Article

The Sin3p PAH Domains Provide Separate Functions Repressing Meiotic Gene Transcription in Saccharomyces cerevisiae

Department of Molecular Biology, University of Medicine and Dentistry of New Jersey, Two Medical Center Drive, Stratford, NJ 08084, USA.
Eukaryotic Cell (Impact Factor: 3.18). 10/2010; 9(12):1835-44. DOI: 10.1128/EC.00143-10
Source: PubMed
ABSTRACT
Meiotic genes in budding yeast are repressed during vegetative growth but are transiently induced during specific stages of
meiosis. Sin3p represses the early meiotic gene (EMG) by bridging the DNA binding protein Ume6p to the histone deacetylase
Rpd3p. Sin3p contains four paired amphipathic helix (PAH) domains, one of which (PAH3) is required for repressing several
genes expressed during mitotic cell division. This report examines the roles of the PAH domains in mediating EMG repression
during mitotic cell division and following meiotic induction. PAH2 and PAH3 are required for mitotic EMG repression, while
electrophoretic mobility shift assays indicate that only PAH2 is required for stable Ume6p-promoter interaction. Unlike mitotic
repression, reestablishing EMG repression following transient meiotic induction requires PAH3 and PAH4. In addition, the role
of Sin3p in reestablishing repression is expanded to include additional loci that it does not control during vegetative growth.
These findings indicate that mitotic and postinduction EMG repressions are mediated by two separate systems that utilize different
Sin3p domains.

Full-text

Available from: Randy Strich, Aug 25, 2014
EUKARYOTIC CELL, Dec. 2010, p. 1835–1844 Vol. 9, No. 12
1535-9778/10/$12.00 doi:10.1128/EC.00143-10
Copyright © 2010, American Society for Microbiology. All Rights Reserved.
The Sin3p PAH Domains Provide Separate Functions Repressing
Meiotic Gene Transcription in Saccharomyces cerevisiae
Michael J. Mallory,
1
Michael J. Law,
1
Lela E. Buckingham,
2
and Randy Strich
1
*
Department of Molecular Biology, University of Medicine and Dentistry of New Jersey, Stratford, New Jersey 08084,
1
and
Armour Academic Center, Rush University Medical Center, Chicago, Illinois 60612
2
Received 7 June 2010/Accepted 8 October 2010
Meiotic genes in budding yeast are repressed during vegetative growth but are transiently induced during
specific stages of meiosis. Sin3p represses the early meiotic gene (EMG) by bridging the DNA binding protein
Ume6p to the histone deacetylase Rpd3p. Sin3p contains four paired amphipathic helix (PAH) domains, one
of which (PAH3) is required for repressing several genes expressed during mitotic cell division. This report
examines the roles of the PAH domains in mediating EMG repression during mitotic cell division and following
meiotic induction. PAH2 and PAH3 are required for mitotic EMG repression, while electrophoretic mobility
shift assays indicate that only PAH2 is required for stable Ume6p-promoter interaction. Unlike mitotic
repression, reestablishing EMG repression following transient meiotic induction requires PAH3 and PAH4. In
addition, the role of Sin3p in reestablishing repression is expanded to include additional loci that it does not
control during vegetative growth. These findings indicate that mitotic and postinduction EMG repressions are
mediated by two separate systems that utilize different Sin3p domains.
Meiosis is the process that produces haploid gametes from
diploid parental cells. Similar to other developmental path-
ways, many genes required for meiosis and spore formation in
the budding yeast Saccharomyces cerevisiae display a transient
transcription profile (7, 25). During vegetative growth, their
mRNA levels are low but increase dramatically at precise
stages in meiosis. This expression is usually followed by an
equally rapid repression that returns the mRNA to mitotic
levels.
The vegetative repression of a group of genes designated
“early meiotic genes” (EMG) requires the recruitment of the
histone deacetylase (HDAC) Rpd3p (13) and the chromatin-
remodeling factor Isw2p (10) by the Ume6p DNA binding
protein (31). Ume6p binds an element termed upstream re-
pressor sequence 1 (URS1) that is responsible for the full
repression and activation of several early meiotic genes (3, 5,
37). The Ume6p-Rpd3p association occurs through the global
corepressor Sin3p (13). Similarly, the last known member of
this repression complex, Ume1p (30), associates with Rpd3p in
an Sin3p-dependent manner (17). The function of Ume1p in
this complex is currently unknown, but it is suggested to be a
tightly associated cofactor (41).
The interactions between the URS1 regulatory element and
its associating factors are complex. For example, URS1 is also
required for the repression of several vegetative genes (22, 27,
32, 38). Of these loci, only CAR1 is repressed by Ume6p (23),
while Sin3p alone regulates HO (6). Given the diverse loci
regulated by URS1, it is likely that specificity is introduced
through the interaction of additional factors targeted to the
various promoters. Indeed, Abf1p helps stimulate transcription
of the URS1-regulated meiotic gene HOP1 (37). Similarly, an
element termed the auxiliary repression element (ARE) has
been identified genetically that contributes to vegetative re-
pression of the meiosis-specific heat shock gene HSP82 (34).
Therefore, the context in which URS1 is found may allow this
single element to respond to different stimuli and function in a
positive or negative manner.
Sin3p belongs to a conserved gene family that contains four
paired amphipathic helix (PAH) protein-protein interaction
domains (see reference 29 for a review). Mutational analysis in
yeast revealed that of the four PAH domains, PAH3 is re-
quired for the repression of several genes, including HO,
PHO5, and IME2 (43). Functionally, PAH3 helps recruit the
HDAC complex and other corepressors, while PAH2 mediates
the interaction with Ume6p in yeast (44). The roles of the PAH
domains in transcriptional repression appear conserved in the
human Sin3 (hSin3). For example, hSin3p also associates with
the histone deacetylase HDAC1 (15), while PAH2 binds tran-
scription factors (2, 28). Less is known about the other two
PAH domains. PAH1 recruits a variety of corepressors, de-
pending on the gene context (29), while PAH4 is reported to
bind the enzyme O-acetylglucosamine transferase (OGT) to
help repress transcription in higher eukaryotes (45). These
results indicate that the PAH domains perform separate, but
complementary, roles in mediating transcriptional repression.
Although it regulates diverse gene sets, mutants lacking
SIN3 do not display significant growth defects (39, 42). How-
ever, Sin3p is required for the execution of the first meiotic
nuclear division (30), with mutants arresting in meiotic
prophase I (11). This present study explores the role of Sin3p
in controlling meiotic gene expression. We find evidence for
two separate Sin3p-dependent regulatory systems, one repress-
ing EMG transcription during mitotic cell division, and the
other functioning to reestablish repression as the cells com-
plete meiosis.
* Corresponding author. Mailing address: Department of Molecular
Biology, University of Medicine and Dentistry of New Jersey, Two
Medical Center Drive, Stratford, NJ 08084. Phone: (856) 566-6043.
Fax: (856) 566-6366. E-mail: strichra@umdnj.edu.
† Present address: Department of Biochemistry and Biophysics,
University of Pennsylvania, Philadelphia, PA 19104.
Published ahead of print on 22 October 2010.
1835
Page 1
MATERIALS AND METHODS
Strains, media, and plasmids. The strains used in this study are listed in Table
1. The PAH deletion strains were constructed by first subcloning the different
SIN3 PAH mutant alleles (a gift from D. Stillman, University of Utah) into the
integrating vector YIplac22 (9). These constructs were used to replace the wild-
type SIN3 gene using the pop-in/pop-out strategy (26). The successful introduc-
tion of all mutant alleles was verified by sequencing genomic PCR fragments. All
growth and sporulation procedures have been described previously (8). Mutant
derivatives of URS1 were introduced into the spo13-lacZ reporter plasmid
p(spo13)40 (5) by site-directed mutagenesis, and lacZ activity was assayed as
described previously (5). Single-stranded oligonucleotides (see Fig. 3E) were
used to mutate a 215-bp EcoRI-BstEII fragment (170 to 45) of SPO13 in
vector pVZ1 (Bio-Rad), and this fragment was cloned into the EcoRI-BstEII
fragment in p(spo13)40.
