TLX1 and NOTCH coregulate transcription in T cell acute lymphoblastic leukemia cells

ArticleinMolecular Cancer 9(1):181 · July 2010with26 Reads
Impact Factor: 4.26 · DOI: 10.1186/1476-4598-9-181 · Source: PubMed
Abstract

The homeobox gene TLX1 (for T-cell leukemia homeobox 1, previously known as HOX11) is inappropriately expressed in a major subgroup of T cell acute lymphoblastic leukemia (T-ALL) where it is strongly associated with activating NOTCH1 mutations. Despite the recognition that these genetic lesions cooperate in leukemogenesis, there have been no mechanistic studies addressing how TLX1 and NOTCH1 functionally interact to promote the leukemic phenotype. Global gene expression profiling after downregulation of TLX1 and inhibition of the NOTCH pathway in ALL-SIL cells revealed that TLX1 synergistically regulated more than 60% of the NOTCH-responsive genes. Structure-function analysis demonstrated that TLX1 binding to Groucho-related TLE corepressors was necessary for maximal transcriptional regulation of the NOTCH-responsive genes tested, implicating TLX1 modulation of the NOTCH-TLE regulatory network. Comparison of the dataset to publicly available biological databases indicated that the TLX1/NOTCH-coregulated genes are frequently targeted by MYC. Gain- and loss-of-function experiments confirmed that MYC was an essential mediator of TLX1/NOTCH transcriptional output and growth promotion in ALL-SIL cells, with TLX1 contributing to the NOTCH-MYC regulatory axis by posttranscriptional enhancement of MYC protein levels. Functional classification of the TLX1/NOTCH-coregulated targets also showed enrichment for genes associated with other human cancers as well as those involved in developmental processes. In particular, we found that TLX1, NOTCH and MYC coregulate CD1B and RAG1, characteristic markers of early cortical thymocytes, and that concerted downregulation of the TLX1 and NOTCH pathways resulted in their irreversible repression. We found that TLX1 and NOTCH synergistically regulate transcription in T-ALL, at least in part via the sharing of a TLE corepressor and by augmenting expression of MYC. We conclude that the TLX1/NOTCH/MYC network is a central determinant promoting the growth and survival of TLX1+ T-ALL cells. In addition, the TLX1/NOTCH/MYC transcriptional network coregulates genes involved in T cell development, such as CD1 and RAG family members, and therefore may prescribe the early cortical stage of differentiation arrest characteristic of the TLX1 subgroup of T-ALL.

Full-text

Available from: Irene Riz
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Open Access
RESEARCH
© 2010 Riz et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attri-
bution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Research
TLX1 and NOTCH coregulate transcription in T cell
acute lymphoblastic leukemia cells
Irene Riz
1
, Teresa S Hawley
2
, Truong V Luu
3
, Norman H Lee*
3
and Robert G Hawley*
1
Abstract
Background: The homeobox gene TLX1 (for T-cell leukemia homeobox 1, previously known as HOX11) is inappropriately
expressed in a major subgroup of T cell acute lymphoblastic leukemia (T-ALL) where it is strongly associated with
activating NOTCH1 mutations. Despite the recognition that these genetic lesions cooperate in leukemogenesis, there
have been no mechanistic studies addressing how TLX1 and NOTCH1 functionally interact to promote the leukemic
phenotype.
Results: Global gene expression profiling after downregulation of TLX1 and inhibition of the NOTCH pathway in ALL-
SIL cells revealed that TLX1 synergistically regulated more than 60% of the NOTCH-responsive genes. Structure-
function analysis demonstrated that TLX1 binding to Groucho-related TLE corepressors was necessary for maximal
transcriptional regulation of the NOTCH-responsive genes tested, implicating TLX1 modulation of the NOTCH-TLE
regulatory network. Comparison of the dataset to publicly available biological databases indicated that the TLX1/
NOTCH-coregulated genes are frequently targeted by MYC. Gain- and loss-of-function experiments confirmed that
MYC was an essential mediator of TLX1/NOTCH transcriptional output and growth promotion in ALL-SIL cells, with
TLX1 contributing to the NOTCH-MYC regulatory axis by posttranscriptional enhancement of MYC protein levels.
Functional classification of the TLX1/NOTCH-coregulated targets also showed enrichment for genes associated with
other human cancers as well as those involved in developmental processes. In particular, we found that TLX1, NOTCH
and MYC coregulate CD1B and RAG1, characteristic markers of early cortical thymocytes, and that concerted
downregulation of the TLX1 and NOTCH pathways resulted in their irreversible repression.
Conclusions: We found that TLX1 and NOTCH synergistically regulate transcription in T-ALL, at least in part via the
sharing of a TLE corepressor and by augmenting expression of MYC. We conclude that the TLX1/NOTCH/MYC network
is a central determinant promoting the growth and survival of TLX1
+
T-ALL cells. In addition, the TLX1/NOTCH/MYC
transcriptional network coregulates genes involved in T cell development, such as CD1 and RAG family members, and
therefore may prescribe the early cortical stage of differentiation arrest characteristic of the TLX1 subgroup of T-ALL.
