Genetic Dissection of the Amyloid Precursor Protein in Developmental Function and Amyloid Pathogenesis

Article (PDF Available)inJournal of Biological Chemistry 285(40):30598-605 · October 2010with4 Reads
DOI: 10.1074/jbc.M110.137729 · Source: PubMed
Abstract
Proteolytic processing of the amyloid precursor protein (APP) generates large soluble APP derivatives, β-amyloid (Aβ) peptides, and APP intracellular domain. Expression of the extracellular sequences of APP or its Caenorhabditis elegans counterpart has been shown to be sufficient in partially rescuing the CNS phenotypes of the APP-deficient mice and the lethality of the apl-1 null C. elegans, respectively, leaving open the question as what is the role of the highly conserved APP intracellular domain? To address this question, we created an APP knock-in allele in which the mouse Aβ sequence was replaced by the human Aβ. A frameshift mutation was introduced that replaced the last 39 residues of the APP sequence. We demonstrate that the C-terminal mutation does not overtly affect APP processing and amyloid pathology. In contrast, crossing the mutant allele with APP-like protein 2 (APLP2)-null mice results in similar neuromuscular synapse defects and early postnatal lethality as compared with mice doubly deficient in APP and APLP2, demonstrating an indispensable role of the APP C-terminal domain in these development activities. Our results establish an essential function of the conserved APP intracellular domain in developmental regulation, and this activity can be genetically uncoupled from APP processing and Aβ pathogenesis.
Genetic Dissection of the Amyloid Precursor Protein in
Developmental Function and Amyloid Pathogenesis
*
S
Received for publication, April 23, 2010, and in revised form, July 21, 2010 Published, JBC Papers in Press, August 6, 2010, DOI 10.1074/jbc.M110.137729
Hongmei Li
‡§
, Zilai Wang
‡¶
, Baiping Wang
, Qinxi Guo
, Georgia Dolios**, Katsuhiko Tabuchi
§1
,
Robert E. Hammer
‡‡
, Thomas C. Su¨ dhof
§ §§¶¶
, Rong Wang**, and Hui Zheng
‡¶2
From the
Huffington Center on Aging,
Department of Molecular and Human Genetics, and
Translational Biology and Molecular
Medicine Program, Baylor College of Medicine, Houston, Texas 77030, the Departments of
§
Neuroscience and
‡‡
Biochemistry and
§§
Howard Hughes Medical Institute, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75390, the
**Department of Genetics and Genomic Sciences, Mount Sinai School of Medicine, New York, New York 10029, and the
¶¶
Department of Cellular and Molecular Physiology and Howard Hughes Medical Institute, Stanford University,
Palo Alto, California 94304
Proteolytic processing of the amyloid precursor protein
(APP) generates large soluble APP derivatives,
-amyloid (A
)
peptides, and APP intracellular domain. Expression of the
extracellular sequences of APP or its Caenorhabditis elegans
counterpart has been shown to be sufficient in partially rescuing
the CNS phenotypes of the APP-deficient mice and the lethality
of the apl-1 null C. elegans, respectively, leaving open the ques-
tion as what is the role of the highly conserved APP intracellular
domain? To address this question, we created an APP knock-in
allele in which the mouse A
sequence was replaced by the
human A
. A frameshift mutation was introduced that replaced
the last 39 residues of the APP sequence. We demonstrate that
the C-terminal mutation does not overtly affect APP processing
and amyloid pathology. In contrast, crossing the mutant allele
with APP-like protein 2 (APLP2)-null mice results in similar
neuromuscular synapse defects and early postnatal lethality as
compared with mice doubly deficient in APP and APLP2, dem-
onstrating an indispensable role of the APP C-terminal domain
in these development activities. Our results establish an essen-
tial function of the conserved APP intracellular domain in
developmental regulation, and this activity can be genetically
uncoupled from APP processing and A
pathogenesis.
Genetic and biochemical evidence establishes a central role
of APP
3
in Alzheimer disease pathogenesis. Genetic mutations
or gene amplification of APP are linked to a subset of cases of
early onset familial Alzheimer disease (FAD); APP processing
generates
-amyloid (A
) peptides, which are the principal
components of the amyloid plaque pathology (reviewed in Ref.
1). APP represents the founding member of a family of con-
served type I membrane proteins including APL-1 in Caenorh-
abditis elegans, APPL in Drosophila, and APP, APP-like
protein 1 (APLP1), and APLP2 in mammals (reviewed in Ref. 2).
Full-length APP is processed by at least three proteinases
known as
-,
-, and
-secretases. Both
-secretase and
-secretase cleave APP in the extracellular domain with
-
secretase cleavage occurring inside the A
domain and
-secretase at the amino terminus of A
. These proteolytic
events generate large soluble APP derivatives and the mem-
brane-anchored APP carboxyl-terminal fragments, which serve
as substrates for subsequent
-secretase processing, producing
either p3 (product of
- and
-secretases) or A
peptides (prod-
uct of
- and
-secretase) and the APP intracellular domain.
The intracellular sequences are most highly conserved among
the APP family members. Of particular interest, phosphoryla-
tion at the threonine 668 residue (Thr
668
) and adaptor protein
interactions through the YENPTY motif have been shown to
regulate APP localization, trafficking, amyloidogenic process-
ing, and possibly cell signaling (reviewed in Refs. 2 and 3).
Despite the high degree of sequence conservation and the
well characterized biochemical and cellular properties, in vivo
loss-of-function studies in mice and in C. elegans both argue
against an important role of the APP intracellular domain. Spe-
cifically, the apl-1-null C. elegans is lethal, and the lethality can
be rescued by neuronal expression of the APL-1 extracellular
domain (4). Mice deficient in APP are viable but exhibit subtle
phenotypes including reduced body weight, locomotor activity,
and forelimb grip strength and impaired synaptic plasticity,
spatial learning, and memory (5, 6). Expressing only the APP
extracellular domain was shown to be sufficient in rescuing the
anatomical and behavioral abnormalities (7). Nevertheless, a
recent publication documented that acute knockdown of APP
by in utero electroporation of an APP RNAi construct leads to
neuronal migration defect, and the phenotype can only be res-
cued by expressing the full-length APP, but not the APP extra-
cellular or intracellular domains, either individually or com-
bined (8).
Gene knock-out studies reveal genetic redundancies among
the APP proteins as mice doubly deficient in APP/APLP2,
* This work was supported, in whole or in part, by National Institutes of Health
Grants AG020670 and AG032051 (to H. Z.), NS061777 (to R. W.), and
MH52804 (to T. C. S.). This work was also supported by Alzheimer’s Associ-
ation Grant IIRG-05-14824 (to R. W.).
S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental methods and references and Figs. S1 and S2.