Meiotic progression/recombination assays. Synchronous meiotic cultures were
generated and analyzed as described previously (8). The recombination assays
were performed as follows. Haploid strains containing one of the PAH deletion
derivatives (RSY427 to RSY430; see Table 1) were mated to RSY404 (sin3).
Eight individual pah/sin3 isolates, along with SIN3/sin3 (RSY276
RSY404) and sin3/sin3 (RSY404 RSY404) controls, were induced to enter
meiosis by using standard protocols. Samples were taken prior to the shift and
12 h after. Initial experiments identified 12 h following the transfer to sporulation
medium (SPM) as the time point that recombination was complete (data not
shown). The cells were lightly sonicated, serially diluted (1:10), and then plated
on solid rich medium to determine total viable cell numbers and minimal me-
dium lacking leucine to monitor intergenic exchange at the leu1 locus. The
samples taken prior to transfer to SPM were used to exclude any isolates that had
a high level of Leu
prototrophs prior to meiotic induction due to mitotic
recombination. The plates were incubated for 3 days at 30°C, and the number of
colonies was determined. The unpaired Student t test was used to determine the
statistical significance of these results.
Northern/S1 nuclease protection/qPCR analyses. Northern blot analyses were
performed as described previously (18) with 25 g of total RNA. Probes were
obtained by PCR amplification of the gene in question and labeled with
[
32
P]dCTP using the PrimeIt random priming kit (Stratagene Inc.). S1 nuclease
protection studies were conducted as described earlier (30) using 20 g of total
RNA and [
32
P]UTP continuously labeled strand-specific riboprobes. Northern
blot signals (see Fig. 5) were quantitated by phosphorimaging (Kodak Inc.), and
the values presented were first corrected for loading differences using ENO1
levels as internal controls. The corrected signal from each time point was plotted
as a percentage of the peak accumulation value within each time course. The
values plotted represent the averages of results from two separate experiments.
The standard deviation within the different trials was 18% or less. Quantitative
PCR (qPCR) analyses were conducted using total RNA isolated from 10 ml of
sporulation culture as described previously (30). Precipitated RNA samples were
treated with DNase I (New England Biolabs [NEB]), and reverse transcription
was performed using oligo(dT) priming and avian myeloblastosis virus (AMV)
reverse transcriptase (NEB). TaqMan reactions were conducted using an Ap-
plied Biosystems StepOne thermal cycler with 2 TaqMan gene expression
master mix (Applied Biosystems) using primers described in Table 2. Relative
mRNA levels were calculated by comparative threshold cycle (C
T
) methodology
using ENO1 as an endogenous control. Values shown are means with standard
deviations from technical triplicates.
Electrophoretic mobility shift assays. Electrophoretic mobility shift assays
(EMSAs) were conducted and extracts prepared as described previously (1) from
cells harvested in mid-logarithmic growth. A 26-bp oligonucleotide containing
the SPO13 URS1 sequence (GAAATAGCCGCCGACAAAAAGGAATT; des-
ignated URS1
SPO13
) or derivatives as indicated in the text was end-labeled with
[
32
P]ATP using polynucleotide kinase and then hybridized to a 3-fold molar
excess of an unlabeled complement to drive the labeled probe into a duplex state.
The probe was separated from unincorporated nucleotides by either column
chromatography or polyacrylamide gel purification (18). Reaction mixtures con-
taining 10 to 20 g of crude extract, 20,000 dpm of probe (approximately 0.1 ng),
and nonspecific competitors [2.5 g poly(dI-dC) and 1.0 g poly(dA-dT)] were
incubated at 16°C for 20 min and then loaded directly onto a 6% nondenaturing
polyacrylamide gel and electrophoresed at 10 V/cm for 2.5 h at 25°C. The gels
were dried and exposed to X-ray film with intensifying screens. Competition
assays were conducted as described above except that 33-, 100-, and 300-fold
excess duplex oligonucleotides were added prior to the introduction of the
extract. The reaction mixtures were vortexed and equilibrated at 16°C for 10 min,
and then the extract was added. Complex quantitation was conducted using
phosphorimaging (Kodak).
Chromatin immunoprecipitation (ChIP) analysis. Chromatin solutions were
prepared essentially as previously described (19) with the following modifica-
tions. A 50-ml dextrose culture was grown to a final density of 2 10
7
cells/ml
and cross-linked for 15 min using 1% formaldehyde with occasional swirling.
Cross-linking reactions were quenched with 50 mM glycine for 5 min, harvested,
and washed twice with ice-cold 1 phosphate-buffered saline (PBS). Immuno-
precipitations of spheroplasted, sonicated material were conducted using 250 g
of total chromatin (25 g for inputs), diluted in immunoprecipitation (IP) dilu-
tion buffer. The chromatin was first precleared with a protein A/G slurry for 1 h
at 4
o
. Following preclearing, 5 l of polyclonal -Ume6p (Open Biosystems) and
the no-antibody (Ab) control were immunoprecipitated overnight. After harvest-
ing the immunoprecipitations with protein A/G slurry for 1 h, beads were washed
(4) and eluted (19) as described. Cross-linking was reversed, and precipitated
DNA was then treated with proteinase K, organically extracted, and used in
qPCRs. qPCR primers (forward, GCT AGT TAG TAC CTT TGC ACG GAA
A; reverse, TCT TAT TGC GCT AAT TGT CTG TTA GAC) were directed at
the SPO13 promoter using SYBR green reactions (Applied Biosystems Power
TABLE 1. Strains and genotypes
Strain
a
Genotype
RSY10 .................MAT ade2 ade6 can1-100 leu2-3,112 his3-11,15 trp1-1
ura3-1
RSY301 ...............MAT ade2 ade6 can1-100 leu2-3,112 his3-11,15 trp1-1
ura3-1 ume6::LEU2
RSY305 ...............MAT ade2 ade6 can1-100 leu2-3,112 his3-11,15 trp1-1
ura3-1 sin3::HIS3
RSY272 ...............MAT can1-100 his4 leu2-3,112 trp1-1 ura3-1
ume6::LEU2
RSY273 ...............MAT can1-100 his4 leu2-3,112 lys2 trp1-1 ura3-1
RSY274 ...............MAT can1-100 his3-11,15 leu2-3,112 lys2 trp1-1 ura3-1
sin3::TRP1 ume6::LEU2
RSY275 ...............MAT can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1
sin3::TRP1
RSY276 ...............MATa cyh2
r
leu1-c met-13B tyr1-2
RSY403 ...............MATa cyh2
r
leu1-c met-13B tyr1-2 sin3::HIS3
RSY404 ...............MAT can1-100 leu1-12 lys2 tyr1-1 sin3::HIS3
RSY427 ...............MATa cyh2
r
leu1-C met13-B tyr1-2 sin3-pah1
RSY428 ...............MATa cyh2
r
leu1-C met13-B tyr1-2 sin3-pah2
RSY429 ...............MATa cyh2
r
leu1-C met13-B tyr1-2 sin3-pah3
RSY430 ...............MATa cyh2
r
leu1-C met13-B tyr1-2 sin3-pah4
RSY877* .............MATa/MAT lys2 trp1::hisG ura3 LYS2::ho
RSY1028* ...........MATa/MAT lys2 trp1::hisG ura3 LYS2::ho sin3::URA3
RSY1029* ...........MATa/MAT lys2 trp1::hisG ura3 LYS2::ho sin3-pah1
RSY1030* ...........MATa/MAT lys2 trp1::hisG ura3 LYS2::ho sin3-pah2
RSY1031* ...........MATa/MAT lys2 trp1::hisG ura3 LYS2::ho sin3-pah3
RSY1032* ...........MATa/MAT lys2 trp1::hisG ura3 LYS2::ho sin3-pah4
a
All strains were generated in this study except RSY10 (27). An asterisk
indicates diploid strains that are homozygous for all alleles shown. Only one is
shown for clarity.