Background
Homeodomain-containing transcription factors play a
major role in the establishment of metazoan body plans
and organogenesis. They are also involved in the mainte-
nance of tissue homeostasis, influencing the self-renewal
and differentiation of stem cells and their progenitors. A
number of experimental investigations have demon-
strated that homeodomain transcription factors regulate
multiple cellular functions including cell growth, prolifer-
ation, apoptosis, communication, adhesion and migration
[1,2]. It is not surprising therefore that anomalous expres-
sion of homeobox genes can disrupt developmental pro-
grams and contribute to neoplasia [3,4].
TLX1 is an evolutionarily conserved member of the
NKL (NK-Like or NK-Linked) subclass of Antennapedia
homeobox genes. During normal development, TLX1 is
required for the formation of the spleen and participates
in certain neuronal cell fate decisions [5-7]. Although
TLX1 is not normally expressed in the hematopoietic sys-
tem, its inappropriate expression due to chromosomal
translocations involving T cell receptor (TCR) genes is
associated with about 30% of adult and approximately 8%
of childhood T-cell acute lymphoblastic leukemia (T-
* Correspondence: phmnhl@gwumc.edu, rghawley@gwu.edu
1
Department of Anatomy and Regenerative Biology, The George Washington
University Medical Center, Washington, DC, USA
3
Department of Pharmacology and Physiology, The George Washington
University Medical Center, Washington, DC, USA
Full list of author information is available at the end of the article
Page 1
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 2 of 17
ALL) cases [3,8]. T cell transforming activity of TLX1 has
been confirmed experimentally in studies of murine bone
marrow transplant recipients that received hematopoietic
stem cells expressing a retrovirally-delivered TLX1 trans-
gene [9,10]. However, a long latency of TLX1-induced
tumorigenesis indicated the necessity for additional
genetic abnormalities. In this regard, mutations activat-
ing NOTCH1 are observed in virtually all TLX1
+
T-ALL
samples [11-13], arguing that the two factors frequently
cooperate in the neoplastic conversion of T cell progeni-
tors. NOTCH stimulates the PI3K-AKT-mTOR pathway
and transcriptionally activates the NF-κB, MYC and
HES1 transcription factors in T-ALL cells, but the critical
target genes responsible for the NOTCH1-induced
malignant phenotype remain to be fully defined [14-19].
The NOTCH receptor family plays an important role in
T cell development by providing instructional and
growth promoting signals [20,21]. Intrathymic T cell dif-
ferentiation is associated with sequential changes in the
expression of the CD1, CD3, CD4 and CD8 cell surface
markers [22,23]. Early thymocyte precursors do not
express CD3, CD4 or CD8. In-frame TCRβ rearrange-
ment and the generation of a functional pre-TCR com-
plex (TCRβ/pre-TCRα/CD3) at the cell surface allows
continued thymocyte development via the process of β-
selection. In humans, CD4 is transiently upregulated fol-
lowing β-selection and the immature single positive (ISP)
CD4
+
cells rapidly give rise to CD4
+
CD8
+
double positive
(DP) cells which undergo further maturation toward two
distinct populations represented by CD4
+
or CD8
+
single
positive (SP) phenotypes. NOTCH and/or pre-TCR sig-
naling provide survival and trophic functions until the
late DP stage when the cells become highly positive for
CD3 and depend on TCR signaling [24,25]. Specifically,
NOTCH signaling was shown to be obligatory for β-
selection [26], and the direct transcriptional target of
NOTCH, MYC, is a central integrator of NOTCH-medi-
ated survival [27,28] and preTCR-mediated proliferative
signals [29,30]. Surface expression of the CD1 family of
genes increases until the late DP stage, after which their
expression is extinguished and remains off in CD4
+
and
CD8
+
SP cells [31,32]. TLX1
+
T-ALL samples exhibit a
predominantly CD1
+
CD3
-
surface phenotype with high
levels of TCR recombination activating gene (RAG1)
expression and TCRβ rearrangement on at least one
allele; but they often lack cytoplasmic and surface TCRβ
expression, suggesting that the onset of malignant trans-
formation occurs before β-selection [32-36]. However
TLX1
+
leukemic cells are characteristically CD4
+
CD8
+
,
indicating that the oncogenic network allows the cells to
bypass the β-selection checkpoint and arrest at the early
cortical DP stage.
The direct transcriptional targets of NOTCH are
tightly regulated such that they are repressed in the
absence of a NOTCH activating signal [12,37]. In Droso-
phila, Groucho, a homolog of Transducin-like Enhancer-
of-split (TLE) proteins, directly associates with the Sup-
pressor of Hairless (the homolog of human RBP-Jκ)
repressor complex to block transcription from NOTCH-
responsive elements [38]. In mammals, SPEN/SHARP, a
different RBP-Jκ-associated corepressor protein performs
this function [39]. Instead, as was shown for the best
characterized target of NOTCH, HES1 (reviewed in [40]),
TLE proteins are involved in modulating NOTCH output
by a mechanism that involves autorepression of HES1 via
formation of a repressive HES1-TLE complex that recog-
nizes an N-box sequence in the HES1 promoter [41].