This article was selected as a Paper of the Week.
1
Present address: Dept. of Cerebral Research, National Institute for Physio-
logical Sciences, 5-1 Higashiyama, Myodaiji, Okazaki 444-8787, Japan.
2
To whom correspondence should be addressed: Huffington Center on
Aging, Baylor College of Medicine, One Baylor Plaza, MS:BCM 230, Hous-
ton, TX 77030. Tel.: 713-798-1568; Fax: 713-798-1610; E-mail: huiz@
bcm.edu.
3
The abbreviations used are: APP, amyloid precursor protein; A
,
-amyloid;
hA
, humanized A
; FAD, familial Alzheimer disease; NMJ, neuromuscular
junction; CHT, choline transporter; df, degrees of freedom; ki, knock-in;
AchR, acetylcholine receptors; Syn, synaptophysin; P, postnatal day.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 40, pp. 30598 –30605, October 1, 2010
© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
30598 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 NUMBER 40 OCTOBER 1, 2010
APLP1/APLP2, or missing all three APP members are early
postnatal lethal (9, 10). Our analysis of APP/APLP2 double
knock-out mice identified an essential role for the APP family of
proteins in the patterning of neuromuscular junction (NMJ)
(11). Further investigation of neuromuscular synapse and cen-
tral synaptogenesis support the notion that APP is a synaptic
adhesion protein, and that the synaptogenic function requires
full-length APP (12, 13). The early postnatal lethality and the
diffused synaptic distribution of the NMJ present in the APP/
APLP2 double knock-out animals provide sensitive and spe-
cific readouts for us to definitely determine the role of the APP
C-terminal domain in vivo.
By creating a strain of APP knock-in mice in which the APP
intracellular domain was mutated by introducing a frameshift
mutation, we report here that the neuromuscular synapse
structure and animal viability require the highly conserved APP
intracellular domain. In contrast, the C-terminal domain is dis-
pensable for APP processing, secretion, and amyloidogenesis.
EXPERIMENTAL PROCEDURES
AnimalsAPLP2 knock-out mice (9), PS1M146V knock-in
mice (14, 15), and APP/hA
mice, which carry the Swedish and
London mutations and humanized A
sequence (16), were
described as cited. To generate APP/hA
/mutC knock-in mice,
a gene-targeting vector including the Swedish/Arctic/London
FAD mutations, the humanized A
sequence, and a frameshift
mutation at the sequence encoding Ile
656
(APP695 numbering)
was electroporated to R1 ES cells (detailed description can be
found in the supplemental methods and supplemental Fig. S1).
ES clones were screened by Southern blotting, and three clones
were used to inject blastocysts to create chimeric mice. Chi-
meric mice were bred to C57BL/6 to establish germline trans-
mission of the knock-in allele. These knock-in mice were then
mated with transgenic mice expressing the Cre recombinase
under the protamine promoter (17) to remove the neomycin
resistance cassette and to produce the APP/hA
/mutC allele.
Genotyping was done by PCR using the following primer pairs
(5 to 3): GTAATGCCTGTGTGGCCAAACACATG and
AAGTAATGGATTTGTTCTCCCAGGTCG, which amplify
the loxP insertion site. The expected PCR product from the
wild-type allele is 230 bp, and the expected PCR product from
the knock-in allele is 270 bp.
Antibodies and Reagents—22C11 and 6E10 monoclonal anti-
bodies are available from Covance. The polyclonal anti-APP
C-terminal antibody APPc was described previously (12). Anti-
FLAG (rabbit polyclonal), anti-synaptophysin, and anti-choline
transporter (CHT) antibodies were purchased from Sigma,
DAKO, and Chemicon, respectively.
-Bungarotoxin was from
Molecular Probes.
Quantitative Real-time PCR—Total RNA was isolated from
mice brains using the RNeasy lipid tissue mini kit (Invitrogen)
and subjected to DNase I digestion to remove contaminating
genomic DNA. Reverse transcription was performed using a
SuperScript III RNase H-reverse transcriptase (Invitrogen), and
the reaction mix was subjected to quantitative real-time PCR
using an ABI PRISM sequence detection system 7000 (Applied
Biosystems, Inc.). Primers were designed with Primer Express
Version 2.0 software (Applied Biosystems) using sequence data
from the National Center for Biotechnology Information
(NCBI). The sets of GAPDH and hypoxanthine-guanine phos-
phoribosyltransferase primers were used as an internal control
for each specific gene amplification. The relative levels of
expression were quantified and analyzed by using the ABI
PRISM sequence detection system 7000 software. The real-
time value for each sample was averaged and compared using
the comparative threshold cycle method. The relative amount
of target RNA was calculated relative to the expression of
endogenous reference and relative to a calibrator, which was
the mean threshold cycle of control samples.
Neuronal Culture—Postnatal day 0 (P0) pups from APP/
hA
/mutC heterozygous breeding were genotyped using the
REDExtract-N-Amp
TM
tissue PCR kit (Sigma). Homozygous
knock-in pups and their wild-type littermates were selected,
and their hippocampi were dissected. The tissue was tryp-
sinized, mechanically dissociated, washed, resuspended in
Neurobasal medium with B27 supplement (Invitrogen), and
plated on poly-
D-lysine-coated 60-mm dishes. Conditioned
medium and total cell lysates (in PBS with Complete protease
inhibitor cocktail) were collected at 14 days in vitro.
Biotinylation Assay—HEK293 cells were transiently trans-
fected with APP constructs. Cells were washed with ice-cold
PBS containing 1.0 m
M MgCl
2
and 0.1 mM CaCl
2
(PBS/Ca-Mg)
and treated with sulfo-NHS-SS-biotin (1.5 mg/ml; Pierce) for
1 h on ice in PBS/Ca-Mg. Biotinylating reagents were removed
by incubating with cold 100 m
M glycine in PBS/Ca-Mg for 30
min followed by three washes with cold PBS/Ca-Mg. Cells were
incubated at 37 °C to allow internalization to occur, which was
subsequently terminated by transferring culture plates to ice.
Residual cell surface biotin was stripped with freshly prepared
50 m
M mercaptoethanesulfonic acid (Sigma) in TE buffer (150
m
M NaCl, 1 mM EDTA, 0.2% bovine serum albumin, 20 mM
Tris, pH 8.6) for 30 min and quenched with iodoacetamide (5
mg/ml) in PBS/Ca-Mg. Cells were then lysed in 1% CHAPS lysis
buffer containing 50 m
M Tris, pH 7.4, 150 mM NaCl, and pro-
tease inhibitors (Roche Applied Science). Biotinylated proteins
and non-biotinylated proteins were separated by incubation
with an UltraLink-NeutrAvidin bead (Pierce). Samples were
subject to Western blot analysis.
