Sipl1 and Rbck1 Are Novel Eya1-Binding Proteins with a Role in Craniofacial Development

Article (PDF Available)inMolecular and Cellular Biology 30(24):5764-75 · October 2010with24 Reads
DOI: 10.1128/MCB.01645-09 · Source: PubMed
Abstract
The eyes absent 1 protein (Eya1) plays an essential role in the development of various organs in both invertebrates and vertebrates. Mutations in the human EYA1 gene are linked to BOR (branchio-oto-renal) syndrome, characterized by kidney defects, hearing loss, and branchial arch anomalies. For a better understanding of Eya1's function, we have set out to identify new Eya1-interacting proteins. Here we report the identification of the related proteins Sipl1 (Shank-interacting protein-like 1) and Rbck1 (RBCC protein interacting with PKC1) as novel interaction partners of Eya1. We confirmed the interactions by glutathione S-transferase (GST) pulldown analysis and coimmunoprecipitation. A first mechanistic insight is provided by the demonstration that Sipl1 and Rbck1 enhance the function of Eya proteins to act as coactivators for the Six transcription factors. Using reverse transcriptase PCR (RT-PCR) and in situ hybridization, we show that Sipl1 and Rbck1 are coexpressed with Eya1 in several organs during embryogenesis of both the mouse and zebrafish. By morpholino-mediated knockdown, we demonstrate that the Sipl1 and Rbck1 orthologs are involved in different aspects of zebrafish development. In particular, knockdown of one Sipl1 ortholog as well as one Rbck1 ortholog led to a BOR syndrome-like phenotype, with characteristic defects in ear and branchial arch formation.
MOLECULAR AND CELLULAR BIOLOGY, Dec. 2010, p. 5764–5775 Vol. 30, No. 24
0270-7306/10/$12.00 doi:10.1128/MCB.01645-09
Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Sipl1 and Rbck1 Are Novel Eya1-Binding Proteins with a Role in
Craniofacial Development
Kathrin Landgraf,
1
# Frank Bollig,
1
Mark-Oliver Trowe,
2
Birgit Besenbeck,
1
Christina Ebert,
1
Dagmar Kruspe,
1
Andreas Kispert,
2
Frank Ha¨nel,
3
and Christoph Englert
1
*
Leibniz Institute for Age Research-Fritz Lipmann Institute, Beutenbergstrasse 11, 07745 Jena, Germany
1
; Hannover Medical School,
Institute for Molecular Biology, OE5250, Carl-Neuberg-Str. 1, 30625 Hannover, Germany
2
; and
Leibniz Institute for Natural Product Research and Infection Biology-Hans Kno¨ll Institute,
Beutenbergstrasse 11a, 07745 Jena, Germany
3
Received 22 December 2009/Returned for modification 15 February 2010/Accepted 5 October 2010
The eyes absent 1 protein (Eya1) plays an essential role in the development of various organs in both
invertebrates and vertebrates. Mutations in the human EYA1 gene are linked to BOR (branchio-oto-renal)
syndrome, characterized by kidney defects, hearing loss, and branchial arch anomalies. For a better under-
standing of Eya1’s function, we have set out to identify new Eya1-interacting proteins. Here we report the
identification of the related proteins Sipl1 (Shank-interacting protein-like 1) and Rbck1 (RBCC protein
interacting with PKC1) as novel interaction partners of Eya1. We confirmed the interactions by glutathione
S-transferase (GST) pulldown analysis and coimmunoprecipitation. A first mechanistic insight is provided by
the demonstration that Sipl1 and Rbck1 enhance the function of Eya proteins to act as coactivators for the Six
transcription factors. Using reverse transcriptase PCR (RT-PCR) and in situ hybridization, we show that Sipl1
and Rbck1 are coexpressed with Eya1 in several organs during embryogenesis of both the mouse and zebrafish.
By morpholino-mediated knockdown, we demonstrate that the Sipl1 and Rbck1 orthologs are involved in
different aspects of zebrafish development. In particular, knockdown of one Sipl1 ortholog as well as one Rbck1
ortholog led to a BOR syndrome-like phenotype, with characteristic defects in ear and branchial arch
formation.
The human EYA1 gene is an ortholog of the fruit fly eyes
absent gene (eya), which was identified as a regulator of com-
pound eye development. In contrast to the single eya gene
found in Drosophila melanogaster, mammals possess four Eya
paralogs, designated Eya1-4. The respective gene products are
characterized by a C-terminal domain called the Eya domain,
which is conserved in both length (271 to 274 amino acids [aa])
and sequence. The Eya domain has an intrinsic phosphatase
activity (24, 39, 53) and is required for protein-protein inter-
actions (38). Recent studies provided evidence that the phos-
phatase function of Eya is involved in the innate immune
system and the regulation of DNA damage response (8, 35).
Interestingly, all Eya interaction partners that have been iden-
tified so far, for example, the Six and Dach proteins or inhib-
itory G protein (G) subunits, bind to the Eya domain (5, 10,
34). It has been demonstrated that the cooperative action of
Eya and Six is essential for the development of several tissues
and organs in a variety of species throughout evolution (re-
viewed in reference 6). In vertebrates, Six induces nuclear
translocation of Eya and recruitment to the DNA, and Eya
enhances Six-mediated activation of target gene expression
(34).
The N termini of Eya proteins, which are highly divergent
between Eya family members, harbor a proline-serine-threo-
nine (PST)-rich transactivation domain, which is indispensable
for their function as coactivators of transcription (31, 45, 50,
58). Natural target genes of the vertebrate Eya-Six complex
are, for example, Six2, Sall1, and Myogenin. Activation of Six2
and Sall1 expression has been shown to be essential for proper
kidney development in the mouse, whereas activation of Myo-
genin is required for muscle development (3, 4, 46).
Mutations in the human EYA1 gene are associated with
several congenital disorders, like BOR (branchio-oto-renal)
and BO (branchio-oto) syndrome, as well as ocular defects.
BOR syndrome patients suffer from severe malformations of
the ears, the branchial arch derivatives, and the kidneys, while
in BO syndrome patients, the kidneys are not affected (11, 12,
30). The physiological importance of Eya1 was underlined by
knockout studies in mice. It was shown that the phenotype of
Eya1-heterozygous mice resembles the characteristic symp-
toms of human patients suffering from BOR syndrome with
renal abnormalities, including hypoplasia and unilateral agen-
esis, and conductive hearing loss. In contrast, Eya1 homozy-
gote mice die at birth, showing severe craniofacial and skeletal
defects and the complete absence of the thymus, parathyroid
glands, ears, and kidneys due to defective inductive tissue in-
teractions (57, 59). Interestingly, similar to EYA1, the paralo-
gous EYA4 gene has also been demonstrated to be associated
with human disease. EYA4 is most closely related to EYA1
rather than EYA2 and EYA3. Mutations in EYA4 have been
* Corresponding author. Mailing address: Leibniz Institute for Age
Research-Fritz Lipmann Institute, Beutenbergstr. 11, 07745 Jena, Ger-
many. Phone: 49 3641 656042. Fax: 49 3641 656040. E-mail: cenglert
@fli-leibniz.de.
# Present address: Hospital for Children and Adolescents, Univer-
sity of Leipzig, Liebigstrasse 21, 04103 Leipzig, Germany.
† Present address: Hannover Medical School, Institute for Clinical
Chemistry, OE 8110, Carl-Neuberg-Str. 1, D-30625 Hanover, Ger-
many.
Published ahead of print on 18 October 2010.
5764
linked to cardiomyopathy and hearing loss (37, 42, 55). In
contrast, there is no evidence for the existence of disease-
associated mutations in EYA2 and EYA3 up to now.
The identification and characterization of an Eya1 ortholog
in zebrafish revealed a remarkable conservation in both the
structure and expression pattern between Eya1 genes in fish
and humans. In zebrafish, eya1 expression was detected in
several organs during embryogenesis, such as the ears, the
lateral line organ, the branchial arches, and the somites (41).
As in mammals, eya1 in zebrafish is essential for the develop-
ment of several tissues and organs. A quite well-studied exam-
ple is the zebrafish ear, whose proper formation depends on
eya1 expression, as shown by morpholino-mediated knock-
down analysis (23).
Since Eya1 is involved in the development of many different
organs, we proposed that additional factors bind to it and,
thereby, modulate its function. Using a yeast two-hybrid-based
approach, we identified the related proteins Sipl1 (Shank-in-
teracting protein-like 1) and Rbck1 (RBCC protein interacting
with PKC1) as so-far-unknown Eya1 interaction partners. We
characterized the interactions and demonstrated that both
Sipl1 and Rbck1 enhance the function of Eya proteins to act as
coactivators for the Six transcription factors. Furthermore, we
showed that Sipl1 and Rbck1 are coexpressed with Eya1 in
several organs during embryogenesis of both the mouse and
zebrafish. Importantly, the morpholino-mediated knockdown
of Sipl1 and Rbck1 orthologs in zebrafish led to a BOR syn-
drome-like phenotype, indicating the relevance of the Eya1-
Sipl1/Rbck1 interaction in vivo.
MATERIALS AND METHODS
Expression constructs and antibodies. The full-length cDNAs of Sipl1 and
Rbck1 were purchased from the ATCC (GenBank accession numbers BC016203
for Sipl1 and BC034555 for Rbck1). Mammalian expression constructs for mouse
Flag-Sipl1 and Flag-Rbck1 as well as bacterial expression constructs for gluta-
thione S-transferase (GST)–Sipl1 and GST-Rbck1 were generated by cloning of
the full-length cDNAs into pcDNA3.1-Flag and pGEX-KG (15), respectively.
