A Role for Thrombospondin-1 Deficits in Astrocyte-Mediated Spine and Synaptic Pathology in Down's Syndrome

Article (PDF Available)inPLoS ONE 5(12):e14200 · December 2010with113 Reads
DOI: 10.1371/journal.pone.0014200 · Source: PubMed
Abstract
Down's syndrome (DS) is the most common genetic cause of mental retardation. Reduced number and aberrant architecture of dendritic spines are common features of DS neuropathology. However, the mechanisms involved in DS spine alterations are not known. In addition to a relevant role in synapse formation and maintenance, astrocytes can regulate spine dynamics by releasing soluble factors or by physical contact with neurons. We have previously shown impaired mitochondrial function in DS astrocytes leading to metabolic alterations in protein processing and secretion. In this study, we investigated whether deficits in astrocyte function contribute to DS spine pathology. Using a human astrocyte/rat hippocampal neuron coculture, we found that DS astrocytes are directly involved in the development of spine malformations and reduced synaptic density. We also show that thrombospondin 1 (TSP-1), an astrocyte-secreted protein, possesses a potent modulatory effect on spine number and morphology, and that both DS brains and DS astrocytes exhibit marked deficits in TSP-1 protein expression. Depletion of TSP-1 from normal astrocytes resulted in dramatic changes in spine morphology, while restoration of TSP-1 levels prevented DS astrocyte-mediated spine and synaptic alterations. Astrocyte cultures derived from TSP-1 KO mice exhibited similar deficits to support spine formation and structure than DS astrocytes. These results indicate that human astrocytes promote spine and synapse formation, identify astrocyte dysfunction as a significant factor of spine and synaptic pathology in the DS brain, and provide a mechanistic rationale for the exploration of TSP-1-based therapies to treat spine and synaptic pathology in DS and other neurological conditions.
A Role for Thrombospondin-1 Deficits in Astrocyte-
Mediated Spine and Synaptic Pathology in Down’s
Syndrome
Octavio Garcia, Maria Torres, Pablo Helguera, Pinar Coskun, Jorge Busciglio*
Department of Neurobiology and Behavior, Institute for Memory Impairments and Neurological Disorders (iMIND), Center for the Neurobiology of Learning and Memory
(CNLM), University of California Irvine, Irvine, California, United States of America
Abstract
Background:
Down’s syndrome (DS) is the most common genetic cause of mental retardation. Reduced number and
aberrant architecture of dendritic spines are common features of DS neuropathology. However, the mechanisms involved in
DS spine alterations are not known. In addition to a relevant role in synapse formation and maintenance, astrocytes can
regulate spine dynamics by releasing soluble factors or by physical contact with neurons. We have previously shown
impaired mitochondrial function in DS astrocytes leading to metabolic alterations in protein processing and secretion. In
this study, we investigated whether deficits in astrocyte function contribute to DS spine pathology.
Methodology/Principal Findings:
Using a human astrocyte/rat hippocampal neuron coculture, we found that DS astrocytes
are directly involved in the development of spine malformations and reduced synaptic density. We also show that
thrombospondin 1 (TSP-1), an astrocyte-secreted protein, possesses a potent modulatory effect on spine number and
morphology, and that both DS brains and DS astrocytes exhibit marked deficits in TSP-1 protein expression. Depletion of
TSP-1 from normal astrocytes resulted in dramatic changes in spine morphology, while restoration of TSP-1 levels prevented
DS astrocyte-mediated spine and synaptic alterations. Astrocyte cultures derived from TSP-1 KO mice exhibited similar
deficits to support spine formation and structure than DS astrocytes.
Conclusions/Significance:
These results indicate that human astrocytes promote spine and synapse formation, identify
astrocyte dysfunction as a significant factor of spine and synaptic pathology in the DS brain, and provide a mechanistic
rationale for the exploration of TSP-1-based therapies to treat spine and synaptic pathology in DS and other neurological
conditions.
Citation: Garcia O, Torres M, Helguera P, Coskun P, Busciglio J (2010) A Role for Thrombospondin-1 Deficits in Astrocyte-Mediated Spine and Synaptic Pathology
in Down’s Syndrome. PLoS ONE 5(12): e14200. doi:10.1371/journal.pone.0014200
Editor: Mel B. Feany, Brigham and Women’s Hospital, Harvard Medical School, United States of America
Received July 2, 2010; Accepted November 15, 2010; Published December 2, 2010
Copyright: ß 2010 Garcia et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants from The Larry L. Hillblom Foundation and the National Institutes of Health (grant no. HD38466, and Alzheimers
Disease Research Center grant no. AG16573). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: jbuscigl@uci.edu
Introduction
Down’s syndrome (DS) or the triplication of chromosome 21
(trisomy 21) is the most common genetic cause of mental
retardation. The cognitive deficits in patients with DS have been
associated with structural changes in the architecture and
alterations in the number of dendritic spines [1]. Morphological
abnormalities such as unusually long spines, shorter spines, and
reduced number of spines have been documented in the cortex of
DS fetuses and newborns [2,3]. Similar alterations were observed
in the hippocampal formation, and additional reductions in spine
number in adult DS patients have been linked to the development
of Alzheimer’s disease (AD) pathology [4,5]. Spine pathology is
also present in the Ts65Dn mouse model of DS, which shows
decreased spine and synaptic density, and aberrant spine
morphology including enlarged spines, irregular spine heads,
and globular spine shapes [6–8]. Since dendritic spines are the
primary sites of excitatory synapses, defects in spine structure and
function can result in synaptic and circuit alterations leading to
cognitive impairment and the progression of AD pathology in DS
patients [9]. Unfortunately, there is little information available on
the cellular and molecular mechanisms involved in DS spine
malformation.
In recent years, a number of studies indicate that astrocytes
regulate the stability, dynamics and maturation of dendritic spines
[10–13]. In addition, astrocytes participate in the regulation of
synaptic plasticity and synaptic transmission [14–18]. Astrocytes
modulate the establishment and maintenance of synaptic contacts
through the release of soluble factors such as cholesterol [19] or
thrombospondins [20], or by direct physical interaction with
neuronal cells [10–13,21]. Our previous research indicates the
presence of mitochondrial dysfunction and energy deficits in DS
astrocytes leading to abnormal amyloid precursor protein (APP)
processing and secretion, and to intracellular accumulation of
amyloid b (Ab) [22]. To investigate the role of astrocytes in DS
spine pathology, we established a coculture system in which rat
PLoS ONE | www.plosone.org 1 December 2010 | Volume 5 | Issue 12 | e14200
hippocampal neurons were plated on top of normal (NL) or DS
astrocyte monolayers. Using this experimental paradigm, we
found abnormal spine development and reduced synaptic density
and activity in neurons growing on top of DS astrocytes, and
identified thrombospondin 1 (TSP-1) as a critical astrocyte-
secreted factor that modulates spine number and morphology.
TSP-1 levels were markedly reduced in DS astrocytes and brain
homogenates, and restoration of TSP-1 levels prevented spine and
synaptic alterations. These results underscore the potential
therapeutic use of TSP-1 to treat spine and synaptic pathology
in DS and other neurodevelopmental or neurodegenerative
conditions.
Results
Rat hippocampal neuron s growing on top of human
astrocytes develop extensive processes and dendritic
spines
Previous reports have established the critical role of astrocytes in
synapse formation [16,17,19–21] and regulation of dendritic
spines [10–13]. However the role of astrocytes in DS spine
pathology has not been investigated. Our previous results indicate
the presence of mitochondrial dysfunction in DS astrocytes leading
to alterations in protein secretion and intracellular Ab accumu-
lation [22]. To establish whether deficits in DS astrocyte function
could be involved in spine pathology, rat hippocampal neurons
were cultured on top of NL or DS astrocyte monolayers
(Figure 1A). Under these conditions, rat hippocampal neurons
survived well for extended periods of time and developed
fast-growing axons and dendrites (Figure 1A). No differences in
neuronal survival were observed between regular rat hippocampal
cultures and rat hippocampal/human astrocyte cocultures (Figure
S1). After 21 DIV, neurons developed numerous spines (Figure 1B)
exhibiting characteristic shapes including stubby-, mushroom-,
thin- and filopodium-like spines [23]. Stubby spines were
especially abundant (Figure 1B). In contrast, human cortical
neurons exhibited poor spine development in culture (data not
shown), precluding their use for this study. Thus, to assess the
capacity of DS astrocytes to sustain spine and synapse formation
we utilized human cortical astrocyte/rat hippocampal neuron
cocultures.
Altered spine number and morphology in hippocampal
neurons growing on top of DS astrocytes
We used immunofluorescence to analyze spine formation in the
cocultures at 21 DIV. For simplicity, we assessed both stubby- and
mushroom-like spines as ‘‘stubby’’, and both thin- and filopodium-
like spines as ‘‘filopodium’’ spines. We found a significant
reduction in the total number of spines in neurons growing on
top of DS astrocytes compared to neurons growing on top of NL
astrocytes (NL: 9.160.5 per 50
mm of dendrite; DS: 7.160.6 per
50
mm of dendrite)(Figure 2A and B), indicating that DS astrocytes
are less efficient than normal astrocytes in supporting dendritic
spine formation. The reduction in spine density affected
specifically stubby spines (NL: 4.660.5 stubby spines per 50
mm
dendrite; DS: 2.160.3 stubby spines per 50
mm dendrite)
(Figure 2C). Conversely, in DS astrocyte/hippocampal neuron
cocultures we observed a significant increase in the number and
Figure 1. Human astrocyte/rat hippocampal neuron cocultures. Cocultures were prepared as described in the Methods section. A) After 21
DIV, the cells were fixed and immunostained with anti-GFAP (1:1000, red) to visualize astrocytes, and anti-b tubulin class III (1:1000, green) to visualize
neurons. Nuclei were counterstained with Hoechst (blue). Note the significant development of neuronal processes in the cocultures. B) Spines
(arrows) present in a typical dendritic segment visualized with anti-drebrin (1:250, red), and anti-b tubulin class III (blue). Scale bars: A: 20
mm upper
panel; 10
mm lower panel. B: 5 mm.
doi:10.1371/journal.pone.0014200.g001
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 2 December 2010 | Volume 5 | Issue 12 | e14200
length of filopodium spines (Figure 2A, D and E), which previous
studies have characterized as immature spines in hippocampal
neurons [24]. Similar alterations in spine number and structure
are present in DS brains [2,3,25], suggesting that astrocyte
dysfunction contributes to spine pathology in DS.
