Molecular and Phenotypic Characteristics of CMY-2 β-Lactamase-Producing Salmonella enterica Serovar Typhimurium Isolated from Cattle in Japan

Abstract

Isolates of extended-spectrum cephalosporin (ESC)-resistant Salmonella enterica serovar Typhimurium obtained from two different farms in Fukushima Prefecture, Japan, in 2007 were characterized in order to determine the genetic basis of resistance. ESC resistance in the two isolates was mediated by an AmpC β-lactamase encoded by the bla(CMY-2) gene, which is located in a large self-transmissible plasmid in each isolate. The sizes of the bla(CMY-2)-carrying plasmids were different. The replicon types of the plasmids were I1-Iγ and A/C. The results of macrorestriction analysis and phage typing suggest a close relationship between both isolates. This is the first report of ESC-resistant S. Typhimurium isolated from cattle in Japan.

Full text

NOTE Public Health
Molecular and Phenotypic Characteristics of CMY-2 β-Lactamase-Producing
Salmonella enterica Serovar Typhimurium Isolated from Cattle in Japan
Masaru SUGAWARA1), Junko KOMORI2), Marimo KAWAKAMI3), Hidemasa IZUMIYA4), Haruo WATANABE4) and
Masato AKIBA5)*
1)Aizu Livestock Hygiene Service Center, 90 Muramae, Kamikoya, Koyamachi, Aizuwakamatsu, Fukushima 965–0077, 2)Iwaki Livestock
Hygiene Service Center, 107–1 Nagamachi, Miyamamachi, Uchigo, Iwaki, Fukushima 973–8402, 3)Kenchu Livestock Hygiene Service
Center, 2 Mansuida, Tomitamachi, Koriyama, Fukushima 963–8041, 4)Department of Bacteriology, National Institute of Infectious
Diseases, 1–23–1 Toyama, Shinjuku, Tokyo 162–8640 and 5)Safety Research Team, National Institute of Animal Health, 3–1–5
Kannondai, Tsukuba, Ibaraki 305–0856, Japan
(Received 14 April 2010/Accepted 28 September 2010/Published online in J-STAGE 12 October 2010)
ABSTRACT. Isolates of extended-spectrum cephalosporin (ESC)-resistant Salmonella enterica serovar Typhimurium obtained from two dif-
ferent farms in Fukushima Prefecture, Japan, in 2007 were characterized in order to determine the genetic basis of resistance. ESC resis-
tance in the two isolates was mediated by an AmpC β-lactamase encoded by the blaCMY-2 gene, which is located in a large self-
transmissible plasmid in each isolate. The sizes of the blaCMY-2-carrying plasmids were different. The replicon types of the plasmids
were I1-I