Western Blotting—To prepare total tissue/cell lysate, mouse
brain, spinal cord, or cultured neurons were homogenized
using radioimmune precipitation buffer (1% Nonidet P-40, 50
m
M Tris, pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate,
0.1% SDS, 2 m
M EDTA) containing Complete protease inhibi-
tor cocktail (Roche Applied Science). After three sets of 10
pulses of sonication, the homogenates were spun at 20,000 g
for 15 min. To prepare the PBS-soluble fraction for soluble APP
quantification, brain/spinal cord was homogenized in PBS with
Complete protease inhibitor cocktail, and then tissue lysates
were centrifuged at 100,000 g at 4 °C for 1 h to collect super-
natants. Protein concentrations were determined using the
Bio-Rad protein dye assay. 10
g of protein were loaded on a
10% SDS-PAGE gel run at 100 V for2hatroom temperature
and transferred onto a nitrocellulose membrane (Bio-Rad) at
100 V for 1 h. Membranes were blocked 1 h using 5% nonfat dry
milk in TBS containing 0.1% Tween 20 (TBST, Sigma). After
three washes with TBST, secondary antibody application was
Role of APP Intracellular Domain in Vivo
OCTOBER 1, 2010 VOLUME 285 NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30599
performed at room temperature for 1 h using 5% milk in TBST
followed by three additional washes with TBST. Signals of
Western blots were detected by enhanced chemiluminescence
(GE Healthcare), scanned, and analyzed using ImageJ software
from the National Institutes of Health. Data were represented
as mean S.E. of three samples/group.
Sandwich ELISA—Brain halves were weighted and homoge-
nized in 4 (w/v) homogenization buffer composed of PBS, 1%
Triton X-100, and Complete protease inhibitor cocktail (Roche
Applied Science). Total brain lysates were centrifuged at
20,000 g, and supernatants were diluted two times and then
applied to A
40 ELISA kit (Invitrogen) following the compa-
ny’s protocol. Each sample was analyzed in duplicates. 4 –5 ani-
mals were used for each genotype.
Mass Spectrometry—The measurement of A
peptides using
immunoprecipitation/mass spectrometry (IP/MS) was carried
out essentially as described except that the 6E10 antibody was
used to precipitate A
from PBS extractions due to the disrup-
tion of the 4G8 site upon introducing the Arctic mutation (18,
19). Mass spectra were collected using a TOF/TOF 5800 mass
spectrometer (ABSciex). Each mass spectrum was averaged
from 4000 laser shots and calibrated using bovine insulin as an
internal mass celebrant. Peak areas were used for relative
quantification.
Immunohistochemistry and Amyloid Load Quantification
Antibody staining on paraffin-embedded brain sections was
performed as described (20). In particular, paraformaldehyde-
perfused brains were cut into 10-
m paraffin sections. The sec-
tions were deparaffinized in xylene, rinsed with ethanol, and
rehydrated through ethanol gradient. Antigen-retrieval was
done by incubating sections with 70% formic acid for 6 min.
Endogenous peroxidase activity was quenched by incubating
the slides in 0.3% H
2
O
2
for 30 min. The slides were rinsed with
Tris-buffered saline (TBS; 50 m
M Tris-Cl, pH 7.5 and 250 mM
NaCl). Nonspecific epitopes were blocked for 30 min with 3%
normal goat serum, 0.4% Triton X-100 in TBS. Primary anti-
body 6E10 was diluted 1:1000 in blocking buffer and incubated
overnight at 4 °C in a humid chamber. Sections were then
washed three times for 5 min each in TBS and incubated with
anti-mouse secondary antibody/peroxidase-conjugated strept-
avidin (VECTASTAIN ABC kit; Vector Laboratories) following
the company’s protocol. Pictures were taken with a Zeiss Axios-
kop 2 Plus microscope equipped with the Axiocam MRC digital
camera, and the images were processed with the Axiovision 3.1
software. Images covering the entire cortex were taken. The
number of A
plaques (5
m) was counted manually under
an Olympus microscope (CX 31). Data were reported as the
total number of plaques divided by the total cortical area for
each animal.
Immunofluorescence Staining of Neuromuscular Junction
Whole-mount immunostaining of the diaphragm muscle and
quantification of neuromuscular phenotypes were carried out
as described (11, 12). Confocal images were obtained with a
Zeiss 510 laser scanning microscope, and quantification was
done using the ImageJ program from the National Institutes of
Health.
Statistical Analysis—Genotyping analysis of the offspring
from APP
ki/
APLP2
/
male and female intercrosses was per
-
formed using chi-square analysis. A
levels and plaque load
were analyzed by analysis of variance. Student’s t test was used
for all other analysis. *, p 0.05, **, p 0.01, ***, p 0.001. Data
were presented as average S.E. (standard error of the mean).
RESULTS
Generation and Expression Analysis of APP/hA
/mutC
Knock-in Animals—To investigate the role of the highly con-
served APP C-terminal domain in survival, neuromuscular syn-
apse development, and amyloid pathology in vivo, we created a
knock-in allele in which the mouse A
was replaced by the
human A
sequence with simultaneous introduction of the
Swedish/London/Arctic FAD mutations. In addition, the two
cytosines in ATC CAT encoding residues Ile
656
–His
657
of APP
(695 isoform numbering) were deleted, resulting in a frameshift
starting at His
657
and deletion of the last 39 amino acids of the
APP C-terminal sequences including the highly conserved
Thr
668
residue and the YENPTY sequence (Fig. 1
A and sup-
plemental Fig. S1). A 10-amino acid out-of-frame spacer
sequence was simultaneously introduced downstream of His
657
to ensure proper membrane anchoring and
-secretase pro-
cessing of the C-terminal deleted APP. This knock-in allele is
herein termed as APP/hA
/mutC or ki.
Homozygous APP/hA
/mutC (ki/ki) mice are viable, fertile,
and exhibit a normal body weight as compared with their wild-
type littermates (not shown). To evaluate the effect of the C-ter-
minal mutation on APP expression, processing, and secretion,
we first compared the mRNA levels of APP in brains of 2-
month-old ki/ki mice and their wild-type littermates by quan-
titative real-time PCR using the APP knock-out mouse brains as
a negative control and found no statistically significant differ-
ences between the two genotypes (Fig. 1B). Western blot anal-
ysis of total brain lysates using the 22C11 antibody (which rec-
ognizes an extracellular epitope) revealed two major bands with
the upper band presumably full-length APP and the lower band
soluble extracellular processed APP derivatives. Quantification
of the total APP showed a slight reduction (20%) in the ki/ki
samples (Fig. 1C, 22C11, quantified in Fig. 1G). Because both
the lower band of total APP (Fig. 1C) and the production of
PBS-extractable soluble APP ectodomains (Fig. 1D) were simi-
lar between the ki/ki and wild-type brains, the lower levels of
total APP in the ki/ki samples must be due to the preferential
reduction of full-length APP/hA
/mutC protein. Similar
results were obtained when spinal cord tissue was analyzed (Fig.