Soluble factors released by astrocytes such as cholesterol or
thrombospondins have been shown to modulate spine formation
and the establishment and maintenance of synaptic contacts
[19,20]. We assessed the effect of astrocyte-released factors on
spine formation. Pure hippocampal cultures grown on polylysine
and maintained with astrocyte conditioned medium (CM)
exhibited somewhat lower spine density than their counterparts
grown on top of astrocyte monolayers, indicating that physical
contact with astrocytes is also relevant for spine formation
(Figure 2B). Hippocampal neurons maintained in DS astrocyte
CM showed a marked reduction in the number of spines
compared to neurons maintained in NL astrocyte CM (NL CM:
6.260.5 spines per 50
mm of dendrite; DS CM: 3.66 0.3 spines
per 50
mm of dendrite)(Figure 2B). Thus, soluble factors are
critically involved in DS astrocyte-mediated spine alterations.
Reduced TSP-1 levels in DS astrocytes and DS brains
TSP-1 is an extracellular matrix protein synthesized and
released by astrocytes [26], which is highly expressed during
development of the nervous system [27]. It promotes neurite
outgrowth and survival [28–30], neuronal migration [31,32] and
synaptogenesis [20]. Recently, it has been demonstrated that TSP-
1 is necessary for synaptic and motor recovery after stroke [33],
suggesting that TSP-1 also participates in neuronal plasticity.
Given that TSP-1 is one of the most abundant proteins secreted by
human astrocytes (data not shown), and that there are marked
deficits in protein secretion in DS astrocytes [22], we next
analyzed TSP-1 expression and secretion in DS astrocyte cultures
and brain homogenates. We found high TSP-1 expression in
human astrocytes and prominent surface localization (Figure 3A-
D). TSP-1 subcellular localization and staining pattern was similar
in normal and DS astrocytes. Quantification of TSP-1 protein
levels by ELISA demonstrated significant reductions in both DS
astrocyte cell lysates and CM (Figure 3E), suggesting that reduced
TSP-1 expression leads to decreased TSP-1 in DS CM. TSP-1
expression was considerably higher in fetal than in adult brain
homogenates (data not shown), consistent with a significant role of
TSP-1 during development [27]. A comparison of TSP-1 protein
expression in fetal brain lysates showed an average reduction of
57.9% in TSP-1 levels in DS brains despite the average age of DS
brain samples being almost 4 weeks younger than the average age
of NL brain samples (Figure 3F). qPCR analysis of mRNA
expression indicated similar mRNA levels in DS brains than in NL
brains for all thrombospondin isoforms (TSP-1, -2, -3 and -
4)(Figure S2), suggesting that a post transcriptional mechanism
underlies the changes observed in TSP-1 in DS brains and
astrocyte cultures.
TSP-1 regulates spine morphology and prevents spine
alterations in neurons grown on top of DS astrocytes
We assessed the effect of TSP-1 on spine development in pure
hippocampal cultures. Recombinant TSP-1 was added to the
culture medium at day 7, and fresh TSP-1 was replenished every 3
days for 14 days. We used a TSP-1 dose of 250 ng/ml because it is
in the range of the difference in the level of TSP-1 in CM between
NL and DS astrocyte cultures (Figure 3E). TSP-1 increased
significantly the number of spines compared to vehicle-treated
cultures (control: 6.560.7 spines per 50
mm dendrite; TSP-1:
9.060.7 spines per 50
mm dendrite)(Figure 4A and B). The effect
of TSP-1 on spine number was similar to the effect of BDNF, a
well known inducer of spine development in hippocampal neurons
[34,35]. Combined treatment of BDNF+TSP-1 had an additive
effect on spine development, suggesting that the two factors act
through non-overlapping, complementary signaling pathways
(Figure 4A and B). A dose-response assay indicated that
concentrations of TSP-1 between 250 ng/ml to 1250 ng/ml
produced a gradual and marked increase in the number of
dendritic spines in pure neuronal cultures (Figure 4C). Thus, TSP-
1 is a strong promoter of spine development.
To determine whether depletion of TSP-1 is sufficient to alter
spine number and morphology, NL astrocyte/hippocampal
neuron cocultures were treated with anti-TSP-1 antibody to
neutralize the endogenous TSP-1 secreted by NL human
astrocytes. At day 7, anti-TSP-1 was added to the cultures and
replenished every 3 days during 14 days. Hippocampal neurons
Figure 2. Spine number and morphology are altered in
hippocampal neurons grown on top of DS astrocytes. A)
Double immunofluorescence with anti-drebrin (red) and anti- b tubulin
class III (green) illustrates typical spine morphologies (arrows) found in
cocultures of neurons with NL and DS astrocytes respectively. The
frequency of filopodium spines is significantly incr eased in DS
cocultures. Scale bar: 5
mm. B) Image analysis indicates a significant
reduction in the total number of spines in neurons grown on top of DS
astrocytes or maintained in DS CM. In particular, this reduction affects
stubby spines (C). Assessment of spine morphology in DS astrocyte
cocultures shows a significant increase in the number (D) (NL 3.760.5;
DS 4.660.2 SEM), and length (E) (NL 4.460.5; DS 7.561 SEM) of
filopodium spines. Spine number represents the average number of
spines scored in a 50
mm dendritic segment. Data were analyzed by
one-way analysis of variance (ANOVA) followed by Fisher’s test. All data
are expressed as mean 6 SEM. *p,0.05.
doi:10.1371/journal.pone.0014200.g002
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 3 December 2010 | Volume 5 | Issue 12 | e14200
treated with anti-TSP-1 exhibited dramatic changes in spine
morphology, including a marked reduction in the density of stubby
spines, and a major increase in the frequency and length of
filopodium spines (Figure 5 and Figure S3). Anti-TSP-1 previously
neutralized with excess TSP-1 and non-immune IgG had no effect
on spine morphology (data not shown). Conversely, addition of
recombinant TSP-1 to hippocampal neurons growing on top of
DS astrocytes exhibited a significant reduction of filopodium
spines (Figure 6A), and a marked increase in the number of stubby
spines (Figure 6B). A similar effect on spines, although of slightly
smaller magnitude, was observed after the addition of BDNF to
the cocultures (data not shown). Heat-inactivated TSP-1 did not
have any effect on spine morphology or number (Figure 6A and
B). These results demonstrate that soluble TSP-1 modulates spine
morphology and that reduced expression of TSP-1 in DS
astrocytes leads to abnormal spine development.
Altered spine morphology in neurons growing on top of
TSP-1 KO astrocytes
To directly address the role of TSP-1 on the regulation of spine
formation, rat hippocampal neurons were grown on top of
astrocyte monolayers derived from wild type (WT) or TSP-1 KO
mice [36]. There were no significant differences in general
morphology, viability, between both cocultures (Figure 7A).
However, neurons growing on top of TSP-1 KO astrocytes
exhibited a striking increase in the number of filopodium spines
and a marked reduction in the number of stubby spines (Figure 7B
and C). Treatment of TSP-1 KO cocultures with recombinant
TSP-1 for 4 days reduced significantly the number of filopodium
spines and increased the number of stubby to similar levels than
WT cocultures (Figure 7C). The effect of TSP-1 was more
pronounced after 7 days of treatment (Figure 7C). The spine
phenotype in TSP-1 KO cocultures is reminiscent to the
alterations observed in DS cocultures, providing direct evidence
for a role of TSP-1 on spine formation.
Synaptic density and the number of functional synapses
are reduced in neurons grown on top of DS astrocytes
We investigated the effect of spine alterations and TSP-1 deficits
on synapse formation and activity in DS cocultures. Synaptic
density was assessed as the frequency of colocalization of the pre-
and post-synaptic markers synaptophysin and PSD95 at 21 DIV
[37–39]. Consistent with the alterations in spine morphology and
density, we found a significant reduction in the number of synaptic
contacts (NL: 12.161.1 synaptophysin/PSD95 colocalized puncta
per 50
mm of dendrite; DS: 5.060.5% synaptophysin/PSD95
colocalized puncta per 50
mm of dendrite)(Figure 8A and B). To
determine the number of synapses specifically localized in spines
(Figure 8C), we measured the frequency of colocalization of
synaptophysin, PSD95 and drebrin, (Figure 8D and Figure S4). Of
the total number of synapses in the culture, represented by
synaptophysin/PSD95 colocalization (Figure 8A and B), more
than 50% were localized at dendritic spines, represented by
synaptophysin/PSD95/drebrin colocalization (Figure 8C and D),
indicating that spines are principal sites of synaptic formation in
the cocultures. The number of synapses localized at spines was also
Figure 3. Reduced TSP-1 levels in DS astrocytes and DS fetal
brain tissue. Human astocytes in culture express abundant TSP-1.A)
Differential interference contrast microscopy (DIC) image of the field
shown in B-D. B) Cell surface TSP-1 IF prior to permeabilization of the
cells (red fluorescence). C) After permeabilization, the preparation was
incubated again with anti-TSP-1 (green fluorescence). Note the strong
perinuclear staining. D) Merged image of the fields shown in B and C.
Nuclei were counterstained with Hoechst (blue). Scale bar: 10
mm. E)
Measurement of TSP-1 levels in homogenates (cellular) and CM
(secreted) indicates significant reductions in DS astrocytes. Homoge-
nates: NL 88.46 11.1 ng/ml, DS 51.516 4.7 ng/ml; CM: NL
564.0654.2 ng/ml, DS 381.9642.0 ng/ml. F) TSP-1 levels were mea-
sured in NL (n = 6) and DS (n = 6) fetal cortical brain samples as
described in the Methods section. Average gestational ages of NL and
DS samples were 22.3 weeks and 18.5 weeks respectively. The
concentration of TSP-1 was markedly reduced in DS brain samples
(average values above of the bars). Data were analyzed by ANOVA
followed by Fisher’s test. Error bars indicate the mean 6 SEM. *p,0.05.
doi:10.1371/journal.pone.0014200.g003
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 4 December 2010 | Volume 5 | Issue 12 | e14200
markedly reduced in DS cocultures (Figure 7D). To study the
presence of functional synapses, we assessed vesicular uptake using
the fluorescent cationic styryl fixable dye AM4-64. Depolarization
induced by 20 mM KCl causes rapid vesicular uptake of A4-64,
Figure 4. TSP-1 modulates spine development. A) Pure rat
hippocampal cultures were incubated with BDNF (10 ng/ml), recombi-
nant TSP-1 (250 ng/ml), or TSP-1+BDNF as described in the Methods
section. Double immunofluorescence shows anti-Drebrin (red) and anti-
b tubulin class III (green) immunostaining. Note abundant spine
development with the treatments. Nuclei were counterstained with
Hoechst (blue). Scale bar: 10
mm. B) TSP-1 and BDNF significantly
enhance total spine number to similar levels. Coincubation with TSP-1+
BDNF produces a higher increase in spine number than either individual
factor. Error bars indicate the mean 6 SEM. *p,0.05 vs Control,
**p,0.05 vs TSP-1 or BDNF. C) Increasing concentrations of TSP-1
induces a gradual increase in spine density in hippocampal neurons.