TABLE 2. Quantitative PCR primers
Gene Forward primer Reverse primer Probe
a
ENO1 GCCGCTGCTGAAAAGAATGT TGGAGAGGTCTTAGACAA (FAM)CATTATACAAGCACTTGGC
SPO13 AAGCCCACATCCAGGATTAAATT CGAACATCTCCAGCCTTTGAG (FAM)TGTAAGTGATGCTCAACAGT
SPS4 GCACAAACAAAGCCTAGAATCGA CACTGGTGCTACGGCTTGAA (FAM)AAGTGGTAGTGTCACGTCC
IME1 TCCCCTAGAAGTTGGCATTTTG CCAAGTTCTGCAGCTGAGATGA (VIC)AAGTCTGACAAAATTG
a
FAM, 6-carboxyfluorescein.
1836 MALLORY ET AL. EUKARYOT.CELL
Page 2
SYBR master mix). Data collected were first normalized to input signal. These
values (percent input) were then compared to enrichment over a no-Ab control.
Wild-type enrichment was set to 100%. Error bars in the figures represent the
means from biological triplicates, and error bars are the standard errors of the
means.
RESULTS
PAH2 and PAH3 are required for mitotic SPO13 repression.
Previous studies indicated that Sin3p-dependent repression of
the IME2 EMG predominantly utilizes PAH3 but also PAH2
to a lesser extent (43). To determine if a similar pattern of
activity was observed for another EMG, SPO13 mRNA levels
were examined in vegetative cultures expressing the different
PAH deletion alleles. A strain deleted for SIN3 was trans-
formed with plasmids harboring the wild-type gene, internal
deletions of each individual PAH domain, or the vector alone.
The protein levels of these deletion derivatives are similar to
the wild-type Sin3p (43). As observed previously (30), the loss
of Sin3p activity derepressed SPO13 transcripts about 10-fold
during mitotic cell division (Fig. 1A, compare lanes 2 and 3).
The derepression observed with sin3 mutants is still far below
that observed when UME6 is deleted (lane 8), indicating that
Sin3p mediates only part of the vegetative repression of early
meiotic genes. The analysis of the individual PAH deletion
mutants revealed that PAH2 and to a lesser extent PAH3 are
required for SPO13 repression (lanes 5 and 6). No aberrant
SPO13 derepression was observed in strains expressing the
pah1 or pah4 mutants. These results indicate that PAH2
and to a lesser extent PAH3 mediate SPO13 repression in
vegetative cells.
PAH3 is required for meiotic nuclear divisions. Previous
studies found that mutants lacking Sin3p failed to progress past
the first meiotic division (11, 30). Another study found that the
pah3 mutant exhibited a 33-fold reduction in sporulation
efficiency when assaying the haploidization of recessive drug
resistance markers (43). To further explore the role of the
PAH domains in meiotic progression, we first monitored mei-
otic nuclear divisions in diploid strains heterozygous for the
various deletion mutations and the null allele (pah/sin3).
These diploids were sporulated in liquid culture, and the per-
centages of cells undergoing one (binucleated) or both (tet-
ranucleated) meiotic divisions were determined by DAPI [4,6-
diamidino-2-phenylindole] analysis. Similar to the sin3/sin3-
null strain, the pah3/sin3 mutant failed to produce bi- or
tetranucleated cells (Fig. 1B; n 200). Strains lacking either of
the other PAH domains executed the meiotic divisions at fre-
quencies similar to that of the wild-type control. The only
exception was an increase in the number of binucleated cells in
the pah4 mutant (33%) compared to that in the wild type
(11%). In addition, the kinetics of bi- and tetranucleate pro-
duction in the pah1/sin3, pah2/sin3, and pah4/sin3
mutants were similar to the kinetics of the SIN3/sin3 control
diploid (data not shown). These results indicate that PAH3 is
required for the execution of meiotic nuclear divisions. The
remaining PAH domains are largely dispensable for meiosis
and spore formation.
PAH2 and PAH3 are required for normal meiotic recombi-
nation. The PAH mutant diploids just described also contained
heteroalleles at the leu1 locus (see Table 1). To test the re-
quirements of the PAH domains for recombination, each dip-
loid was examined for the production of Leu
prototrophs (see
Materials and Methods for details). With wild-type levels set at
100%, these studies found that pah1 and pah4 mutants
produced Leu
prototrophs near wild-type levels (Fig. 1C).
However, compared to the wild type, the sin3-null strain and
pah2 and pah3 mutants displayed a reduction in the number
of recombinants (P 0.01). This defect does not appear to be
the result of delayed recombination kinetics, as the production
of prototrophs reached a maximum between 12 and 24 h in all
strains tested (data not shown). These experiments revealed
that PAH2 and PAH3 are required for the normal execution of
meiotic recombination. As meiotic DNA synthesis appears
normal in an sin3 mutant (reference 11 and our unpublished
results), these findings point to a requirement of PAH2 and
PAH3 during prophase I of the meiotic program.
FIG. 1. PAH regulation during meiotic and mitotic cell division.
(A) S1 nuclease protection assays were performed on total RNA pre-
pared from RSY278 transformed with plasmids expressing the indi-
cated SIN3 alleles. The SPO13-specific bands corresponding to the 3
end of the mRNA are indicated by the arrows. ACT1 mRNA levels
serve as a control for the amount of poly(A)
RNA in each sample. t,
tRNA control for nonspecific self-annealing of the single-stranded
riboprobe. (B) PAH deletion derivatives (RS427 to RS430) mated to
RSY404 (sin3) were induced to enter meiosis in liquid culture for
24 h. The cells were fixed and stained with 4,6-diamidino-2-phenylin-
dole (DAPI), and the percentages of binucleated (black columns) and
tetranucleated (white columns) cells were determined. The values pre-
sented represent the averages of results from two independent trials
for each strain. (C) The percentage of Leu
prototrophs were estab
-
lished for independent isolates for each strain (n 8 isolates, except
pah3n 7 isolates) with wild-type levels set at 100%. The standard
deviations from the means are shown with corresponding P values.
V
OL. 9, 2010 Sin3p REGULATES TRANSIENT TRANSCRIPTION 1837
Page 3
PAH2 is required for Ume6p-URS1 promoter complex for-
mation in vitro. We previously demonstrated that six complexes
(C1 to C6) are observed in electrophoretic mobility shift assays
(EMSAs) when crude vegetative extracts are incubated with an
oligonucleotide probe containing the SPO13 URS1 element
(URS1
SPO13
) (31). This study also demonstrated that two of
these complexes, C1 and C2, were absent in extracts prepared
from ume6 mutant cultures (see Fig. 2A, left). In addition, new
species were detected in the ume6 extract that were not present
in the wild type (Fig. 2A, open arrows). To determine if Sin3p
is required for normal complex formation in vitro, EMSAs
were performed with an extract derived from an sin3-null
strain. Interestingly, sin3 mutant extracts produced an EMSA
pattern similar to that observed with ume6 strains. In addition
to the loss of C1 and C2 in the sin3 mutant, the new complexes
observed in the ume6 mutant are also present in extracts lack-
ing sin3 (open arrows).
To determine if any of the PAH domains are required for C1
and C2 formation, these experiments were repeated in an
sin3-null strain harboring plasmids expressing wild-type SIN3
or the different PAH deletion derivatives. Of the PAH mu-
tants, only pah2 demonstrated an alteration in the EMSA
pattern (Fig. 2A, right). In this extract, levels of C1 and C2 are
reduced compared to those of the other pah mutant extracts,
while C3 to C6 are unaffected (quantitated in Fig. 2B). Of note
is that the new complexes observed in either ume6- or sin3-null
extracts (open arrows) are not observed in the pah2 mutant
strain. The requirement of PAH2 for C1 and C2 formation is
consistent with our finding that the pah2 mutant allows
SPO13 derepression in vegetative cultures (Fig. 1A). To deter-
mine whether a similar loss in Ume6p-URS1
SPO13
association
is observed in vivo, chromatin immunoprecipitation (ChIP)
studies were performed. Wild-type, ume6, and sin3 log-
phase cultures were harvested and cross-linked samples immu-
noprecipitated with Ume6p-specific antibodies (see Materials
and Methods for details). Quantitative PCR was utilized to
calculate the relative occupancy of Ume6p at URS1
SPO13
.