Moreover, the levels of HES1-repressive activity have
been shown to define the type of NOTCH response, e.g.,
whether it is repressed, oscillating or strongly activated
[42]. It is noteworthy that transcriptional repression in
response to NOTCH signaling occurs via an indirect
mechanism through downstream effectors; among these,
HES1-TLE repressor complexes play a central role, a well-
studied example of which is in the context of NOTCH
antineurogenic activity [43]. Thus, TLE corepressors con-
tribute to two aspects of NOTCH signaling: establishing
negative loops of regulation and mediating NOTCH
repressor activity. TLE proteins are also emerging as focal
points for crosstalk between signaling pathways [44,45].
Additionally, there is mounting evidence that the expres-
sion of TLE genes is altered in a growing list of human
cancers [46], including hematologic malignancies [41,47].
We recently showed that TLX1 interacts with TLE1 via
an Engrailed homology 1 (Eh1) motif (FXIXXIL, where X
can be any amino acid) encompassing amino acids 19-26
[46,48], and proposed that TLX1 activates transcription
at least in part by derepressing TLE-controlled genes
[49]. Here we demonstrate that TLX1-TLE interaction
contributes in a positive manner to NOTCH transcrip-
tional programs in T-ALL. Functional classification of the
overlapping targets of these cooperating genetic lesions
showed enrichment for genes associated with other
human cancers as well as those involved in developmen-
tal processes. We found that TLX1 augments the
NOTCH-MYC regulatory axis by enhancing MYC pro-
tein levels and that this represents a major component of
TLX1-mediated growth control in ALL-SIL cells. We fur-
ther show that MYC coregulates a significant proportion
of common TLX1/NOTCH targets, among them the
CD1B and RAG1 genes characteristic of the early cortical
phenotype exhibited by TLX1
+
T-ALLs [32-36]. Down-
regulation of TLX1 in concert with NOTCH blockade
resulted in irreversible repression of these genes. There-
Page 2
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 3 of 17
fore, our data suggest that the TLX1/TLE/NOTCH/MYC
network contributes to the pathogenesis of T-ALL by
concomitantly promoting the differentiation arrest and
expansion of cells at the CD1
+
early cortical DP stage of
thymocyte development.
Results
TLX1 signature genes in T-ALL cells
In an effort to identify TLX1 target genes critical to the
malignant phenotype in T-ALL, we recently performed
gene expression profiling of a patient-derived TLX1
+
T-
ALL cell line (ALL-SIL) where TLX1 was downregulated
by a lentiviral TLX1 shRNA knockdown approach [50].
Despite selection for vector-encoded drug resistance,
there was a certain degree of heterogeneity in TLX1 lev-
els within the transduced cells [50]. We therefore sought
to devise a strategy to obtain more homogeneous ALL-
SIL populations, ideally having more defined levels of
TLX1 expression. In that study, we observed that down-
regulation of TLX1 was associated with decreased levels
of CD1B and increased levels of CD55 at the mRNA level
and on the cell surface [50]. Based on those findings, we
used fluorescence-activated cell sorting (FACS) to isolate
the following ALL-SIL populations: cells with shRNA-
mediated knockdown of TLX1 were sorted for a
CD1b
Low
CD55
High
surface phenotype (predicted "low"
TLX1), and control vector-transduced cells were sorted
into CD55
High
(predicted intermediate or "medium"
TLX1) and CD55
Low
(predicted "high" TLX1) popula-
tions. As anticipated, TLX1 protein levels in the resulting
populations exhibited an inverse correlation with surface
expression of CD55 (r = -0.9) (Figure 1A). We performed
expression profiling of the sorted TLX1
High
, TLX1
Med
and
TLX1
Low
ALL-SIL cells to identify transcripts whose
changes in expression levels correlated with TLX1 pro-
tein levels. To globally validate and extend our previous
data, which was carried out using an Affymetrix oligonu-
cleotide microarray [50], we chose a 39,936 element
cDNA microarray for these experiments [51] (see ref.
[52]) (Additional file 1). The datasets of candidate TLX1-
responsive genes obtained using these two expression
platforms overlapped significantly (P < 0.0001), yielding a
robust consensus set of TLX1 signature genes (Figure 1B,
C).
To rule out off-target effects of the TLX1 shRNA, we
wanted to assess whether reintroduction of wild-type
TLX1 would reverse the knockdown impact on the
expression levels of representative genes selected from
the TLX1 signature gene list (see Figure 2B). In the exper-
iments described above, we downregulated endogenous
TLX1 using an shRNA (TLX1 shRNA95) directed against
the TLX1 coding region. To independently corroborate
target gene expression changes and to facilitate rescue
experiments by ectopic TLX1 expression, we used a dif-
ferent shRNA (TLX1 shRNA93) directed against the 3'
noncoding region of TLX1 mRNA. After lentiviral deliv-
ery of TLX1 shRNA93 and sorting for a
CD1b
Low
CD55
High
surface profile, retroviral vectors
expressing the coding region of wild-type TLX1 (TLX1
WT) and two mutant TLX1 proteins were stably intro-
duced into the TLX1 knockdown cells (Figure 1D). As
shown in Figure 1E, regulation by TLX1 was confirmed
for the selected genes (DTX1, GAS1, HMGA2, L1TD1,
PLAC8, SH3BP5, SLC44A1) (P < 0.05, TLX1 WT vs GFP
control). GAS1, HMGA2, L1TD1 and PLAC8 expression
required TLX1 DNA-binding activity since introduction
of a DNA binding-deficient form of TLX1 carrying a
mutation within the homeodomain (TLX1 N51A) [53]
had minimal if any activity (P < 0.05, TLX1 WT vs TLX1
N51A).