Error bars indicate the mean 6 SEM. *p,0.05.
doi:10.1371/journal.pone.0014200.g004
Figure 5. Depletion of TSP-1 markedly alters spine morphol-
ogy. Cocultures of rat hippocampal neurons and NL astrocytes were
incubated with a control IgG (A) or anti- TSP-1 (B). The region outlined
by rectangles is shown at higher magnification in the panels below.
Cocultures immunodepleted of TSP-1 exhibit dramatic changes in spine
morphology including a marked increase in long filopodium-like spines
(arrows) compared to control cultures, in which stubby spines
predominate (arrows). Cocultures were fixed and immunofluorescence
was performed with anti-drebrin (red) and anti- b tubulin class III
(green) antibodies. The panels at higher magnification have been
pseudocolored in red (tubulin) and white (drebrin) to facilitate the
visualization of spine morphologies. Nuclei were counterstained with
Hoechst (blue). Scale bars: 10
mm (upper panel), 5 mm (lower panel).
doi:10.1371/journal.pone.0014200.g005
Figure 6. TSP-1 prevents spine alterations in neurons grown on
top of DS astrocytes. Recombinant TSP-1 (250 ng/ml) was added to
DS astrocyte/hippocampal neuron cocultures. TSP-1 induced a signif-
icant reduction in the number of filopodium-like spines (DS: 5.360.5;
DS+TSP-1: 1.260.1)(A), and a marked increase in the number of stubby
spines (DS: 3.560.3; DS+TSP-1: 7.260.5)(B). Heat-inactivated (H.I.) TSP-1
did not have any effect on spines. Data were analyzed by ANOVA
followed by Fisher’s test. Error bars indicate the mean 6 SEM. *p,0.05,
**p,0.05.
doi:10.1371/journal.pone.0014200.g006
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 5 December 2010 | Volume 5 | Issue 12 | e14200
Figure 7. Altered spine morphology in neurons growing on top of TSP-1 KO astrocytes. Rat hippocampal neuron/mouse astrocyte
cocultures were prepared as described in the Methods section. (A) After 21 DIV, the cultures were fixed and immunostained with anti-GFAP (1:1000,
red), an astrocytic marker, and anti-b tubulin class III (1:1000, green), a neuronal marker. Hoechst was used for nuclear staining (blue). Similar neuronal
viability and growth was observed in WT and TSP-1 KO (TSP-1
2/2
) cocultures. Scale bar: 20 mm. (B) Double immunofluorescence with anti-drebrin
(red) and anti- b tubulin class III (green) illustrates the differences in spine morphology in neurons growing on top of WT or TSP-1 astrocytes. Note the
presence of numerous filopodium spines in TSP-1 KO cocultures. Scale bar: 5
mm. (C) Assessment of spine morphology indicates a significant increase
in filopodium spines in TSP-1 KO cocultures (KO) compared to WT cocultures. Conversely, the number of stubby spines is reduced more than 50% in
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 6 December 2010 | Volume 5 | Issue 12 | e14200
allowing the visualization of recycled vesicles [37], which in this
case was used as an indicator of active synapses. Depolarization
induced massive vesicle recycling in both NL and DS cocultures,
indicating the presence of a high number of functional synapses in
the cocultures (Figure 8E). However, there was a significantly
lower density of A4-64-positive vesicles in DS cocultures after
stimulation with KCl (Figure 8F). These findings demonstrate that
the total number of synapses, the number of synapses at spines,
and the number of active synapses are all reduced in DS
cocultures.
TSP-1 increases synaptic density and activity in neurons
grown on top of DS astrocytes
The ability of TSP-1 to modulate spine formation (Figure 4), to
rescue spine defects associated with DS and TSP-1 KO cocultures
(Figure 6 and 7), and its capacity to stimulate synaptogenesis [20],
prompted us to examine the effect of TSP-1 treatment on synapse
formation in neurons growing on top of DS astrocytes. Addition of
250 ng/ml TSP-1 resulted in a major increase in both total
synaptic density (Figure 8B) and in the number of synapses
localized at spines (Figure 8D). Restoration of TSP-1 levels also
increased synaptic activity in DS cocultures as measured by A4-64
uptake (Figure 8E and F).
Antioxidants and mitochondrial cofactors have no effect
on TSP-1 expression and secretory deficits in DS
astrocytes
Protein synthesis and secretory function are highly dependent
on mitochondrial energy production and are particularly vulner-
able to the effects of intracellular oxidative damage. For example,
APP secretory deficits in DS astrocytes are directly linked to
impaired mitochondrial metabolism and abnormal secretory
function [22], and increased apoptosis of DS neurons can be
prevented by antioxidants [40]. To establish whether reduced
expression of TSP-1 in DS astrocytes was associated with oxidative
stress and/or energy deficits in DS cells, we analyzed the effect of
free radical scavengers, antioxidants, and energy substrates on
TSP-1 expression. DS astrocytes were treated with sPBN
(100
mM), trolox (100 mM), resveratrol (100 mM), nicotinamide
(15 mM), nicotinamide adenine dinucleotide (b–NAD, 15 mM),
creatine (5 mM) or glucose (5 mM), and TSP-1 levels were
quantified 24 hr later. None of the compounds tested were able to
modify TSP-1 levels inside the cells or in the CM, suggesting that
neither mitochondrial dysfunction nor oxidative stress are primary
factors mediating TSP-1 deficits in DS astrocytes (Figure S5).
Discussion
Dendritic spine abnormalities have long been recognized as
structural correlates of mental retardation in DS [1,9,41].
However, the origin and mechanisms involved in DS spine
alterations are not known. Here, we show that: 1) DS astrocytes
play a significant role in spine pathology and reduced synaptic
density; 2) both DS brains and DS astrocytes show deficits in TSP-
1 levels and secretion; 3) TSP-1 modulates dendritic spine
development and morphology; and 4) TSP-1 addition reverts
DS astrocyte-mediated spine and synaptic alterations.
Astrocytes are important modulators of neuronal develop-
ment, metabolism, and synaptic activity [15,18,42,43]. Astrocyte
alterations have been linked to diverse neurological conditions
such as epilepsy [44–46], AD [47,48], ischemic injury [49],
amyotrophic lateral sclerosis [50,51], and neurodevelopmental
disorders such as Rett’s syndrome [52,53] and fragile X syndrome
[54]. However, the role of astrocytes in DS has received less
attention. Astrocytes from DS fetal brain tissue and DS mouse
models show increased concentration of intracellular calcium
[55,56], altered sensitivity to oxidative stress [57], deficits in
mitochondrial energy metabolism [22,58] and abnormal APP
transport and secretion [22]. In addition, there is increased S100
and interleukin-1 expression in astrocytes in DS brain cortex
[59,60]. Together, these results indicate the presence of metabolic
alterations in DS astrocytes that can directly affect neuronal
survival and development. Supporting this notion, Nelson and
colleagues demonstrated that NL neurons co-cultured with TS16
mouse astrocytes exhibit reduced cholinergic function, while TS16
neurons co-cultured with WT mouse astrocytes display normal
cholinergic activity [61]. Our data indicate that neurons growing
on top of DS astrocytes exhibit abnormal changes in spine
morphology and density, and a marked reduction in synaptic
density. Hippocampal neurons cocultured on top of DS astrocytes
display a high number and longer filopodium spines, and a
significant reduction in the number of stubby spines (Figure 2),
reminiscent of the spine pathology described in DS infant brains
[2,3,62]. Filopodium spines are expressed early during hippocam-
pal [63–65] and cortical development [66,67]. Although the
function of filopodium spines is unclear, some studies suggest that
they are associated with early stages of synaptic formation
including spinogenesis, synaptogenesis and regulation of dendritic
braching [24,64,68]. At maturity, filopodia disappear in many
neurons and are replaced by stubby spines [69,70]. Astrocytes
control the maturation and dynamics of dendritic spines by
physical contact with neurons [10–13], and can influence synapse
formation through secreted factors such as cholesterol [19],
thrombospondins [20] and TNF-a [71]. Thus, functional or
metabolic alterations in DS astrocytes may affect normal spine
development and plasticity, ultimately leading to abnormal
synapse and circuit formation.
Secretory function is integral for astrocytes neuromodulatory
role. Astrocytes secrete growth factors, extracellular matrix
proteins, proteases, modulators of protease activity, etc [72–74],
which regulate neuronal development and survival [75], neur-
itogenesis [76] and synaptogenesis [19,20,77]. Human astrocytes
synthesize and secrete TSP-1, an extracellular matrix component
involved in cell-cell and cell-matrix communication [26,78], which
is widely expressed in the developing nervous system [27]. In vitro,
human astrocytes expressed high levels of TPS-1, which was
detected intracellularly and at the cell surface (Figure 3A-D). TSP-
1 levels were reduced in both DS astrocyte homogenates and CM,
as well as in DS fetal brains, raising the possibility that in DS, TSP-
1 deficits could affect critical stages of neuronal development such
as neurite outgrowth [28–30,79], neuronal migration [32], or
synaptogenesis [20,80]. Indeed, reduced TSP-1 activity in
cocultures of NL astrocytes is sufficient to dramatically alter spine
morphology (Figure 5) and synapse formation (data not shown) in
hippocampal neurons. Moreover, neurons growing on top of TSP-
1 KO astrocytes developed abnormal spines reminiscent to the
spines in DS astrocyte cocultures. Conversely, addition of TSP-1
prevented the alterations in spine morphology and the reductions
TSP-1 KO cocultures. Continuous treatment with recombinant TSP-1 (250 ng/ml) during 4 days (4D) or 7 days (7D) prior to fixation at day 21 averted
the spine alterations in TSP-1 KO cocultures. Spine number represents the average number of spines scored in a 50
mm dendritic segment. Data were
analyzed by ANOVA followed by Fisher’s test. All data are expressed as mean 6 SEM. *p,0.05.
doi:10.1371/journal.pone.0014200.g007
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 7 December 2010 | Volume 5 | Issue 12 | e14200
in both synaptic density and activity in neurons growing on top of
DS and TSP-1 KO astrocytes. Interestingly, thrombospondin-
deficient mice exhibit deficits in recovery of motor function after
stroke [33], and reduced proliferation and differentiation of
neuronal progenitors [81]. Thrombospondins are expressed in
forebrain of human but not nonhuman primates [82], further
suggesting a role for thrombospondins in synaptic plasticity and
human cognition. Lastly, the loss of thrombospondins also leads to
craniofacial dysmorphism [83], which is a common feature of DS
subjects and DS mouse models [84,85], raising the possibility that
reduced TSP-1 levels may be associated with a number of
developmental anomalies present in DS.