These studies found that Ume6p occupancy was reduced but
not strongly (P 0.15) compared to that of the wild-type
control in this assay (Fig. 2C). The differences in these results
compared to those of the EMSA studies may reflect the in vivo
versus in vitro environment. Ume6p may be more stably asso-
ciated with URS1 in its natural chromatin context than when
binding a 26-bp probe. Conversely, the EMSA conditions may
amplify subtle differences in protein-DNA interactions.
Sin3p is not required for SPO13 mRNA derepression in a
ume6 mutant. A previous study found that Sin3p plays a pos-
itive and negative role in gene transcription (40). For example,
Sin3p represses the acid phosphatase PHO5 in a high-phos-
phate environment but is also necessary for maximal expres-
sion under limiting phosphate conditions. To determine
whether Sin3p is required for SPO13 mRNA derepression
associated with the ume6 mutation, isogenic strains were con-
structed containing the sin3 or ume6 alleles individually or
in combination. Mid-log-phase SPO13 mRNA levels were de-
termined in each strain background by S1 nuclease protection
analysis as described above. This experiment revealed similar
SPO13 mRNA levels in an ume6 mutant regardless of SIN3
status (Fig. 2D). In addition, a similar analysis conducted with
the individual pah mutants revealed identical results (data
not shown). Taken together, these results indicate that Sin3p is
not required for SPO13 derepression in the absence of Ume6p.
Three distinct protein binding domains exist at URS1
SPO13
.
The results presented in the previous section indicate that C1
and C2 represent Ume6p-URS1
SPO13
interactions in a re
-
pressed configuration, while their loss correlates with SPO13
derepression. However, the complicated pattern of six com-
plexes observed for the relatively small probe (26 bp)
prompted further investigation of this promoter element. A
previous study identified a single nucleotide substitution
(C91T) that disrupted the URS1 core consensus element and
allowed mitotic derepression of SPO13 (5). An oligonucleotide
was synthesized (URS1
91T
) (Fig. 3
E) to include this single base
FIG. 2. Sin3p is required for Ume6p-dependent complex forma-
tion. (A) Left, extracts prepared from RSY10 (WT), RSY305 (sin3),
and RSY301 (ume6) were incubated with the
32
P-labeled SPO13
URS1 promoter element (URS1
SPO13
; see Materials and Methods for
details). Six protein-DNA complexes (C1 to C6) are indicated by the
black arrows. The open arrows indicate new complexes that are ob-
served in the sin3 and ume6 extracts. The C5 and C6 complexes do not
resolve under these gel conditions (see Fig. 3). Right, the experiments
were repeated with extracts prepared from mid-log-phase RSY278
(sin3) harboring plasmids containing the wild-type SIN3 gene or the
different PAH mutant derivatives as indicated. comp, 150-fold excess
of unlabeled competitor URS1
SPO13
double-stranded oligonucleotide
added to the reaction. (B) Complex intensities of C1, C2, C3, and C4
were quantitated from pah2, pah3, and pah4 extracts as indicated.
Complex intensities are given in arbitrary units. (C) Chromatin immu-
noprecipitations were conducted with Ume6p antibodies in extracts
prepared from three independent wild-type (RSY10), ume6
(RSY291), or sin3 (RSY579) cultures. Enrichment over no antibody
control was established for each sample with the wild type set to 100%.
The data are presented as the means standard deviations (SD) of
results from three independent experiments (P values are indicated;
t test). (D) S1 nuclease protection assays were conducted with total
RNA prepared from wild-type (RSY273), ume6 (RSY272), sin3
(RSY275), and sin3 ume6 (RSY274) vegetative cultures. SPO13-
specific bands are indicated by the arrows. ACT1 mRNA levels were
used to control for the poly(A)
percentages in the total RNA prep
-
arations.
1838 MALLORY ET AL. E
UKARYOT.CELL
Page 4
change and used as an unlabeled competitor in EMSAs em-
ploying the wild-type probe. The URS1
91T
oligonucleotide was
able to compete for C3 to C6 binding as effectively as the
wild-type control (Fig. 3A). However, complex C2 was not as
effectively competed with URS1
91T
. In these experiments, C1
was not effectively competed by either the wild-type or 91T
probe. These results suggest that the derepression observed
with the C91T mutation is due to reduced Ume6p binding to
URS1. Next, the entire URS1 GC core consensus element was
mutated (URS1
GC
) (Fig. 3E) and used as a competitor in
EMSAs using URS1
SPO13
and wild-type vegetative extracts.
These experiments found that the formation of the C1 to C3
complexes was not affected by this competitor, indicating that,
along with the Ume6p-dependent C1 and C2 complexes, the
C3 complex also recognizes the GC-rich URS core element
(Fig. 3B). The C5 and C6 complexes, however, were still ef-
fectively competed by URS1
GC
, indicating that they recognize
another element(s) in the probe.
To determine what sequences direct C5 and C6 complex
formation, we examined the flanking sequences more carefully.
5 to URS1 is a motif (GAAATA) with significant homology to
the auxiliary repression element (ARE) described for the mei-
otic gene HSP82 (34). This element helps maintain full repres-
sion of HSP82 during vegetative growth and is found in the
promoters of several early meiotic genes (data not shown). The
other flanking region contains sequences similar to the T4C
motif that is required for full transcriptional activation of the
meiotic gene IME2 (3). To test if either one, or both, of these
motifs was directing the binding of C5 or C6, mutant oligonu-
cleotides were synthesized with changes in either T4C
(URS1
T4C
) or T4C and ARE (URS1
ARE/T4C
) (see Fig.
3E). The duplex oligonucleotides were radiolabeled and incu-
FIG. 3. Multiple protein binding elements exist in URS1
SPO13
. (A) Unlabeled wild-type (URS1
SPO13
) or mutant (URS1
91T
) oligonucleotides
were added (50-fold, 150-fold, and 300-fold excess) to standard EMSA with wild-type extracts prepared from mid-log-phase cells. The six
complexes are indicated by black arrows. Ø, no competitor added. (B) Competition EMSA as described for panel A with the unlabeled URS1
GC
oligonucleotide added. N, no extract added; Ø, no competitor added. (C)
32
P-labeled wild-type (URS1
SPO13
) and two mutant URS1 oligonucleo
-
tide probes (URS1
T4C
, URS1
T4C/ARE
) were incubated with wild-type mid-log-phase extracts in standard EMSA reactions. N, no extract added.
The six specific complexes observed under wild-type conditions are indicated by black arrows. (D) EMSA conducted with radiolabeled URS1
SPO13
and the indicated unlabeled competitors. Complexes 5 and 6 are indicated. Ø, no competitor added. (E) The DNA sequences of wild-type
URS1
SPO13
and mutant derivatives are indicated. Proposed locations of the repressor ARE and activator T4C domains are indicated. The
complexes corresponding to each domain are indicated below the sequences. The T4C and ARE double-mutant oligonucleotide represented
in panel C is not shown for clarity.
V
OL. 9, 2010 Sin3p REGULATES TRANSIENT TRANSCRIPTION 1839
Page 5
bated with wild-type mitotic extracts in a standard EMSA. The
alteration of T4C eliminated C5 formation, while changing
both ARE and T4C dramatically reduced C5 and C6 assembly
(Fig. 3C). Enhanced binding of C3 was observed for both
mutant oligonucleotides. The underlying reason for this obser-
vation is unclear but may be the result of the mutations intro-
duced into these derivatives providing a better binding sub-
strate for this unknown protein (or proteins). To strengthen
these conclusions, standard unlabeled competitor assays were
performed as described in the legend to Fig. 3A. In these
assays, gel conditions and exposure times were employed that
allowed better separation and visualization of C5 and C6. Oligo-
nucleotides 91T and GC were able to compete with C5 and
C6 in a manner similar to that of the wild-type probe (Fig. 3D).