Mammalian expression constructs for mouse Eya1, Eya2, and Eya3 (pHM6-
Eya1, -Eya2, -Eya3) were generous gifts from Kyoshi Kawakami. Yeast expres-
sion constructs for Eya1, Eya2, and Eya3 were obtained by PCR amplification of
the respective cDNA fragments and subsequent cloning into pGBT9 for inter-
action assays or pGBKT7 for expression analysis. Similarly, Sipl1 and its deletion
fragments were introduced into the yeast expression vector pGADT7. Yeast
expression constructs for mouse Eya4 were kindly provided by Richard J. H.
Smith, and the plasmids pGL3-MEF3/TATA, pGL3-TATA, and pCR3-Six4 used
for luciferase reporter assays were provided by Pascal Maire.
Mouse monoclonal anti-Flag M2 (Sigma), anti-HA 6E2 and anti-c-Myc 9B11
(Cell Signaling), and anti--actin (ab8224; Abcam) antibodies were purchased
from the indicated manufacturers. The hybridoma cell line for production of the
mouse monoclonal antihemagglutinin (anti-HA) 12CA5 antibody was obtained
from Ed Harlow.
Yeast two-hybrid analysis. Yeast two-hybrid screens were performed accord-
ing to the manufacturer’s instructions (Clontech). Briefly, the DNA fragment
encoding the C terminus of murine Eya1 (aa 291 to 591) was PCR amplified and
ligated into the bait vector pGBT9. The resultant plasmid was used to transform
the yeast strain KFY1 (generated by Thomas Munder, Jena, Germany), which
was then mated to the yeast strain Y187 pretransformed with a cDNA library of
an 11-day-old mouse embryo (Clontech). About 2 10
6
clones were screened
for activity of the reporter genes HIS3 and lacZ by growth on selection medium
lacking histidine and colony-lift filter assay, respectively. Positive clones were
subjected to plasmid rescue to isolate the prey plasmid (18) and confirmed by
retransformation into S. cerevisiae KFY1 together with the bait plasmid.
To assess the strength of a protein-protein interaction, the yeast strain KFY1
was cotransformed with the indicated bait and prey plasmids. Colonies were
analyzed by quantitative -galactosidase (-Gal) liquid assay, according to the
Clontech protocol. Expression of the constructs used for the -Gal liquid assay
was confirmed by yeast protein extraction as described previously (27).
In vitro transcription/translation and GST pulldown assays. Full-length HA-
Eya1 or HA-Eya2 were synthesized in vitro using pHM6-Eya1 or pHM6-Eya2 as
a template in a coupled transcription/translation system (Promega). Recombi-
nant GST-Sipl1 and GST-Rbck1 fusion proteins or GST alone was purified and
coupled to glutathione-agarose beads as described previously (56).
For GST pulldown assays, the GST fusion proteins precoupled to agarose
beads were resuspended in 100 l HB buffer (20 mM HEPES at pH 7.8, 100 mM
KCl, 5 mM MgCl
2
, 0.5% NP-40) and 30 lofin vitro-translated HA-Eya1 or
HA-Eya2. After incubation overnight at 4°C, the beads were washed in HB
buffer. Proteins were eluted in 2 Laemmli loading buffer, separated on a 10%
sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel, and analyzed by im-
munoblotting.
Coimmunoprecipitation. Cos-7 cells (1 10
6
) were seeded into 10-cm plates
and transfected with the indicated expression constructs using SuperFect
(Qiagen). To increase protein input, cells were treated with the proteasome
inhibitor MG132 (1 M; Sigma) at 24 h posttransfection. The following day, cells
were scraped in phosphate-buffered saline (PBS), collected by centrifugation
(3,000 rpm, 5 min, 4°C), and lysed in 500 l HEPES lysis buffer (25 mM HEPES
at pH 7.9, 0.5 mM EDTA, 150 mM NaCl, 0.5% NP-40). The lysate was cleared
by centrifugation (10,000 rpm, 5 min, 4°C) and added to anti-HA 12CA5 anti-
body, which had been coupled to protein G-agarose (Calbiochem) previously.
After incubation overnight at 4°C and being washed in lysis buffer, immunocom-
plexes were eluted by being boiled in 2 Laemmli loading buffer. Samples were
analyzed by 10% SDS-PAGE and immunoblotting.
RNA isolation and RT-PCR analysis. Total RNA obtained from mouse tissues
or zebrafish embryos was isolated using the RNeasy minikit (Qiagen). An aliquot of
the RNA (500 ng) was reverse transcribed into cDNA using SuperScript II RNase
H
reverse transcriptase (RT) (Invitrogen) and random primers (Promega). The
following primers were used for RT-PCR analysis: for mouse Eya1, for-TGGCCC
TACCCCTTCCCCAC and rev-TGACAATCCACTTTCCGTCTT; for mouse
Sipl1, for-CCTGTGTATGCCTGAACGAA and rev-AGAGGATCCCAAGCAC
AGG; for mouse Rbck1, for-AACACGTCACTCAACCCACA and rev-CTGTTT
CCGCTGCTGGTACT; for mouse Lim1, for-TCACCTCAACTGCTTCACCT
and rev-CATCCTGCGATGGATCTTG; for mouse Tbp, for-GGCCTCTCAGAA
GCATCACTA and rev-GCCAAGCCCTGAGCATAA.
In order to quantify the expression levels of Eya1, Sipl1, and Rbck1 in different
mouse tissues, quantitative real-time RT-PCR (qRT-PCR) analysis was per-
formed using SYBR green I nucleic acid gel stain (BioWhittaker Molecular
Applications) and 1 M fluorescein calibration dye (Bio-Rad). The factor dif-
ference in expression of each of the analyzed genes was calculated according to
the ⌬⌬CT (threshold cycle) method (26), including normalization to expression
of the housekeeping gene Tbp.
Luciferase reporter assay. Transfection of Cos-7 cells for the luciferase re-
porter assay was performed using Lipofectamine 2000 (Invitrogen). Cos-7 cells
(1.5 10
5
) were seeded into 6-well dishes and transfected on the following day
with 1 g pGL3-MEF3/TATA reporter construct, 1.6 g pHM6-Eya2, 0.4 g
pCR3-Six4, and 1 g Flag-Sipl1 or Flag-Rbck1. To normalize for transfection
efficiency, 0.05 g phRL-TK control plasmid was added to each sample. At 48 h
posttransfection, cells were harvested, and luciferase activities were determined
using the dual-luciferase reporter assay (Promega).
In situ hybridization analysis. Zebrafish embryos were obtained from matings
of wild-type fish of the Tu¨AB strain, which has been kept in laboratory stocks in
Jena, Germany, for many generations. Embryos were raised at 28°C and staged
according to Kimmel et al. (22).
In situ hybridizations on 10-m paraffin sections of mouse or zebrafish em-
bryos were performed essentially as described previously (32). For double in situ
hybridization, sections of the zebrafish head were incubated with a fluorescein-
labeled probe for eya1 and a digoxigenin-labeled probe for sipl1-rbck1. Fluores-
cein-labeled eya1 was detected using a sheep antifluorescein antibody coupled to
alkaline phosphatase. Staining was developed using Fast Red (Roche). After
staining, slides were washed twice in 0.1 M Tris-0.1% Tween, and antibody was
stripped by incubation in 0.1 M glycine, pH 2.2, containing 0.1% Tween for 20
min. Subsequently, hybridization of the digoxigenin-labeled sipl1-rbck1 probe
was detected as described previously (32).
Whole-mount in situ hybridizations were performed as described by Haupt-
mann and Gerster (16). The cDNA templates for the synthesis of digoxigenin-
labeled riboprobes were amplified with the following primers: for mouse Sipl1,
for-ACGTGAATTCATGTCGCCGCCCGCCGG and rev-ACGTCTCGAGCT
AGTCGAGGAAGTGCACGCTG; for mouse Rbck1, for-CCCTCAGGGTGC
AAGTAAAA and rev-CTCAAGGTGCTTCGGTTCTC; for zebrafish eya1, for-
GGACTATCCTTCCTACCCGACG and rev-GTGGCAGCAGCGTGGAA
VOL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5765
TCCG (23); for zebrafish sipl1, for-GTGGGCTCCGACTCTCTG and rev-GC
ACAAACACTGAGAGATGATCC; for zebrafish sipl1-rbck1, for-AGTTTGGC
AACACCTCCACA and rev-CAATTGTGGAGTGTGGGAAG; for zebrafish
rbck1, for-TATGGCTTCCATCCGTCTCT and rev-TCCAGCATCTCTGTGG
TCTG. The zebrafish probes are located within the coding regions of the re-
spective mRNAs and correspond to aa 229 to 431 for Eya1, aa 23 to 239 for Sipl1,
aa 113 to 248 for Sipl1-Rbck1, and aa 98 to 440 for Rbck1. Each cDNA fragment
was cloned into pCRII-TOPO (Invitrogen), which was used as a template for in
vitro transcription to generate probes in antisense and sense orientations. The
riboprobe for mouse Eya1 was generated by HindIII digestion of pHM6-Eya1.
The HindIII fragment was cloned into pBSK, which was used as a template for
in vitro transcription.
Injection of zebrafish embryos with morpholinos and Alcian Blue staining.
