiescence
when the oocyte arrests at diplotene until completing meiosis
following the LH surge. It has been assumed that DAZL
functions to regulate intraoocyte gene expression at these
particular stages. However, in our study , the in crease d
sensitivity of the granulosa cells to FSH is likely to be through
oocyte-secreted proteins, as there are few reports of DAZL
expression in granulosa and theca cells in mouse and human
ovaries [42–44]. Therefore, regulation of an oocyte-secreted
protein must be either directly or indirectly related to DAZL
expression. Of the oocyte-secreted proteins whose effects on
granulosa cells are well documented [4, 45], GDF9 could be a
candidate for DAZL interaction. However, the lack of a
putative DAZL binding consensus sequence precludes any
apparent direct interaction with DAZL, and, furthermore, by
using real-time PCR, we have shown there are no differences in
Gdf9 mRNA expression between the genotypes (Y.A. Brown,
unpublished observation). A possible indirect effect might be
through modulation of anti-Mu¨llerian hormone, which can
affect the effects of FSH on follicular growth [46].
Efforts to identify in vivo mRNA targets of mammalian
DAZL have focused mainly on testis-expressed mRNAs.
Mouse vasa homolog (Mvh [official symbol, Ddx4 ]) and
synaptonemal complex protein (Sycp3) genes were isolated by
coprecipitation with DAZL prote in from testis extracts [47, 48]
but are also present in oocytes during early oogenesis.
However, the connec tion betwe en these genes, fo llicle
sensitivity to FSH, and early follicular maturation does not
seem obvious at the moment and needs further investigation.
Embryonic stem cells derived from Dazl heterozygous mice
appear to show aberrant gene expression and imprinting
abnormalities, suggesting that a single copy of the Dazl gene
may not be enough to support germ cell development in vitro
[20]. However, in vivo, in the present study, there were no
differences between the number of oocyte-containing follicles
in het and those in wt mice, suggesting that there was no
impairment in oocyte development or survival in fetal life.
Furthermore, once formed in vivo, the germ cells and oocytes
are perfectly viable, because in our studies, there was an
increase in fertility and fecundity, and almost all ovulations
appear to result in implantation and birth of viable young.
Identification of oocyte-specific mRNAs with putative DAZL
consensus sequences at later stages of oogenesis might help
elucidate the complex signaling pathways that appear to be
modified in DAZL het mice. Our unpublished results after
attempting to use the DAZL monoclonal antibody that was
used for immunohistochemistry failed to identify any products
when used in cross-linking and immunoprecipitation assays
with pools of up to 500 oocytes from D21 ovaries, even though
DDX4 was successfully identified from testis extracts at the
same time, as previously reported [47, 48]. Indeed Western blot
analysis of proteins from pools of D21 oocytes (n ¼ 500) or
D10 ovaries, using the same monoclonal antibody, failed to
OOCYTE DAZL AFFECTS FOLLICLE FSH SENSITIVITY 591
Downloaded from www.biolreprod.org.
identify any protein of the expected size (33 kDa), although
this was identified in extracts from both juvenile and adult wt
testes. Thus, it was not possible to determine if there was a
reduction in DAZL protein levels, even though this would be
highly probable given the reduction in Dazl mRNA levels.
Furthermore, it might be possible that DAZL could form
dimers in the present KO model as, potentially, the RNA-
binding domain may remain present if the protein were
expressed. However, this was shown not to be the case when
the original KO mo del was created as the mRNA was
destabilized and no protein was detectable with a range of
antibodies raised to different parts of the protein [16] (Prof. H.
Cooke, personal communication).
In conclusion, it is suggested that in activated wt follicles,
DAZL represses a specific gene or genes that, through
unknown pathways, regulate the response of the granulosa
cells to FSH. If the degree of repression is reduced, as in the
DAZL het mice, then there is increased expression of this
specific gene(s), allowing increased responsiveness of the
granulosa cells to FSH. Thus, more follicles continue to grow
in the face of declining plasma concentrations of FSH in the
late follicular phase of the cycle, fewer become atretic, and
more eventually ovulate, resulting in increased litter sizes.
ACKNOWLEDGMENTS
We thank Howard Cooke for initially providing the DAZL mice. We
also thank Mark Fisken, Ian Swanston, Nancy Evans, and members of the
imaging facility, especially Mike Miller, for assistance.