However, the T4C mutant probe failed to compete for C5,
while ARE did not compete for C6. As expected, the double
mutant failed to compete for either complex. These results
indicate that three separate domains exist within URS1
SPO13
.
Three functional elements are present at URS1
SPO13
. To
test the physiological significance of the elements identified in
vitro, the different mutations represented in Fig. 3 were intro-
duced into an spo13-lacZ reporter gene. Cultures harboring
the different reporter genes were transferred to SPM and sam-
ples taken at various time points. Protein extracts were pre-
pared from samples collected prior to the switch to SPM (0 h)
and at subsequent times as indicated in Fig. 4. For each ex-
periment, the wild-type spo13-lacZ expression pattern was de-
termined in parallel cultures. Mutating this reporter gene at
position 91 (91T) allowed constitutive -galactosidase ex-
pression in vegetative cells but prevented full induction during
meiosis (Fig. 4A), suggesting that partial repression of Ume6p
was still retained and that induction was reduced. Altering the
entire GC core sequence, which failed to compete for Ume6p
complex formation, resulted in high vegetative spo13-lacZ ex-
pression that was similar to its fully induced levels observed in
wild-type meioses (Fig. 4B). These observations indicate that
URS1 participates in both repression and activation of SPO13
transcription in meiosis.
The T4C and ARE DNA elements regulate SPO13 meiotic
induction and vegetative repression. The A-rich sequence re-
sembling the T4C coactivator sequence required for complex 5
formation was mutated (T4C) in the spo13-lacZ reporter
gene. Analysis of -galactosidase expression revealed that,
while mitotic repression was unaffected by this mutation, peak
meiotic expression was reduced (Fig. 4C), indicating that this
sequence is required for full derepression of spo13-lacZ. Next,
we tested the functionality of the sequence resembling the
ARE repression element. Mutating this sequence (ARE) re-
vealed two defects in the spo13-lacZ expression profile. First, a
low level of derepression was observed in vegetative cells (Fig.
4D) that was similar to the levels observed in sin3 mutants.
Next, no meiotic induction was observed, as the activity re-
mained constant throughout the time course. These results
indicate that the ARE serves two roles in both maintaining
vegetative repression and directing normal induction. Taken
together, the in vitro and in vivo results indicate the presence of
two additional functional elements in the SPO13 promoter.
The T4C element is required for full induction, while the
URS1 and ARE control both repression and activation.
PAH3 and PAH4 are required to reestablish transcriptional
repression of early meiotic genes. The meiotic transcription
program consists of several waves of transient expression that
are partitioned into three general classes termed early, middle,
and late (reviewed in reference 20). Most analyses of meiotic
gene repression have focused on regulation during mitotic cell
division. However, the repression of these genes is reestab-
lished (meiotic repression) to their vegetative levels late in
meiosis. To determine if Sin3p is required for meiotic repres-
sion, diploid strains were constructed that are homozygous for
either the wild-type, null, or different PAH mutant alleles in a
strain background (SK1) that exhibits synchronous meiotic
progression (see Table 1). These strains were induced to un-
dergo meiosis, and SPO13 transcription profiles were followed
by Northern blot analysis. Compared to the wild type, the sin3
mutant displayed two distinct differences. First, peak SPO13
mRNA accumulation was delayed (Fig. 5A, black arrowheads;
quantitated in Fig. 5B) compared to that in the wild type.
Second, rerepression was not fully established in the sin3 mu-
tant strain, as SPO13 mRNA levels at 12 h posttransfer to SPM
were reduced to only 40% of the peak expression value com-
pared to 5% for the wild-type control (Fig. 5C). These results
indicate that Sin3p is required for both normal induction and
efficient establishment of meiotic repression.
To determine which, if any, of the PAH domains is required
for either normal induction or meiotic repression, the experi-
ments were repeated with the pah deletion diploids. These
experiments revealed that no single PAH domain was required
for the timely induction of SPO13 mRNA (Fig. 5A and B).
However, both PAH3 and PAH4 mutants exhibited a defect in
reestablishing SPO13 repression as the cells completed the
FIG. 4. Three functional domains exist at URS1
SPO13
. Strain S104
harboring the wild-type spo13-lacZ reporter expression plasmid or
derivatives containing URS1 mutations as indicated was induced to
enter meiosis. -Galactosidase activity was determined from samples
taken at the times indicated. Each point represents the average of
values for that time point from 2 to 3 independent experiments mea-
sured in triplicate or quadruplicate. Error bars represent standard
deviations of the means (Miller units). The closed and open circles
denote the wild-type and mutant spo13-lacZ expression patterns, re-
spectively.
1840 MALLORY ET AL. EUKARYOT.CELL
Page 6
meiotic program. The magnitudes of the defect, when normal-
ized to peak induction values, were similar between the null
and pah3 or pah4 strains (Fig. 5C). These results suggest
that these two PAH domains do not contribute a portion of the
rerepression activity independently. Rather, the data suggest
that each domain provides an essential function.
The inability to reestablish repression in sin3 and pah3
strains may be a consequence of the meiotic arrest associated
with these mutations. However, the pah4 mutant, which also
displays a failure to reestablish repression, executes meiosis
with kinetics identical to those of the wild type (Fig. 5D).
These findings suggest that Sin3p-dependent repression of
SPO13 is independent of meiotic progression. In addition, the
delayed SPO13 mRNA accumulation profile observed in the
null strain suggests that Sin3p has an activity that is indepen-
dent of any individual PAH domain.
The next question we posed is whether the continued ex-
pression of SPO13 in an sin3 mutant was a terminal pheno-
type or part of a delayed transient transcription profile. To test
these possibilities, an extended meiotic time course was per-
formed. Total RNA was prepared from samples collected from
the wild type and the sin3-null mutant for 48 h following the
shift to sporulation medium. In addition, more sensitive S1
nuclease protection assays were performed to allow the detec-
tion of even a relatively small defect in late meiotic repression.
As observed above, SPO13 mRNA levels remain elevated in
the sin3 mutant even 48 h following meiotic induction (Fig.
6A). These findings indicate that Sin3p is required for reestab-
lishing EMG repression.
Sin3p is required for the meiotic repression of additional
expression classes. A previous study reported that Sin3p is
required for the normal induction of SPS4, a member of the
“middle” gene expression group (21). To test whether the PAH
domains are required for SPS4 induction, the Northern blots
shown in Fig. 5 were stripped and reprobed with SPS4 se-
quences. These experiments revealed a reduction and delay in
SPS4 mRNA accumulation in the null strain compared to that
in the wild-type control (Fig. 5A). However, the examination of
the PAH mutant strains did not reveal a defect in SPS4 induc-
tion. Therefore, similar to SPO13 regulation, the delay in SPS4
transcript accumulation appears to be independent of any one
PAH domain. In addition, meiotic repression of SPS4 was also
FIG. 5. PAH3 and PAH4 are required to reestablish SPO13 repression in meiotic cells. Isogenic wild-type (RSY877), sin3 (RSY1028), pah1
(RSY1029), pah2 (RSY1030), pah3 (RSY1031), or pah4 (RSY1032) strains were induced to enter meiosis, and time points were taken as
indicated. Northern blots of total RNA were probed with SPO13 (black arrowheads) and then stripped and probed sequentially with probes
directed toward SPS4 (gray arrowheads) and ENO1 (white arrowheads). (B) Quantitation of SPO13 signals in panel A following standardization
with ENO1. The time point exhibiting the maximum signal from each time course was set at 100%. (C) The percentage of maximum induction of
the 12-h signal from panel B is shown for the SIN3 alleles indicated. (D) Meiotic progression in the wild type (RSY877) and pah4 mutant
(RSY1032) was determined by monitoring nuclear divisions using DAPI analysis. The percentage of each population executing at least one nuclear
division is shown.
