Contribution of Enhanced Efflux to Reduced Susceptibility of Salmonella enterica Serovar Choleraesuis to Fluoroquinolone and Other Antimicrobials

Ministry of Agriculture, Forestry and Fisheries, Tokyo, Japan.
Journal of Veterinary Medical Science (Impact Factor: 0.78). 02/2011; 73(2):279-82. DOI: 10.1292/jvms.10-0309
Source: PubMed

ABSTRACT

We examined antimicrobial susceptibility and efflux systems in laboratory-derived mutants of Salmonella enterica serovar Choleraesuis selected by culture on fluoroquinolone-containing plates. The mutants exhibited decreased susceptibilities to quinolones and several other antimicrobials. Mutations in the gyrA gene were not always found in the mutants. Accumulation assays revealed that intracellular enrofloxacin concentrations were significantly lower in the mutants compared with parent isolates. Increased expression of acrB mRNA can explain the decreased susceptibilities to several antimicrobials but not in the case of carbonyl cyanide m-chlorophenylhydrazone (CCCP). Decreased susceptibility to CCCP may result from the increased expression of emrA mRNA. These results suggest that the enhancement of multiple efflux pumps is responsible for decreased susceptibilities to several antimicrobials in the laboratory-derived mutants.

Download full-text

Full-text

Available from: Tetsuo Asai, Dec 20, 2015
  • Source
    • "acrA-R GTACCGGACTGCGGGAATT Usui et al. (2011) acrB-rt1 GGCATTGGGTATGACTGGAC Zheng et al. (2009) acrB-rt2 GCATTACGGAGAACGGGATAG Zheng et al. (2009) ramA-rt1 TTTCCGCTCAGGTTATCGAC Zheng et al. (2009) ramA-rt2 CGGGCAATATCATCAATACG Zheng et al. (2009) soxS-rt1 AAATCGGGCTACTCCAAG Zheng et al. (2009) soxS-rt2 TACTCGCCTAATGTTTGATG Zheng et al. (2009) marA-rt1 ATTCTCTATCTGGCGGAAC Zheng et al. (2009) marA-rt2 CGGGTCAATGTTTGCTGTG Zheng et al. (2009) robA-rt1 TATTCCGCCAGTGCTTTATG Zheng et al. (2009) robA-rt2 CCTGCTCATCGTCTTTCTCC Zheng et al. (2009) 16S rRNA-F CCAGCAGCCGCGGTAAT Usui et al. (2010) 16S rRNA-R TTTACGCCCAGTAATTCCGATT Usui et al. (2010) "
    [Show abstract] [Hide abstract]
    ABSTRACT: Understanding the impact of antimicrobial use on the emergence of resistant bacteria is imperative to prevent its emergence. For instance, activation of the AcrAB efflux pumps is responsible for the emergence of antimicrobial-resistant Salmonella strains. Here, we examined the expression levels of acrB and its multiple regulator genes (RamA, SoxS, MarA, and Rob) in 17 field isolates of S. Choleraesuis by using quantitative PCR methods. The expression of acrB increased in 8 of the field isolates (P < 0.05). The expression of acrB was associated with that of ramA in 1 isolate, soxS in 1 isolate, and both these genes in 6 isolates. Thereafter, to examine the effect of selected antimicrobials (enrofloxacin, ampicillin, oxytetracycline, kanamycin, and spectinomycin) on the expression of acrB and its regulator genes, mutants derived from 5 isolates of S. Choleraesuis were selected by culture on antimicrobial-containing plates. The expression of acrB and ramA was higher in the mutants selected using enrofloxacin (3.3–6.3- and 24.5–37.7-fold, respectively), ampicillin (1.8–7.7- and 16.1–55.9-fold, respectively), oxytetracycline (1.7–3.3- and 3.2–31.1-fold, respectively), and kanamycin (1.6–2.2- and 5.6–26.4-fold, respectively), which are AcrAB substrates, than in each of the parental strains (P < 0.05). In contrast, in AcrAB substrate-selected mutants, the expression of soxS, marA, and rob remained similar to that in parental strains. Of the 4 antimicrobials, the level of ramA expression was significantly higher in the enrofloxacin- and ampicillin-selected mutants than in the oxytetracycline- and kanamycin-selected mutants (P < 0.05), whereas the expression levels of acrB and multiple regulator genes in spectinomycin-selected mutants were similar to those in each parental strain. These data suggest that exposure to antimicrobials that are AcrAB substrates enhance the activation of the AcrAB efflux pump via RamA, but not via SoxS, MarA, or Rob in S. Choleraesuis.
    Full-text · Article · Mar 2013 · Frontiers in Microbiology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: We investigated the mechanism responsible for bile susceptibility in three deoxycholate-sensitive (DCs) strains of Salmonella enterica subspecies enterica serovar Pullorum isolated in 1958 in Japan. Of the genes encoding the AcrAB-TolC efflux system, the expression of acrB mRNA was 10-fold lower in the DCs strains than in a deoxycholate-resistant (DCr) strain, whereas those of the acrA and tolC genes were two-fold lower. These results suggested that low expression of acrB was strongly correlated with bile susceptibility in the DCs strains. In addition, the increase in tolC expression levels was not detected in the DCr mutants derived from the DCs strains, suggesting that difference in the expression levels of tolC is not associated with bile susceptibility.
    Full-text · Article · May 2011 · Microbiology and Immunology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Salmonella enterica subsp. enterica serovar Choleraesuis is a highly invasive pathogen of swine that frequently causes serious outbreaks, in particular in Asia, and can also cause severe invasive disease in humans. In this study, 21 S. Choleraesuis isolates, detected from 21 patients with diarrhea in China between 2010 and 2011, were found to include 19 H2S-negative S. Choleraesuis isolates and two H2S-positive isolates. This is the first report of H2S-negative S. Choleraesuis isolated from humans. The majority of H2S-negative isolates exhibited high resistance to ampicillin, chloramphenicol, gentamicin, tetracycline, ticarcillin, and trimethoprim-sulfamethoxazole, but only six isolates were resistant to norfloxacin. In contrast, all of the isolates were sensitive to cephalosporins. Fifteen isolates were found to be multidrug resistant. In norfloxacin-resistant isolates, we detected mutations in the gyrA and parC genes and identified two new mutations in the parC gene. Pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and clustered regularly interspaced short palindromic repeat (CRISPR) analysis were employed to investigate the genetic relatedness of H2S-negative and H2S-positive S. Choleraesuis isolates. PFGE revealed two groups, with all 19 H2S-negative S. Choleraesuis isolates belonging to Group I and H2S-positive isolates belonging to Group II. By MLST analysis, the H2S-negative isolates were all found to belong to ST68 and H2S-positive isolates belong to ST145. By CRISPR analysis, no significant differences in CRISPR 1 were detected; however, one H2S-negative isolate was found to contain three new spacers in CRISPR 2. All 19 H2S-negative isolates also possessed a frame-shift mutation at position 760 of phsA gene compared with H2S-positive isolates, which may be responsible for the H2S-negative phenotype. Moreover, the 19 H2S-negative isolates have similar PFGE patterns and same mutation site in the phsA gene, these results indicated that these H2S-negative isolates may have been prevalent in China. These findings suggested that surveillance should be increased of H2S-negative S. Choleraesuis in China.
    Full-text · Article · Oct 2015 · PLoS ONE