Reply to “Concerns about Recently Identified Widespread Antisense Transcription in Escherichia coli”

Article (PDF Available)inmBio 1(2) · June 2010with22 Reads
DOI: 10.1128/mBio.00119-10 · Source: PubMed
Reply to “Concerns about Recently Identified Widespread Antisense
Transcription in Escherichia coli
I
n our recent article, “Widespread Antisense Transcription in
Escherichia coli (1), we describe the identification of ~1,000
antisense RNAs (aRNAs) in the model bacterium Escherichia coli.
This finding is significant because it suggests that aRNAs represent
a major class of regulators in bacteria. Slonczewski expressed con-
cerns regarding (i) the documentation of methods used, (ii) pos-
sible contamination of the cDNA library, (iii) insufficient con-
trols, and (iv) failure to consider alternative interpretations of the
data (4).
Due to strict space limitations for Observations, we provided
only the most relevant aspects of the methods used. A detailed
description of the library construction is included at the end of
this letter.
Library construction involved ligation of an RNA linker, re-
verse transcription, and two rounds of nested PCR. This method
effectively eliminates the possibility of contamination by exoge-
nous DNA or RNA. We attempted to construct a control cDNA
library from a mock sample lacking RNA. We cloned and se-
quenced several individual fragments from this library, all of
which were products formed by ligation of multiple mutant RNA
linker oligonucleotides. Hence, we did not subject this library to
high-throughput sequencing. This observation supports the idea
that contamination by exogenous DNA or RNA was not a con-
cern.
As described in the article, we validated the aRNAs using bioin-
formatic and experimental approaches. Crucially, we demon-
strated that (i) putative aRNAs are significantly enriched for “A” at
the initiating nucleotide (P 1e
50
) and are indistinguishable in
this respect from published RNA 5= ends (P 0.40); (ii) 10
hexamers for putative aRNAs have significantly better matches to
the consensus sequence than random sequences do (P
8.8E
102
) and are indistinguishable from those of published RNAs
(P 0.49); (iii) 9 of 10 putative aRNA promoters tested resulted
in significant expression of a lacZ reporter gene; in all nine cases,
expression was dependent upon an intact 10 hexamer, indica-
tive of a functional promoter; and (iv) one of two putative aRNAs
tested repressed expression of the overlapping protein-coding
gene.
Our data are most easily explained by the presence of a large
number of aRNAs and are not consistent with any other reason-
able interpretation. We note that no other possible interpretations
and no other controls were suggested by Slonczewski.
Lastly, our conclusions are consistent with those of many other
studies. In particular, a study in which the authors identified a
similar number of aRNAs in Helicobacter pylori (2) was published
while our work was in press.
For cDNA library construction, MG1655 E. coli cells were
grown in LB to an optical density at 600 nm (OD
600
) of 0.7. RNA
was purified using the hot-phenol method (3) and treated with
DNase I. rRNA was removed by two rounds of treatment with the
MICROBExpress kit (Ambion). RNA was treated with tobacco
acid pyrophosphatase (TAP). TAP-treated RNA was purified by
phenol extraction and ethanol precipitation. An RNA oligonucle-
otide (5=-ACACUCUUUCCCUACACGACGCUCUUCCGAUC
U-3=) was ligated to the RNA 5= ends using T4 RNA ligase 1 (NEB)
for1hat37°C. RNA was gel purified to remove unligated 5= linker
oligonucleotide. RNA was reverse transcribed with 5=-GTTTCCC
AGTCACGATCNNNNNNNNN-3= and SuperScript III reverse
transcriptase (Invitrogen). cDNA was amplified by PCR (25 cy-
cles) using primers 5=-GTTTCCCAGTCACGATC-3= and 5=-AC
ACTCTTTCCCTACACG-3=. DNAs of lengths between 80 and
200 bp were gel purified and reamplified by PCR using primers
5=-GTTTCCCAGTCACGATC-3= and 5=-ACGCTCTTCCGATC
T-3=. One-hundredth of the DNA sample was amplified by PCR
using the primers 5=-AATGATACGGCGACCACCGAGATCTAC
ACTCTTTCCCTACACGACGCTCTTCCGATCT-3= and 5=-CA
AGCAGAAGACGGCATACGAGCTCTTCCGATCTGTTTC
CCAGTCACGATC-3=.