V
OL. 9, 2010 Sin3p REGULATES TRANSIENT TRANSCRIPTION 1841
Page 7
defective in the sin3 strain as well as both pah3 and pah4
mutants (Fig. 5A, compare the 12-h time points). These results
suggest that Sin3p couples the timings of early and middle gene
expression.
We next tested the role of Sin3p in regulating the transcrip-
tion of two additional meiosis-specific genes. First, the expres-
sion profile of another middle gene (SPS2) (24) was examined.
In this case, we expanded the time course to more fully eval-
uate the role of Sin3p in meiotic repression. Interestingly, SPS2
induction was also delayed approximately 3 h (Fig. 6A) as
observed for SPS4 mRNA. However, unlike SPS4 transcrip-
tion, SPS2 mRNA levels returned to their preinduction levels
with kinetics similar to those of the wild type (note the differ-
ent time points for SPO13 and SPS2 experiments). These find-
ings indicate that SIN3 is required for the normal timing and
magnitude of middle-gene induction but not the meiotic re-
pression of all loci in this expression group.
We next examined whether Sin3p was required for meiotic
repression of IME1, a gene transcribed prior to the EMG
(reviewed in reference 12). In the sin3 mutant, a low level of
IME1 transcript is observed prior to transfer to SPM (Fig. 6A,
compare the 0 h time points). However, IME1 mRNA is often
observed in wild-type cells growing in acetate-based medium
(14), making any conclusions about Sin3p repressing IME1
expression difficult. However, compared to those of the wild
type, IME1 mRNA levels remain elevated throughout the du-
ration of the experiment in the sin3 mutant. These results
indicate that Sin3p is also required for reestablishing IME1
repression as cells progress through meiosis.
To further explore the role of the PAH domains in meiotic
repression, the mRNA levels of IME1, SPS4, and SPO13 were
monitored in the wild-type, sin3, pah3, and pah4 strains.
For these studies, qPCR was utilized to quantitate the mRNA
levels during meiosis (see Materials and Methods for details).
Time points were taken at 12 and 18 h following transfer to
SPM to focus on the meiotic repression activities of these
Sin3p derivatives. The expression levels of each mRNA were
first normalized to ENO1 transcript levels and then compared
to those of the wild-type strain. At 12 h, the sin3, pah3, and
pah4 mutants exhibited significant increases in mRNA levels
for all loci tested. By 18 h, the sin3 mutant still displayed
meiotic repression defects, as observed in Fig. 6A. Although
still exhibiting elevated mRNA levels, the requirement for
PAH3 or PAH4 for meiotic repression was more modest at this
later time point. Similar results were observed for a 36-h time
point (data not shown). Taken together, our findings provide
evidence for an expanded role for Sin3p in reestablishing re-
pression of meiotic genes from different expression classes.
DISCUSSION
This report dissects the contributions of the four Sin3p PAH
domains in controlling both in vivo meiotic gene expression
and in vitro promoter-protein complex formation. PAH2 and
PAH3, but not PAH1 and PAH4, are required for EMG tran-
scription during vegetative growth and efficient recombination
during meiosis. In addition, Sin3p is required for both the
normal timing of induction and reestablishing repression of
meiotic genes from several expression classes. The latter activ-
ity requires only PAH3 and PAH4, suggesting that a different
repression mechanism is installed in postinduction meiotic
cells than the one active during mitotic cell division.
Our data indicated that the PAH domains played separable
roles in repressing meiotic gene transcription. Only PAH2 and
PAH3 are required for repression in vegetative cells, while
PAH3 and PAH4 are solely responsible for meiotic repression
as the cells complete the sporulation program. As outlined
earlier, the roles of PAH2 and PAH3 have been elucidated and
found to be conserved. PAH2 associates with DNA binding
proteins, while PAH3 tethers the HDAC to promoters. Much
less is known about PAH4 function, although the finding that
this domain recruits the O-linked N-acetylglucosamine (O-
GlcNac) transferase (OGT) to promoters provides some clues
to its role. This study found that PAH4 interacted with the
tetratricopeptide (TRP) protein-protein interaction domain on
OGT (45). This interaction is required for establishing the
repression of SP1-activated genes in HepG2 cell culture. How-
ever, this enzyme is not found in yeast, suggesting that another
TRP protein may be bound by PAH4. Analysis of the yeast
proteome identified several TRP proteins that function in a
variety of processes, including protein trafficking and destruc-
tion. Interestingly, a prominent corepressor, Cyc8p, also pos-
sesses TRP repeats. Determining what role, if any, Cyc8p and
other TRP proteins play in meiotic repression may provide
insight into the mechanism by which PAH4 exerts its control.
FIG. 6. Sin3p displays expanded meiotic regulatory targets. (A) S1
nuclease protection assay monitoring IME1, SPO13, and SPS2 mRNA
levels in wild-type (RSY887) and sin3 (RSY1028) cultures in extended
meiotic time courses. Arrows indicate the protected riboprobe for each
mRNA. (B) Quantitative PCR was utilized to monitor mRNA levels of
the indicated genes at either 12 h (top) or 18 h (bottom) in wild-type
(RSY877), sin3 (RSY1028), pah3 (RSY1031), or pah4 (RSY1032)
strains. The graphs are expressed as fold increase over wild-type
mRNA levels at a given time point. Note the split axes for the 18-h
time points.
1842 MALLORY ET AL. E
UKARYOT.CELL
Page 8
A poorly understood facet of meiotic gene regulation is how
transcriptional repression is reestablished following normal in-
duction. Several findings in the present and previous studies
argue that the system controlling mitotic repression of the
EMG is different than that installed in meiotic cells. First,
Ume6p is not required for reestablishing repression. This is
demonstrated in several ways. We have previously shown that
Ume6p destruction is required for EMG induction (16). How-
ever, Ume6p levels do not return until spore wall assembly,
which occurs after EMG repression is reestablished. Consis-
tent with this conclusion, we demonstrate that PAH2, the
Ume6p interaction domain, is not required for reestablishing
repression. In addition, other factors that mediate EMG re-
pression in vegetative cells are not required for reestablishing
repression. For example, loss of Ume1p (17), cyclin C (Ssn3p)
(8), or Cdk8p (Ssn8p) (33) activity does not effect this process.
We have not directly tested the role of Rpd3p in this regula-
tion, but the requirement of PAH3, the HDAC-interacting
domain, strongly suggests this possibility. These results indi-
cate that only Sin3p and Rpd3p are required for EMG repres-
sion before and after induction. Furthermore, Sin3p utilizes
PAH2 and PAH3 for vegetative repression but PAH3 and
PAH4 for meiotic repression.
How does Sin3p mediate meiotic repression? Most studies
to date in several systems indicate that Sin3p is recruited to the
promoter by a DNA binding factor. For EMG vegetative re-
pression, Ume6p serves this role. However, Ume6p is not
involved in Sin3p-dependent meiotic repression. One possibil-
ity is that Sin3p jumps to one of the other two DNA binding
factors identified in this report that recognize the ARE or T4C
sequences (see Fig. 7, bottom right). In support of this model,
EMSA analysis found that complexes C5 and C6 are main-
tained throughout meiosis and spore formation (data not
shown). An alternative possibility is that Sin3p does not utilize
a transcription factor to reestablish repression (Fig. 7, bottom
left). For example, chromatin immunoprecipitation studies re-
vealed that the human Sin3 associates with additional loci
independent of known DNA binding factors following myo-
genic differentiation (35). In addition, the Sin3p-Rpd3p com-
plex can stably associate with chromatin in vitro (36). A careful
mapping of Sin3p-Rpd3p locations before and after induction,
as well as the identification of the ARE and/or T4C binding
proteins, will be necessary to answer this question.
Why employ two systems to repress EMG expression? Dur-
ing vegetative growth, the meiotic genes are silent but must be
ready to be activated upon the correct environmental cues.