In other recent work, we reported that TLX1 binds the
TLE1 corepressor in an Eh1-dependent manner [49], and
we demonstrated that this interaction is important for
transcriptional activation of two known TLX1 target
genes, Aldh1a1 and Fhl1 in NIH3T3 cells [54,55]. We
therefore wished to determine whether any of the
selected TLX1-responsive genes in human T-ALL cells
similarly depend on the Eh1 motif. Notably, we found
that introduction of a TLE binding-deficient mutant of
TLX1 (TLX1 F19E, with a Phe 19 to Glu mutation within
the Eh1 motif) [49] significantly diminished the effect
obtained by TLX1 reconstitution-of-function for GAS1,
PLAC8 and SH3BP5 (P < 0.05, TLX1 WT vs TLX1 F19E)
(Figure 1E). The data thus suggested that DNA-binding
activity and/or TLE interaction are important for TLX1-
mediated transcriptional regulation of the studied TLX1
signature genes.
TLX1 and NOTCH coregulate transcription on a global scale
Toward the identification of transformation-essential
TLX1 targets, we employed an elegant approach recently
described by Land and colleagues, who found that the
gene sets that were coregulated by loss-of-function p53
and Ras activation, but not the targets of either genetic
lesion alone, were enriched in genes required for in vivo
tumorigenic potential [56]. Since activating NOTCH1
mutations are tightly associated with TLX1
+
T-ALL [11-
13], we were interested in investigating whether there was
a potential cooperation between NOTCH and TLX1 in
the control of target gene expression underlying leukemic
cell growth, especially in view of the role of TLE proteins
in NOTCH signaling [41-43]. T-ALL-associated muta-
tions in NOTCH1 occur in the extracellular heterodi-
merization (HD) domain and/or the C-terminal PEST
domain of the protein: HD domain mutations increase
the rate of production of the intracellular form of
NOTCH1 and mutations that eliminate the PEST domain
Page 3
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 4 of 17
increase protein half-life [57]. ALL-SIL cells harbor gain-
of-function NOTCH1 mutations in both the HD domain
and the PEST domain [11]. This NOTCH1 mutant still
requires cleavage by γ-secretase to generate the mature
intracellular form which translocates to the nucleus to
regulate gene transcription. Therefore, we used the γ-
secretase inhibitor (GSI) Compound E [11] to downregu-
late NOTCH pathway signaling in the ALL-SIL cell-
derived populations described above expressing three dif-
ferent levels of TLX1. GSI treatment was with 500 nM
Compound E and RNA was prepared 24 hours posttreat-
ment as described previously [14]. In total, we generated
six different experimental conditions - high, medium or
low TLX1 levels treated with GSI or vehicle control
(DMSO) - and performed expression profiling experi-
ments using cDNA arrays as described above. Principal
Component Analysis indicated that transcription on a
global scale was more profoundly affected by downregu-
lation of TLX1 than by inhibition of NOTCH signaling;
i.e., larger sets of genes were found to be responsive to
changes in TLX1 levels than to GSI treatment (Additional
files 1 and 2). Sets of TLX1-responsive genes derived
from GSI- or DMSO- treated cells overlapped signifi-
cantly as did sets of GSI-responsive genes identified
under the conditions of high or low TLX1 levels (P <
0.0001) (Figure 2A). Using the DAVID gene ontology
classification tool, we performed comparative analysis of
the functions of the genes responsive to NOTCH in the
presence or absence of TLX1 and searched for GO terms
uniquely associated with either of these conditions. The
best DAVID score for TLX1
+
conditions was associated
with the GO term "response to external stimulus" (P <
Figure 1 Structure-function analysis of TLX1-mediated transcriptional regulation in ALL-SIL T-ALL cells. (A) TLX1 protein levels inversely cor-
relate with CD55 surface levels. Top, CD55 FACS analysis. Histogram colors indicate: blue, TLX1
Low
; green, TLX1
Med
; and red, TLX1
High
. Bottom, TLX1
Western blot. TLX1
High
levels were 6.5× higher and TLX1
Med
levels were 4.9× higher than TLX1
Low
levels (P < 0.0001). The difference between the
TLX1
High
and TLX1
Med
levels was statistically significant (P < 0.05). (B) Venn diagram comparing candidate TLX1 target genes derived from two different
microarray technologies: Affymetrix data have been described [50]; cDNA array targets were selected based on correlation of expression levels with
TLX1 protein levels (r > 0.9 or < -0.9; 1% FDR; n = 3-4). (C) Hierarchical clustering of genes identified in both profiling experiments. (D) TLX1 levels in
knockdown and "rescued" ALL-SIL populations: top, Western blot; bottom qRT-PCR. The TLX1 knockdown populations expressing coding regions of
wild-type or mutant forms of TLX1 are: TLX1 WT, wild-type; TLX1 N51A, DNA binding-deficient mutant; TLX1 F19E, TLE binding-deficient mutant;
shTLX1 GFP, TLX1 knockdown plus GFP reporter. Total or endogenous TLX1 mRNA levels were determined using primers targeting coding or 3' non-
coding regions of TLX1, respectively. The data is normalized to TLX1 knockdown expressing GFP alone (shTLX1 GFP). (E) TLX1 signature gene expres-
sion in the populations described in D. The data is normalized to TLX1 knockdown expressing GFP alone (P values are indicated in the text and
Additional file 4; n = 2-3 biological replicates, each comprising 3 technical replicates).