The stimulatory effect of TSP-1 on spine formation was of
similar magnitude to that of BDNF (Figure 4), pointing to a role
for TSP-1 not only in synaptogenesis [20,80], but also in spine
formation. Together, TSP-1 and BDNF potentiated their effect,
suggesting the presence of non-redundant, complementary
pathways for TSP-1 and BDNF action on spines. In this respect,
thrombospondins have been shown to act at multiple levels in
different signaling pathways [86]. TSP-1 can bind and activate
integrin receptors to mediate neurite outgrowth [28], and some
studies suggest that TSP-1 can reorganize the actin cytoskeleton
through stimulation of phosphoinositide 3-kinase (PI3-K) [87].
TSP-1 can also induce changes in cell morphology through
activation of the Src family of kinases, ERK 1/2 or Rac-1 [88]. In
addition, many effects of TSP-1 as inhibitor of angiogenesis and
tumor growth are mediated by nitric oxide [89], p38 MAPK [90],
PI3-K, FAK [91] and the CD36 receptor [92]. Recent studies
show that TSP-1 can interact with the a2d-1 gabapentin receptor
[93], and with neuroligin 1 during synaptogenesis [80]. Ongoing
experiments are directed to establish which signaling pathway(s)
engaged by TSP-1 mediates spine formation and morphology.
Mitochondrial dysfunction and oxidative stress are major factors
contributing to DS altered cellular function and survival [22,40,94-
96]. In DS astrocytes, energy depletion leads to abnormal APP
metabolism and altered APP secretion, both of which can be
prevented by treatment with antioxidants [22]. However, antiox-
idants or mitochondrial cofactors did not revert TSP-1 deficits in
DS astrocytes (Figure S5). One possibility is that mechanism(s)
regulating TSP-1 expression such as activation of purinergic
receptors [97], muscarinic receptors [74], or nitric oxide-mediated
signaling [89,98] could be altered in DS astrocytes. Alternatively,
TSP-1 reduced levels in DS may be linked to the capacity of
gamma interferon (IFN-c) to inhibit both the production and
secretion of thrombospondins without changing mRNA levels [99].
IFN-c levels are elevated in both DS [100,101] and trisomy 16 mice
[102,103]. DS individuals are hypersensitive to IFN-c [104–107]
and exhibit pronounced dysregulation in the levels of IFN-c and
other cytokines [108,109]. These actions of INF-c in DS are likely
to be related to the presence of several IFN receptor genes in
chromosome 21 including IFNGR2, which is one of the subunits of
the IFN-c receptor [110]. Thus, upregulated IFN-c signaling in DS
astrocytes may lead to a downregulation of TSP-1 protein levels.
Furthermore, interferons also inhibit protein glycosylation [111],
which is required for TSP-1 secretion. Experiments in progress are
directed to understand the role of IFN-c signaling in the post-
transcriptional regulation of TSP-1 in DS.
Figure 8. Reduced synaptic density in hippocampal neurons
grown on top of DS astrocytes can be reversed by treatment
with TSP-1. A) Colocalization of post-synaptic marker PSD-95 (1:250,
red) and pre-synaptic marker synaptophysin (1:250, green)(arrows) was
utilized to define synaptic contacts and to assess synaptic density.
Neuronal processes were stained with tubulin class III (blue). B) Synaptic
density was expressed as the number of colocalized puncta per 50
mm
of dendrite in NL, DS and DS treated with 250 ng/ml TSP-1 cocultures.
Error bars indicate the mean 6 SEM. *p,0.05 vs cocultures of NL
astrocytes, **p,0.05 vs cocultures of DS astrocytes. C) The colocaliza-
tion of synaptophysin, drebrin and tubulin class III denotes the
presence of synapses at spines (arrows). D) The number of synapses
localized at spines was assessed by quantifying the triple colocalization
of synaptophysin, PSD95 and drebrin (arrows). Error bars indicate the
mean 6 SEM. *p,0.05. E) The fluorescent cationic styryl fixable dye
AM4-64, which is taken up during vesicle recycling, was used to study
synaptic activity in the cocultures. AM4-64 fluorescence is shown in
living NL cultures after depolarization induced by treatment with KCl
(upper panel). DS cocultures present a marked decrease in AM4-64-
positive vesicles after stimulation with KCl (middle panel). Treatment
with TSP-1 increases synaptic activity in DS cocultures (lower panel). F)
Quantification of AM4-64-positive puncta shows a significant reduction
in DS compared to NL cocultures, which can be reverted by TSP-1
treatment. Data were analyzed by ANOVA followed by Fisher’s test. All
data are expressed as mean 6 SEM. *p,0.05. Scale bars: 5
mm.
doi:10.1371/journal.pone.0014200.g008
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 8 December 2010 | Volume 5 | Issue 12 | e14200
In summary, we found metabolic alterations in DS astrocytes
that cause spine pathology and reduced synaptic density in
cocultured neurons. Spine and synaptic alterations were associated
with reduced expression of TSP-1, which was also significantly
reduced in DS brains. Finally, the identification of a novel role for
TSP-1 as a strong modulator of dendritic spine development and
morphology supports the exploration of TSP-1 and downstream
signaling partners as therapeutic targets to treat spine pathology
and cognitive impairment in DS and other neurological
conditions.
Methods
Ethics Statement
This study is part of an ongoing research protocol approved by
the Health and Hospital Corporation of the City of New York, the
Albert Einstein College of Medicine Committee on Clinical
Investigation and the Internal Review Board of the University of
California-Irvine. The protocols for obtaining post-mortem fetal
brain tissue comply with all federal and institutional guidelines
with special respect for the confidentiality of the donor’s identity.
Written informed consent was obtained from all tissue donors.
All procedures for the generation of rat hippocampal neuronal
suspensions were reviewed and approved by the Institutional Care
and Use Committee (IACUC) at the University of California
Irvine, protocol number 2008-2779.
Cell Culture
Astrocyte cultures were established from postmortem NL and
DS human fetal brain tissue samples as described [22]. Normal
and DS fetal human brain samples are procured at the Human
Fetal Tissue Repository, Albert Einstein School of Medicine
(AECOM), NY, and received and processed in the Busciglio
laboratory at UCI. Cortical tissue samples were dissociated into a
single-cell suspension by incubation with 0.25% trypsin/40
mg/ml
DNAse (Sigma, St Louis, MO) in PBS at 37uC for 30 min, and
mechanically dissociated with a fire-polished glass Pasteur pipette.
Cells were plated on the bottom of tissue culture dishes or on glass
coverslips, and maintained in DMEM (Invitrogen, Grand Island,
NY) supplemented with 10% fetal bovine serum (HyClone, Road
Logan, UT). After growing to confluence, cells were subjected to
two passages to generate pure astrocytic cultures. The identity and
purity of the astrocyte cultures was confirmed by immunocyto-
chemistry with anti-GFAP and anti-S100 antibodies. To generate
the cocultures, hippocampi were dissected from rat newborn pups,
incubated with trypsin, and triturated through a glass Pasteur
pipette as described by Kaech and Banker [112]. The neurons
were plated on top of NL or DS astrocyte monolayers at
100,000 cells/mm
2
. Two hr after neuronal plating, the medium
was changed to Neurobasal plus N2 and B27 supplements
(Invitrogen, Grand Island, NY). Partial medium changes were
performed every 5 days. Cultures were maintained for 21 days to
allow for the development and maturation of dendritic spines.
Under these conditions, there is minimal growth of rat astrocytes
in the coculture (Figure S6). Pure hippocampal cultures were
maintained in NL or DS astrocyte conditioned medium (CM)
obtained from astrocyte cultures. For pure hippocampal cultures,
the neurons were plated on coverslips pretreated with 1 mg/ml
poly-L-lysine immediately after dissociation (Sigma, St Louis,
MO). Two hr after plating, the medium was switched to NL or DS
CM. Partial medium changes with fresh CM were performed
every 3 days. For some experiments, astrocyte monloayers were
generated from the cortex of WT and TSP-1 KO [36] newborn
pups following the procedures described above.
Immunofluorescence and image analysis
Cultures were fixed with 4% paraformaldehyde/0.12 M
sucrose/PBS for 15 min at 37uC, permeabilized 15 min with
0.2% Triton X-100/PBS, and blocked for 30 min in 5% bovine
serum albumin/PBS. Then, the cultures were incubated with one
or more of the following primary antibodies: mouse anti-drebrin, a
marker of dendritic spines (1:250, Stressegen, Ann Arbor, MI),
GFAP (1:1000, Sigma, St Louis, MO), anti-b-tubulin isotype III
(1:1000, Sigma, St Louis, MO), mouse anti-thrombospondin-1
(1:250 Calbiochem, La Jolla, CA), anti-synaptophysin (1:250,
Calbiochem, Gibbstown, NJ), anti-PSD95 (1:250, Abcam, Cam-
bridge, MA), and anti S-100b (1:500, R&D systems, Minneapolis,
MN), for 1 hr at RT, followed by a 30 min incubation in
fluorescent-conjugated secondary antibody (1:500, Alexa 350,
Alexa 488 and Alexa 594, Invitrogen, Eugene, OR). An Axiovert
200 inverted microscope (Zeiss, Jena, Germany) was used for
examination, imaging and quantification of various parameters of
spine morphology. Images were captured with a digital camera
and processed using AxioVision software (Zeiss). When required,
Z-stacks were captured at 500 nm intervals, processed and
rendered using the Apotome imaging system (Zeiss). Spine-like
protrusions were classified according to Hering and Sheng [23].