However, following the induction of these genes during meio-
sis, the cell completes the program and the haploid nuclei are
encapsulated into spores. These spores can remain dormant
for extended periods without losing viability. Therefore, a
mechanism that maintains repression in spores has to be sturdy
but perhaps not as responsive. Then, as the spore germinates
and returns to mitotic cell division, the responsive, PAH2-
dependent system would be installed at the early meiotic pro-
moters. Understanding the nature of this system may shed light
onto gene silencing that occurs in terminally differentiated cells
in higher systems.
ACKNOWLEDGMENTS
We thank E. Winter, K. Cooper, and M. Henry for helpful discus-
sions and critical readings of the manuscript. We thank D. Stillman for
the PAH deletion series and valuable discussion throughout the course
of this work.
This work was supported by public health service grants GM-086788
and CA-099003 from the General Medicine and National Cancer In-
stitute, respectively.
REFERENCES
1. Arcangioli, B., and B. Lescure. 1985. Identification of proteins involved in
the regulation of yeast iso-1-cytochrome C expression by oxygen. EMBO
4:2627–2633.
2. Ayer, D. E., Q. A. Lawrence, and R. N. Eisenman. 1995. Mad-Max transcrip-
tional repression is mediated by ternary complex formation with mammalian
homologs of yeast repressor Sin3. Cell 80:767–776.
3. Bowdish, K. S., and A. P. Mitchell. 1993. Bipartite structure of an early
meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol.
Cell. Biol. 13:2172–2181.
4. Braunstein, M., A. B. Rose, S. G. Holmes, C. D. Allis, and J. R. Broach. 1993.
Transcriptional silencing in yeast is associated with reduced nucleosome
acetylation. Genes Dev. 7:592–604.
5. Buckingham, L. E., H.-T. Wang, R. T. Elder, R. M. McCarroll, M. R. Slater,
and R. E. Esposito. 1990. Nucleotide sequence and promoter analysis of
SPO13, a meiosis-specific gene of Saccharomyces cerevisiae. Proc. Natl. Acad.
Sci. U. S. A. 87:9406–9410.
6. Carrozza, M., L. Florens, S. Swanson, W. Shia, S. Anderson, J. Yates, M.
Washburn, and J. Workman. 2005. Stable incorporation of sequence specific
repressors Ash1 and Ume6 into the Rpd3L complex. Biochim. Biophys. Acta
1731:77–87; discussion 75–76.
7. Chu, S., J. DeRisi, M. Eisen, J. Mulholland, D. Botstein, P. O. Brown, and
I. Herskowitz. 1998. The transcriptional program of sporulation in budding
yeast. Science 282:699–705.
8. Cooper, K. F., and R. Strich. 2002. Saccharomyces cerevisiae C-type cyclin
UME3/SRB11 is required for efficient induction and execution of meiotic
development. Eukaryot. Cell 1:67–76.
9. Gietz, R. D., and A. Sugino. 1988. Escherichia coli shuttle vectors constructed
with in vitro mutagenized yeast genes lacking six-base-pair restriction sites.
Gene 74:527–534.
10. Goldmark, J. P., T. G. Fazzio, P. W. Estep, G. M. Church, and T. Tsukiyama.
2000. The Isw2 chromatin remodeling complex represses early meiotic genes
upon recruitment by Ume6p. Cell 103:423–433.
11. Hepworth, S. R., H. Friesen, and J. Segall. 1998. NDT80 and the meiotic
recombination checkpoint regulate expression of middle sporulation-specific
genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:5750–5761.
12. Honigberg, S. M., R. M. McCarroll, and R. E. Esposito. 1993. Regulatory
mechanisms in meiosis. Curr. Opin. Cell Biol. 5:219–225.
13. Kadosh, D., and K. Struhl. 1997. Repression by Ume6 involves recruitment
of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to
target promoters. Cell 89:365–371.
14. Kassir, Y., D. Granot, and G. Simchen. 1988. IME1, a positive regulator of
meiosis in S. cerevisiae. Cell 52:853–862.
FIG. 7. Model for Sin3p-dependent mitotic (top) and two potential
meiotic (bottom) repression systems. During vegetative growth, Sin3p
bridges Rpd3p to Ume6p, utilizing PAH3 and PAH2, respectively.
Meiotic repression occurs in the absence of Ume6p and requires
PAH3 and PAH4 by associating to the promoter in a transcription
factor-independent (left) or -dependent (right) fashion.
V
OL. 9, 2010 Sin3p REGULATES TRANSIENT TRANSCRIPTION 1843
Page 9
15. Laherty, C. D., W.-M. Yang, J.-M. Sun, J. R. Davie, E. Seto, and R. N.
Eisenman. 1997. Histone deacetylases associated with the mSin3 corepressor
mediate mad transcriptional repression. Cell 89:349–356.
16. Mallory, M. J., K. F. Cooper, and R. Strich. 2007. Meiosis-specific destruc-
tion of the Ume6p repressor by the Cdc20-directed APC/C. Mol. Cell 27:
951–961.
17. Mallory, M. J., and R. Strich. 2003. Ume1p represses meiotic gene tran-
scription in S. cerevisiae through interaction with the histone deacetylase
Rpd3p. J. Biol. Chem. 278:44727–44734.
18. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a labo-
ratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
19. Meluh, P. B., and D. Koshland. 1997. Budding yeast centromere composition
and assembly as revealed by in vivo cross-linking. Genes Dev. 11:3401–3412.
20. Mitchell, A. P. 1994. Control of meiotic gene expression in Saccharomyces
cerevisiae. Microbiol. Rev. 58:56–70.
21. Pak, J., and J. Segall. 2002. Regulation of the premiddle and middle phases
of expression of the NDT80 gene during sporulation of Saccharomyces cer-
evisiae. Mol. Cell. Biol. 22:6417–6429.
22. Park, H.-O., and E. A. Craig. 1989. Positive and negative regulation of basal
expression of a yeast HSP70 gene. Mol. Cell. Biol. 9:2025–2033.
23. Park, H. D., R. M. Luche, and T. G. Cooper. 1992. The yeast UME6 gene
product is required for transcriptional repression mediated by the CAR1
URS1 repressor binding site. Nucleic Acids Res. 20:1909–1915.
24. Percival-Smith, A., and J. Segall. 1986. Characterization and mutational
analysis of a cluster of three genes expressed preferentially during sporula-
tion of Saccharomyces cerevisiae. Mol. Cell. Biol. 6:2443–2451.
25. Primig, M., R. M. Williams, E. A. Winzeler, G. G. Tevzadze, A. R. Conway,
S. Y. Hwang, R. W. Davis, and R. E. Esposito. 2000. The core meiotic
transcriptome in budding yeasts. Nat. Genet. 26:415–423.
26. Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue:
integrative DNA transformation in yeast, p. 281–301. In J. N. Abelson and
M. I. Simon (ed.), Methods in enzymology, vol. 194. Academic Press Inc.,
San Diego, CA.
27. Russell, D. W., R. Jensen, M. J. Zoller, J. Burke, B. Errede, M. Smith, and
I. Herskowitz. 1986. Structure of the Saccharomyces cerevisiae HO gene and
analysis of its upstream regulatory region. Mol. Cell. Biol. 6:4281–4294.
28. Schreiber-Agus, N., L. Chin, K. Chen, R. Torres, G. Rao, P. Guida, A. I.
Skoultchi, and R. A. DePiho. 1995. An amino-terminal domain of Mxi1
mediates anti-myc oncogenic activity and interacts with a homolog of the
yeast transcriptional repressor SIN33. Cell 80:777–786.
29. Silverstein, R. A., and K. Ekwall. 2005. Sin3: a flexible regulator of global
gene expression and genome stability. Curr. Genet. 47:1–17.
30. Strich, R., M. R. Slater, and R. E. Esposito. 1989. Identification of negative
regulatory genes that govern the expression of early meiotic genes in yeast.
Proc. Natl. Acad. Sci. U. S. A. 86:10018–10022.
31. Strich, R., R. T. Surosky, C. Steber, E. Dubois, F. Messenguy, and R. E.
Esposito. 1994. UME6 is a key regulator of nitrogen repression and meiotic
development. Genes Dev. 8:796–810.