1, E and F). The absence of the APP intracellular domain and
the introduction of human A
sequence in the APP/hA
/mutC
protein were confirmed by Western blotting using the C-termi-
nal specific APPc antibody and human A
-specific 6E10 anti-
body, respectively (Fig. 1C, APPc and 6E10). This corresponds
to the absence of APP/Fe65 interaction using the bimolecular
fluorescence complementation assay (supplemental Fig. S2)
(21) The reduced full-length APP/hA
/mutC but normal solu-
ble secreted APP is consistent with the observation that dele-
tion of the APP intracellular domain leads to its reduced inter-
nalization and elevated secretion (Fig. 2D) (22).
We next investigated APP processing and secretion using
primary neuronal cultures prepared from newborn littermate
ki/ki pups and their wild-type controls. At 14 days in vitro,
Role of APP Intracellular Domain in Vivo
30600 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 NUMBER 40 OCTOBER 1, 2010
conditioned medium and total cell lysates were collected and ana-
lyzed by Western blotting (Fig. 2A). Similar to that of the adult
mouse brain and spinal cord, there was a significant reduction of
APP in total cell lysates between the ki/ki and wild-type cultures as
blotted by the N-terminal antibody 22C11, but the secretion of
APPs into the conditioned medium was comparable (quantifica-
tion in Fig. 2, B and C). Transfection of full-length or APP/hA
/
mutC constructs followed by examination of internalization of
surface APP by biotinylation assay showed that, consistent with
the published report (22), APP/hA
/mutC exhibited reduced
internalization, thus leading to elevated secretion (Fig. 2D). Over-
all, the results suggest that the highly conserved APP C-terminal
domain is dispensable in APP extracellular processing and soluble
APP production and secretion.
Analysis of A
Production and Amyloid Pathology in APP/
hA
/mutC Knock-in Animals—Having established that the
APP C-terminal domain is dispensable for APP secretion, we
next asked whether it is required for A
production and devel-
opment of
-amyloid pathology. We used a sandwich ELISA to
measure A
40 levels in 3-month-old APP/hA
/mutC animals
in comparison with another strain
of full-length APP knock-in mice
with humanized A
and Swedish
and London FAD mutations (APP/
hA
) at the same age (16). This
young age was chosen to avoid the
confounding effects due to amyloid
deposition. The results showed
similar A
40 levels and dose-
dependent increases in both strains,
suggesting that the C-terminal
replacement does not have signifi-
cant impact on
-secretase process-
ing and A
production (Fig. 3A).
Because studies of the APP/hA
knock-in animals have shown that
these mice develop minimal amy-
loid plaque pathology in their life-
time (16), to facilitate the develop-
ment of amyloid pathology, we
crossed the APP/hA
/mutC and
APP/hA
animals with the PS1
knock-in mice carrying the M146V
FAD mutation and created animals
that are doubly homozygous for
APP/hA
/mutC or APP/hA
and
PS1M146V. The addition of the
PS1M146V mutation resulted in a
similar increase of A
levels in both
APP knock-in alleles (Fig. 3A),
suggesting that the C-terminal
sequence does not affect the modi-
fication of
-secretase processing by
the PS1 FAD mutation.
Due to the physiological expres-
sion of the APP alleles in the knock-
in animals, the A
42 level is below
the detection limit of the ELISA kit.
We therefore resorted to a more sensitive immunoprecipita-
tion/mass spectrometry method to measure the levels of A
42
and normalized the values to A
40 (Fig. 3B). Comparing the
A
42/A
40 ratios from 3 month-old APP/hA
/mutC and
APP/hA
knock-in mice, with or without the PS1M146V FAD
mutation, we did not find any significant differences between
the two knock-in lines, again suggesting that C-terminal region
does not play a critical role in regulating the pathological pro-
cessing of APP.
Immunostaining of 13-month-old APP/hA
/mutC and
PS1M146V double knock-in mice with the 6E10 antibody
revealed abundant A
plaque deposits in cortex and hippocam-
pus. The degree of A
pathology was dependent on the
PS1M146V dosage (Fig. 3C and quantified in Fig. 3D). Consis-
tent with the fact that the Arctic variants of A
are more robust
in developing parenchymal amyloidosis (23, 24), the amyloid
loads of APP/hA
/mutC and PS1M146V double knock-in ani-
mals are much higher than the corresponding APP/hA
and
PS1M146V double knock-in animals without the Arctic muta-
tion (Fig. 3, C and D).
FIGURE 1. Generation and biochemical characterization of APP/hA
/mutC ki mice. A, schematic representa-
tion of wild-type (WT) and APP/hA
/mutC (ki) alleles. TM stands for transmembrane region (also marked by gray
shading), and mA
and hA
represent mouse and human A
sequences, respectively. Amino acid sequences from
the A
region to the end of the C terminus of both the wild-type allele and the ki allele are listed. Residues corre-
sponding to Swedish (K595N and M596L), Arctic (E618G), and London (V642I) mutation sites are shown in bold and
underlined letters. Residues different between mouse and human A
are shown in bold letters. Frameshift mutations
of the ki allele, which starts at the coding sequence for residue Ile
656
and results in stop codon after 10 amino acids,
are indicated by italic letters.B,quantitativereal-time PCR of APP mRNA from 2-month-old wild-type (/),homozy-
gous APP/hA
/mutC knock-in (ki/ki), and APP knock-out (/) mouse brains. APP
/
was used as a negative
control. C–F, representative Western blot analysis of 2-month-old ki/ki mice and their wild-type (/) littermates of
APP expression in total brain lysate, PBS-soluble fraction of the brain lysate, total spinal cord lysate, and PBS-soluble
fraction of spinal cord lysate, respectively, using the 22C11, 6E10, and APPc antibodies.
-Tubulin blot was used as
protein loading control. G, quantification of the relative ratio of 22C11/
-tubulin blots. Both the upper and the
lower bands were included in the brain and spinal cord total lysate quantification. **, p 0.01; N.S., non-
significant (p 0.05) (Student’s t test).