REFERENCES
1. Dornenburg, J. E., A. M. DeVita, M. J. Palumbo, and J. T. Wade. 2010.
Widespread antisense transcription in Escherichia coli. mBio 1(1):e00024-
10. doi:10.1128/mBio.00024-10.
2. Sharma, C. M., S. Hoffmann, F. Darfeuille, J. Reignier, S. Findeiss, A.
Sittka, S. Chabas, K. Reiche, J. Hackermüller, R. Reinhardt, P. F. Stadler,
and J. Vogel. 2010. The primary transcriptome of the major human patho-
gen Helicobacter pylori. Nature 464:250–255.
3. Rhodius, V. A., W. C. Suh, G. Nonaka, J. West, and C. A. Gross. 2006.
Conserved and variable functions of the sigmaE stress response in related
genomes. PLoS Biol. 4(1):e2. doi:10.1371/journal.pbio.0040002.
4. Slonczewski, J. L. 2010. Concerns about recently identified widespread
antisense transcription in Escherichia coli. mBio 1(2):e00106-10. doi:10
.1128/mBio.00106-10.
Joseph T. Wade
James E. Dornenburg
Anne M. DeVita
Michael J. Palumbo
Wadsworth Center, New York State Department of Health, Albany, New York,
USA
Published 18 May 2010
Citation Wade, J. T., J. E. Dornenburg, A. M. DeVita, and M. J. Palumbo. 2010. Reply to
“Concerns about recently identified widespread antisense transcription in Escherichia
coli.” mBio 1(2):e00119-10. doi:10.1128/mBio.00119-10.
Copyright © 2010 Wade et al. This is an open-access article distributed under the terms
of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported License,
which permits unrestricted noncommercial use, distribution, and reproduction in any
medium, provided the original author and source are credited.
Address correspondence to Joseph T. Wade, jwade@wadsworth.org.
AUTHOR REPLY
May/June 2010 Volume 1 Issue 2 e00119-10
mbio.asm.org 1
    • "The layers of biological PI continue to grow. Anti-sense transcription is occurring157158159160161162163. DNA is being read in both directions. "
    [Show abstract] [Hide abstract] ABSTRACT: Is life physicochemically unique? No. Is life unique? Yes. Life manifests innumerable formalisms that cannot be generated or explained by physicodynamics alone. Life pursues thousands of biofunctional goals, not the least of which is staying alive. Neither physicodynamics, nor evolution, pursue goals. Life is largely directed by linear digital programming and by the Prescriptive Information (PI) instantiated particularly into physicodynamically indeterminate nucleotide sequencing. Epigenomic controls only compound the sophistication of these formalisms. Life employs representationalism through the use of symbol systems. Life manifests autonomy, homeostasis far from equilibrium in the harshest of environments, positive and negative feedback mechanisms, prevention and correction of its own errors, and organization of its components into Sustained Functional Systems (SFS). Chance and necessity—heat agitation and the cause-and-effect determinism of nature’s orderliness—cannot spawn formalisms such as mathematics, language, symbol systems, coding, decoding, logic, organization (not to be confused with mere self-ordering), integration of circuits, computational success, and the pursuit of functionality. All of these characteristics of life are formal, not physical.
    Full-text · Article · Jan 2012
  • [Show abstract] [Hide abstract] ABSTRACT: Several studies have shown that promoters of protein-coding genes are origins of pervasive non-coding RNA transcription and can initiate transcription in both directions. However, only recently have researchers begun to elucidate the functional implications of this bidirectionality and non-coding RNA production. Increasing evidence indicates that non-coding transcription at promoters influences the expression of protein-coding genes, revealing a new layer of transcriptional regulation. This regulation acts at multiple levels, from modifying local chromatin to enabling regional signal spreading and more distal regulation. Moreover, the bidirectional activity of a promoter is regulated at multiple points during transcription, giving rise to diverse types of transcripts.
    Full-text · Article · Jul 2011
  • [Show abstract] [Hide abstract] ABSTRACT: We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread.
    Full-text · Article · Jul 2014