Injections into zebrafish embryos were performed as described previously (36).
Briefly, morpholino antisense oligonucleotides (MO) (Gene Tools) were diluted
to a concentration of 1 or 2 mM in water with 0.1% phenol red (Sigma) and
injected into the yolks of 1- to 2-cell embryos. Morpholinos were directed against
splice donor sites of the pre-mRNA. The morpholino sequences are as follows:
for eya1,5-AAACAAAGATGATAGACCTACTTCC-3 (exon 10-intron 10)
(23); for sipl1,5-AGGCCCTATGATATACCTGATGTCT-3 (exon 4-intron 4)
and 5-TATTTTGATCCTCCTACCTGCTGCT-3 (exon 5-intron 5); for sipl1-
rbck1,5-CAAGTTGGACATTTACTCACCACAC-3 (exon 1-intron 1) and 5-
GCAGAAGAAATGCAAACCTCTGTGT-3 (exon 2-intron 2); and for rbck1,
5-AATGCATTACCATCGATCTGCCTCT-3 (exon 5-intron 5) and 5-AGAG
GCATCAAGAGCAGCCATACTT-3 (translational start site).
In each case, knockdown efficiency was confirmed by RT-PCR analysis. For
this, total RNA from 10 injected zebrafish embryos at 24 hours postfertilization
(hpf) was isolated and reverse transcribed into cDNA as described above. The
following primers were used: for zebrafish eya1, for-GGACTATCCTTCCTAC
CCGACG and rev-GTGGCAGCAGCGTGGAATCCG (23); for zebrafish sipl1,
for-ATGAGCTGCGTCTCCTCAAG and rev-GCACAAACACTGAGAGATG
ATCC; for zebrafish sipl1-rbck1, for-TCGTTCAAATTTCGGTGTGA (exon
2-intron 2 MO) or for-TATACGGCCGCTATGTCTCC (exon 1-intron 1 MO)
and rev-GGAGGTAGTCGCCCTTCTTC; and for zebrafish rbck1, for-TGAAT
AAACCGACACGTCCA and rev-CATGATGGTGCCAAAACAAA. The
identity of the resulting product was verified by cloning and sequencing in each
case.
Alcian Blue staining of morpholino-injected zebrafish embryos was performed
at 5 days postfertilization, according to the protocol by Walker and Kimmel (54).
RESULTS
Sipl1 is a novel Eya1-binding protein. In order to identify
novel interaction partners of Eya1, we performed a yeast two-
hybrid screen, using the highly conserved C terminus of Eya1
as bait against a mouse embryonic cDNA library. Within this
screen, we isolated 35 positives from approximately 2 10
6
clones. Upon retransformation, 10 clones turned out to be true
positives. One clone encoded a part of Six2, a well-established
Eya1-interacting protein, thus confirming the validity of the
screen. Another positive clone coded for a fragment of Sipl1
(aa 1 to 343). The Sipl1 protein consists of 380 aa and was
previously described as an interaction partner of the Shank1
scaffolding protein in rat brain (25). The C-terminal part of
Sipl1 includes the following two conserved regions: a Ubl
(ubiquitin-like) domain and a Ran-BP2 (Ran binding protein
2)-type zinc finger (ZnF) (Fig. 1A). In order to confirm the
interaction between Eya1 and Sipl1, we performed GST pull-
down experiments using GST-Sipl1 as bait and in vitro-synthe-
sized HA-tagged Eya1 as prey. We could detect binding of
Eya1 to GST-Sipl1 but not to GST alone (Fig. 1B), indicating
a physical association between the two proteins in vitro. Fur-
thermore, we verified the interaction in mammalian cells by
coimmunoprecipitation. To this end, we transfected Cos-7 cells
with expression constructs for HA-tagged Eya1 and Flag-
tagged Sipl1. As shown in Fig. 1C after precipitation of Eya1,
we were able to detect coprecipitation of Sipl1 (Fig. 1C).
Sipl1 interacts with Eya1 and Eya2 via its Ubl domain. The
C terminus of Eya1, which served as bait for the yeast two-
hybrid screen, contains the Eya domain. This domain is highly
conserved in the Eya paralogs Eya2, Eya3, and Eya4. To ad-
dress the specificity of the interaction, we tested whether Sipl1
can also interact with these paralogs using a yeast two-hybrid-
based approach. We were able to detect an interaction of Sipl1
with Eya1 and Eya2 but not with Eya3 and two alternative
splice forms of Eya4 (Fig. 1D).
To further characterize the Eya1-Sipl1 interaction, we nar-
rowed down the binding sites using a yeast two-hybrid assay
and different deletion fragments for each of the interaction
partners. The strongest interaction with Eya1 could be ob-
served with a Sipl1 fragment containing the whole Ubl domain
and an additional 35 aa located N terminally of it (Fig. 1E).
Binding in this case was even stronger than with the full-length
Sipl1 protein, which might be explained by different folding of
the respective protein fragments. In the case of Eya1, we were
not able to identify a subregion within the Eya1 C terminus,
which mediates binding to Sipl1. Any deletion led to complete
loss of interaction with Sipl1 (data not shown), suggesting that
the whole Eya domain of Eya1 is required for the Sipl1 inter-
action or that subfragments of the Eya domain may not fold
correctly.
Eya1 interacts with the Sipl1-related protein Rbck1. The
Ubl domain of Sipl1, which has been shown to mediate the
interaction with Eya1, is a conserved domain present in other
proteins as well. One of those is Rbck1 (RBCC protein inter-
acting with PKC1). In fact, the N terminus of Rbck1 is highly
similar to the C terminus of Sipl1, including both conserved
regions, namely, the Ubl and ZnF domains. The C terminus of
Rbck1 contains a coiled-coil region and a RING-IBR
(RING-in between RING) domain (Fig. 2A). Recently, it has
been shown that Rbck1 acts as an E3 ubiquitin ligase (49, 60).
In addition to that, Rbck1 possesses a transactivation activity
and functions as a transcriptional coactivator (7, 47). Based on
the fact that the Ubl domain shows a high degree of conser-
vation between Sipl1 and Rbck1 (42% identity), we analyzed
whether Rbck1 also interacts with Eya1. Therefore, we per-
formed GST pulldown experiments and could show that Eya1
binds to Rbck1 in vitro (Fig. 2B). Furthermore, by coimmuno-
precipitation analysis, we were able to detect complex forma-
tion of Eya1 and Rbck1 in Cos-7 cells (Fig. 2C).
Sipl1 and Rbck1 are coexpressed with Eya1 in several tissues
of a mouse embryo. As a first step to address the functional
relevance of the interactions of Eya1 with its novel interaction
partners Sipl1 and Rbck1 in vivo, we performed expression
studies. For this, we analyzed RNA from several tissues of a
13.5-day-old mouse embryo for expression of Sipl1, Rbck1, and
Eya1 using RT-PCR and quantitative real-time RT-PCR (Fig.
3A and B). In line with already published data, we could detect
Eya1 mRNA in multiple tissues during this stage of embryonic
development, with the lowest expression level in the neural
tube and the highest expression level in the kidney (approxi-
mately 70-fold compared to that in the neural tube) (Fig. 3B)
(58). Furthermore, our analysis shows that at this stage of
development, both Sipl1 and Rbck1 are ubiquitously expressed
(Fig. 3A and B). As an additional control for PCR specificity
and cDNA quality, we have used Lim1, a gene that is expressed
specifically in the brain and the kidney (13). In situ hybridiza-
5766 LANDGRAF ET AL. MOL.CELL.BIOL.
tion analysis on transverse sections of the kidney region of a
13.5-day-old mouse embryo confirmed the results of the RT-
PCR analyses, with ubiquitous expression of Sipl1 and Rbck1
as well as prominent Eya1 expression in the embryonic kidney
(Fig. 3C). In the latter, coexpression of Eya1, Sipl1, and Rbck1
could be observed in developing nephrons in the outer region
of the kidney. The apparent differences in Eya1 expression
when comparing the RT-PCR data with the in situ hybridiza-
tion results can be attributed to the different sensitivities of the
methods, as well as the fact that in situ hybridization is per-
formed on a section that represents only a very specific area of
the embryo. An additional site of Eya1 expression is the inner
ear (62). We analyzed gene expression of Eya1, Sipl1, and
Rbck1 on adjacent sections of the inner ear of a 14.5-day-old
mouse embryo and found all three genes coexpressed in the
otic epithelium and the spiral ganglion (Fig. 3D).