Role of APP Intracellular Domain in Vivo
OCTOBER 1, 2010 VOLUME 285 NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30601
Analysis of Survival and Neuromuscular Synapse Develop-
ment in APP/hA
/mutC Knock-in Animals—Our previous
studies established that APP and APLP2 play essential yet
redundant roles in animal viability and neuromuscular synapse
assembly (11). To determine whether these developmental
activities require the APP C-terminal domain, we performed
intercrosses of mice with one copy of each of the APP/hA
/
mutC and APLP2-null mutation (APP
ki/
APLP2
/
). We
determined the genotypes of the surviving offspring at postna-
tal day 1 (P1) and at weaning age (P21) and compared the num-
ber observed against the number expected (Fig. 4). The 54 new-
born mice from the intercrossing analyzed showed a close to
Mendelian ratio for all genotypes (Fig. 4A). However, few of
the APP
ki/ki
APLP2
/
and APP
ki/
APLP2
/
mice survived
to adulthood (Fig. 4B). Of the 113 offspring genotyped at
weaning age, only 25% of the expected APP
ki/ki
APLP2
/
and APP
ki/
APLP2
/
mice were recovered (Fig. 4B), which
was significantly different from the predicted Mendelian ratio
(chi-square 33.8; degrees of freedom (df), 8; p 0.001). These
results demonstrate that, in contrast to the reported dispensa-
ble role of the APP intracellular domain in APP-mediated
growth, anatomical, and synaptic properties (7), the highly con-
served APP C-terminal sequences are essential in postnatal
viability.
Our studies of APP-mediated NMJ development suggest that
this activity correlates with a change in the presynaptic local-
ization of the high affinity CHT and that these two proteins may
physically interact via their intracellular sequences (12). The
creation of the APP/hA
/mutC mice allows testing of the role
of the APP cytoplasmic tail in NMJ development. Indeed, sim-
ilar to the APP-null mutant, immunostaining of CHT in the
NMJ of APP/hA
/mutC mice revealed clear mislocalization of
CHT (Fig. 5, A and B). Moreover, whole-mount staining of dia-
phragm of newborn APP
ki/
APLP2
/
or APP
ki/ki
APLP2
/
pups with anti-synaptophysin antibody and
-bungarotoxin
showed diffused presynaptic and postsynaptic distribution (Fig.
5, C and D) and reduced pre- and postsynaptic apposition (Fig.
5, E and F) indistinguishable from the APP/APLP2 double defi-
cient mice. The combined results demonstrate an indispensa-
ble role of the highly conserved APP intracellular sequences in
survival and proper CHT targeting and neuromuscular synapse
development.
DISCUSSION
Genetic studies in C. elegans and mammals have established
essential functions of APP proteins in development (4, 9, 26).
Interestingly, expression of the APL-1 extracellular domain has
been shown to be sufficient in rescuing the apl-1-null lethality
(4). Likewise, expressing the soluble,
-secretase-cleaved APP
ectodomain complements the anatomical and behavioral
abnormalities of the APP-deficient mice (7). Both results argue
for a dispensable role of the APP intracellular domain. How-
ever, our previous in vivo and HEK293/hippocampal mixed cul-
ture studies support an important activity of the APP C-termi-
nal domain in modulating neuromuscular synapse and central
synaptogenesis (12, 13). By creating mice with mutated APP
intracellular sequences, we demonstrate here for the first time
that the highly conserved APP intracellular sequences are
required for APP-mediated survival and neuromuscular syn-
apse assembly in vivo. It needs to be pointed out that to simul-
taneously determine the role of the APP intracellular domain in
developmental function and A
pathogenesis, we introduced
both the human A
sequence with FAD mutations and the
C-terminal mutation in APP/hA
/mutC knock-in animals.
Therefore, it is conceivable that changes in the A
region con-
tribute to the lethality and NMJ defects. We believe that it is
highly unlikely because analysis of another APP knock-in strain
in which the first Tyr residue of the YENPTY sequence was
mutated, whereas the A
region was not altered, revealed sim-
ilar developmental defects.
4
Although the reason for the distinct domain requirement for
C. elegans and mouse viability is not known, it is worth noting
that the lethality of the apl-1-null worm is likely caused by a
molting defect not relevant to mammals. Indeed, expression of
the corresponding APP extracellular domain is not able to res-
cue the apl-1 deficiency (4). Phenotypes present in APP-null
mice are rather diverse, and the underlying mechanisms are not
established. As such, it is difficult to explain the apparent dif-
ferential pathways mediating the APP activity in synaptic plas-
ticity and synaptogenesis. The fact that APP exists both as a
full-length protein and in multiple processed forms and that the
cleavage products can be differentially sorted and indepen-
dently transported makes it plausible that these APP isoforms
4
Z. Wang, H. Zheng, A. Barbagallo, and L. D’Adamio, unpublished data.
FIGURE 2. Measurement of APP secretion from APP/hA
/mutC knock-in
neurons. A, Western blot analysis of APP expressed in total cell lysate (TCL)
and conditioned medium (CM) of hippocampal neuronal cultures of wild-
type (/) and homozygous ki/ki pups. Antibodies 22C11 and APPc recog-
nize the APP N-terminal region and APP C-terminal region, respectively.
-Tu-
bulin blot was used as protein loading control. B and C are quantifications of
22C11 blots of APP to tubulin ratio in total cell lysate and conditioned
medium, respectively. *, p 0.05; N.S., non-significant (p 0.05) (t test.).
D, representative biotinylation assay showing a slower rate of APP internal-
ization in the absence of the intracellular domain. HEK293 cells expressing
full-length APP (FL) or APP/hA
/mutC (MutC) constructs were cell surface
biotinylated and incubated at 37 °C for 5 min to allow endocytosis of biotin-
ylated APP. After stripping the remaining biotin from the cell surface (0 min),
internalized biotinylated APP was isolated and detected by immunoblot
using the 22C11 antibody (5 min). 10% of the lysate was reserved as a repre-
sentative of the total protein expressed (Total) prior to the isolation of biotin-
ylated surface proteins (Surface).
Role of APP Intracellular Domain in Vivo
30602 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 NUMBER 40 OCTOBER 1, 2010
confer distinct APP activities (27). Nevertheless, our previous
mixed culture studies (13), combined with the current NMJ
investigation, make a strong argument that full-length APP
may play an important role not only in neuromuscular synapse
development but also a central synaptogenesis and synaptic
function as well.