For spine assessment, dendritic spines were defined as protrusions
from the surface of dendritic processes exhibiting a high
concentration of drebrin [113,114]. Morphologically, we identified
2 populations of spines: stubby-/mushroom-like spines, short,
small and rounded spines with or without a short neck, and
filopodium-like spines, which are typically longer, thin and lack a
head. For quantification, 10 neurons per culture were selected
from 3–6 separate cultures. Density and morphology of spines
were scored in dendritic segments approximately 50
mm away
from the cell body. Spine length was measured using the
measurement tool of AxioVision. Spine length was defined as
the distance from the base of the neck to the tip of the spine. To
assess synaptic density, the colocalization of pre- and post-synaptic
markers was performed as described [37–39].
TSP-1 measurements
TSP-1 levels were determined in astrocyte cultures and fetal
brain homogenates. Astrocytes were plated in 24-well plates.
Cultures were washed in ice-cold PBS and collected in Eppendorf
tubes in 0.1 M NaOH. The lysates were centrifuged at
14,000 rpm in an Eppendorf microcentrifuge for 30 min at 4uC,
and the supernatants were used to determine the intracellular
concentration of TSP-1. Aliquots of CM from the same cultures
were processed to determine the level of secreted TSP-1. Samples
of fetal cortex were homogenized in RIPA buffer plus protease
inhibitors (Complete, Roche, Mannheim, Germany) with a
Turrax homogenizer (Ika Works, Wilmington, NC), and centri-
fuged at 14,000 rpm for 30 min at 4uC. TSP-1 levels in the
supernatant fraction were determined using a commercial ELISA
kit following the vendor’s instructions (R&D systems, Minneapolis,
MN). For some experiments, the following compounds (purchased
from Sigma, St Louis, MO) were added to pure astrocyte cultures,
and TSP-1 levels were determined after 24 hr: s-PBN (100 mM),
Trolox (100
mM), resveratrol (100 mM), nicotinamide (15 mM),
nicotinamide adenine dinucleotide (b–NAD, 15 mM), creatine
(5 mM) and glucose (5 mM).
TSP-1 treatments
Cocultures were plated in 24-well plates and human recombi-
nant TSP-1 (R&D system Minneapolis, MN) was added every 3
days at the indicated concentrations. Control cultures were
incubated with heat-inactivated TSP-1 (100uC for 5 min).
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 9 December 2010 | Volume 5 | Issue 12 | e14200
Cocultures were fixed at 21 DIV and analysis of spines was
performed as described above. For some experiments, pure
hippocampal cultures were treated with TSP-1 (250 ng/ml),
BDNF (10 ng/ml, PeproTech Inc, Rocky Hill, NJ) or with TSP-
1+BDNF.
Depletion of TSP-1
Cocultures were plated in 24-well plates. Starting at day 7, anti-
TSP-1 (1:1000 Calbiochem, Gibbstown, NJ) was added to the
cultures, and fresh anti-TSP-1 was replenished with partial
medium changes every 3 days. Control cultures were treated with
anti-TSP-1 previously neutralized with an excess of recombinant
human TSP-1 or with non-immune rabbit serum. Cocultures were
fixed at 21 DIV to assess spine density and morphology.
Assessment of vesicle recycling
To assess activity-dependent vesicle recycling, the cultures were
incubated with the fixable fluorescent probe AM4-64 (Biotium Inc,
Hayward, CA) for 5 min with or without 20 mM KCl [37]. AM4-
64 fluorescent density was quantified using Axiovision.
Statistical analysis
All experiments were repeated three to six times using cultures
derived from different brain specimens. Each individual experi-
ment was performed at least in in triplicate samples. Data were
analyzed by one-way analysis of variance (ANOVA) followed by
Fisher’s test. Results were expressed as the mean 6 SEM.
Significance was assessed at p,0.05. All results shown correspond
to individual representative experiments.
Supporting Information
Figure S1 Similar viability in neurons growing on top of normal
or DS astrocytes and pure rat hippocampal cultures. Hippocampi
from rat newborn pups were processed as described (Kaech and
Banker, 2006). Rat hippocampal cultures were plated on coverslips
precoated with poly-L-lysine. To generate cocultures, the neurons
were plated on top of NL or DS astrocyte monolayers. All cultures
were fixed after 21 days. Cell viability was evaluated by direct
examination of neuronal morphology by a blinded operator.
Neurons were visualized after immunofluorescence with anti-beta
tubulin class III. Nuclei were counterstained with Hoechst.
Neurons with round or oval nuclei showing light blue fluorescence
and intact neuronal morphology were considered viable. Cells
exhibiting condensed or fragmented nuclei and/or disrupted
neuronal processes were considered dead. Fluorescent images were
captured at 630X final magnification. Five fields per coverslip
from 3-6 independent experiments were randomly selected for
scoring of live or dead neurons. Error bars indicate the mean 6
SEM. *p,0.05.
Found at: doi:10.1371/journal.pone.0014200.s001 (0.68 MB TIF)
Figure S2 Similar TSP-1, -2, -3 and -4 mRNA levels in normal
and DS fetal brains. TSP-1, -2, -3 and -4 mRNA levels were
quantified in four 18-23 week old DS fetal brains and five age-
matched controls. Quantitative real-time PCR was performed
with a LightCycler 480 Real-Time PCR System utilizing Light-
Cycler 480 SYBR Green I Master from Roche Applied
Biosciences. The expression levels were normalized using 3
housekeeping genes (HKGs), Glucose 6 Phospahate Dehydroge-
nase (G6DH), b-Actin (Actb), and TATA binding protein (TBP).
None of the housekeeping genes were found differentially
expressed between control and DS fetal brains. The graph
summarizes the fold differences of each thrombospondin isoform
in DS brains compared to normal brains. Each sample was run in
triplicates. The primer pairs for each gene from 5- to 3-primus end
are as follows: TSP1: GCTGCACTGAGTGTCACTGTC and
TCAGGAACTGTGGCATTGG; TSP2: GTGCAGGAGCGT-
CAGATGT, and GGGTTGGATAAACAGCCATC; TSP3: AA-
TCTCCAGTATCGATGCAATG, and GTGGCCTCC TCC
TCA CAC; TSP4: CTACCGCTGTTCCTACAGC, and GAG-
CCTTCATAAAATCGTACCC; G6DH: GAGCCAGATGCA-
CTTCGTG and GGGCTTCTCCAGCTCAATC; Actb: CAA-
CCGCGAGAAGATGAC and GTCCATCACGATGCCAGT;
TBP: TGAATCTTGGTTGTAAACTTGACC and CTCAT-
GATTACCGCAGCAAA. The thermal cycle protocol consisted
of an initial heat denaturation at 95uC for 5 min, followed by 45
cycles each of denaturation at 95uC for 10 sec, annealing at 60uC
for 10 sec, and an extension at 72uC for 10 sec for all primer sets.
The bars represent SD.
Found at: doi:10.1371/journal.pone.0014200.s002 (0.76 MB TIF)
Figure S3 Increased number of filopodium spines after TSP-1
immunodepletion in neurons grown on top of normal astrocytes.
The histogram shows the number of filopodium spines per 50
mm
of dendrite in control cocultures and cocultures treated with anti-
TSP-1 antibody. At day 7, anti-TSP-1 was added to the culture
medium and replenished every 3 days during 14 days. The
cultures were fixed at day 21, and the number and type of spines
was quantified as described in the Methods section. Hippocampal
neurons treated with anti-TSP-1 exhibited a significant increase in
the frequency and length of filopodium spines. Data were analyzed
by ANOVA followed by Fisher’s test. Results are expressed as the
mean 6 SEM. *p,0.05. The experiment was repeated using 3
different cocultures in triplicate or cuadruplicate samples. The
graph corresponds to an individual representative experiment.
Found at: doi:10.1371/journal.pone.0014200.s003 (0.66 MB TIF)
Figure S4 Colocalization of synaptic and spine markers. Single
channel images of triple immunofluorescence showing drebrin
(spine marker), PSD95 (post-synaptic marker) and synapthophysin
(pre-synaptic marker). The merged image is shown in Figure 7D.
Found at: doi:10.1371/journal.pone.0014200.s004 (0.64 MB TIF)
Figure S5 Antioxidants and mitochondrial cofactors have no
effect on TSP-1 expression and secretion in DS astrocytes.
Astrocyte cultures were treated with the designated compounds
as described in the Methods section. TSP-1 levels were quantified
by ELISA in soluble fractions and cellular homogenates. Sodium
4-[(tert-butylimino) methyl]benzene-3-sulfonate N-oxide (s-PBN,
100 mM); trolox (100
mM); resveratrol (Resv, 100 mM); nicotin-
amide (Nico, 15 mM); nicotinamide adenine dinucleotide (NAD,
15 mM); creatine (cre, 5 mM); glucose (Gluco, 5 mM). Data were
analyzed by ANOVA followed by Fisher’s test. The results are
expressed as the mean 6 SEM. Values represent the mean from 6
independent experiments. *p,0.05 vs cocultures of NL astrocytes.
Found at: doi:10.1371/journal.pone.0014200.s005 (3.26 MB TIF)
Figure S6 Quantification of rat astrocytes in rat hippocampal
neuron/human astrocyte cocultures. Hippocampal cell suspen-
sions were incubated for 1 hr with fluorescent microspheres (PS-
Speck, Invitrogen, Carlsbad, CA), which are rapidly taken up by
viable cells. The microspheres remain in the cytoplasm and do not
affect cell function or survival. Then, hippocampal suspensions
were plated on top of human astrocyte monolayers, cultured for 21
days, fixed, counterstained with Hoechst, and processed for image
analysis. A) DIC and fluorescence image of a microscopic field in
which fluorescent microspheres are apparent in one cell (arrow,
putative rat astrocyte) and absent in the other three cells in the
field (putative human astrocytes). Nuclei were stained with
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 10 December 2010 | Volume 5 | Issue 12 | e14200
Hoechst. Scale bar: 10 mm. B) Total number of astrocytes in the
culture was assessed by scoring astrocyte nuclei, which are easily
distinguishable because of their size (3 to 5 times larger than
neuronal nuclei). The number of rat astrocytes was assessed by
counting astrocyte cells containing fluorescent microspheres in the
cytoplasm. Rat astrocytes represented approximately 18% of the
total number of astrocytes in the coculture. Data were analyzed by
ANOVA followed by Fisher’s test. *p,0.05.