A
C
B
18 23 251
cDNA
Array
Oligo
Array
SLC44A1
HMGA2
L1TD1
PLAC8
SH3BP5
TLX1 WT
TLX1 N51A
TLX1 F19E
0
20
40
TLX1 Signal Intensity
(Relative Units, x 10
4
)
TLX1
Low
TLX1
Med
TLX1
High
TLX1
β-actin
Counts
CD55
10
0
10
1
10
2
10
3
10
0
10
1
10
2
10
3
10
0
10
1
10
2
10
3
10
0
10
1
10
2
10
3
TLX1
Low
TLX1
High
TLX1
Low
TLX1
High
Oligo
Array
E
0
2
4
6
8
10
GAS1
DTX1
Fold Change (qRT-PCR)
D
-1 0 1
cDNA
Array
TLX1 total levels
TLX1 endogenous
Relative TLX1 mRNA
Levels (qRT-PCR)
TLX1
β-actin
TLX1 WT
TLX1 F19E
TLX1 N51A
shTLX1 GFP
0
5
10
15
20
TLX1 WT
TLX1 F19E
TLX1 N51A
shTLX1 GFP
Page 4
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 5 of 17
0.001, representing 8% of the subset under high TLX1
conditions and P < 0.001, representing 6.7% of the subset
under medium TLX1 conditions) whereas the best score
in the absence of TLX1 expression was associated with
the GO term "nervous system development" (P < 0.006,
representing 8.8% of the subset). This data suggested that
expression of TLX1 may influence the functional out-
come of NOTCH pathway activation.
Strikingly, the lists of GSI-responsive genes and TLX1-
responsive genes overlapped very strongly: more than
60% of the GSI-responsive genes were also controlled by
TLX1 (Figure 2A), indicating that a significant fraction of
NOTCH target genes in ALL-SIL cells is coregulated by
TLX1 (P < 0.0001). To quantitatively compare the indi-
vidual contributions of TLX1 and NOTCH in the regula-
tion of common targets, we identified those genes that
are differentially expressed in ALL-SIL cells where TLX1
and NOTCH are "on" versus cells where both factors are
"off" (i.e., GSI-treated TLX1
Low
cells) (Additional file 3).
As summarized in Figure 2B, downregulation of TLX1
and inhibition of NOTCH affected the regulation of the
vast majority of genes in the same direction. We found
that approximately half of the TLX1-induced genes
showed the highest expression levels in the presence of
NOTCH signaling. Interruption of the transcriptional
output of either factor led to the downregulation of these
genes. Less than 10% showed a much stronger response
to GSI, exhibiting downregulation upon GSI treatment
Figure 2 TLX1 and NOTCH coregulate transcription. (A) ALL-SIL cells were treated for 24 hours with 500 nM Compound E (GSI) and 0.05% DMSO
as vehicle control and then harvested for microarray analysis. The Venn diagrams indicate a significant overlap between TLX1 targets and GSI-respon-
sive genes (P < 0.0001; data for a 10% FDR is shown). GO terms uniquely associated with the overlapping genes in each pair-wise comparison are
indicated (see text for details). (B) Hierarchical clustering of known genes showing > 2-fold change under TLX1
High
versus TLX1
Low
conditions and a
FDR < 10%. (C) Confirmation by qRT-PCR of representative coregulated genes. Data is normalized to TLX1
Low
GSI-treated samples, where both NOTCH
and TLX1 are downregulated. The average of 3 experiments is shown (P values are indicated in the text where discussed and the P values for all com-
parisons are provided in Additional file 4; n = 3 biological replicates, each comprising 3 technical replicates). (D) TLX1 and NOTCH repress the GAS1
gene via a TLE corepressor-mediated mechanism. Top, ALL-SIL cells expressing the TX1 shRNA95 or pLKO control vector were transduced with lenti-
viral vectors expressing panTLE shRNAs. Bottom, ALL-SIL cells expressing the pLKO control vector were transduced with lentiviral vectors expressing
panTLE shRNAs. GSI treatment was for 24 hours. (E) Western blot analysis showing 50% reduced TLE1 levels in ALL-SIL cells expressing panTLE shRNAs
(P < 0.05).