and A/C. The results of macrorestriction analysis and phage typing suggest a close relationship between both isolates. This
is the first report of ESC-resistant S. Typhimurium isolated from cattle in Japan.
KEY WORDS: AmpC β-lactamase, blaCMY-2, ESC-resistant Salmonella, Salmonella Typhimurium.
J. Vet. Med. Sci. 73(3): 345–349, 2011
Nontyphoidal salmonellae are a leading cause of food-
borne illness worldwide. Gastroenteritis caused by Salmo-
nella infection is typically self-limited, and antimicrobial
therapy may not decrease the severity but rather prolong
fecal excretion of this organism [6]. However, antimicro-
bial therapy is lifesaving for invasive Salmonella infections,
which commonly occur in children, particularly in infants
less than one year old [14]. Extended-spectrum cepha-
losporins (ESCs) are the antimicrobials of choice for inva-
sive Salmonella infections in pediatric patients [14].
Therefore, the increasingly frequent isolation of ESC-resis-
tant Salmonella from food animals is an important public
health concern [5].
ESC-resistant Salmonella have emerged worldwide since
1988 and the prevalence among human cases was reported
to be 0–3.4% in the U.S.A., European countries and Taiwan
[5]. The resistance was mediated by classical extended-
spectrum β-lactamase, plasmid-mediated cephalosporinases
and a class A carbapenemase. Of these, CMY-2, an AmpC
β-lactamase encoded by the blaCMY-2 gene, is the most fre-
quently detected enzyme [5]. In most cases, the blaCMY-2
gene exists in large plasmids, of which several genetic types
have been reported [8, 12, 18], and the blaCMY-2-carrying
plasmids have been isolated from cattle, swine, humans and
retail meat [13, 25, 26]. Salmonella enterica serovars Typh-
imurium (S. Typhimurium) and Enteritidis are the most
common serovars associated with ESC resistance in human
infections [5].
Limited information is available about ESC-resistant Sal-
monella in Japan. CTX-M enzymes, which are responsible
for ESC resistance, were detected from serovars Senften-
berg and Enteritidis [1, 15, 16]. An isolate of serovar Sen-
ftenberg recovered from a broiler chicken in a national
surveillance of Japan was the 1st report of ESC-resistant
Salmonella directly isolated from a food-producing animal
in Japan [15]. In 2007, we isolated ESC-resistant S. Typh-
imurium from diseased cattle that originated from two dif-
ferent farms located in Fukushima Prefecture, Japan. The
purpose of this study was to elucidate the genetic basis of
ESC resistance and the origin of these isolates.
S. Typhimurium isolate 19–80 was recovered from a dis-
eased cow at a dairy farm. Clinical symptoms including
fever, depressed milk yield, diarrhea and abortion were
observed in cattle during an outbreak. This farm had not
introduced any animals from other farms during a 3-year
period. Isolate 19–1823 was recovered from a diseased calf
in a beef production setting. Clinical symptoms including
fever, diarrhea and septicemia were observed in calves dur-
ing an outbreak. Calves were introduced to this farm from
other farms once every other week, and isolate 19–1823 was
recovered from a calf introduced from the neighboring pre-
fecture of Yamagata. Both farms are located in Fukushima
Prefecture, and the distance between the two farms is about
55 km as the crow flies. No epidemiological relationships
were observed between these farms.
Both isolates were identified as Salmonella spp. based on
their colony morphology on selective media and biochemi-
cal testing [11]. Serovar identification was performed using
microtiter and slide agglutination methods according to the
latest version of the Kauffmann and White scheme using
antiserums (Denka Seiken, Tokyo, Japan) [23]. The isolates
were stored at –80°C in Trypto-Soya Broth (Nissui Pharma-
*CORRESPONDENCE TO: Dr. AKIBA, M., Safety Research Team,
National Institute of Animal Health, 3–1–5 Kannondai, Tsukuba,
Ibaraki 305–0856, Japan.
e-mail: akiba@affrc.go.jp