Found at: doi:10.1371/journal.pone.0014200.s006 (2.48 MB TIF)
Acknowledgments
We thank Michael Hanna for his expert assistance with tissue culture
procedures.
Author Contributions
Conceived and designed the experiments: OG JB. Performed the
experiments: OG MT PH PC. Analyzed the data: OG MT PH PC JB.
Wrote the paper: OG JB.
References
1. Benavides-Piccione R, Ballesteros-Yanez I, de Lagran MM, Elston G, Estivill X,
et al. (2004) On dendrites in Down syndrome and DS murine models: a spiny
way to learn. Prog Neurobiol 74: 111–126.
2. Marin-Padilla M (1972) Structural abnormalities of the cerebral cortex in
human chromosomal aberrations: a Golgi study. Brain Res 44: 625–629.
3. Marin-Padilla M (1976) Pyramidal cell abnormalities in the motor cortex of a
child with Down’s syndrome. A Golgi study. J Comp Neurol 167: 63–81.
4. Ferrer I, Gullotta F (1990) Down’s syndrome and Alzheimer’s disease: dendritic
spine counts in the hippocampus. Acta Neuropathol 79: 680–685.
5. Suetsugu M, Mehraein P (1980) Spine distribution along the apical dendrites of
the pyramidal neurons in Down’s syndrome. A quantitative Golgi study. Acta
Neuropathol 50: 207–210.
6. Belichenko PV, Kleschevnikov AM, Salehi A, Epstein CJ, Mobley WC (2007)
Synaptic and cognitive abnormalities in mouse models of Down syndrome:
exploring genotype-phenotype relationships. J Comp Neurol 504: 329–345.
7. Belichenko PV, Masliah E, Kleschevnikov AM, Villar AJ, Epstein CJ, et al.
(2004) Synaptic structural abnormalities in the Ts65Dn mouse model of Down
Syndrome. J Comp Neur ol 480: 281–298.
8. Kurt MA, Kafa MI, Dierssen M, Davies DC (2004) Deficits of neuronal density
in CA1 and synaptic density in the dentate gyrus, CA3 and CA1, in a mouse
model of Down syndrome. Brain Res 1022: 101–109.
9. Dierssen M, Ramakers GJ (2006) Dendritic pathology in mental retardation:
from molecular genetics to neurobiology. Genes Brain Behav 5(Suppl 2):
48–60.
10. Haber M, Zhou L, Murai KK (2006) Cooperative astrocyte and dendritic spine
dynamics at hippocampal excitatory synapses. Journal of Neuroscience 26:
8881–8891.
11. Murai KK, Nguyen LN, Irie F, Yamaguchi Y, Pasquale EB (2003) Control of
hippocampal dendritic spine morphology through ephrin-A3/EphA4 signaling.
Nature Neuroscience 6: 153–160.
12. Nishida H, Okabe S (2007) Direct astrocytic contacts regulate local maturation
of dendritic spines. J Neurosci 27: 331–340.
13. Ventura R, Harris KM (1999) Three-dimensional relationships between
hippocampal synapses and astrocytes. Journal of Neuroscience 19: 6897–6906.
14. Halassa MM, Fellin T, Takano H, Dong JH, Haydon PG (2007) Synaptic
islands defined by the territory of a single astrocyte. J Neurosci 27: 6473–6477.
15. Haydon PG (2001) GLIA: listening and talking to the synapse. Nat Rev
Neurosci 2: 185–193.
16. Pfrieger FW, Barres BA (1997) Synaptic efficacy enhanced by glial cells in vitro.
Science 277: 1684–1687.
17. Ullian EM, Sapperstein SK, Christopherson KS, Barres BA (2001) Control of
synapse number by glia. Science 291: 657–661.
18. Volterra A, Meldolesi J (2005) Astrocytes, from brain glue to communication
elements: the revolution continues. Nat Rev Neurosci 6: 626–640.
19. Mauch DH, Nagler K, Schumacher S, Goritz C, Muller EC, et al. (2001) CNS
synaptogenesis promoted by glia-derived cholesterol. Science 294: 1354–1357.
20. Christopherson KS, Ullian EM, Stokes CC, Mullowney CE, Hell JW, et al.
(2005) Thrombospondins are astrocyte-secreted proteins that promote CNS
synaptogenesis. Cell 120: 421–433.
21. Hama H, Hara C, Yamaguchi K, Miyawaki A (2004) PKC signaling mediates
global enhancement of excitatory synaptogenesis in neurons triggered by local
contact with astrocytes. Neuron 41: 405–415.
22. Busciglio J, Pelsman A, Wong C, Pigino G, Yuan M, et al. (2002) Altered
metabolism of the amyloid beta precursor protein is associated with
mitochondrial dysfunction in Down’s syndrome. Neuron 33: 677–688.
23. Hering H, Sheng M (2001) Dendritic spines: structure, dynamics and
regulation. Nat Rev Neurosci 2: 880–888.
24. Ziv NE, Smith SJ (1996) Evidence for a role of dendritic filopodia in
synaptogenesis and spine formation. Neuron 17: 91–102.
25. Fiala JC, Spacek J, Harris KM (2002) Dendritic spine pathology: cause or
consequence of neurological disorders? Brain Res Brain Res Rev 39: 29–54.
26. Asch AS, Leung LL, Shapiro J, Nachman RL (1986) Human brain glial cells
synthesize thrombospondin. Proc Natl Acad Sci U S A 83: 2904–2908.
27. Adams JC, Tucker RP (2000) The thrombospondin type 1 repeat (TSR)
superfamily: diverse proteins with related roles in neuronal development. Dev
Dyn 218: 280–299.
28. DeFreitas MF, Yoshida CK, Frazier WA, Mendrick DL, Kypta RM, et al.
(1995) Identification of integrin alpha 3 beta 1 as a neuronal thrombospondin
receptor mediating neurite outgrowth. Neuron 15: 333–343.
29. O’Shea KS, Liu LH, Dixit VM (1991) Thrombospondin and a 140 kd
fragment promote adhesion and neurite outgrowth from embryonic central and
peripheral neurons and from PC12 cells. Neuron 7: 231–237.
30. Yu K, Ge J, Summers JB, Li F, Liu X, et al. (2008) TSP-1 secreted by bone
marrow stromal cells contributes to retinal ganglion cell neurite outgrowth and
survival. PLoS One 3: e2470.
31. Blake SM, Strasser V, Andrade N, Duit S, Hofbauer R, et al. (2008)
Thrombospondin-1 binds to ApoER2 and VLDL receptor and functions in
postnatal neuronal migration. EMBO J 27: 3069–3080.
32. O’Shea KS, Rheinheimer JS, Dixit VM (1990) Deposition and role of
thrombospondin in the histogenesis of the cerebellar cortex. J Cell Biol 110:
1275–1283.
33. Liauw J, Hoang S, Choi M, Eroglu C, Sun GH, et al. (2008) Thrombospondins
1 and 2 are necessary for synaptic plasticity and functional recovery after
stroke. J Cereb Blood Flow Metab 28: 1722–1732.
34. Chapleau CA, Carlo ME, Larimore JL, Pozzo-Miller L (2008) The actions of
BDNF on dendritic spine density and morphology in organotypic slice cultures
depend on the presence of serum in culture media. J Neurosci Methods 169:
182–190.
35. Gu J, Firestein BL, Zheng JQ (2008) Microtubules in dendritic spine
development. J Neurosci 28: 12120–12124.
36. Lawler J, Sunday M, Thibert V, Duquette M, George EL, et al. (1998)
Thrombospondin-1 is required for normal murine pulmonary homeostasis and
its absence causes pneumonia. J Clin Invest 101: 982–992.
37. Deshpande A, Kawai H, Metherate R, Glabe CG, Busciglio J (2009) A role for
synaptic zinc in activity-dependent Abeta oligomer formation and accumula-
tion at excitatory synapses. J Neurosci 29: 4004–4015.
38. Deshpande A, Mina E, Glabe C, Busciglio J (2006) Different conformations of
amyloid beta induce neurotoxicity by distinct mechanisms in human cortical
neurons. J Neurosci 26: 6011–6018.
39. Deshpande A, Win KM, Busciglio J (2008) Tau isoform expression and
regulation in human cortical neurons . FASEB J 22: 2357–2367.
40. Busciglio J, Yankner BA (1995) Apoptosis and increased generation of reactive
oxygen species in Down’s syndrome neurons in vitro. Nature 378: 776–779.
41. Kaufmann WE, Moser HW (2000) Dendritic anomalies in disorders associated
with mental retardation. Cereb Cortex 10: 981–991.
42. Lovatt D, Sonnewald U, Waagepetersen HS, Schousboe A, He W, et al. (2007)
The transcriptome and metabolic gene signature of protoplasmic astrocytes in
the adult murine cortex. J Neurosci 27: 12255–12266.
43. Mori T, Buffo A, Gotz M (2005) The novel roles of glial cells revisited: the
contribution of radial glia and astrocytes to neurogenesis. Curr Top Dev Biol
69: 67–99.
44. Oberheim NA, Tian GF, Han X, Peng W, Takano T, et al. (2008) Loss of
astrocytic dom ain organization in the epileptic brain. J Neurosc i 28:
3264–3276.
45. Tian GF, Azmi H, Takano T, Xu Q, Peng W, et al. (2005) An astrocytic basis
of epilepsy. Nat Med 11: 973–981.
46. Wetherington J, Serrano G, Dingledine R (2008) Astrocytes in the epileptic
brain. Neuron 58: 168–178.
47. Nagele RG, D’Andrea MR, Lee H, Venkataraman V, Wang HY (2003)
Astrocytes accumulate A beta 42 and give rise to astrocytic amyloid plaques in
Alzheimer disease brains. Brain Res 971: 197–209.
48. Nagele RG, Wegiel J, Venka taraman V, Imaki H, Wang KC (2004)
Contribution of glial c ells to the development of amyloid plaques in
Alzheimer’s disease. Neurobiol Aging 25: 663–674.