A
C
BD
E
Repressed by TLX1 or NOTCHInduced by TLX1 and/or NOTCH
GSI - + - +
1024 746 1852
575 966 2656
NOTCH
GSI
DMSO
261 61 261
TLX1
Low
TLX1
High
GSI-responsive TLX1-responsive
TLX1
PLAC8
OR10R2
SH3BP5
SLC44A1
HMGA2
CD1B
GAS1
L1TD1
D
T
X1
10
4
10
3
10
2
10
1
10
-1
10
-2
Fold Change (qRT-PCR)
TLE1
β-actin
shTLE
pLKO
TLX1
High
DMSO
TLX1
Low
DMSO
TLX1
High
GSI
GSI GSI
shTLE
DMSO DMSO
Relative GAS1 mRNA
Levels (qRT-PCR)
0
1
2
3
pLKO
TLX1
Low
TLX1
High
1
10
100
pLKO
shTLE
shTLX1
+ shTLE
Relative GAS1 mRNA
Levels (qRT-PCR)
shTLX1
P < 0.008
P < 0.05
P < 0.008
P < 0.003
Page 5
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 6 of 17
and a somewhat more complex response to TLX1 knock-
down. One such example, the NOTCH target gene, DTX1
(Deltex1) [58], was chosen for validation by qRT-PCR
together with 7 TLX1/NOTCH-coinduced genes (CD1B,
HMGA2, L1TD1, OR10R2, PLAC8, SH3BP5, SLC44A1)
and one TLX1/NOTCH-corepressed gene (GAS1). The
qRT-PCR data reported in Figure 2C is presented as rela-
tive expression levels normalized to levels in GSI-treated
TLX1
Low
cells; thus, a positive value indicates positive
regulation by TLX1 and activated NOTCH. Regulation
by TLX1 in the presence or absence of NOTCH signaling
was demonstrated for all of the putative TLX1/NOTCH-
coinduced genes examined (P < 0.05), and by NOTCH
under conditions of high or low TLX1 expression (P <
0.05, for at least one TLX1 expression condition; see
Additional file 4 for a complete list of P values) (Figure
2C). In support of the generality of these latter results, it
had previously been reported that PLAC8, SH3BP5 and
SLC44A1 were downregulated following NOTCH inhibi-
tion with a different GSI in a different T-ALL-derived cell
line [59] (see also Additional file 5). Regulation of the
NOTCH target gene DTX1 by TLX1 was also confirmed
in this series of experiments (Figure 2C). As expected,
DTX1 showed significantly lower levels of expression fol-
lowing GSI treatment (P < 0.05). Interestingly, under con-
ditions of NOTCH inhibition, DTX1 mRNA levels were
higher in TLX1
Low
cells than in TLX1
High
cells (P < 0.05),
reaffirming the complexity of the DTX1 response to
TLX1/NOTCH coregulation suggested by the microarray
data.
We also verified in this series of experiments that GAS1
was repressed by TLX1 (P < 0.001) (Figure 2C). Since the
Eh1 TLE-binding motif mutant of TLX1 (TLX1 F19E)
exhibited markedly reduced GAS1 repressive activity (P <
0.02) (Figure 1E), we decided to directly investigate the
potential contribution of TLE corepressors to the GAS1
repression mechanism. ALL-SIL cells expressing the
TLX1 shRNA95 or pLKO control vector were transduced
with lentiviral vectors expressing panTLE shRNAs. As
seen in Figure 2D, knockdown of TLE resulted in partial
derepression of GAS1 in the presence of TLX1 (P <
0.008). In contrast, no effect was observed under condi-
tions of low TLX1 expression (P = 0.6), indicating that
TLX1 is required for repression of GAS1. The magnitude
of derepression achieved by TLE knockdown (~3-fold)
was much less than that obtained following TLX1 knock-
down (~40-fold), presumably due in part to incomplete
knockdown of TLE. A representative Western blot shown
in Figure 2E indicates that only ~50% downregulation of
TLE1 protein levels was obtained (P < 0.05). In this series
of experiments, GSI treatment also resulted in partial
derepression of GAS1 in the presence of TLX1 (~2-fold,
P < 0.003) (Figure 2D) supporting the data presented in
Figure 2C indicating involvement of NOTCH. Notably,
knockdown of TLE resulted in partial derepression of
GAS1 in the presence of activated NOTCH (~3-fold, P <
0.008) but had no significant additional effect when
NOTCH was inhibited. Collectively, the data for GAS1
supported the hypothesis that TLE corepressors can
serve as common cofactors in the regulation of certain
TLX1/NOTCH-corepressed genes.
To compare the cellular functions regulated by TLX1
and NOTCH together or by either factor separately, we
performed a functional classification of gene sets that
were enriched for NOTCH only-induced genes, TLX1
only-induced genes and TLX1/NOTCH-coinduced
genes. DAVID analysis revealed that all three datasets
were enriched for functional GO terms associated with
developmental processes. In agreement with the well-rec-
ognized survival function of NOTCH in normal and
malignant T cells, we found that the gene set induced by
NOTCH alone was specifically enriched for GO terms
"positive regulation of metabolism" and "apoptosis"
[14,15,27], whereas genes only induced by TLX1 were
enriched for GO terms associated with "chromatin func-
tion and regulation", "proliferation" and "cell-cycle" [60].