M. SUGAWARA ET AL.
346
ceutical, Tokyo, Japan) containing 25% glycerol until they
were analyzed.
A minimum inhibitory concentration assay for the iso-
lates was performed by an agar dilution method using the
National Committee for Clinical and Laboratory Standards
(NCCLS, currently CLSI) [21]. Staphylococcus aureus
ATCC 29213, Enterococcus faecalis ATCC 29212, Escher-
ichia coli ATCC 25922 and Pseudomonas aeruginosa
ATCC 27853 were utilized as quality control strains. The
following 14 antimicrobials were analyzed for resistance:
ampicillin, cefazolin, cefoxitin, ceftiofur, ceftazidime,
ceftriaxone, cefepime, streptomycin, kanamycin, gentami-
cin, tetracycline, chloramphenicol, nalidixic acid and enrof-
loxacin. The data obtained was interpreted according to the
CLSI standards [22] with the exception of ceftiofur and
enrofloxacin, for which the resistance breakpoint was
obtained from previous reports [10, 15].
Cephalosporinase was detected in the bacterial strains by
the P/Case test (Nissui Pharmaceutical) according to the
manufacturer’s instructions.
Plasmid DNA was isolated by the method described by
Kado and Liu [17] followed by phenol-chloroform extrac-
tion. The BAC-Tracker Supercoiled DNA ladder (Epicentre
Biotechnologies, Madison, WI, U.S.A.) was used as a size
marker for plasmid analysis. Conjugation was performed as
described previously to detect R-plasmids from the isolates
using Escherichia coli strain ML1410 (resistant to rifampi-
cin) as a recipient [2]. The transconjugant was selected on
DHL agar (Eiken Chemical, Tokyo, Japan) plates contain-
ing rifampicin (100 μg/ml) and cefazolin (50 μg/ml).
The PCR primers listed in Table 1 were used for detection
of each target gene, replicon typing and preparation of the
DNA probe for Southern hybridization. This experiment
was performed to detect the replicon type-specific sequence
on plasmid DNA. Each PCR product was sequenced using
an ABI Prism BigDye Terminator v3.1 Cycle Sequencing
Kit on an ABI 3100 DNA Genetic Analyzer (Applied Bio-
systems, Foster City, CA, U.S.A.) to confirm the target
amplifications. DNA probe labeling, hybridization and
detection were performed using DIG-PCR and DIG Nucleic
Acid Detection Kits (Roche Diagnostics, Basel, Switzer-
land) in accordance with the manufacturer’s instructions.
DNA molecular-weight marker II, DIG-labeled (Roche
Diagnostics), DNA molecular-weight marker VI, DIG-
labeled (Roche Diagnostics), and a 2.5-kbp DNA Ladder
(Takara Bio, Shiga, Japan) were used as DNA size markers.
As shown in Table 2, S. Typhimurium isolates 19–80 and
19–1823 were resistant to 5 and 6 antimicrobials, respec-
tively, in addition to the ESCs including cefoxitin, ceftiofur,
ceftazidime and ceftriaxone. Cephalosporinase was
detected from both the isolates by the P/Case test. We also
detected both blaCMY-2 and blaTEM-1 genes in the 2 isolates by
PCR and direct sequencing of the amplified fragments
(Table 3).
Table 1. PCR primers used in this study
Primer Nucleotide sequence (5’3’) Target Accession no. Product size (bp) Reference
CMY-2 FW ATGATGAAAAAATCGTTATGCT blaCMY-2 X91840 1146 [19]
CMY-2 RV TTATTGCAGCTTTTCAAGAATGCG
TEM-1 FW ATGAGTATTCAACATTTTCG blaTEM-1 AB194682 861 [19]
TEM-1 RV TTACCAATGCTTAATCAGTG
spvB FW TGTCAGCAGTTGCATCATCA spvB AE006471 573 This work
spvB RV GGGCGATTGTAGAGGAATCA
FIB FW GGAGTTCTGACACACGATTTTCTG repA (IncFIB) M26308 702 [7]
FIB RV CTCCCGTCGCTTCAGGGCATT
FIIs FW CTGTCGTAAGCTGATGGC repA (IncFIIA) AE006471 270 [7]
FIIs RV CTCTGCCACAAACTTCAGC
I1 FW CGAAAGCCGGACGGCAGAA RNAI (IncI1) M20413 139 [7]
I1 RV TCGTCGTTCCGCCAAGTTCGT
A/C FW GAGAACCAAAGACAAAGACCTGGA repA (IncA/C) X73674 465 [7]
A/C RV ACGACAAACCTGAATTGCCTCCTT
Table 2. Antimicrobial susceptibilities of the strains
Straina) Minimum inhibitory concentrations (

g/ml)b)
AMP CFZ FOX CFT CAZ CRO FEP STR KAN GEN TET CHL NAL EFX
19–80 >512 >512 128 64 128 64 2 512 >512 0.5 256 440.125
19–80TC 64 >512 32 8880.125 2 2 0.5 4 2 512 0.5
19–1823 >512 >512 128 64 128 64 2>512>512 32 512 512 40.125
19–1823TC 64 512 32 48 40.125 >512 16 32 128 64 512 0.5
ML1410 1 1 1 0.125 0.125 0.125 0.125 2 2 0.5 4 2 512 0.5
a) #TC, transconjugant.
b) AMP, ampicillin; CFZ, cefazolin; FOX, cefoxitin; CFT, ceftiofur; CAZ, ceftazidime; CRO, ceftriaxone; FEP, cefepime; STR, streptomycin;
KAN, kanamycin; GEN, gentamicin; TET, tetracycline; CHL, chloramphenicol; NAL, nalidixic acid; EFX, enrofloxacin. Underlined values
indicate resistance.