Both Sipl1 and Rbck1 enhance the transactivation potential
of the Eya-Six complex. The best understood function of Eya
proteins is their role as coactivators for the Six-transcription
factors. In fact, complex formation of Eya and Six proteins and
subsequent activation of organ-specific genes are regarded to
be essential for the development of various organs, such as the
kidney, thymus, and muscle (17, 21, 57, 59). In order to assess
the effect of the two interaction partners Sipl1 and Rbck1 on
FIG. 1. Sipl1 is a novel interaction partner of Eya1. (A) Sipl1 protein domain structure. Ubl, ubiquitin-like; ZnF, zinc finger. (B) Eya1 and Sipl1
interact directly with each other. GST pulldown assay with in vitro-synthesized HA-Eya1 and recombinant GST-Sipl1 or GST as a control. HA-Eya1
was visualized by immunoblotting (IB) with anti-HA 6E2 antibody (top) and GST fusion proteins by SDS-PAGE and Coomassie blue staining
(bottom). The asterisk indicates bacterial protein copurifying with GST. (C) Sipl1 and Eya1 interact in mammalian cells. Cos-7 cells were
transfected with expression constructs for HA-Eya1 and Flag-Sipl1. At 48 h posttransfection, cells were lysed, and HA-Eya1 was precipitated with
anti-HA 12CA5 antibody. Cell lysates before immunoprecipitation (IP) and precipitated complexes were analyzed by immunoblotting using
anti-HA 6E2 antibody for the detection of HA-Eya1 and anti-Flag M2 antibody for the detection of Flag-Sipl1. (D) Sipl1 interacts with Eya1 and
Eya2 but not with Eya3 and Eya4. Cotransformation of S. cerevisiae KFY1 with constructs encoding the C-terminal fragments of Eya1-4 and
pGADT7-Sipl1 or empty vector. In each case, the interaction strength was determined by -Gal liquid assay from three pooled colonies in
triplicate. (E) Eya1 binds to the conserved Ubl domain of Sipl1. S. cerevisiae KFY1 was transformed with a pGBT9 vector encoding the C terminus
of Eya1 and pGADT7 encoding the indicated Sipl1 deletion fragments. For each sample, a -Gal liquid assay was performed with 3 pooled colonies
and measured in triplicate. The data represent the means and standard deviations from the results of one representative experiment. Expression
of the yeast constructs was confirmed by protein extraction and immunoblot analysis (insets).
V
OL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5767
the function of Eya proteins as coactivators of transcription, we
established a transactivation assay. Based on already reported
data, we used a luciferase reporter construct containing 6
MEF3 (myogenic enhancing factor 3) sites in the background
of a minimal TATA promoter, which can be efficiently acti-
vated by the complex of Eya2 and Six4 (10). As shown previ-
ously, Sipl1 also interacts with Eya2 in the yeast two-hybrid
assay, an activity that can be assumed for Rbck1 as well, since
the binding regions of the two proteins are conserved. We
indeed confirmed direct binding of both Sipl1 and Rbck1 to
Eya2 by GST pulldown analysis (Fig. 4A). In line with pub-
lished data, we observed that Six4 alone activated the reporter
to about 4-fold, and this activation was further enhanced to
about 12-fold in the presence of Eya2. The presence of Sipl1 or
Rbck1 did not influence transactivation by Six4 alone but en-
hanced transactivation by Eya2 and Six4 to about 16-fold,
indicating that this effect is mediated via the interaction of
Sipl1 and Rbck1 with Eya2 (Fig. 4B).
Identification of orthologs of Sipl1 and Rbck1 in zebrafish.
Since our analysis had shown that Sipl1 and Rbck1 are ex-
pressed in multiple tissues in the embryo, we wanted to inves-
tigate a potential role of both genes during embryonic devel-
opment. We therefore turned to zebrafish as a model system.
By bioinformatic analysis, we were able to identify putative
orthologs of Sipl1 and Rbck1 in zebrafish (Fig. 5A). One of
them, zebrafish sipl1, is located on chromosome 2 and is an
ortholog of mouse Sipl1. This gene encodes a protein, which
contains the conserved regions of the Ubl domain and of the
Ran-BP-type ZnF in its C-terminal part. Furthermore, our
analysis revealed zebrafish rbck1 on chromosome 22 to be an
ortholog of mouse Rbck1, with the respective proteins sharing
all the conserved domains, as follows: the Ubl domain, the
Ran-BP-type ZnF, the coiled-coil region, and the RING-IBR
domain. Interestingly, we identified a third ortholog on ze-
brafish chromosome 7, which we have named sipl1-rbck1, be-
cause it seems to be a fusion of both sipl1 and rbck1. According
to our analysis, a sipl1-rbck1 ortholog is present in the genomes
of other teleost fish species, such as stickleback and fugu, but
not in higher vertebrates like mice or humans. An alignment of
the minimal Eya1-binding region in mouse Sipl1 or Rbck1 to
each of the identified zebrafish proteins revealed that zebrafish
Sipl1 and Sipl1-Rbck1 are more closely related to mouse Sipl1
(50% identity in the case of Sipl1 and 49% identity in the case
of Sipl1-Rbck1), whereas Rbck1 is more closely related to
mouse Rbck1 (41% identity) within this region.
Coexpression of eya1 and the orthologs of Sipl1 and Rbck1 in
developing zebrafish embryos. In zebrafish, eya1 expression
has been described in several organs during embryogenesis, for
example, the otic vesicle and the pharyngeal arches (41). In
order to investigate the expression pattern of each of the newly
identified zebrafish orthologs of Sipl1 and Rbck1 during em-
bryonic development, we performed whole-mount in situ hy-
bridization using gene-specific probes at different stages of
development.
In agreement with published data, we could detect eya1
expression in the otic vesicle, the region of the pharyngeal
arches, and the lateral line organ (Fig. 5B). In the case of sipl1,
we observed a high level of expression in the zebrafish head at
35 hpf (hours postfertilization), with prominent expression in
the brain, the eyes, the otic vesicle, and the pharyngeal arches.
At later stages (48 and 72 hpf), sipl1 expression was still de-
tectable in the same organs although decreasing in intensity.
In contrast to sipl1, expression of sipl1-rbck1 was more re-
stricted during all developmental stages analyzed. At 35 hpf
and 48 hpf, sipl1-rbck1 mRNA was detected in the otic vesicle
and in a region in the zebrafish brain probably representing the
midbrain-hindbrain boundary. In addition to that, at 48 hpf
and 72 hpf, sipl1-rbck1 expression was detectable in the pha-
ryngeal arches. In order to have a closer look at a potential
coexpression of sipl1-rbck1 and eya1 in the otic vesicle, we
performed in situ hybridization on transverse sections of the
zebrafish head at 72 hpf (Fig. 5C). We detected expression of
sipl1-rbck1 and eya1 in an overlapping region corresponding to
the sensory epithelium. Coexpression was confirmed by double
in situ hybridization of the same section using probes against
both genes simultaneously (Fig. 5D).
Regarding rbck1, we were not able to detect expression at
earlier stages of zebrafish development. However, at 72 hpf, we
observed a specific signal for rbck1 mRNA in the pharyngeal
arches, which was not present when we used the corresponding
probe in sense orientation.
In summary, we have shown by whole-mount in situ hybrid-
ization that the orthologs of Sipl1 and Rbck1 are expressed in
distinct but overlapping domains during zebrafish embryonic
development. While sipl1 is expressed ubiquitously in the head
of the zebrafish embryo, both sipl1-rbck1 and rbck1 show co-
expression with eya1 in the otic vesicle and/or the region of the
pharyngeal arches.
FIG. 2. Eya1 interacts with the Sipl1-related protein Rbck1.
(A) Rbck1 protein domain structure. RING, really interesting new
gene; IBR, in-between RING; C/H, cysteine/histidine rich. (B) Eya1
and Rbck1 bind directly to each other. A GST pulldown assay was
performed by incubating in vitro-synthesized HA-Eya1 with GST-
Rbck1 or GST alone as a control. HA-Eya1 was detected by immuno-
blotting using anti-HA 6E2 antibody (top). The input levels of GST
fusion proteins were determined by SDS-PAGE and Coomassie blue
staining (bottom). The asterisk indicates bacterial protein copurifying
with GST. (C) Eya1 interacts with Rbck1 in mammalian cells. For
coimmunoprecipitation analysis, Cos-7 cells were transfected with ex-
pression constructs for HA-Eya1 and Flag-Rbck1. After lysis of the
cells, HA-Eya1 was precipitated using anti-HA 12CA5 antibody.
Whole-cell extracts and immunocomplexes were analyzed by SDS-
PAGE and immunoblotting. HA-Eya1 was detected with anti-HA 6E2
antibody, and Flag-Sipl1 was detected with anti-Flag M2 antibody.
5768 LANDGRAF ET AL. M
OL.CELL.BIOL.
The zebrafish orthologs of Sipl1 and Rbck1 are essential for
craniofacial development. Mutations in the zebrafish eya1 gene
have been shown to result in defects in the formation of the
inner ear and the lateral line sensory systems during embryo-
genesis (23). Furthermore, it has been demonstrated that mi-
croinjection of an eya1 morpholino complementary to the exon
10-intron 10 splice site in the eya1 primary mRNA pheno-
copies this mutant phenotype (23). We reproduced the previ-
FIG. 3. Sipl1 and Rbck1 are expressed in several tissues of a developing mouse embryo. (A) Eya1, Sipl1, and Rbck1 expression in the tissue of
a 13.5-day-old mouse embryo was analyzed by RT-PCR using gene-specific primers. As an additional control, expression analysis of Lim1 was
included. For control of the cDNA input, Tbp expression was determined in parallel in the same samples. (B) Quantification of Eya1, Sipl1, and
Rbck1 expression by quantitative real-time RT-PCR. Relative expression levels normalized to Tbp were calculated using the ⌬⌬CT method. For
comparison, expression in the neural tube was set to 1. The left y axis corresponds to Eya1 expression, and the right y axis corresponds to Sipl1
and Rbck1 expression. The data represent means and standard deviations from the results of three independent experiments. (C) Analysis of Eya1,
Sipl1, and Rbck1 expression by in situ hybridization on adjacent sections of a 13.5-day-old mouse embryo. (Top) Overview. Arrows mark the
kidneys, arrowheads mark the guts, and asterisks mark the neural tubes of the mouse embryo. Please note that staining of the tissue surrounding
the embryos is unspecific. (Bottom) Higher magnification of the right embryonic kidney. (D) Analysis of Eya1, Sipl1, and Rbck1 expression in the
inner ear by in situ hybridization on adjacent sections of a 14.5-day-old mouse embryo. oe, otic epithelium; otc, otic capsule; sg, spiral ganglion.