We reported that APP is targeted to the synaptic sites of the
NMJ, where it may modulate CHT activity through physical
FIGURE 3. Analysis of A
levels and plaque pathology in APP/hA
/mutC
mice. A, sandwich ELISA measurement of A
40 levels in the brains of APP/
hA
/mutC and APP/hA
knock-in mice at 3 months of age. APP/hA
/mutC
and APP/hA
mice are represented by black and gray bars, respectively. PS1 is
wild type unless otherwise indicated, and blank represents buffer blank con-
trol of ELISA plate. The ELISA kit does not recognize mouse A
sequence in
wild-type animals and was used as an additional negative control. The APP
transgenic mice Tg2576 were used as positive control. n 5/genotype. The
A
40 peptide standard curve is shown in the inset. B,A
42/A
40 ratio deter-
mined by IP/MS in brains of 3-month-old APP/hA
/mutC (black bars)or
APP/hA
(gray bars) knock-in mice with or without the PS1M146V mutation.
n 3 for each genotype. Typical mass spectrum traces for A
40 and A
42 are
shown in the inset. C, representative plaque images in the hippocampus area
of 13-month-old APP/hA
/mutC ki/ki; PS1M146V/, APP/hA
/mutC ki/ki;
PS1M146V/M146V, and APP/hA
ki/ki; and PS1M146V/M146V mice. Scale bar,
100
m. D, quantification of plaque load in the cortex and hippocampus of
the above animals. ***, p 0.001; N.S., non-significant (analysis of variance).
FIGURE 4. Postnatal lethality of APP/hA
/mutC knock-in mice on APLP2-
null background. A, analysis of genotypes of 53 offspring collected at P1
derived from mating of APP
ki/
/APLP2
/
males and females. Gray bars rep
-
resent observed frequency of various genotypes as the percentage of total,
and open bars are expected frequency based on Mendelian inheritance. Chi-
square 4.9; df,8;p 0.1. B, analysis of genotypes of 114 offspring collected
at P21 derived from the same breeding as in A. Genotypes with impaired
survival are highlighted in bold. Chi-square 33.8; df,8;p 0.001.
Role of APP Intracellular Domain in Vivo
OCTOBER 1, 2010 VOLUME 285 NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30603
interaction mediated by the APP intracellular domain (12, 13).
Our finding that expression of APP with mutated C-terminal
sequences leads to aberrant CHT localization and impaired
NMJ patterning strengthens this notion. However, APP is
known to undergo kinesin-dependent trafficking via the C-ter-
minal sequences (28). Although a recent report documented
that the fast anterograde transport of APP does not require the
intracellular domain or any sorting
signal (29), we cannot exclude the
possibility that the neuromuscular
synapse defect seen in APP/hA
/
mutC mice is primarily caused by
defective APP trafficking. Further-
more, APP intracellular sequences
mediate additional activities, in-
cluding interactions with multiple
proteins (reviewed in Ref. 3) and
transcriptional regulation via bind-
ing to Fe65 (30, 31), so it is therefore
conceivable that defective adaptor
protein interactions and intracellu-
lar signaling pathway may contrib-
ute to the developmental pheno-
types seen in the APP/hA
/mutC
mice.
In contrast to its critical role in
survival and neuromuscular syn-
apse organization during develop-
ment, we show here that the highly
conserved APP intracellular do-
main does not overtly affect APP
expression, processing, or secretion
in adult brain or in primary neuro-
nal cultures. The A
40 levels,
A
42/A
40 ratio, and modulation
by the PS1M146V FAD mutation
are all comparable with a similar
APP knock-in strain expressing the
full-length protein. Although subtle
effects of the Arctic mutation on
APP localization or
-secretase
cleavage as reported by Sahlin et al.
(25) cannot be formally excluded,
our results are consistent with the
published reports that introduction
of the Arctic mutation leads to a
more aggressive amyloid pathology,
likely due to enhanced A
fibriliza-
tion (23, 24). In light of the exten-
sively published reports addressing
the various effects of the Thr
668
res
-
idue and the YENPTY sequence on
APP localization, trafficking, and
processing (reviewed in Refs. 2
and 3), the relatively normal APP
and A
metabolism in the APP/
hA
/mutC mice is therefore unex-
pected. Differences in the model
systems (in vivo versus in vitro), expression levels (physiological
versus overexpression), cell types (neurons versus non-neuro-
nal cells), and the nature of the systems (chronic versus acute)
could all contribute to the contrasting findings between our
work and the published studies.
Because of the central role of APP in Alzheimer disease, it is
essential to understand the mechanisms mediating its physio-
FIGURE 5. Neuromuscular synapse defects in APP/hA
/mutC mice. A, double labeling of P0 diaphragm
muscles of wild-type (/) and APP/hA
/mutC ki/ki littermates with the anti-CHT antibody and
-bungaro-
toxin that recognizes the postsynaptic acetylcholine receptors (AchR). Merge, overlay of CHT and AchR images.
The open arrow marks the CHT staining beyond the end plates, and the arrowheads label the synaptic sites with
sparse CHT staining. B, quantification of the percentage of AchR-positive endplates covered by CHT immuno-
reactivity (average S.E. of 20 endplates per genotype). C, whole-mount staining of P0 diaphragm muscles of
APP
ki/ki
APLP2
/
mutants (ki/ki) and littermate APP
/
APLP2
/
controls (ctrl) with an anti-synaptophysin
(Syn) antibody and
-bungarotoxin (AchR), showing diffused pre- and postsynaptic distribution in the ki/ki
mutant. Merge, overlay of Syn and AchR images. D, quantification of the average bandwidth of AchR-positive
endplates. E, higher magnification images of synapse structures showing axonal staining of Syn and poorly
covered endplates by Syn and extrasynaptic Syn staining in the ki/ki mutant. Merge, overlay of Syn and AchR
images. F, quantification of the percentage of AchR-positive endplates covered by Syn (average S.E. of 20
endplates/genotype). ***, p 0.001; *, p 0.05 (Student’s t test). Scale bars in A and E,20
m; scale bar in
C, 100
m.
Role of APP Intracellular Domain in Vivo
30604 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 NUMBER 40 OCTOBER 1, 2010
logical function and pathogenesis. By creating a novel APP
knock-in allele that allows us to examine the in vivo function of
the highly conserved APP intracellular domain in developmen-
tal regulation and A
pathology, we report here that the two
pathways can be genetically uncoupled. Because the APP intra-
cellular domain is critical for its physiological function but dis-
pensable for A
production, targeting this region may thus lead
to undesirable physiological impairment rather than antici-
pated A
modulation.
Acknowledgments—We thank N. Aithmitti and X. Chen for expert
technical assistance and members of the Zheng laboratory for stimu-
lating discussions. We are grateful to the Baylor College of Medicine
Eunice Kennedy Shriver Intellectual and Developmental Disabilities
Research Center (HD024064) for support in confocal imaging.
REFERENCES
1. Hardy, J. (2006) Neuron 52, 3–13
2. Zheng, H., and Koo, E. H. (2006) Mol. Neurodegener. 1, 5
3. King, G. D., and Scott Turner, R. (2004) Exp. Neurol. 185, 208 –219
4. Hornsten, A., Lieberthal, J., Fadia, S., Malins, R., Ha, L., Xu, X., Daigle, I.,
Markowitz, M., O’Connor, G., Plasterk, R., and Li, C. (2007) Proc. Natl.