347
CHARACTERISTICS OF ESC-RESISTANT SALMONELLA
Transconjugants harboring a single plasmid that origi-
nated from both isolates were successfully selected. Both
transconjugants were resistant to cefazolin and cefoxitin
(Table 2). The blaCMY-2 gene was detected from each
transconjugant by PCR and direct sequencing of the ampli-
fied fragments (Table 3). These data indicate that the
blaCMY-2 genes of isolates 19–80 and 19–1823 were located
in 95-kbp and >165-kbp plasmids, respectively. The fact
that 19–1823 transconjugant was also resistant to strepto-
mycin, gentamicin, tetracycline and chloramphenicol indi-
cates that the >165-kb plasmid contains genes contributing
to these resistances. The replicon types of the plasmids
were determined as I1-Iγ and A/C, respectively, by PCR and
direct sequencing of the amplified fragments (Table 3).
Both replicon types have been reported as the most predom-
inant replicon types of the blaCMY-2-carrying plasmids from
the Canadian cefoxitin-resistant Salmonella [20].
To characterize the blaCMY-2 gene-containing plasmids,
we performed Southern hybridization analysis using the
intact or PstI-digested plasmid DNA. The signals of
Table 4. Results of hybridization experiments of each plasmid
Plasmid Origina) Hybridization with the gene-specific probeb)
(kbp) blaCMY-2 spv B IncFI

IncFII IncI1-IIncA/C
95 19–80 + – – – + –
165 19–80 – + + + – –
95 19–80TC + – – – + –
165 19–1823 – + + + – –
>165 19–1823 + – – – – +
>165 19–1823TC + – – – – +
a) #TC, transconjugant.
b) +, hybridization signal was observed; –, hybridization signal was not observed.
Table 3. Plasmid profiles, replicon types and

-lactamase genes detected
Straina) Plasmid Replicon

-lactamase
profile (kbp) types genes
19–80 165, 95 FIB, FII, I1-ICMY-2, TEM-1
19–80TC 95 I1-ICMY-2
19–1823 >165, 165 FIB, FII, A/C CMY-2, TEM-1
19–1823TC >165 A/C CMY-2
a) #TC, transconjugant.
Fig. 1. (A) PstI digests of the blaCMY-2-carrying plasmids extracted from the
transconjugants. Lanes1, 2, 3, 4 and 5: DNA molecular-weight marker II,
DIG-labeled; 19-80TC; 19-1823TC; DNA molecular-weight marker VI, DIG-
labeled; and 2.5-kbp DNA Ladder, respectively. (B) Subsequent Southern
hybridization of the gel in panel A probed with blaCMY-2. Sizes of bands
hybridizing to the blaCMY-2 probe are given on the right.