REFERENCES
1. Canning J, Takai Y, Tilly JL. Evidence for genetic modifiers of ovarian
follicular endowment and development from studies of five inbred mouse
strains. Endocrinology 2003; 144:9–12.
2. Spearow JL, Barkley M. Genetic control of hormone-induced ovulation
rate in mice. Biol Reprod 1999; 61:851–856.
3. Richards JS. Maturation of ovarian follicles: effects of gonadotropin on
antral and preantral follicles. Physiol Rev 1980; 60:51–89.
4. Moore RK, Erickson GF, Shimasaki S. Are BMP-15 and GDF-9 primary
determinants of ovulation quota in mammals? Trends Endocrinol Metab
2004; 15:356–361.
5. Richards JS. Perspective: the ovarian follicle—a perspective in 2001.
Endocrinology 2001; 142:2184–2193.
6. Craig J, Orisaka M, Wang H, Orisaka S, Thompson W, Zhu C, Kotsuji F,
Tsang BK. Gonadotropin and intra-ovarian signals regulating follicle
development and atresia: the delicate balance between life and death. Front
Biosci 2007; 12:3628–3639.
7. Wallace JM, McNeilly AS, Baird DT. Ovulation rate and embryo survival
in Damline ewes after treatment with bovine follicular fluid in the luteal
phase of the oestrous cycle. J Reprod Fertil 1985; 75:101–109.
8. Picton HM, McNeilly AS. Evidence to support a follicle-stimulating
hormone threshold theory for follicle selection in ewes chronically treated
with gonadotrophin-releasing hormone agonist. J Reprod Fertil 1991;
93:43–51.
9. Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is
required for ovarian follicle maturation but not male infertility. Nat Genet
1997; 15:201–204.
10. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M,
Sassone-Corsi P. Impaired follicle-stimulating hormone (FSH) signaling in
vivo: targeted disruption of the FSH receptor leads to aberrant
gametogenesis and hormonal imbalance. Proc Natl Acad Sci U S A
1998; 95:13612–13617.
11. Abel MH, Wooton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton
HM. The effect of a null mutation in the follicle-stimulating hormone
receptor gene on mouse reproduction. Endocrinology 2000; 141:1795–
1803.
12. Catternach BM, Iddon CA, Charlton HM, Chiappa SA, Fink G.
Gonadotrophin-releasing hormone deficiency in a mutant mouse with
hypogonadism. Nature (Lond) 1977; 269:338–340.
13. Halpin DMG, Charlton HM. Effects of short-term injection of gonado-
trophins on ovarian follicle development in hypogonadal (hpg) mice. J
Reprod Fertil 1988; 82:393–400.
14. Scaramuzzi RJ, Adams NR, Baird DT, Campbell BK, Downing JA,
Findlay JK, Henderson KM, Martin GB, McNatty KP, McNeilly AS,
Tsonis CG. A model for follicle selection and the determination of
ovulation rate in the ewe. Reprod Fertil Dev 1993; 5:459–478.
15. Knight PG and Glister C. Potential local regulatory functions of inhibins,
activins and follistatin in the ovary. Reproduction 2001; 121:503–512.
16. Ruggiu M, Speed R, Taggart M, McKay SJ, Kilanowski F, Saunders P,
Dorin J, Cooke HJ. The mouse Dazla gene encodes a cytoplasmic protein
essential for gametogenesis. Nature 1997; 389:77–79.
17. Saunders PT, Turner JM, Ruggiu M, Taggart M, Burgoyne PS, Elliott D,
Cooke HJ. Absence of mDazl produces a final block on germ cell
development at meiosis. Reproduction 2003; 126:589–597.
18. Lin Y, Page DC. Dazl deficiency leads to embryonic arrest of germ cell
development in XY C57BL/6 mice. Dev Biol 2005; 288:309–316.
19. Lin Y, Gill ME, Koubova J, Page DC. Germ cell-intrinsic and -extrinsic
factors govern meiotic initiation in mouse embryos. Science 2008;
322:1685–1687.
20. Haston KM, Tung JY, Reijo Pera RA. Dazl functions in maintenance of
pluripotency and genetic and epigenetic programs of differentiation in
mouse primordial germ cells in vivo and in vitro. PLoS One 2009;
4:e5654.