49. Takano T, Oberheim N, Cotrina ML, Nedergaard M (2009) Astrocytes and
ischemic injury. Stroke 40: S8–12.
50. Nagai M, Re DB, Nagata T, Chalazonitis A, Jessell TM, et al. (2007) Astrocytes
expressing ALS-linked mutated SOD1 release factors selectively toxic to motor
neurons. Nat Neurosci 10: 615–622.
51. Yamanaka K, Chun SJ, Boillee S, Fujimori-Tonou N, Yamashita H, et al.
(2008) Astrocytes as determinants of disease progression in inherited
amyotrophic lateral sclerosis. Nature Neuroscience 11: 251–253.
52. Ballas N, Lioy DT, Grunseich C, Mandel G (2009) Non-cell autonomous
influence of MeCP2-deficient glia on neuronal dendritic morphology. Nat
Neurosci 12: 311–317.
53. Maezawa I, Swanberg S, Harvey D, LaSalle JM, Jin LW (2009) Rett syndrome
astrocytes are abnormal and spread MeCP2 deficiency through gap junctions.
J Neurosci 29: 5051–5061.
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 11 December 2010 | Volume 5 | Issue 12 | e14200
54. Jacobs S, Doering LC Astrocytes prevent abnormal neuronal development in
the fragile x mouse. J Neurosci 30: 4508–4514.
55. Bambrick LL, Golovina VA, Blaustein MP, Yarowsky PJ, Krueger BK (1997)
Abnormal calcium homeostasis in astrocytes from the trisomy 16 mouse. Glia
19: 352–358.
56. Bambrick LL, Yarowsky PJ, Krueger BK (2003) Altered astrocyte calcium
homeostasis and proliferation in theTs65Dn mouse, a model of Down
syndrome. J Neurosci Res 73: 89–94.
57. Sebastia J, Cristofol R, Pertusa M, Vilchez D, Toran N, et al. (2004) Down’s
syndrome astrocytes have greater antioxidant capacity than euploid astrocytes.
European Journal of Neuroscience 20: 2355–2366.
58. Shukkur EA, Shimohata A, Akagi T, Yu W, Yamaguchi M, et al. (2006)
Mitochondrial dysfunction and tau hyperphosphorylation in Ts1Cje, a mouse
model for Down syndrome. Hum Mol Genet 15: 2752–2762.
59. Griffin WS, Stanley LC, Ling C, White L, MacLeod V, et al. (1989) Brain
interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and
Alzheimer disease. Proc Natl Acad Sci U S A 86: 7611–7615.
60. Jorgensen OS, Brooksbank BW, Balaz s R (1990) Neuronal plasticity and
astrocytic reaction in Down syndrome and Alzheimer disease. J Neurol S ci 98:
63–79.
61. Nelson PG, Fitzgerald S, Rapoport SI, Neale EA, Galdzicki Z, et al. (1997)
Cerebral cortical astroglia from the trisomy 16 mouse, a model for down
syndrome, produce neuronal cholinergic deficits in cell culture. Proc Natl Acad
Sci U S A 94: 12644–12648.
62. Takashima S, Iida K, Mito T, Arima M (1994) Dendritic and histochemical
development and ageing in patients with Down’s syndrome. J Intellect Disabil
Res 38(Pt 3): 265–273.
63. Dailey ME, Smith SJ (1996) The dynamics of dendritic structure in developing
hippocampal slices. J Neurosci 16: 2983–2994.
64. Fiala JC, Feinberg M, Popov V, Harris KM (1998) Synaptogenesis via
dendritic filopodia in developing hippocampal area CA1. J Neurosci 18:
8900–8911.
65. Papa M, Bundman MC, Greenberger V, Segal M (1995) Morphological
analysis of dendritic spine development in primary cultures of hippocampal
neurons. J Neurosci 15: 1–11.
66. Holtmaat AJ, Trachtenberg JT, Wilbrecht L, Shepherd GM, Zhang X, et al.
(2005) Transient and persistent dendritic spines in the neocortex in vivo.
Neuron 45: 279–291.
67. Zuo Y, Lin A, Chang P, Gan WB (2005) Development of long-term dendritic
spine stability in diverse regions of cerebral cortex. Neuron 46: 181–189.
68. Marrs GS, Green SH, Dailey ME (2001) Rapid formation and remodeling of
postsynaptic densities in developing dendrites. Nat Neurosci 4: 1006–1013.
69. Harris KM (1999) Structure, development, and plasticity of dendritic spines.
Curr Opin Neurobiol 9: 343–348.
70. Wong WT, Wong RO (2000) Rapid dendritic movements during synapse
formation and rearrangement. Curr Opin Neurobiol 10: 118–124.
71. Beattie EC, Stellwagen D, Morishita W, Bresnahan JC, Ha BK, et al. (2002)
Control of synaptic strength by glial TNF alpha. Science 295: 2282–2285.
72. Dowell JA, Johnson JA, Li L (2009) Identification of astrocyte secreted proteins
with a combination of shotgun proteomics and bioinformatics. J Proteome Res
8: 4135–4143.
73. Keene SD, Greco TM, Parastatidis I, Lee SH, Hughes EG, et al. (2009) Mass
spectrometric and computational analysis of cytokine-induced alterations in the
astrocyte secretome. Proteomics 9: 768–782.
74. Moore NH, Costa LG, Shaffer SA, Goodlett DR, Guizzetti M (2009) Shotgun
proteomics implicates extracellular matrix proteins and protease systems in
neuronal dev elopment in duced by astrocyte cholinergic stimulation.
J Neurochem 108: 891–908.
75. Booth GE, Kinrade EF, Hidalgo A (2000) Glia maintain follower neuron
survival during Drosophila CNS development. Development 127: 237–244.
76. Guizzetti M, Moore NH, Giordano G, Costa LG (2008) Modulation of
neuritogenesis by astrocyte muscarinic receptors. J Biol Chem 283:
31884–31897.
77. Hughes EG, Elmariah SB, Balice-Gordon RJ Astrocyte secreted proteins
selectively increase hippocampal GABAergic axon length, branching, and
synaptogenesis. Mol Cell Neurosci 43: 136–145.
78. Chen H, Herndon ME, Lawler J (2000) The cell biology of thrombospondin-1.
Matrix Biol 19: 597–614.
79. Osterhout DJ, Frazier WA, Higgins D (1992) Thrombospondin promotes
process outgrowth in neurons from the peripheral and central nervous systems.
Dev Biol 150: 256–265.
80. Xu JY, Xiao N, Xia J (2010) Thrombospondin 1 accelerates synaptogenesis in
hippocampal neurons through neuroligin 1. Nature Neuroscience 13: 22–24.
81. Lu ZJ, Kipnis J (2010) Thrombospondin 1-a key astrocyte-derived neurogenic
factor. Faseb Journal 24: 1925–1934.
82. Caceres M, Suwyn C, Maddox M, Thomas JW, Preuss TM (2007) Increased
cortical expression of two synaptogenic thrombospondins in human brain
evolution. Cereb Cortex 17: 2312–2321.
83. Nishiwaki T, Yamaguchi T, Zhao C, Amano H, Hankenson KD, et al. (2006)
Reduced expression of thrombospondins and craniofacial dysmorphism in mice
overexpressing Fra1. Journal of Bone and Mineral Research 21: 596–604.
84. Olson LE, Richtsmeier JT, Leszl J, Reeves RH (2004) A chromosome 21
critical region does not cause specific Down syndrome phenotypes. Science
306: 687–690.
85. Richtsmeier JT, Baxter LL, Reeves RH (2000) Parallels of craniofacial
maldevelopment in Down syndrome and Ts65Dn mice. Dev Dyn 217: 137–145.
86. Lawler J (2000) The functions of thrombospondin-1 and-2. Curr Opin Cell Biol
12: 634–640.
87. Greenwood JA, P allero MA, T heibert AB, Murphy-Ullrich JE (1998)
Thrombospondin signaling of focal adhesion disassembly requires activation
of phosphoinositide 3-kinase. J Biol Chem 273: 1755–1763.
88. Giehl K, Graness A, Goppelt-Struebe M (2008) The small GTPase Rac-1 is a
regulator of mesangial cell morphology and thrombospondin-1 expression.
Am J Physiol Renal Physiol 294: F407–413.
89. Isenberg JS, Martin-Manso G, Maxhimer JB, Roberts DD (2009) Regulation of
nitric oxide signalling by thrombospondin 1: implications for anti-angiogenic
therapies. Nature Reviews Cancer 9: 182–194.
90. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL, et al. (2000)
Signals leading to apoptosis-dependent inhibition of neovascularization by
thrombospondin-1. Nat Med 6: 41–48.
91. Lymn JS, Rao SJ, Clunn GF, Gallagher KL, O’Neil C, et al. (1999)
Phosphatidylinositol 3-kinase and focal adhesion kinase are early signals in the
growth factor-like responses to thrombospondin-1 seen in human vascular
smooth muscle. Arterioscler Thromb Vasc Biol 19: 2133–2140.
92. Dawson DW, Pearce SF, Zhong R, Silverstein RL, Frazier WA, et al. (1997)
CD36 mediates the In vitro inhibitory effects of thrombospondin-1 on
endothelial cells. J Cell Biol 138: 707–717.
93. Eroglu C, Allen NJ, Susman MW, O’Rourke NA, Park CY, et al. (2009)
Gabapentin receptor alpha2delta-1 is a neuronal thrombospondin receptor
responsible for excitatory CNS synaptogenesis. Cell 139: 380–392.
94. Busciglio J, Andersen JK, Schipper HM, Gilad GM, McCarty R, et al. (1998)
Stress, aging, and neurodegenerative disorders. Molecular mechanisms.
Ann N Y Acad Sci 851: 429–443.
95. Helguera P, Pelsman A, Pigino G, Wolvetang E, Head E, et al. (2005) ets-2
promotes the activation of a mitochondrial death pathway in Down’s syndrome
neurons. J Neurosci 25: 2295–2303.
96. Pelsman A, Hoyo-Vadillo C, Gudasheva TA, Seredenin SB, Ostrovskaya RU,
et al. (2003) GVS-111 prevents oxidative damage and apoptosis in normal and
Down’s syndrome human cortical neurons. Int J Dev Neurosci 21: 117–124.