M. SUGAWARA ET AL.
348
blaCMY-2 and IncI1-Iγ were detected from the 95-kbp plas-
mid that originated from isolate 19–80, while those of
blaCMY-2 and IncA/C were detected from the >165-kbp plas-
mid that originated from isolate 19–1823 (Table 4). After
PstI digestion of the 95-kbp plasmid isolated from 19–
80TC, blaCMY-2 signals were detected from 2.5- and 0.8-kbp
fragments, while the signals were detected from 12.5- and
0.8-kbp fragments of the >165-kbp plasmid isolated from
19–1823TC (Fig. 1). Similar hybridization patterns were
also reported in the analysis of blaCMY-2-carrying plasmids
of Salmonella isolated in the U.S.A. [8, 12].
Pulsed-field gel electrophoresis (PFGE) was performed
to compare the macrorestriction patterns of the isolates.
Genomic DNA was prepared as described previously [3]
and digested with XbaI or BlnI (Takara Bio). Lambda Lad-
der PFG Marker (New England BioLabs, Beverly, MA,
U.S.A.) was used as a DNA size marker. PFGE was per-
formed in a 1% megabase agarose gel (Bio-Rad Laborato-
ries, Hercules, CA, U.S.A.) using a CHEF DR III system
(Bio-Rad Laboratories) in 0.5X TBE (89 mM Tris, 89 mM
boric acid and 2 mM EDTA) at 14°C. The electrophoresis
conditions were 0.6 V/cm with pulse times of 5 to 50 sec for
22 hr.
As shown in Fig. 2, digestion of genomic DNA from iso-
lates 19–80 and 19–1823 with XbaI produced 16 and 17
fragments with sizes ranging from 28 to 770 kbp, respec-
tively, while BlnI digestion produced 10 and 9 fragments
with sizes ranging from 85 to 790 kbp, respectively. A dif-
ference was observed in three bands (XbaI, 503, 380 and
155 kbp; BlnI, 160, 145 and 104 kbp) between isolates 19–
80 and 19–1823 for each digestion. The fact that these dif-
ferences can be explained by 1 or 2 genetic differences sug-
gests a close relationship between the isolates [24].
Bacteriophage typing was performed in accordance with
the methods of the Public Health Laboratory Service,
London, United Kingdom [4]. Isolates 19–80 and 19–1823
were phage type untypable with regards to the standard
Colindale panel of phages.
Davis et al. [9] reported that multidrug-resistant S. Typh-
imurium with the specific PFGE types has been isolated
from humans and cattle in the Pacific Northwest, U.S.A.,
since the beginning of 2000. All the isolates were phage
type untypable, and more than half were resistant to ESCs.
In addition, similarities between the data from plasmid anal-
yses have been noted between Japan and North America,
including the U.S.A. and Canada [8, 12, 20]. To elucidate
the relationship between our isolates and foreign isolates,
more extensive and detailed comparisons are necessary.
Taken together, we obtained two isolates of ESC-resis-
tant S. Typhimurium from diseased cattle at epidemiologi-
cally unrelated farms located in Fukushima Prefecture,
Japan. ESC resistance in these isolates was mediated by an
AmpC β-lactamase encoded by the blaCMY-2 gene, which
was located in a large plasmid in each isolate. Although the
macrorestriction patterns of these isolates were highly simi-
lar, the sizes of the blaCMY-2-carrying plasmids were differ-
ent. The replicon types of the plasmids were I1-Iγ and A/C.
The IncA/C plasmid carried genes contributing to at least
four antimicrobials in addition to ESCs. The fact that both
plasmids were self-transmissible suggests that these isolates
are possible sources of transmission of blaCMY-2 and other
resistance genes for other bacteria by conjugation. To eval-
uate the importance of ESC-resistant Salmonella among
food-producing animals in Japan as a public health concern,
an extensive surveillance is needed. To the best of our
knowledge, this is the first characterization of ESC-resistant
S. Typhimurium isolated from cattle in Japan.
ACKNOWLEDGMENT. This work was supported in part
by a grant-in-aid from the Ministry of Health, Labour and
Welfare of Japan (H21-Shokuhin-Ippan-013).
REFERENCES
1. Ahmed, A. M., Nakano, H. and Shimamoto, T. 2004. The first
characterization of extended-spectrum beta-lactamase-produc-
ing Salmonella in Japan. J. Antimicrob. Chemother. 54: 283–
284.
2. Akiba, M., Nakaoka, Y., Kida, M., Ishioka, Y., Sameshima, T.,
Yoshii, N., Nakazawa, M., Uchida, I. and Terakado, N. 2007.
Changes in antimicrobial susceptibility in a population of Sal-
monella enterica serovar Dublin isolated from cattle in Japan
Fig. 2. Macrorestriction analysis of genomic DNA digested with
XbaI (A) and BlnI (B) of ESC-resistant S. Typhimurium by
PFGE. Lanes 1, 2 and 3: Lambda Ladder PFG Marker, 19–80
and 19–1823, respectively. Black arrowheads shown on the right
of each panel indicate the different bands observed for the iso-
lates.