V
OL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5769
ously published results using the same eya1-specific morpho-
lino and observed an abnormal morphology of the otic vesicle
(Fig. 6A and B).
To address the question of whether the zebrafish orthologs of
Sipl1 and Rbck1 are involved in developmental processes, we
employed a morpholino-mediated knockdown approach. Mor-
pholinos are chemically modified antisense oligonucleotides that
prevent gene expression on two different levels. When targeting
the translational initiation codon AUG, translation of the corre-
sponding mRNA is inhibited. We have used an alternative strat-
egy, namely, splice morpholinos that are directed against specific
splice donor or acceptor sites. Possible consequences are the
inclusion of an intron, the exclusion of an exon, or usage of an
alternative splice site. In each case, generation of the normal
mRNA is prevented. We designed two different morpholinos for
each gene and tested them independently. In each case, the two
morpholinos directed against the same gene showed identical and
consistent phenotypes (Fig. 6 and data not shown). In the follow-
ing, results for only one of the gene-specific morpholinos are
presented. Injection of a sipl1 morpholino directed against the
splice donor site of intron 4 led to efficient knockdown of sipl1
expression via exclusion of exon 4 from the mRNA, leading to a
frameshift and an early stop codon, as confirmed by sequencing
(Fig. 6D). In line with the above-described expression pattern of
sipl1, knockdown of sipl1 gene expression resulted in a severe
phenotype affecting the cranial structures of the embryo (Fig. 6C).
The head itself as well as individual organs, such as the eyes and
the ears, were significantly smaller in size compared to those of
noninjected control embryos. Furthermore, the brain appeared to
be severely malformed. Thus, the observed sipl1 knockdown phe-
notype affects specifically those organs, which display high levels
of sipl1 expression in the zebrafish head.
In contrast to sipl1, knockdown of sipl1-rbck1 using a morpho-
lino targeting the splice donor site of intron 2 led to a milder
phenotype affecting mainly the region of the pharyngeal arches
and the developing ears of the zebrafish embryo (Fig. 6E). We
could show by RT-PCR analysis of injected embryos at 24 hpf that
in the presence of the morpholino, cryptic splicing occurred 15 bp
upstream of the natural splice site (Fig. 6F). Interestingly, the
observed sipl1-rbck1 knockdown phenotype resembled the mor-
phology of BOR syndrome in human patients (29). In sipl1-rbck1
morphants, the pharyngeal arches and the lower jaw, which is
derived from the pharyngeal arches, were shortened. Staining of
the cartilage using Alcian Blue at 5 days postfertilization revealed
that the pharyngeal arches were reduced in number and disorga-
nized compared to those of control embryos at the same age.
Moreover, knockdown of sipl1-rbck1 inhibited proper ear devel-
opment, in that the otic vesicle of sipl1-rbck1 morphants was
smaller in size and that structures were not properly developed
compared to those of control embryos. The sipl1-rbck1 knock-
down phenotype resembles the expression pattern of the respec-
tive gene, with major expression in the otic vesicle and the pha-
ryngeal arches, and is partly similar to the phenotype of eya1
knockdown embryos, affecting the developing ear (23). Interest-
ingly, rbck1 also seems to be involved in the development of the
pharyngeal arches (Fig. 6G). Knockdown of rbck1 by injection of
a morpholino directed against the splice donor site of intron 5
resulted in a mild phenotype affecting only the development of
the pharyngeal arches, including the lower jaw of the developing
zebrafish embryo. Alcian Blue staining confirmed a high degree
of disorganization in the pharyngeal arches, particularly in the
first two, and an almost complete lack of arches 3 to 7 after
knockdown of rbck1, similar to the results shown previously for
sipl1-rbck1. We confirmed knockdown efficiency by RT-PCR
analysis and showed that injection of the rbck1 morpholino inhib-
ited splicing of intron 5, resulting in a premature stop codon
(Fig. 6H).
DISCUSSION
Eya1 is required for the development of several organs in
vertebrates, including the kidney, ear, thymus, and muscle (14, 57,
59). In addition to its activity as a phosphatase, Eya1 can also act
as a transcriptional cofactor, together with interacting proteins,
FIG. 4. Sipl1 and Rbck1 interact with Eya2 and enhance Eya2-Six4-
mediated transactivation. (A) Sipl1 and Rbck1 bind directly to Eya2. A
GST pulldown assay was performed using in vitro-synthesized HA-Eya2
and recombinant GST-Sipl1, GST-Rbck1, or GST as a control. HA-Eya2
was visualized by immunoblotting with anti-HA 6E2 antibody (top) and
GST fusion proteins by SDS-PAGE and Coomassie blue staining (bot-
tom). The asterisk indicates bacterial protein copurifying with GST.
(B) Sipl1 and Rbck1 enhance Eya2-mediated transactivation. Scheme of
the luciferase reporter construct containing six MEF3 sites in the back-
ground of a minimal TATA promoter (top). For luciferase reporter as-
says, Cos-7 cells were cotransfected with the pGL3-MEF3/TATA or
pGL3-TATA reporter construct, indicated expression constructs, and Re-
nilla control plasmid. Each transfection was performed in triplicate. After
normalization to Renilla activity, the fold reporter gene activation of
samples containing pGL3-MEF3/TATA was calculated relative to respec-
tive samples containing pGL3-TATA. Activity of the reporter alone was
set to 1. The graph represents one of three experiments showing similar
results. Error bars indicate standard deviations, and asterisks indicate
statistically significant differences (P value 0.001; Student’s t test).
5770 LANDGRAF ET AL. M
OL.CELL.BIOL.
FIG. 5. The zebrafish orthologs of Sipl1 and Rbck1 are expressed during embryonic development. (A) Protein domain structures of the zebrafish
orthologs of Sipl1 and Rbck1. zf, zebrafish. (B) Expression of eya1, sipl1, sipl1-rbck1, and rbck1 at different embryonic stages was analyzed with the help
of whole-mount in situ hybridization using gene-specific probes in antisense or sense orientation. White arrows point at expression in the otic vesicle, and
white arrowheads point at expression in the pharyngeal arches. (C) Expression of sipl1-rbck1 and eya1 in otic vesicles was analyzed at 72 hpf using in situ
hybridization on a transverse section of the zebrafish head. Black arrows point at the sensory epithelium of the otic vesicle (ov). The differences in signal
intensities between the respective left and right otic vesicles are most likely due to the fact that the sections are slightly askew. (D) Double in situ
hybridization on a transverse section of the zebrafish head (72 hpf) using a fluorescein-labeled eya1 probe and a digoxigenin sipl1-rbck1 probe. (Left)
Staining for eya1 alone; (right) double staining for eya1 and sipl1-rbck1 on the same section. Insets show higher magnifications of the sensory epithelium.
Black arrows point at the sensory epithelium of the otic vesicle, and white arrowheads indicate areas of coexpression of eya1 and sipl1-rbck1.
VOL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5771
e.g., of the Six and Dach families. In this work, we have identified
Sipl1 and Rbck1 as two novel interaction partners of Eya1.
Sipl1 was first described in the rat as an interaction partner of
Shank1, a protein that functions as a scaffold factor in the forma-
tion and maintenance of postsynaptic densities (44). However,
Sipl1 is expressed not only in the brain but also in many other
adult tissues, for example, in the heart, muscle, kidney, and spleen
(25). This is in line with our data that show Sipl1 expression in
multiple tissues in the developing mouse embryo. Homologs of
Sipl1 have been identified in the human and mouse, for which
they have been implicated in enteric nervous system function (9).
Furthermore, recent studies indicated that mutations in the
FIG. 6. The zebrafish orthologs of Sipl1 and Rbck1 are essential for embryonic development. Expression of each of the orthologs was targeted
by injection of splice donor site morpholinos into 1- to 2-cell embryos. Noninjected control embryos compared to embryos injected with morpholino
directed against eya1 (A), sipl1 (C), sipl1-rbck1 (E), and rbck1 (G) are shown at the indicated stages (left). Arrows point to the region of the otic
vesicle, and arrowheads point to the region of the pharyngeal arches. In the cases of eya1 and sipl1-rbck1, higher magnifications of the otic vesicles
of control embryos and morpholino-injected embryos at 96 hpf are shown. Sipl1-rbck1- and rbck1-morphant embryos were subjected to Alcian Blue
staining at 5 day postfertilization to visualize the pharyngeal arches. In each case, knockdown was confirmed by RT-PCR at 24 hpf (B, D, F, and
H) using gene-specific primers, as indicated by black arrows. The bars in the diagrams mark the target sites for the respective morpholinos. The
asterisk indicates a cryptic splice site.
5772 LANDGRAF ET AL. M
OL.CELL.BIOL.
mouse Sipl1 gene result in multiorgan inflammation, immune
system dysregulation, and dermatitis (43).
We have identified the Ubl domain in the C terminus of
Sipl1 as the region that mediates binding to Eya1. Since the
Ubl domain is a conserved domain, we proposed that other
Ubl domain-containing proteins might also interact with Eya1.