Importantly, GO terms associated with "immune system
development" and "oncogenesis" only appeared in the set
of genes regulated by both TLX1 and NOTCH (Figure
2A). Notably, HMGA2 and PLAC8 were previously
reported to be among the 'cooperation response genes'
identified by loss-of-function p53 and Ras activation as
contributing to the malignant phenotype in colon cancer
[56]. A role of HMGA2 in embryonic growth and devel-
opment has also been described [61-63]. Moreover, the
mouse orthologs of 4 of the other 6 TLX1/NOTCH-coin-
duced signature genes verified by qRT-PCR (L1TD1,
PLAC8, SH3BP5, SLC44A1) are downregulated during
differentiation of mouse embryonic stem cells whereas
the TLX1/NOTCH-corepressed target GAS1 is activated
during embryonic stem cell differentiation (GEO profiles
GDS2905 and GDS2906). These observations indicate
that the TLX1/NOTCH leukemic signature shares a com-
mon component with an embryonic stem cell-like tran-
scriptional program [64]. Furthermore, CD1b, the cell
surface marker characteristic of the early cortical thymo-
cyte stage of differentiation arrest associated with the
vast majority of TLX1
+
T-ALL cases, was also among the
targets coregulated by TLX1 and NOTCH.
TLX1-mediated augmentation of MYC contributes to T-ALL
growth regulation
To understand how TLX1 might modulate NOTCH-
dependent transcription, we first examined whether
TLX1 influences intracellular levels of NOTCH1. We
found that neither TLX1 levels nor sorting for CD1/
CD55 affected the levels of activated NOTCH1, whereas,
as expected, GSI treatment markedly decreased intracel-
Page 6
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 7 of 17
lular levels of NOTCH1 (Figure 3A). We also found that
expression of constitutively active form of NOTCH1,
ICN1 (encoding the intracellular domain of NOTCH1),
does not substitute for the lack of TLX1 in the growth
regulation of ALL-SIL cells (Figure 3B). However, as
determined by growth competition assay, both factors
synergistically regulated ALL-SIL growth, since GSI
treatment significantly enhanced the differences between
the growth rates of the TLX1-expressing and knockdown
populations (Figure 3C). Together, the data suggested
that TLX1 and NOTCH utilize different but synergistic
mechanisms contributing to the growth of ALL-SIL cells.
We hypothesized that the MYC gene might represent
the master regulatory hub targeted by both oncogenic
lesions because TLX1
+
T-ALLs exhibit increased levels of
MYC and MYC target genes [33,60] and NOTCH1
directly activates the MYC gene at the transcriptional
level in T-ALL [14,15]. We therefore investigated whether
TLX1 and NOTCH coregulate MYC in ALL-SIL cells.
MYC protein levels were found to be lowest in TLX1
Low
Figure 3 TLX1 and NOTCH coregulate MYC levels and ALL-SIL growth. (A) ALL-SIL derivatives expressing the indicated levels of TLX1 were treated
for 24 hours with 500 nM Compound E (GSI, +) and 0.05% DMSO (GSI, -) as vehicle control. Whole cell lysates were analyzed for expression of activated
NOTCH1 and MYC proteins by Western blotting. A representative blot of 4 biological replicates is shown. (B) Activated NOTCH1 expression does not
compensate for the lack of TLX1. ALL-SIL cells expressing the TX1 shRNA95 or pLKO.1-CFP control vector were lentivirally transduced to express a con-
stitutively active form of NOTCH1 (ICN1). Cells were seeded at 1 × 10
5
cells per ml in parallel with mock-transduced controls and counted on days 1
and 4 by trypan blue staining. (C) Growth competition experiments in the presence or absence of 500 nM Compound E, indicated as GSI and DMSO,
respectively. ALL-SIL cells expressing TLX1 shRNA95 and CFP or pLKO.1-CFP were mixed with parental ALL-SIL cells in equal proportions. Mixed pop-
ulations were divided, treated with GSI or DMSO control for up to 3 weeks and periodically examined by flow cytometric analysis. (D) TLX1 and NOTCH
regulation of MYC and HES1 mRNA. (E) TLX1 prevents GSI-induced downregulation of MYC protein and extends MYC half-life. Cells were treated with
500 nM Compound E or DMSO control for 24 hours, then assayed for MYC protein levels and stability using 50 μg/ml cycloheximide or 40 μM MG132
treatment for the indicated times.
- + - + -+
A
D
BE
C
TLX1
Med
TLX1
High
TLX1
Low
GSI
0
10
20
30
40
pLKO
shTLX1
shTLX1
+ ICN1
shTLX1
+ GSI
pLKO
+ GSI
shTLX1
pLKO
+ DMSO
+ DMSO
+ ICN1
pLKO
DAY 1
DAY 4
Cells per ml (x 10
4
)
20
30
40
50
60
0 5 10 15
Days of treatment
CFP
+
(%)
MYC
HES1
0
1
2
3
5
4
Fold Downregulation
(qRT-PCR)
β-actin
β-actin
pLKO + GSI
CHX (min)
MG132
MYC
MYC
TLX1
pLKO + DMSO
shTLX1 + GSI
shTLX1 + DMSO
0 20 40 60 180 180 0 20 40 60 180 180
----- -----++
pLKO+ALL-SIL
shTLX1+ALL-SIL
DMSO
DMSO
GSI
GSI
TLX1
β-actin
MYC
NOTCH1
NS
Page 7
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 8 of 17
cells treated with GSI (Figure 3A). Notably, TLX1 did not
influence MYC mRNA levels under any conditions; e.g.,
MYC mRNA levels decreased following GSI treatment
regardless of TLX1 expression (P < 0.05, GSI- vs DMSO-
treated cells) although TLX1 prevented GSI-mediated
downregulation of HES1 mRNA (P < 0.05) (Figure 3D).