349
CHARACTERISTICS OF ESC-RESISTANT SALMONELLA
from 1976 to 2005. J. Antimicrob. Chemother. 60: 1235–1242.
3. Akiba, M., Uchida, I., Nishimori, K., Tanaka, K., Anzai, T.,
Kuwamoto, Y., Wada, R., Ohya, T. and Ito, H. 2003. Compari-
son of Salmonella enterica serovar Abortusequi isolates of
equine origin by pulsed-field gel electrophoresis and fluores-
cent amplified-fragment length polymorphism fingerprinting.
Vet. Microbiol. 92: 379–388.
4. Anderson, E. S., Ward, L. R., Saxe, M. J. and de Sa, J. D. 1977.
Bacteriophage-typing designations of Salmonella typhimu-
rium. J. Hyg. (Lond.) 78: 297–300.
5. Arlet, G., Barrett, T. J., Butaye, P., Cloeckaert, A., Mulvey, M.
R. and White, D. G. 2006. Salmonella resistant to extended-
spectrum cephalosporins: prevalence and epidemiology.
Microbes Infect. 8: 1945–1954.
6. Aserkoff, B. and Bennett, J. V. 1969. Effect of antibiotic ther-
apy in acute salmonellosis on the fecal excretion of salmonel-
lae. New Engl. J. Med. 281: 636–640.
7. Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K. L.
and Threlfall, E. J. 2005. Identification of plasmids by PCR-
based replicon typing. J. Microbiol. Methods 63: 219–228.
8. Carattoli, A., Tosini, F., Giles, W. P., Rupp, M. E., Hinrichs, S.
H., Angulo, F. J., Barrett, T. J. and Fey, P. D. 2002. Character-
ization of plasmids carrying CMY-2 from expanded-spectrum
cephalosporin-resistant Salmonella strains isolated in the
United States between 1996 and 1998. Antimicrob. Agents
Chemother. 46: 1269–1272.
9. Davis, M. A., Besser, T. E., Eckmann, K., MacDonald, K.,
Green, D., Hancock, D. D., Baker, K. N., Warnick, L. D.,
Soyer, Y., Wiedmann, M. and Call, D. R. 2007. Multidrug-
resistant Salmonella Typhimurium, Pacific Northwest, United
States. Emerg. Infect. Dis. 13: 1583–1586.
10. Esaki, H., Morioka, A., Ishihara, K., Kojima, A., Shiroki, S.,
Tamura, Y. and Takahashi, T. 2004. Antimicrobial susceptibil-
ity of Salmonella isolated from cattle, swine and poultry
(2001–2002): report from the Japanese Veterinary Antimicro-
bial Resistance Monitoring Program. J. Antimicrob.
Chemother. 53: 266–270.
11. Edwards P. R. and Ewing, W. H. 1986. Edwards and Ewing's
Identification of Enterobacteriaceae, Fourth Edition. Elsevier
Science Publishing Co., Inc., New York.
12. Giles, W. P., Benson, A. K., Olson, M. E., Hutkins, R. W.,
Whichard, J. M., Winokur, P. L. and Fey, P. D. 2004. DNA
sequence analysis of regions surrounding blaCMY-2 from multi-
ple Salmonella plasmid backbones. Antimicrob. Agents
Chemother. 48: 2845–2852.
13. Gray, J. T., Hungerford, L. L., Fedorka-Cray, P. J. and Head-
rick, M. L. 2004. Extended-spectrum-cephalosporin resistance
in Salmonella enterica isolates of animal origin. Antimicrob.
Agents Chemother. 48: 3179–3181.
14. Hohmann, E. L. 2001. Nontyphoidal salmonellosis. Clin.
Infect. Dis. 32: 263–269.
15. Ishihara, K., Takahashi, T., Morioka, A., Kojima, A., Kijima,
M., Asai, T. and Tamura, Y. 2009. National surveillance of
Salmonella enterica in food-producing animals in Japan. Acta
Vet. Scand. 51: 35.
16. Izumiya, H., Mori, K., Higashide, M., Tamura, K., Takai, N.,
Hirose, K., Terajima, J. and Watanabe, H. 2005. Identification
of CTX-M-14