The N terminus of Rbck1, including the Ubl domain and a
Ran-BP2-type zinc finger, is highly similar to the C terminus of
Sipl1 and was previously considered to be an independent
domain, termed the Rbck1 homology domain (25). Based on
the homology within this region, we have speculated that
Rbck1 might also interact with Eya1 and could indeed dem-
onstrate interaction of the two proteins.
Rbck1 belongs to the family of RING-IBR-containing pro-
teins, which have been shown to possess E3 ubiquitin ligase
activity (28). In fact, Rbck1 has been described to act as an E3
ubiquitin ligase, mediating the degradation of several proteins,
like IRP2 (iron regulatory protein 2), PKC (protein kinase C),
Bach1, and TAB2/3 (TAK1-binding protein 2/3) (33, 51, 60,
61). Based on our observation that Eya1 and Rbck1 can asso-
ciate, one could therefore speculate that Eya1 itself or other
Eya1-associated proteins might be subject to regulation by
Rbck1-mediated ubiquitination.
Rbck1 also possesses transactivation activity (7) and has
been shown to shuttle between the cytoplasm and the nucleus
(48). Eya proteins have been shown to act as coactivators in
several transcriptional activation complexes, too. One of the
best-studied examples is the Eya-Six complex, which has been
demonstrated to mediate activation of gene expression during
the development of a variety of organs in both invertebrates
and vertebrates (2, 3, 17, 21, 46). Therefore, we tested whether
Rbck1 and Sipl1 can also act as cofactors for the Eya-Six
complex and could indeed show that both proteins could in-
crease Eya-Six-mediated transactivation. This result provides a
potential mechanistic basis for the role of Eya1 and its associ-
ated proteins in organ development. Moreover, Eya1 and
Rbck1 share an interaction partner, CBP (CREB binding pro-
tein). CBP is a well-characterized coactivator that functions as
a key integrator in various transcription-activating complexes
(1). CBP has been described to act as a linker for the interac-
tion between mammalian Eya and Dach proteins, thereby me-
diating target gene activation (20). Strikingly, interaction with
CBP has also been implicated in the regulation of Rbck1 trans-
activation function (48). It is tempting to speculate that CBP is
also part of the Eya1-Rbck1 complex and presumably involved
in target gene activation.
Sipl1 and Rbck1 have been shown to be expressed ubiqui-
tously in adult mammalian tissues (9, 25, 52). However, expres-
sion and function of Sipl1 and Rbck1 during embryonic devel-
opment has not been described yet. We show here that both
Sipl1 and Rbck1 are expressed together with Eya1 in many
tissues of a mouse embryo, which is in line with the hypothesis
that the proteins act together during embryonic development.
We underlined this assumption by the identification and func-
tional characterization of zebrafish orthologs of Sipl1 and
Rbck1. We identified not only one Sipl1 ortholog and one
Rbck1 ortholog but also a gene which seems to represent a
fusion of both, sipl1-rbck1. Using morpholino-mediated knock-
down analysis, we could show that each of the zebrafish or-
thologs is involved in organogenesis. This is in line with the
expression of each respective ortholog in the affected tissues.
For example, zebrafish sipl1 is expressed in the brain region
and essential for its proper development. Moreover, deficiency
for both zebrafish sipl1-rbck1 and rbck1 leads to anomalies in
the regions of the lower jaw and the pharyngeal arches. Also,
knockdown of sipl1-rbck1 leads to anomalies in formation of
the zebrafish ear. Interestingly, the development of the ears
and the pharyngeal arches also depends on proper function
of Eya1. It has been shown that eya1 directs ear develop-
ment in zebrafish (23). Moreover, in Eya1 knockout mice,
several organs which are derived from the pharyngeal arches
are malformed or even completely absent, such as the thy-
mus, cranial skeleton, and middle ear. Furthermore, muta-
tions in human EYA1 lead to BOR/BO syndrome, affecting
mainly the cranial skeleton and the ear, including the inner,
middle, and outer ear.
As described above, there is a remarkable overlap between
the phenotypes of sipl1-, rbck1-, and sipl-rbck1-deficient ze-
brafish embryos and the characteristic symptoms of BOR and
BO syndrome. The latter is caused by mutations in EYA1 but
also in SIX1 and SIX5, as recently demonstrated (19, 40). Since
SIX1 and SIX5 encode interaction partners of Eya1, it is tempt-
ing to speculate that mutations in human SIPL1 or RBCK1
could also be associated with BOR syndrome.
In conclusion, we identified Sipl1 and Rbck1 as novel Eya1-
interacting proteins and provided a first insight into the phys-
iological importance of the respective interactions. Using the
zebrafish model system, we showed that orthologs of Sipl1 and
Rbck1 direct the development of several organs, for example,
the ears and the pharyngeal arches, which also depend on
expression of Eya1. On the molecular level, we showed that
both Sipl1 and Rbck1 act as cofactors for the Eya-Six complex.
Further experiments regarding the functional consequences of
the interaction of Sipl1 or Rbck1 with Eya1 should clarify the
importance of the respective interaction for vertebrate orga-
nogenesis.
ACKNOWLEDGMENTS
We thank Eric Rivera-Milla for critically reading and improving the
manuscript, as well as Frank-Dietmar Bo¨hmer and Amna Musharraf
for stimulating discussions throughout the project. We also thank Pas-
cal Maire for providing the myogenin reporter, Kiyoshi Kawakami for
providing Eya1-3 expression constructs, and Richard J. Smith for pro-
viding the Eya4 expression construct. We are grateful to Ulrike Gaus-
mann for help with bioinformatic analysis, Helmut Pospiech for estab-
lishing the cartilage staining, and Claudia Franke, Uta Schmidt, and
Katrin Sulik for technical support. We appreciate the help of the
rotating students Doreen Ko¨hler, Andreas Boland, Daniela Endt, and
Andrea Wetzel.
This work was supported by a grant from the Deutsche Forschungs-
gemeinschaft (SFB604, project C7) to C.E.
REFERENCES
1. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos.
2000. Ordered recruitment of chromatin modifying and general transcription
factors to the IFN-beta promoter. Cell 103:667–678.
2. Bonini, N. M., Q. T. Bui, G. L. Gray-Board, and J. M. Warrick. 1997. The
Drosophila eyes absent gene directs ectopic eye formation in a pathway
conserved between flies and vertebrates. Development 124:4819–4826.
3. Brodbeck, S., B. Besenbeck, and C. Englert. 2004. The transcription factor
Six2 activates expression of the Gdnf gene as well as its own promoter. Mech.
Dev. 121:1211–1222.
4. Chai, L., J. Yang, C. Di, W. Cui, K. Kawakami, R. Lai, and Y. Ma. 2006.
Transcriptional activation of the SALL1 by the human SIX1 homeodomain
during kidney development. J. Biol. Chem. 281:18918–18926.
VOL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5773
5. Chen, R., M. Amoui, Z. Zhang, and G. Mardon. 1997. Dachshund and eyes
absent proteins form a complex and function synergistically to induce ectopic
eye development in Drosophila. Cell 91:893–903.
6. Christensen, K. L., A. N. Patrick, E. L. McCoy, and H. L. Ford. 2008. The six
family of homeobox genes in development and cancer. Adv. Cancer Res.
101:93–126.
7. Cong, Y. S., Y. L. Yao, W. M. Yang, N. Kuzhandaivelu, and E. Seto. 1997.
The hepatitis B virus X-associated protein, XAP3, is a protein kinase C-
binding protein. J. Biol. Chem. 272:16482–16489.
8. Cook, P. J., B. G. Ju, F. Telese, X. Wang, C. K. Glass, and M. G. Rosenfeld.
2009. Tyrosine dephosphorylation of H2AX modulates apoptosis and sur-
vival decisions. Nature 458:591–596.
9. Daigo, Y., I. Takayama, S. M. Ward, K. M. Sanders, and M. A. Fujino. 2003.
Novel human and mouse genes encoding a shank-interacting protein and its
upregulation in gastric fundus of W/WV mouse. J. Gastroenterol. Hepatol.
18:712–718.
10. Fan, X., L. F. Brass, M. Poncz, F. Spitz, P. Maire, and D. R. Manning. 2000.
The alpha subunits of Gz and Gi interact with the eyes absent transcription
cofactor Eya2, preventing its interaction with the six class of homeodomain-
containing proteins. J. Biol. Chem. 275:32129–32134.
11. Fraser, F. C., D. Ling, D. Clogg, and B. Nogrady. 1978. Genetic aspects of the
BOR syndrome—branchial fistulas, ear pits, hearing loss, and renal anom-
alies. Am. J. Med. Genet. 2:241–252.
12. Fraser, F. C., J. R. Sproule, and F. Halal. 1980. Frequency of the branchio-
oto-renal (BOR) syndrome in children with profound hearing loss. Am. J.
Med. Genet. 7:341–349.
13. Fujii, T., J. G. Pichel, M. Taira, R. Toyama, I. B. Dawid, and H. Westphal.
1994. Expression patterns of the murine LIM class homeobox gene lim1 in
the developing brain and excretory system. Dev. Dyn. 199:73–83.
14. Grifone, R., J. Demignon, J. Giordani, C. Niro, E. Souil, F. Bertin, C. Laclef,
P. X. Xu, and P. Maire. 2007. Eya1 and Eya2 proteins are required for
hypaxial somitic myogenesis in the mouse embryo. Dev. Biol. 302:602–616.