Acad. Sci. U.S.A. 104, 1971–1976
5. Zheng, H., Jiang, M., Trumbauer, M. E., Sirinathsinghji, D. J., Hopkins, R.,
Smith, D. W., Heavens, R. P., Dawson, G. R., Boyce, S., Conner, M. W.,
Stevens, K. A., Slunt, H. H., Sisoda, S. S., Chen, H. Y., and Van der Ploeg,
L. H. (1995) Cell 81, 525–531
6. Dawson, G. R., Seabrook, G. R., Zheng, H., Smith, D. W., Graham, S.,
O’Dowd, G., Bowery, B. J., Boyce, S., Trumbauer, M. E., Chen, H. Y., Van
der Ploeg, L. H., and Sirinathsinghji, D. J. (1999) Neuroscience 90, 1–13
7. Ring, S., Weyer, S. W., Kilian, S. B., Waldron, E., Pietrzik, C. U., Filippov,
M. A., Herms, J., Buchholz, C., Eckman, C. B., Korte, M., Wolfer, D. P., and
Mu¨ller, U. C. (2007) J. Neurosci. 27, 7817–7826
8. Young-Pearse, T. L., Bai, J., Chang, R., Zheng, J. B., LoTurco, J. J., and
Selkoe, D. J. (2007) J. Neurosci. 27, 14459–14469
9. von Koch, C. S., Zheng, H., Chen, H., Trumbauer, M., Thinakaran, G., van
der Ploeg, L. H., Price, D. L., and Sisodia, S. S. (1997) Neurobiol. Aging 18,
661–669
10. Heber, S., Herms, J., Gajic, V., Hainfellner, J., Aguzzi, A., Ru¨licke, T., von
Kretzschmar, H., von Koch, C., Sisodia, S., Tremml, P., Lipp, H. P., Wolfer,
D. P., and Mu¨ller, U. (2000) J. Neurosci. 20, 7951–7963
11. Wang, P., Yang, G., Mosier, D. R., Chang, P., Zaidi, T., Gong, Y. D., Zhao,
N. M., Dominguez, B., Lee, K. F., Gan, W. B., and Zheng, H. (2005) J. Neu-
rosci. 25, 1219 –1225
12. Wang, B., Yang, L., Wang, Z., and Zheng, H. (2007) Proc. Natl. Acad. Sci.
U.S.A. 104, 14140 –14145
13. Wang, Z., Wang, B., Yang, L., Guo, Q., Aithmitti, N., Songyang, Z., and
Zheng, H. (2009) J. Neurosci. 29, 10788 –10801
14. Guo, Q., Fu, W., Sopher, B. L., Miller, M. W., Ware, C. B., Martin, G. M.,
and Mattson, M. P. (1999) Nat. Med. 5, 101–106
15. Wang, R., Wang, B., He, W., and Zheng, H. (2006) J. Biol. Chem. 281,
15330–15336
16. Ko¨hler, C., Ebert, U., Baumann, K., and Schro¨der, H. (2005) Neurobiol Dis.
20, 528 –540
17. O’Gorman, S., Dagenais, N. A., Qian, M., and Marchuk, Y. (1997) Proc.
Natl. Acad. Sci. U.S.A. 94, 14602–14607
18. Uljon, S. N., Mazzarelli, L., Chait, B. T., and Wang, R. (2000) Methods Mol.
Biol. 146, 439 452
19. Lehman, E. J., Kulnane, L. S., Gao, Y., Petriello, M. C., Pimpis, K. M.,
Younkin, L., Dolios, G., Wang, R., Younkin, S. G., and Lamb, B. T. (2003)
Hum. Mol. Genet. 12, 2949 –2956
20. Dineley, K. T., Xia, X., Bui, D., Sweatt, J. D., and Zheng, H. (2002) J. Biol.
Chem. 277, 22768 –22780
21. Kerppola, T. K. (2006) Nat. Rev. Mol. Cell Biol. 7, 449 456
22. Koo, E. H., Squazzo, S. L., Selkoe, D. J., and Koo, C. H. (1996) J. Cell Sci.
109, 991–998
23. Nilsberth, C., Westlind-Danielsson, A., Eckman, C. B., Condron, M. M.,
Axelman, K., Forsell, C., Stenh, C., Luthman, J., Teplow, D. B., Younkin,
S. G., Na¨ slund, J., and Lannfelt, L. (2001) Nat. Neurosci. 4, 887–893
24. Cheng, I. H., Palop, J. J., Esposito, L. A., Bien-Ly, N., Yan, F., and Mucke, L.
(2004) Nat. Med. 10, 1190 –1192
25. Sahlin, C., Lord, A., Magnusson, K., Englund, H., Almeida, C. G., Green-
gard, P., Nyberg, F., Gouras, G. K., Lannfelt, L., and Nilsson, L. N. (2007)
J. Neurochem. 101, 854 862
26. Herms, J., Anliker, B., Heber, S., Ring, S., Fuhrmann, M., Kretzschmar, H.,
Sisodia, S., and Mu¨ller, U. (2004) EMBO J. 23, 4106 4115
27. Muresan, V., Varvel, N. H., Lamb, B. T., and Muresan, Z. (2009) J. Neuro-
sci. 29, 3565–3578
28. Koo, E. H., Sisodia, S. S., Archer, D. R., Martin, L. J., Weidemann, A.,
Beyreuther, K., Fischer, P., Masters, C. L., and Price, D. L. (1990) Proc.