-lactamase in a Salmonella enterica serovar
Enteritidis isolate from Japan. Antimicrob. Agents. Chemother.
49: 568–2570.
17. Kado, C. I. and Liu, S. T. 1981. Rapid procedure for detection
and isolation of large and small plasmids. J. Bacteriol. 145:
1365–1373.
18. Kang, M. S., Besser, T. E. and Call, D. R. 2006. Variability in
the region downstream of the blaCMY-2 beta-lactamase gene in
Escherichia coli and Salmonella enterica plasmids. Antimi-
crob. Agents Chemother. 50: 1590–1593.
19. Kojima, A., Ishii, Y., Ishihara, K., Esaki, H., Asai, T., Oda, C.,
Tamura, Y., Takahashi, T. and Yamaguchi, K. 2005. Extended-
spectrum-beta-lactamase-producing Escherichia coli strains
isolated from farm animals from 1999 to 2002: report from the
Japanese Veterinary Antimicrobial Resistance Monitoring Pro-
gram. Antimicrob. Agents Chemother. 49: 3533–3537.
20. Mataseje, L. F., Xiao, J., Kost, S., Ng, L. K., Dore, K. and Mul-
vey, M. R. 2009. Characterization of Canadian cefoxitin-resis-
tant non-typhoidal Salmonella isolates, 2005–06. J.
Antimicrob. Chemother. 64: 723–730.
21. National Committee for Clinical Laboratory Standards. 2001.
Performance standards for antimicrobial disk and dilution sus-
ceptibility test for bacteria isolated from animals-second edi-
tion: Approved Standard M31-A2, Wayne, PA, U.S.A.
22. National Committee for Clinical Laboratory Standards. 2003.
Performance standards for antimicrobial susceptibility testing:
Thirteen Informational Supplement M100-S13, Wayne, PA,
U.S.A.
23. Popoff, M. Y. 2001. Antigenic Formulas of the Salmonella
serovars, Eith Edition. WHO Collaborating Centre for Refer-
ence and Research on Salmonella, Paris, France.
24. Tenover, F. C., Arbeit, R. D., Goering, R. V., Mickelsen, P. A.,
Murray, B. E., Persing, D. H. and Swaminathan, B. 1995. Inter-
preting chromosomal DNA restriction patterns produced by
pulsed-field gel electrophoresis: criteria for bacterial strain typ-
ing. J. Clin. Microbiol. 33: 2233–2239.
25. Winokur, P. L., Brueggemann, A., DeSalvo, D. L., Hoffmann,
L., Apley, M. D., Uhlenhopp, E. K., Pfaller, M. A. and Doern,
G. V. 2000. Animal and human multidrug-resistant, cepha-
losporin-resistant Salmonella isolates expressing a plasmid-
mediated CMY-2 AmpC beta-lactamase. Antimicrob. Agents
Chemother. 44: 2777–2783.
26. Zaidi, M. B., Leon, V., Canche, C., Perez, C., Zhao, S., Hubert,
S. K., Abbott, J., Blickenstaff, K. and McDermott, P. F. 2007.
Rapid and widespread dissemination of multidrug-resistant
blaCMY-2 Salmonella Typhimurium in Mexico. J. Antimicrob.
Chemother. 60: 398–401.