15. Guan, K. L., and J. E. Dixon. 1991. Eukaryotic proteins expressed in Esch-
erichia coli: an improved thrombin cleavage and purification procedure of
fusion proteins with glutathione S-transferase. Anal. Biochem. 192:262–267.
16. Hauptmann, G., and T. Gerster. 1994. Two-color whole-mount in situ hy-
bridization to vertebrate and Drosophila embryos. Trends Genet. 10:266.
17. Heanue, T. A., R. Reshef, R. J. Davis, G. Mardon, G. Oliver, S. Tomarev,
A. B. Lassar, and C. J. Tabin. 1999. Synergistic regulation of vertebrate
muscle development by Dach2, Eya2, and Six1, homologs of genes required
for Drosophila eye formation. Genes Dev. 13:3231–3243.
18. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from
yeast efficiently releases autonomous plasmids for transformation of Esche-
richia coli. Gene 57:267–272.
19. Hoskins, B. E., C. H. Cramer, D. Silvius, D. Zou, R. M. Raymond, D. J.
Orten, W. J. Kimberling, R. J. Smith, D. Weil, C. Petit, E. A. Otto, P. X. Xu,
and F. Hildebrandt. 2007. Transcription factor SIX5 is mutated in patients
with branchio-oto-renal syndrome. Am. J. Hum. Genet. 80:800–804.
20. Ikeda, K., Y. Watanabe, H. Ohto, and K. Kawakami. 2002. Molecular inter-
action and synergistic activation of a promoter by Six, Eya, and Dach pro-
teins mediated through CREB binding protein. Mol. Cell. Biol. 22:6759–
6766.
21. Kawakami, K., S. Sato, H. Ozaki, and K. Ikeda. 2000. Six family genes—
structure and function as transcription factors and their roles in develop-
ment. Bioessays 22:616–626.
22. Kimmel, C. B., W. W. Ballard, S. R. Kimmel, B. Ullmann, and T. F. Schill-
ing. 1995. Stages of embryonic development of the zebrafish. Dev. Dyn.
203:253–310.
23. Kozlowski, D. J., T. T. Whitfield, N. A. Hukriede, W. K. Lam, and E. S.
Weinberg. 2005. The zebrafish dog-eared mutation disrupts eya1, a gene
required for cell survival and differentiation in the inner ear and lateral line.
Dev. Biol. 277:27–41.
24. Li, X., K. A. Oghi, J. Zhang, A. Krones, K. T. Bush, C. K. Glass, S. K. Nigam,
A. K. Aggarwal, R. Maas, D. W. Rose, and M. G. Rosenfeld. 2003. Eya
protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects
in mammalian organogenesis. Nature 426:247–254.
25. Lim, S., C. Sala, J. Yoon, S. Park, S. Kuroda, M. Sheng, and E. Kim. 2001.
Sharpin, a novel postsynaptic density protein that directly interacts with the
shank family of proteins. Mol. Cell. Neurosci. 17:385–397.
26. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.
Methods 25:402–408.
27. Lussier, M. P., S. Cayouette, P. K. Lepage, C. L. Bernier, N. Francoeur, M.
St-Hilaire, M. Pinard, and G. Boulay. 2005. MxA, a member of the dynamin
superfamily, interacts with the ankyrin-like repeat domain of TRPC. J. Biol.
Chem. 280:19393–19400.
28. Marin, I., and A. Ferrus. 2002. Comparative genomics of the RBR family,
including the Parkinson’s disease-related gene parkin and the genes of the
ariadne subfamily. Mol. Biol. Evol. 19:2039–2050.
29. Melnick, M., D. Bixler, W. E. Nance, K. Silk, and H. Yune. 1976. Familial
branchio-oto-renal dysplasia: a new addition to the branchial arch syn-
dromes. Clin. Genet. 9:25–34.
30. Melnick, M., D. Bixler, K. Silk, H. Yune, and W. E. Nance. 1975. Autosomal
dominant branchiootorenal dysplasia. Birth Defects Orig. Artic. Ser. 11:121–
128.
31. Mermod, N., E. A. O’Neill, T. J. Kelly, and R. Tjian. 1989. The proline-rich
transcriptional activator of CTF/NF-I is distinct from the replication and
DNA binding domain. Cell 58:741–753.
32. Moorman, A. F., A. C. Houweling, P. A. de Boer, and V. M. Christoffels. 2001.
Sensitive nonradioactive detection of mRNA in tissue sections: novel appli-
cation of the whole-mount in situ hybridization protocol. J. Histochem.
Cytochem. 49:1–8.
33. Nakamura, M., F. Tokunaga, S. Sakata, and K. Iwai. 2006. Mutual regula-
tion of conventional protein kinase C and a ubiquitin ligase complex. Bio-
chem. Biophys. Res. Commun. 351:340–347.
34. Ohto, H., S. Kamada, K. Tago, S. I. Tominaga, H. Ozaki, S. Sato, and K.
Kawakami. 1999. Cooperation of six and eya in activation of their target
genes through nuclear translocation of Eya. Mol. Cell. Biol. 19:6815–6824.
35. Okabe, Y., T. Sano, and S. Nagata. 2009. Regulation of the innate immune
response by threonine-phosphatase of Eyes absent. Nature 460:520–524.
36. Perner, B., C. Englert, and F. Bollig. 2007. The Wilms tumor genes wt1a and
wt1b control different steps during formation of the zebrafish pronephros.
Dev. Biol. 309:87–96.
37. Pfister, M., T. Toth, H. Thiele, B. Haack, N. Blin, H. P. Zenner, I. Sziklai, P.
Nurnberg, and S. Kupka. 2002. A 4-bp insertion in the eya-homologous
region (eyaHR) of EYA4 causes hearing impairment in a Hungarian family
linked to DFNA10. Mol. Med. 8:607–611.
38. Pignoni, F., B. Hu, and S. L. Zipursky. 1997. Identification of genes required
for Drosophila eye development using a phenotypic enhancer-trap. Proc.
Natl. Acad. Sci. U. S. A. 94:9220–9225.
39. Rayapureddi, J. P., C. Kattamuri, B. D. Steinmetz, B. J. Frankfort, E. J.
Ostrin, G. Mardon, and R. S. Hegde. 2003. Eyes absent represents a class of
protein tyrosine phosphatases. Nature 426:295–298.
40. Ruf, R. G., P. X. Xu, D. Silvius, E. A. Otto, F. Beekmann, U. T. Muerb, S.
Kumar, T. J. Neuhaus, M. J. Kemper, R. M. Raymond, Jr., P. D. Brophy, J.
Berkman, M. Gattas, V. Hyland, E. M. Ruf, C. Schwartz, E. H. Chang, R. J.
Smith, C. A. Stratakis, D. Weil, C. Petit, and F. Hildebrandt. 2004. SIX1
mutations cause branchio-oto-renal syndrome by disruption of EYA1-SIX1-
DNA complexes. Proc. Natl. Acad. Sci. U. S. A. 101:8090–8095.
41. Sahly, I., P. Andermann, and C. Petit. 1999. The zebrafish eya1 gene and its
expression pattern during embryogenesis. Dev. Genes Evol. 209:399–410.
42. Schonberger, J., L. Wang, J. T. Shin, S. D. Kim, F. F. Depreux, H. Zhu, L.
Zon, A. Pizard, J. B. Kim, C. A. Macrae, A. J. Mungall, J. G. Seidman, and
C. E. Seidman. 2005. Mutation in the transcriptional coactivator EYA4
causes dilated cardiomyopathy and sensorineural hearing loss. Nat. Genet.
37:418–422.
43. Seymour, R. E., M. G. Hasham, G. A. Cox, L. D. Shultz, H. Hogenesch, D. C.
Roopenian, and J. P. Sundberg. 2007. Spontaneous mutations in the mouse
Sharpin gene result in multiorgan inflammation, immune system dysregula-
tion and dermatitis. Genes Immun. 8:416–421.
44. Sheng, M., and E. Kim. 2000. The Shank family of scaffold proteins. J. Cell
Sci. 113(Pt. 11):1851–1856.
45. Silver, S. J., E. L. Davies, L. Doyon, and I. Rebay. 2003. Functional dissection
of eyes absent reveals new modes of regulation within the retinal determi-
nation gene network. Mol. Cell. Biol. 23:5989–5999.
46. Spitz, F., J. Demignon, A. Porteu, A. Kahn, J. P. Concordet, D. Daegelen,
and P. Maire. 1998. Expression of myogenin during embryogenesis is con-
trolled by Six/sine oculis homeoproteins through a conserved MEF3 binding
site. Proc. Natl. Acad. Sci. U. S. A. 95:14220–14225.
47. Tatematsu, K., C. Tokunaga, N. Nakagawa, K. Tanizawa, S. Kuroda, and U.
Kikkawa. 1998. Transcriptional activity of RBCK1 protein (RBCC protein
interacting with PKC 1): requirement of RING-finger and B-Box motifs and
regulation by protein kinases. Biochem. Biophys. Res. Commun. 247:392–
396.
48. Tatematsu, K., N. Yoshimoto, T. Koyanagi, C. Tokunaga, T. Tachibana, Y.
Yoneda, M. Yoshida, T. Okajima, K. Tanizawa, and S. Kuroda. 2005. Nu-
clear-cytoplasmic shuttling of a RING-IBR protein RBCK1 and its func-
tional interaction with nuclear body proteins. J. Biol. Chem. 280:22937–
22944.