21. McNeilly JR, Saunders PTK, Taggart M, Cranfield M, Cooke HJ,
McNeilly AS. Loss of oocytes in Dazl knockout mice results in maintained
ovarian steroidogenic function but altered gonadotropin secretion in adult
animals. Endocrinology 2000; 141:4284–4294.
22. Spears N, Murray AA, Allison V, Boland NI, Gosden RG. Role of
gonadotrophins and ovarian steroids in the development of mouse follicles
in vitro. J Reprod Fertil 1998; 113:19–26.
23. Myers M, Britt KL, Wreford NGM, Ebling FJP, Kerr JB. Methods for
quantifying follicular numbers within the mouse ovary. Reproduction
2004; 127:569–580.
24. Brown P, McNeilly JR, Evans JG, Christian HC, Crawford GM, Walker
M, McNeilly AS. Manipulating the in vivo mRNA expression profile of
FSHb to resemble that of LHb does not promote a concomitant increase in
intracellular storage of follicle-stimulating hormone. J Neuroendocrinol
2001; 13:50–62.
25. McNeilly JR, Brown P, Mullins JJ, Clark AJ, McNeilly AS. Character-
isation of the ovine LHb-subunit gene: the promoter is regulated by GnRH
and gonadal steroids in transgenic mice. J Endocrinol 1996; 151:481–489.
26. Groome NP, Illingworth PJ, O’Brien M, Cooke I, Ganesan TS, Baird DT,
McNeilly AS. Detection of dimeric inhibin throughout the human
menstrual cycle by two-site enzyme immunoassay. Clin Endocrinol
1994; 40:717–723.
27. Groome NP, Illingworth PJ, O’Brien M, Pai R, Rodger FE, Mather JP,
McNeilly AS. Measurement of dimeric inhibin B throughout the human
menstrual cycle. J Clin Endocrinol Metab 1996; 81:1401–1405.
28. Mann GE, Lamming GE. Effects of treatment with buserelin on plasma
concentrations of oestradiol and progesterone and cycle length in the cow.
Br Vet J 1995; 151:427–432.
29. Wallace JM, McNeilly AS. Changes in FSH and the pulsatile secretion of
LH during treatment of ewes with bovine follicular fluid throughout the
luteal phase of the oestrous cycle. J Endocrinol 1986; 111:317–327.
30. Webb R, Baxter G, McBride D, Nordblom GD, Shaw MP. The
measurement of testosterone and oestradiol-17 beta using iodinated tracers
and incorporating an affinity chromatography extraction procedure. J
Steroid Biochem 1985; 23:1043–1051.
31. Turner KJ, Macpherson S, Millar M, McNeilly AS, Williams K, Groome
NP, Sharpe RM, Fraser HM, Saunders PTK. Development and validation
of a new monoclonal antibody to mammalian aromatase. J Endocrinol
2002; 172:21–30.
32. Hirshfield AN, Midgley AR Jr. The role of FSH in the selection of large
ovarian follicles in the rat. Biol Reprod 1978; 19:606–611.
33. Flaws JA, Langenberg P, Babus JK, Horshfield AN, Sharara FI. Ovarian
volume and antral follicle counts as indicators of menopausal status.
Menopause 2001; 8:175–180.
34. Danilovich N, Roy I, Sairam MR. Ovarian pathology and high incidence
of sex cord tumors in follitropin receptor knockout (FORKO) mice.
Endocrinology 2001; 142:3678–3684.
35. Galway AB, Lapoit PS, Tsafriri A, Dargan CM, Boime I, Hsueh AJ.
Recombinant follicle-stimulating hormone induces ovulation and tissue
plasminogen activator expression in hypophysectomized rats. Endocrinol-
ogy 1990; 127:3023–3028.
36. Picton HM, Tsonis CG, McNeilly AS. FSH causes a time-dependent
stimulation of preovulatory follicle growth in the absence of pulsatile LH
secretion in ewes chronically treated with gonadotrophin-releasing
hormone agonist. J Endocrinol 1990; 126:297–307.
37. Souza CJH, Campbell BK, McNeilly AS, Baird DT. Bone morphogenic
592 MCNEILLY ET AL.
Downloaded from www.biolreprod.org.
proteins and folliculogenesis: lessons from the Booroola mutation. Reprod
Suppl 2003; 61:361–370.