32. Sumrada, R. A., and T. G. Cooper. 1985. Point mutation generates consti-
tutive expression of an inducible eukaryotic gene. Proc. Natl. Acad. Sci.
U. S. A. 82:643–647.
33. Surosky, R. T., R. Strich, and R. E. Esposito. 1994. The yeast UME5 gene
regulates the stability of meiotic mRNAs in response to glucose. Mol. Cell.
Biol. 14:3446–3458.
34. Szent-Gyorgyi, C. 1995. A bipartite operator interacts with a heat shock
element to mediate early meiotic induction of Saccharomyces cerevisiae
HSP82. Mol. Cell. Biol. 15:6754–6769.
35. van Oevelen, C., J. Wang, P. Asp, Q. Yan, W. G. Kaelin, Jr., Y. Kluger, and
B. D. Dynlacht. 2008. A role for mammalian Sin3 in permanent gene silenc-
ing. Mol. Cell 32:359–370.
36. Vermeulen, M., W. Walter, X. Le Guezennec, J. Kim, R. S. Edayathuman-
galam, E. Lasonder, K. Luger, R. G. Roeder, C. Logie, S. L. Berger, and
H. G. Stunnenberg. 2006. A feed-forward repression mechanism anchors the
Sin3/histone deacetylase and N-CoR/SMRT corepressors on chromatin.
Mol. Cell. Biol. 26:5226–5236.
37. Vershon, A. K., N. M. Hollingsworth, and A. D. Johnson. 1992. Meiotic
induction of the yeast HOP1 gene is controlled by positive and negative
regulatory sites. Mol. Cell. Biol. 12:3706–3714.
38. Vidal, M., A. M. Buckley, C. Yohn, D. J. Hoeppner, and R. F. Gaber. 1995.
Identification of essential nucleotides in an upstream repressing sequence of
Saccharomyces cerevisiae by selection for increased expression of TRK2.
Proc. Natl. Acad. Sci. U. S. A. 92:2370–2374.
39. Vidal, M., and R. F. Gaber. 1991. RPD3 encodes a second factor required to
achieve maximum positive and negative transcriptional states in Saccharo-
myces cerevisiae. Mol. Cell. Biol. 11:6317–6327.
40. Vidal, M., R. Strich, R. E. Esposito, and R. F. Gaber. 1991. RPD1 (SIN3/
UME4) is required for maximal activation and repression of diverse yeast
genes. Mol. Cell. Biol. 11:6306–6316.
41. Vogelauer, M., J. Wu, N. Suka, and M. Grunstein. 2000. Global histone
acetylation and deacetylation in yeast. Nature 408:495–498.
42. Wang, H., I. Clark, P. R. Nicholson, I. Herskowitz, and D. J. Stillman. 1990.
The Saccharomyces cerevisiae SIN3 gene, a negative regulator of HO, con-
tains four paired amphipathic helix motifs. Mol. Cell. Biol. 10:5927–5936.
43. Wang, H., and D. J. Stillman. 1993. Transcriptional repression in Saccharo-
myces cerevisiae by a SIN3-LexA fusion protein. Mol. Cell. Biol. 13:1804–
1815.
44. Washburn, B. K., and R. E. Esposito. 2001. Identification of the Sin3-binding
site in Ume6 defines a two-step process for conversion of Ume6 from a
transcriptional repressor to an activator in yeast. Mol. Cell. Biol. 21:2057–
2069.
45. Yang, X., F. Zhang, and J. E. Kudlow. 2002. Recruitment of O-GlcNAc
transferase to promoters by corepressor mSin3A: coupling protein O-
GlcNAcylation to transcriptional repression. Cell 110:69–80.
1844 MALLORY ET AL. EUKARYOT.CELL
Page 10
  • Source
    • "The functional significance of the VTH RNA/protein patterns observed during growth, starvation and development could be the consequence at least three distinct mechanisms that are not mutually exclusive: (i) Vth2 could become unstable in the presence of acetate because it is targeted by a protease like in the case of Ume6 [26,46]; (ii) uORFs present in the extended 5 0 -UTR might inhibit protein translation [45]; (iii) Vth2 protein levels could be down-regulated because VTH2 mRNA and its antisense VDT2 form double-stranded RNA molecules that sequester mRNAs in the nucleus, or that prevent ribosome subunits from associating with the mRNAs. Extensive experimental work will be required to conclusively determine the mechanism(s) behind the expression patterns observed. "
    [Show abstract] [Hide abstract] ABSTRACT: The tripartite Rpd3/Sin3/Ume6 complex represses meiotic isoforms during mitosis. We asked if it also controls starvation-induced isoforms. We report that VTH1/VTH2 encode acetate-inducible isoforms with extended 5'-regions overlapping antisense long non-coding RNAs. Rpd3 and Ume6 repress the long isoform of VTH2 during fermentation. Cells metabolizing glucose contain Vth2, while the protein is undetectable in acetate and during sporulation. VTH2 is a useful model locus to study mechanisms implicating promoter directionality, lncRNA transcription and post-transcriptional control of gene expression via 5'-UTRs. Since mammalian genes encode transcript isoforms and Rpd3 is conserved, our findings are relevant for gene expression in higher eukaryotes. Copyright © 2015. Published by Elsevier B.V.
    Full-text · Article · Feb 2015 · FEBS Letters
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Cells encounter numerous signals during the development of an organism that induce division, differentiation, and apoptosis. These signals need to be present for defined intervals in order to induce stable changes in the cellular phenotype. The point after which an inducing signal is no longer needed for completion of a differentiation program can be termed the "commitment point." Meiotic development in the yeast Saccharomyces cerevisiae (sporulation) provides a model system to study commitment. Similar to differentiation programs in multicellular organisms, the sporulation program in yeast is regulated by a transcriptional cascade that produces early, middle, and late sets of sporulation-specific transcripts. Although critical meiosis-specific events occur as early genes are expressed, commitment does not take place until middle genes are induced. Middle promoters are activated by the Ndt80 transcription factor, which is produced and activated shortly before most middle genes are expressed. In this article, I discuss the connection between Ndt80 and meiotic commitment. A transcriptional regulatory pathway makes NDT80 transcription contingent on the prior expression of early genes. Once Ndt80 is produced, the recombination (pachytene) checkpoint prevents activation of the Ndt80 protein. Upon activation, Ndt80 triggers a positive autoregulatory loop that leads to the induction of genes that promote exit from prophase, the meiotic divisions, and spore formation. The pathway is controlled by multiple feed-forward loops that give switch-like properties to the commitment transition. The conservation of regulatory components of the meiotic commitment pathway and the recently reported ability of Ndt80 to increase replicative life span are discussed.
    Preview · Article · Mar 2012 · Microbiology and molecular biology reviews: MMBR
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Differentiation programs require strict spatial and temporal control of gene transcription. Genes expressed during meiotic development in S. cerevisiae display transient induction and repression. Early meiotic gene (EMG) repression during mitosis is achieved by recruiting both histone deacetylase and chromatin remodeling complexes to their promoters by the zinc clusterDNA binding protein Ume6p. Ume6p repression is relieved by ubiquitin-mediated destruction that is stimulated by Gcn5p induced acetylation. In this report, we demonstrate that Gcn5p acetylation of separate lysines within the zinc cluster domain negatively impacts Ume6p DNA binding. Mimicking lysine acetylation using glutamine substitution mutations decreased Ume6p binding efficiency and resulted in partial derepression of Ume6p-regulated genes. Consistent with this result, molecular modeling predicted that these lysine side chains are adjacent to the DNA phosphate backbone suggesting that acetylation inhibits Ume6p binding by electrostatic repulsion. Preventing acetylation did not impact final EMG induction levels during meiosis. However, a delay in EMG induction was observed that became more severe in later expression classes ultimately resulting in delayed and reduced execution of the meiotic nuclear divisions. These results indicate that Ume6p acetylation insures the proper timing of the transient transcription program during meiotic development.
    Full-text · Article · Dec 2013 · Molecular and Cellular Biology