49. Tatematsu, K., N. Yoshimoto, T. Okajima, K. Tanizawa, and S. Kuroda.
2008. Identification of ubiquitin ligase activity of RBCK1 and its inhibition
by splice variant RBCK2 and protein kinase C{beta}. J. Biol. Chem. 283:
11575–11585.
50. Theill, L. E., J. L. Castrillo, D. Wu, and M. Karin. 1989. Dissection of
functional domains of the pituitary-specific transcription factor GHF-1. Na-
ture 342:945–948.
51. Tian, Y., Y. Zhang, B. Zhong, Y. Y. Wang, F. C. Diao, R. P. Wang, M. Zhang,
D. Y. Chen, Z. H. Zhai, and H. B. Shu. 2007. RBCK1 negatively regulates
tumor necrosis factor- and interleukin-1-triggered NF-kappaB activation by
targeting TAB2/3 for degradation. J. Biol. Chem. 282:16776–16782.
52. Tokunaga, C., S. Kuroda, K. Tatematsu, N. Nakagawa, Y. Ono, and U.
Kikkawa. 1998. Molecular cloning and characterization of a novel protein
kinase C-interacting protein with structural motifs related to RBCC family
proteins. Biochem. Biophys. Res. Commun. 244:353–359.
5774 LANDGRAF ET AL. MOL.CELL.BIOL.
53. Tootle, T. L., S. J. Silver, E. L. Davies, V. Newman, R. R. Latek, I. A. Mills,
J. D. Selengut, B. E. Parlikar, and I. Rebay. 2003. The transcription factor
Eyes absent is a protein tyrosine phosphatase. Nature 426:299–302.
54. Walker, M. B., and C. B. Kimmel. 2007. A two-color acid-free cartilage and
bone stain for zebrafish larvae. Biotech. Histochem. 82:23–28.
55. Wayne, S., N. G. Robertson, F. DeClau, N. Chen, K. Verhoeven, S. Prasad,
L. Tranebjarg, C. C. Morton, A. F. Ryan, G. Van Camp, and R. J. Smith.
2001. Mutations in the transcriptional activator EYA4 cause late-onset deaf-
ness at the DFNA10 locus. Hum. Mol. Genet. 10:195–200.
56. Wollmann, Y., U. Schmidt, G. D. Wieland, P. F. Zipfel, H. P. Saluz, and F.
Hanel. 2007. The DNA topoisomerase IIbeta binding protein 1 (TopBP1)
interacts with poly (ADP-ribose) polymerase (PARP-1). J. Cell. Biochem.
102:171–182.
57. Xu, P. X., J. Adams, H. Peters, M. C. Brown, S. Heaney, and R. Maas. 1999.
Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of
organ primordia. Nat. Genet. 23:113–117.
58. Xu, P. X., J. Cheng, J. A. Epstein, and R. L. Maas. 1997. Mouse Eya genes
are expressed during limb tendon development and encode a transcriptional
activation function. Proc. Natl. Acad. Sci. U. S. A. 94:11974–11979.
59. Xu, P. X., W. Zheng, C. Laclef, P. Maire, R. L. Maas, H. Peters, and X. Xu.
2002. Eya1 is required for the morphogenesis of mammalian thymus, para-
thyroid and thyroid. Development 129:3033–3044.
60. Yamanaka, K., H. Ishikawa, Y. Megumi, F. Tokunaga, M. Kanie, T. A.
Rouault, I. Morishima, N. Minato, K. Ishimori, and K. Iwai. 2003. Identi-
fication of the ubiquitin-protein ligase that recognizes oxidized IRP2. Nat.
Cell Biol. 5:336–340.
61. Zenke-Kawasaki, Y., Y. Dohi, Y. Katoh, T. Ikura, M. Ikura, T. Asahara, F.
Tokunaga, K. Iwai, and K. Igarashi. 2007. Heme induces ubiquitination and
degradation of the transcription factor Bach1. Mol. Cell. Biol. 27:6962–6971.
62. Zou, D., C. Erickson, E. H. Kim, D. Jin, B. Fritzsch, and P. X. Xu. 2008. Eya1
gene dosage critically affects the development of sensory epithelia in the
mammalian inner ear. Hum. Mol. Genet. 17:3340–3356.
VOL. 30, 2010 Sipl1 AND Rbck1 ARE Eya1-INTERACTING PROTEINS 5775
    • "Thus, SHARPIN is clearly a multifunctional protein (Fig 7B) with most likely scaffolding or adaptor protein-like functions, as SHARPIN has no demonstrated enzymatic activity . Interestingly, all these known SHARPIN regulatory functions are mediated via direct binding of these proteins to the SHARPIN UBL domain [6,10,20,21], indicative of its role as a multi-faceted protein interaction hub. Given the relatively small size of the UBL domain (Fig 2) it is unlikely that all these SHARPIN interactors bind simultaneously. "
    [Show abstract] [Hide abstract] ABSTRACT: SHANK-associated RH domain interactor (SHARPIN) inhibits integrins through interaction with the integrin α-subunit. In addition, SHARPIN enhances nuclear factor-kappaB (NF-κB) activity as a component of the linear ubiquitin chain assembly complex (LUBAC). However, it is currently unclear how regulation of these seemingly different roles is coordinated. Here, we show that SHARPIN binds integrin and LUBAC in a mutually exclusive manner. We map the integrin binding site on SHARPIN to the ubiquitin-like (UBL) domain, the same domain implicated in SHARPIN interaction with LUBAC component RNF31 (ring finger protein 31), and identify two SHARPIN residues (V267, L276) required for both integrin and RNF31 regulation. Accordingly, the integrin α-tail is capable of competing with RNF31 for SHARPIN binding in vitro. Importantly, the full SHARPIN RNF31-binding site contains residues (F263A/I272A) that are dispensable for SHARPIN-integrin interaction. Importantly, disrupting SHARPIN interaction with integrin or RNF31 abolishes SHARPIN-mediated regulation of integrin or NF-κB activity, respectively. Altogether these data suggest that the roles of SHARPIN in inhibiting integrin activity and supporting linear ubiquitination are (molecularly) distinct.
    Full-text · Article · Nov 2015
    • "The N-terminal domain is required for the co-activator function (Xu et al, 1997) and the C-terminal domain for the tyrosine phosphatase function (Li et al, 2003), which is highly conserved (Buller et al, 2001). The conserved Eya domain (ED), in the C terminal portion of the protein, is required for interaction with proteins of the Six family (Chen et al, 1997; Fan et al, 2000; Landgraf et al, 2010; Tootle et al, 2003 ). It is known that mutations in the SIX1 and SIX5 , members of this gene family, also cause BOR syndrome; mutations in SIX2 are related to renal hypoplasia (Hoskins et al, 2007; Ruf et al, 2004; Weber et al, 2008). "
    [Show abstract] [Hide abstract] ABSTRACT: Objective: To identify novel genetic causes of syndromic hearing loss in Brazil. Design: To map a candidate chromosomal region through linkage studies in an extensive Brazilian family and identify novel pathogenic variants using sequencing and array-CGH. Study sample: Brazilian pedigree with individuals affected by BO syndrome characterized by deafness and malformations of outer, middle and inner ear, auricular and cervical fistulae, but no renal abnormalities. Results: Whole genome microarray-SNP scanning on samples of 11 affected individuals detected a multipoint Lod score of 2.6 in the EYA1 gene region (chromosome 8). Sequencing of EYA1 in affected patients did not reveal pathogenic mutations. However, oligonucleotide-array-CGH detected a duplication of 71.8Kb involving exons 4 to 10 of EYA1 (heterozygous state). Real-time-PCR confirmed the duplication in fourteen of fifteen affected individuals and absence in 13 unaffected individuals. The exception involved a consanguineous parentage and was assumed to involve a different genetic mechanism. Conclusions: Our findings implicate this EYA1 partial duplication segregating with BO phenotype in a Brazilian pedigree and is the first description of a large duplication leading to the BOR/BO syndrome.
    Full-text · Article · Apr 2015
    • "Moreover, EYA1 and SIX1 have been directly implicated as promoters of the early steps of neurogenesis in mouse cranial placodes [117, 118]. A role for EYA in craniofacial development is further supported by the work of Landgraf et al. who showed that Eya1 interacts with Sipl1 and Rbck1, proteins important in craniofacial development whose knockdown causes zebrafish embryos to develop with a branchiootorenal (BOR) syndrome-like phenotype [49]. "
    [Show abstract] [Hide abstract] ABSTRACT: The Eyes Absent (EYA) proteins, first described in the context of fly eye development, are now implicated in processes as disparate as organ development, innate immunity, DNA damage repair, photoperiodism, angiogenesis, and cancer metastasis. These functions are associated with an unusual combination of biochemical activities: tyrosine phosphatase and threonine phosphatase activities in separate domains, and transactivation potential when associated with a DNA-binding partner. EYA mutations are linked to multiorgan developmental disorders, as well as to adult diseases ranging from dilated cardiomyopathy to late-onset sensorineural hearing loss. With the growing understanding of EYA biochemical and cellular activity, biological function, and association with disease, comes the possibility that the EYA proteins are amenable to the design of targeted therapeutics. The availability of structural information, direct links to disease states, available animal models, and the fact that they utilize unconventional reaction mechanisms that could allow specificity, suggest that EYAs are well-positioned for drug discovery efforts. This review provides a summary of EYA structure, activity, and function, as they relate to development and disease, with particular emphasis on recent findings.
    Full-text · Article · Sep 2012
Show more