38. Richards JS, Russell DL, Ochsner S, Hsieh M, Doyle KH, Falender AE,
Lo YK, Sharma SC. Novel signaling pathways that control ovarian
follicular development, ovulation, and luteinization. Recent Prog Horm
Res 2002; 57:195–220.
39. Sicinski P, Donaher JL, Geng Y, Parker SB, Gardner H, Park MY, Robker
RL, Richards JS, McGinnis LK, Biggers JD, Eppig JJ, Bronson RT, et al.
Cyclin D2 is an FSH-responsive gene involved in gonadal cell
proliferation and oncogenesis. Nature 1996; 384:470–474.
40. Kayampilly PP, Menon KMJ. Follicle-stimulating hormone inhibits
adenosine 5
0
-monophosphate-activated protein kinase activation and
promotes cell proliferation of primary granulosa cells in culture through
an Akt-dependent pathway. Endocrinology 2009; 150:929–935.
41. Brook M, Smith JWS, Gray NK. The Dazl and PABP families: RNA-
binding proteins with interrelated roles in translational control in oocytes.
Reproduction 2009; 137:595–617.
42. Dorfman DM, Genest DR, Rejio Pera RA. Human DAZL1 encodes a
candidate fertility factor in women that localizes to the prenatal and post
natal cells. Hum Reprod 1999; 14:2531–2536.
43. Brekhman V, Itskovitz-Eldor J, Yodko E, Deutsch M, Seligman J. The
DAZL1 gene is expressed in human male and female embryonic gonads
before meiosis. Mol Hum Reprod 2000; 6:465–468.
44. Pan HA, Tsai SJ, Chen CW, Lee YC, Lin YM, Kuo PL. Expression of
DAZL protein in the human corpus luteum. Mol Hum Reprod 2002;
8:540–545.
45. Elvin JA, Yan C, Wang P, Nishimori K, Matzuk MM. Molecular
characterization of the follicle defects in the growth differentiation factor
9-deficient ovary. Mol Endocrinol 1999; 13:1018–1034.
46. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Kumar TJ, Matzuk MM,
Rose UM, de Jong FH, Uilenbroek JT, Grootegoed JA, Themmen AP.
Anti-Mu¨llerian hor mone attenuates the effects of FSH on follicle
development in the mouse ovary. Endocrinology 2001; 142:4891–4899.
47. Reynolds N, Collier B, Maratou K, Bingham V, Speed RM, Taggart M,
Semple CA, Gray NK, Cooke HJ. Dazl binds in vitro to specific transcripts
and can regulate the pre-meiotic translation of Mvh in germ cells. Hum
Mol Genet 2005; 14:3899–3909.
48. Reynolds N, Collier B, Bingham V, Gray NK, Cooke HJ. Translation of
the synaptonemal complex component Sycp3 is enhanced in vitro by the
germ cell specific regulator Dazl. RNA 2007; 13:974–981.
OOCYTE DAZL AFFECTS FOLLICLE FSH SENSITIVITY 593
Downloaded from www.biolreprod.org.
    • "A decrease in Dazl mRNA in HF offspring is thus consistent with an inability of FSH to induce follicle growth and differentiation. Although, it has also been shown that Dazl heterozygous female mice have increased FSH sensitivity [76] suggesting that a lack of DAZL supports FSH induced follicle growth. This implicates DAZL as a regulator of FSH sensitivity; where decreased Dazl in HF offspring is potentially a response that aims to increase FSH sensitivity and rescue growing follicles from atresia. "
    [Show abstract] [Hide abstract] ABSTRACT: Maternal obesity predisposes offspring to metabolic and reproductive dysfunction. We have shown previously that female rat offspring born to mothers fed a high fat (HF) diet throughout pregnancy and lactation enter puberty early and display aberrant reproductive cyclicity. The mechanisms driving this reproductive phenotype are currently unknown thus we investigated whether changes in ovarian function were involved. Wistar rats were mated and randomized to: dams fed a control diet (CON) or dams fed a HF diet from conception until the end of lactation (HF). Ovaries were collected from fetuses at Embryonic Day (E) 20, and neonatal ovaries at Day 4 (P4), prepubertal ovaries at P27 and adult ovaries at P120. In a subset of offspring, the effects of a HF diet fed postweaning were evaluated. The present study shows that fetuses of mothers fed a HF diet had significantly fewer oocytes at E20, and in neonates, have reduced AMH signaling that may facilitate an increased number of assembled primordial follicles. Both prepubertally and in adulthood, ovaries show increased follicular atresia. As adults, offspring have reduced FSH responsiveness, low expression levels of estrogen receptor alpha (Erα), the oocyte-secreted factor, Gdf9, oocyte-specific RNA binding protein, Dazl, and high expression levels of the granulosa-cell derived factor, AMH, in antral follicles. Together, these data suggest that ovarian compromise in offspring born to HF fed mothers may arise from changes already observable in the fetus and neonate and in the long term, associated with increased follicular atresia through adulthood.