97. Tran MD, Neary JT (2006) Purinergic signaling induces thrombospondin-1
expression in astrocytes. Proc Natl Acad Sci U S A 103: 9321–9326.
98. Roberts DD, Isenberg JS, Ridnour LA, Wink DA (2007) Nitric oxide and its
gatekeeper thrombospondin-1 in tumor angiogenesis. Clin Cancer Res 13:
795–798.
99. Nickoloff BJ, Riser BL, Mitra RS, Dixit VM, Varani J (1988) Inhibitory effect
of gamma inter feron on cultured human keratinocyte thrombospondin
production, distribution, and biologic activities. J Invest Dermatol 91: 213–218.
100. Franciotta D, Verri A, Zardini E, Andreoni L, De Amici M, et al. (2006)
Interferon-gamma- and interleukin-4-producing T cells in Down’s syndrome.
Neurosci Lett 395: 67–70.
101. Guazzarotti L, Trabattoni D, Castelletti E, Boldrighini B, Piacentini L, et al.
(2009) T lymphocyte maturation is impaired in healthy young individuals
carrying trisomy 21 (Down syndrome). Am J Intellect Dev Disabil 114: 100–109.
102. Hallam DM, Capps NL, Travelstead AL, Brewer GJ, Maroun LE (2000)
Evidence for an interferon-related inflammatory reaction in the trisomy 16
mouse brain leading to caspase-1-mediated neuronal apoptosis.
J Neuroimmunol 110: 66–75.
103. Hallam DM, Maroun LE (1998) Anti-gamma interferon can prevent the
premature death of trisomy 16 mouse cortical neurons in culture. Neurosci Lett
252: 17–20.
104. Iwamoto T, Yamada A, Yuasa K, Fukumoto E, Nakamura T, et al. (2009)
Influences of interferon-gamma on cel l proliferation and interleukin-6
production in Down syndrome derived fibroblasts. Arch Oral Biol 54:
963–969.
105. Tan YH (1976) Chromosome 21 and the cell growth inhibitory effect of human
interferon preparations. Nature 260: 141–143.
106. Tan YH, Schneider EL, Tischfiel d J, Epstein CJ, Ruddle FH (1974) Human
chromosome 21 dosage: effect on the expression of the interferon induced
antiviral state. Science 186: 61–63.
107. Zihni L (1994) Down’s syndrome, interferon sensitivity and the development of
leukaemia. Leuk Res 18: 1–6.
108. Maroun LE (1996) In terferon action and chromosome 21 trisomy (Down
syndrome): 15 years later. J Theor Biol 181: 41–46.
109. Murphy M, Friend DS, Pike-Nobile L, Epstein LB (1992) Tumor necrosis
factor-alpha and IFN-gamma expression in human thymus. Localization and
overexpression in Down syndrome (trisomy 21). J Immunol 149: 2506–2512.
110. Hattori M, Fujiyama A, Taylor TD, Watanabe H, Yada T, et al. (2000) The
DNA sequence of human chromosome 21. Nature 405: 311–319.
111. Maheshwari RK, Banerjee DK, Waechter CJ, Olden K, Friedman RM (1980)
Interferon treatment inhibits glycosylation of a viral protein. Nature 287: 454–456.
112. Kaech S, Banker G (2006) Culturing hippocampal neurons. Nat Protoc 1:
2406–2415.
113. Hayashi K, Ishikawa R, Ye LH, He XL, Takata K, et al. (1996) Modulatory
role of drebrin on the cytoskeleton within dendritic spines in the rat cerebral
cortex. J Neurosci 16: 7161–7170.
114. Kobayashi C, Aoki C, Kojima N, Yamazaki H, Shirao T (2007) Drebrin a
content correlates with spine head size in the adult mouse cerebral cortex.
J Comp Neurol 503: 618–626.
Down Syndrome Spine Pathology
PLoS ONE | www.plosone.org 12 December 2010 | Volume 5 | Issue 12 | e14200
    • "The promotion of the differentiation of progenitor neural cells into neurons and the reduction of neuronal death and the increase of neurogenesis and synaptic plasticity in the adulthood, leading to increased synaptic function; 2. The induction of the secretion of soluble factors by astrocytes that act indirectly on neurons, increasing differentiation and reducing death; the effects of flavonoids on synaptic function remain unknown; 3. The reduction of astrocytic reactivity and the increase in the antioxidant response; additionally, these compounds are able to increase the secretion of neuroprotective factors by astrocytes, although the identity of these factors remains unknown; 4. The decrease in the microglial activation and secretion of pro-inflammatory cytokines by these cells. the abnormal development of dendritic spines and the reduced activity and density of synapses (Chen et al., 2014; Garcia et al., 2010 ). Interestingly, several of these abnormalities were prevented by the presence of normal astrocytes (Chen et al., 2014). "
    [Show abstract] [Hide abstract] ABSTRACT: In the last decade, there have been major advances in the understanding of the role of glial cells as key elements in the formation, maintenance and refinement of synapses. Recently, the discovery of natural compounds capable of modulating nervous system function has revealed new perspectives on the restoration of the injured brain. Among these compounds, flavonoids stand out as molecules easily obtainable in the diet that have remarkable effects on cognitive performance and behavior. Nevertheless, little is known about the cellular and molecular mechanisms underlying the actions of flavonoids in the nervous system. The present review presents recent advances in the effects of natural compounds, particularly flavonoids, in the nervous system. We shed light on astrocytes as targets of flavonoids and discuss how this interaction might contribute to the effects of flavonoids on neuronal survival, differentiation and function. Finally, we discuss how the effects of flavonoids on astrocytes might contribute to the development of alternative therapeutic approaches to the treatment of neural diseases.
    Full-text · Article · Feb 2016
    • "Selected segments were at least 50 µm away from the cell body and the numbers of spines were counted on dendritic segments spanning 50 µm. Spines were defined and quantified as previously described (Garcia et al., 2010). Two populations of spines were identified based on the morphology of the spine and intensity of drebrin staining. "
    [Show abstract] [Hide abstract] ABSTRACT: Angiotensin IV (Ang IV) and related peptide analogues, as well as non-peptide inhibitors of insulin-regulated aminopeptidase (IRAP), have previously been shown to enhance memory and cognition in animal models. Furthermore, the endogenous IRAP substrates oxytocin and vasopressin are known to facilitate learning and memory. In this study, the two recently synthesized 13-membered macrocylic competitive IRAP inhibitors HA08 and HA09, which were designed to mimic the N-terminal of oxytocin and vasopressin, were assessed and compared based on their ability to bind to the IRAP active site, and alter dendritic spine density in rat hippocampal primary cultures. The binding modes of the IRAP inhibitors HA08, HA09 and of Ang IV in either the extended or γ-turn conformation at the C-terminal to human IRAP were predicted by docking and molecular dynamics (MD) simulations. The binding free energies calculated with the linear interaction energy (LIE) method, which are in excellent agreement with experimental data and simulations, have been used to explain the differences in activities of the IRAP inhibitors, both of which are structurally very similar, but differ only with regard to one stereogenic center. In addition, we show that HA08, which is 100-fold more potent than the epimer HA09, can enhance dendritic spine number and alter morphology, a process associated with memory facilitation. Therefore, HA08, one of the most potent IRAP inhibitors known today, may serve as a suitable starting point for medicinal chemistry programs aided by MD simulations aimed at discovering more drug-like cognitive enhancers acting via augmenting synaptic plasticity.
    Full-text · Article · Jan 2016
    • "Original theories regarding the disease focused almost exclusively on neurons, but recent evidence now indicates that glial cells (astrocytes, microglia and oligodendrocytes) are important contributors to disease pathology (reviewed in Guizzetti et al., 2014). Disruptions in astrocyte development and function may contribute to autism, fragile X, Down syndrome, Costello syndrome, neurofibromatosis-1, Noonan syndrome and Cardiofaciocutaneous syndrome (Garcia et al., 2010; Jacobs and Doering, 2010; Sloan and Barres, 2014). Astrocyte dysfunction is also hypothesized to partially underlie the neurodevelopmental origins of major depressive disorder (MDD) and schizophrenia as evidenced by glial anomalies in patients with these disorders (Sloan and Barres, 2014). "
    [Show abstract] [Hide abstract] ABSTRACT: Alcohol consumption during pregnancy can produce a variety of central nervous system (CNS) abnormalities in the offspring resulting in a broad spectrum of cognitive and behavioral impairments that constitute the most severe and long-lasting effects observed in fetal alcohol spectrum disorders (FASD). Alcohol-induced abnormalities in glial cells have been suspected of contributing to the adverse effects of alcohol on the developing brain for several years, although much research still needs to be done to causally link the effects of alcohol on specific brain structures and behavior to alterations in glial cell development and function. Damage to radial glia due to prenatal alcohol exposure may underlie observations of abnormal neuronal and glial migration in humans with Fetal Alcohol Syndrome (FAS), as well as primate and rodent models of FAS. A reduction in cell number and altered development has been reported for several glial cell types in animal models of FAS. In utero alcohol exposure can cause microencephaly when alcohol exposure occurs during the brain growth spurt a period characterized by rapid astrocyte proliferation and maturation; since astrocytes are the most abundant cells in the brain, microenchephaly may be caused by reduced astrocyte proliferation or survival, as observed in in vitro and in vivo studies. Delayed oligodendrocyte development and increased oligodendrocyte precursor apoptosis has also been reported in experimental models of FASD, which may be linked to altered myelination/white matter integrity found in FASD children. Children with FAS exhibit hypoplasia of the corpus callosum and anterior commissure, two areas requiring guidance from glial cells and proper maturation of oligodendrocytes. Finally, developmental alcohol exposure disrupts microglial function and induces microglial apoptosis; given the role of microglia in synaptic pruning during brain development, the effects of alcohol on microglia may be involved in the abnormal brain plasticity reported in FASD. The consequences of prenatal alcohol exposure on glial cells, including radial glia and other transient glial structures present in the developing brain, astrocytes, oligodendrocytes and their precursors, and microglia contributes to abnormal neuronal development, reduced neuron survival and disrupted brain architecture and connectivity. This review highlights the CNS structural abnormalities caused by in utero alcohol exposure and outlines which abnormalities are likely mediated by alcohol effects on glial cell development and function.
    Full-text · Article · Jan 2016
Show more