Natl. Acad. Sci. U.S.A. 87, 1561–1565
29. Back, S., Haas, P., Tscha¨pe, J. A., Gruebl, T., Kirsch, J., Mu¨ller, U.,
Beyreuther, K., and Kins, S. (2007) J. Neurosci. Res. 85, 2580 –2590
30. Cao, X., and Su¨dhof, T. C. (2001) Science 293, 115–120
31. Cao, X., and Su¨dhof, T. C. (2004) J. Biol. Chem. 279, 24601–24611
Role of APP Intracellular Domain in Vivo
OCTOBER 1, 2010 VOLUME 285 NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 30605
    • "PS1 M146V knock-in mice [23,24] and APP knock-in mice carrying Swedish and London mutations and humanized Aβ region (APP SL) were previously published. APP DSL knock-in mice with Dutch/Swedish/London mutations and humanized Aβ region was generated in the similar manner as previously published APP/hAβ/mutC [25], except that the Dutch mutation (E618Q, APP695 numbering) was incorporated by site-directed mutagenesis when constructing the gene-targeting vector. Briefly, exons 16 and 17 of mouse APP were replaced by the mutant construct from the knock-in vector by homologous recombination, in which a pair of loxP sites flanked truncated exon 16 and neocassette , followed by mutant exon 16 with Swedish mutation (KM595-596NL) and humanized Aβ sequence (G601R, F606Y, and R609H), and then mutant exon 17 carrying Dutch mutation (E618Q) and London mutation (V642I) (Figure 1A). "
    [Show abstract] [Hide abstract] ABSTRACT: Accumulation and deposition of β-amyloid peptides (Aβ) in the brain is a central event in the pathogenesis of Alzheimer’s disease (AD). Besides the parenchymal pathology, Aβ is known to undergo active transport across the blood–brain barrier and cerebral amyloid angiopathy (CAA) is a prominent feature in the majority of AD. Although impaired cerebral blood flow (CBF) has been implicated in faulty Aβ transport and clearance, and cerebral hypoperfusion can exist in the pre-clinical phase of Alzheimer’s disease (AD), it is still unclear whether it is one of the causal factors for AD pathogenesis, or an early consequence of a multi-factor condition that would lead to AD at late stage. To study the potential interaction between faulty CBF and amyloid accumulation in clinical-relevant situation, we generated a new amyloid precursor protein (APP) knock-in allele that expresses humanized Aβ and a Dutch mutation in addition to Swedish/London mutations and compared this line with an equivalent knock-in line but in the absence of the Dutch mutation, both crossed onto the PS1M146V knock-in background. Introduction of the Dutch mutation results in robust CAA and parenchymal Aβ pathology, age-dependent reduction of spatial learning and memory deficits, and CBF reduction as detected by fMRI. Direct manipulation of CBF by transverse aortic constriction surgery on the left common carotid artery caused differential changes in CBF in the anterior and middle region of the cortex, where it is reduced on the left side and increased on the right side. However these perturbations in CBF resulted in the same effect: both significantly exacerbate CAA and amyloid pathology. Our study reveals a direct and positive link between vascular and parenchymal Aβ; both can be modulated by CBF. The new APP knock-in mouse model recapitulates many symptoms of AD including progressive vascular and parenchymal Aβ pathology and behavioral deficits in the absence of APP overexpression.
    Full-text · Article · Aug 2014
    Hongmei LiHongmei LiQinxi GuoQinxi GuoTaeko InoueTaeko Inoue+1more author...[...]
    • "Our lab previously validated the presence of human Aβ in the APP knock-in mice [16], but the level is not sufficient to induce detectable plaque pathology within their lifespan (data not shown). We first examined the γ-secretase activity in WT, APP, PS1, APP/PS1, and APP/PS1/htau brain samples at 3 to 4 months of age. "
    [Show abstract] [Hide abstract] ABSTRACT: Alzheimer's disease (AD), the most common cause of dementia in the elderly, has two pathological hallmarks: Aβ plaques and aggregation of hyperphosphorylated tau (p-tau). Aβ is a cleavage product of Amyloid Precursor Protein (APP). Presenilin 1 (PS1) and presenilin 2 (PS2) are the catalytic subunit of γ-secretase, which cleaves APP and mediates Aβ production. Genetic mutations in APP, PSEN1 or PSEN2 can lead to early onset of familial AD (FAD). Although mutations in the tau encoding gene MAPT leads to a subtype of frontotemporal dementia and these mutations have been used to model AD tauopathy, no MAPT mutations have been found to be associated with AD. To model AD pathophysiology in mice without the gross overexpression of mutant transgenes, we created a humanized AD mouse model by crossing the APP and PSEN1 FAD knock-in mice with the htau mice which express wildtype human MAPT genomic DNA on mouse MAPT null background (APP/PS1/htau). The APP/PS1/htau mice displayed mild, age-dependent, Aβ plaques and tau hyperphosphorylation, thus successfully recapitulating the late-onset AD pathological hallmarks. Selected biochemical analyses, including p-tau western blot, γ-secretase activity assay, and Aβ ELISA, were performed to study the interaction between Aβ and p-tau. Subsequent behavioral studies revealed that the APP/PS1/htau mice showed reduced mobility in old ages and exaggerated fear response. Genetic analysis suggested that the fear phenotype is due to a synergic interaction between Aβ and p-tau, and it can be completely abolished by tau deletion. The APP/PS1/htau model represents a valuable and disease-relevant late-onset pre-clinical AD animal model because it incorporates human AD genetics without mutant protein overexpression. Analysis of the mice revealed both cooperative and independent effects of Aβ and p-tau.
    Full-text · Article · Nov 2013
    • "Its persistence is likely due to the overlap with the E3 domain. It has been shown that the E3 domain is essential for life in mammals and the βA4 domain contains an HD motif with evidence of positive selection, both of which may explain some of the persistence of amyloidogenic Aβ in the mammalian genome [30,35]. Our analysis also found evidence of aggregation prone C-terminal regions in nearly all sequences in the dataset, which is not surprising as this is part of the transmembrane region high in hydrophobic residues, but a stable β-fold requires two regions within the peptide. "
    [Show abstract] [Hide abstract] ABSTRACT: Background Amyloid-β plaques are a defining characteristic of Alzheimer Disease. However, Amyloid-β deposition is also found in other forms of dementia and in non-pathological contexts. Amyloid-β deposition is variable among vertebrate species and the evolutionary emergence of the amyloidogenic property is currently unknown. Evolutionary persistence of a pathological peptide sequence may depend on the functions of the precursor gene, conservation or mutation of nucleotides or peptide domains within the precursor gene, or a species-specific physiological environment. Results In this study, we asked when amyloidogenic Amyloid-β first arose using phylogenetic trees constructed for the Amyloid-β Precursor Protein gene family and by modeling the potential for Amyloid-β aggregation across species in silico. We collected the most comprehensive set of sequences for the Amyloid-β Precursor Protein family using an automated, iterative meta-database search and constructed a highly resolved phylogeny. The analysis revealed that the ancestral gene for invertebrate and vertebrate Amyloid-β Precursor Protein gene families arose around metazoic speciation during the Ediacaran period. Synapomorphic frequencies found domain-specific conservation of sequence. Analyses of aggregation potential showed that potentially amyloidogenic sequences are a ubiquitous feature of vertebrate Amyloid-β Precursor Protein but are also found in echinoderm, nematode, and cephalochordate, and hymenoptera species homologues. Conclusions The Amyloid-β Precursor Protein gene is ancient and highly conserved. The amyloid forming Amyloid-β domains may have been present in early deuterostomes, but more recent mutations appear to have resulted in potentially unrelated amyoid forming sequences. Our results further highlight that the species-specific physiological environment is as critical to Amyloid-β formation as the peptide sequence.
    Full-text · Article · Apr 2013
Show more

    Recommended publications

    Discover more