    Full-text · Article · Mar 2016
    • "In classic PCOS, the hyperandrogenism and elevated GnRH generally results in an increase in the LH/FSH ratio [44]. In our mice, the elevated FSH may have been responsible for the increased number of recruited, but unovulated follicles as FSH is known to stimulate follicle development [45,46] and protect against follicle atresia [47,48]. FSH is a potent activator of the PI3K/akt signaling pathway [49] and the elevated circulating FSH seen in the CD36 null mice may have contributed to the increased akt phosphorylation observed in the ovaries from these mice. "
    [Show abstract] [Hide abstract] ABSTRACT: Ovarian angiogenesis is a complex process that is regulated by a balance between pro- and anti-angiogenic factors. Physiological processes within the ovary, such as folliculogenesis, ovulation, and luteal formation are dependent upon adequate vascularization and anything that disrupts normal angiogenic processes may result in ovarian dysfunction, and possibly infertility. The objective of this study was to evaluate the role of the thrombospondin-1 (TSP-1) receptor CD36 in mediating ovarian angiogenesis and regulating ovarian function. The role of CD36 was evaluated in granulosa cells in vitro and ovarian morphology and protein expression were determined in wild type and CD36 null mice. In vitro, CD36 inhibition increased granulosa cell proliferation and decreased apoptosis. Granulosa cells in which CD36 was knocked down also exhibited an increase in expression of survival and angiogenic proteins. Ovaries from CD36 null mice were hypervascularized, with increased expression of pro-angiogenic vascular endothelial growth factor (VEGF) and its receptor VEGFR-2. Ovaries from CD36 null mice contained an increase in the numbers of pre-ovulatory follicles and decreased numbers of corpora lutea. CD36 null mice also had fewer number of offspring compared to wild type controls. The results from this study demonstrate that CD36 is integral to the regulation of ovarian angiogenesis by TSP-1 and the expression of these family members may be useful in the control of ovarian vascular disorders.
    Full-text · Article · Mar 2014
    • "Every tenth section of each ovary was H&E stained and examined at ×20 and ×40 magnification under a light microscope. Follicles were counted and classified according to a previously published method, allowing for a realistic estimate of follicle proportions with minimal data manipulation (Hirshfield & Midgley 1978, McNeilly et al. 2011). Only follicles containing a visible oocyte nucleus were included in the count, and these were classified based on their GC morphology. "
    [Show abstract] [Hide abstract] ABSTRACT: We investigated the effects of different windows of testosterone propionate (TP) treatment during foetal and neonatal life in female rats to determine whether and when excess androgen exposure would cause disruption of adult reproductive function. Animals were killed prepubertally at d25 and as adults at d90. Plasma samples were taken for hormone analysis and ovaries serial sectioned for morphometric analyses. In prepubertal animals, only foetal+postnatal and late postnatal TP resulted in increased body weights, and an increase in transitory, but reduced antral follicle numbers without affecting total follicle populations. Treatment with TP during both foetal+postnatal life resulted in the development of streak ovaries with activated follicles containing oocytes that only progressed to a small antral (smA) stage and inactive uteri. TP exposure during foetal or late postnatal life had no effect upon adult reproductive function or the total follicle population, although there was a reduction in the primordial follicle pool. In contrast, TP treatment during full postnatal life (d1-25) resulted in anovulation in adults (d90). These animals were heavier, had a greater ovarian stromal compartment, no differences in follicle thecal cell area, but reduced numbers of anti-Mullerian hormone-positive smA follicles when compared with controls. Significantly reduced uterine weights lead reduced follicle oestradiol production. These results support the concept that androgen programming of adult female reproductive function occurs only during specific time windows in foetal and neonatal life with implications for the development of polycystic ovary syndrome in women.
    Full-text · Article · Jan 2012
Show more