We asked next if TLX1 expression contributes to the syn-
thesis or stability of the MYC protein. As shown in Figure
3E, TLX1 increased MYC protein levels in the presence
of the MG132 protease inhibitor and, in addition, as seen
from cycloheximide treatment, prolonged MYC protein
half-life. NOTCH also positively contributed to total
MYC protein levels, consistent with previously published
data showing that NOTCH directly activates MYC gene
expression in T-ALL [14,15]. The data thus suggested that
TLX1 contributes to the NOTCH-MYC oncogenic axis at
least in part via augmentation of MYC protein expression
and stability.
Next, we assessed the functional role of TLX1-medi-
ated augmentation of MYC and asked how inhibition of
MYC activity affects the growth of ALL-SIL cells. ALL-
SIL cells were treated with a small-molecule MYC inhibi-
tor, compound 10058-F4 [65,66]. Compound 10058-F4
treatment decreased the growth of ALL-SIL cells to simi-
lar levels regardless of TLX1 expression (Figure 4A), sug-
gesting that augmentation of MYC function is a central
mechanism of TLX1 contribution to ALL-SIL cell
growth. Ectopic expression of wild-type MYC in TLX1
Low
ALL-SIL derivatives fully compensated for the knock-
down of endogenous TLX1. On the other hand, an inac-
tive MYC mutant missing an evolutionarily conserved
region called MYC homology box II (MYC ΔC) [67] was
not capable of promoting growth of the cells (Figure 4B,
C), as expected [68]. Interestingly, we found that a large
fraction of TLX1/NOTCH-targeted genes was repre-
sented by potential MYC targets when we compared the
expression profiling data with MYC CHIP-on-chip data
obtained previously for the TLX3
+
T-ALL-derived cell
line HPB-ALL [58] (Additional file 5). Accordingly, we
determined that of 8 representative genes coinduced by
TLX1 and NOTCH, 6 were inhibited by 10058-F4 treat-
ment (Table 1). Interestingly, PLAC8 expression was
upregulated by the MYC inhibitor in agreement with pre-
viously published data showing repression of PLAC8 in
response to MYC overexpression [69]. Since we found
that both TLX1 and NOTCH activated PLAC8, the data
suggested that, at least in this case, there is a more com-
plex interplay between the three transcription factors
than simple coactivation.
TLX1/NOTCH coregulation of T-cell developmental genes
The functional classification of the TLX1/NOTCH-
coregulated genes suggested that concerted activity of
these oncogenes may alter T-cell development. We previ-
ously reported that TLX1 downregulation correlates with
a decrease in CD1b surface expression in ALL-SIL cells
and in another TLX1
+
T-ALL cell line (K3P) [50]. Here we
investigated whether inhibition of NOTCH contributes
Figure 4 Role of MYC as a downstream component of the TLX1/
NOTCH regulatory network. (A) Chemical inhibition of MYC (10058-
F4 treatment) mimics TLX1 knockdown in ALL-SIL cells expressing
shRNA93 versus pLKO.1-CFP expressing TLX1
+
controls. (B) Expression
of wild-type but not an inactive MYC mutant (MYC ΔC) compensates
for the lack of TLX1 expression in ALL-SIL cells treated with GSI. TLX1
shRNA93 was co-expressed with CFP; MYC constructs were coex-
pressed with RFP. ALL-SIL cells expressing pLKO.1-CFP-TLX1 shRNA93
were transduced with retroviral vectors coexpressing RFP alone, wild-
type MYC plus RFP or the MYC ΔC mutant plus RFP and sorted for CFP
and RFP expression. Equal numbers were seeded and counted after 2
weeks in culture. CFP + RFP, parental ALL-SIL cells coexpressing CFP
and RFP. (C) Growth competition experiments. The same CFP
+
RFP
+
ALL-SIL derivatives as in B were mixed with parental ALL-SIL cells ex-
pressing GFP in equal proportions. Aliquots were periodically analyzed
by flow cytometry; shown are data 2 weeks after initiation of the exper-
iment. (D) Western blot analysis showing MYC protein levels and the
corresponding levels of TLX1 for the cell lines studied in B and C.
A
B
0
20
40
60
80
100
120
02550
shTLX1
pLKO
Relative Cell Count (%)
0
20
40
60
80
100
0
20
40
60
80
100
CFP
+ RFP
+ RFP
shTLX1
shTLX1
+ MYC WT
shTLX1
+ MYC ΔC
CFP
+ RFP
+ RFP
shTLX1
shTLX1
+ MYC WT
shTLX1
+ MYC ΔC
CFP
+
RFP
+
vs GFP
+
(%)
DC
MYC Inhibitor 10058-F4 (μM)
Cells per ml (x10
4
)
MYC
TLX1
CFP
+ RFP
+ RFP
shTLX1
shTLX1
+ MYC WT
shTLX1
+ MYC ΔC
β-actin
Table 1: TLX1/NOTCH signature gene response to MYC
inhibition in ALL-SIL cells
Gene Fold Downregulation
CD1B 3.6 ± 0.4
HMGA2 2.4 ± 0.3
L1TD1 5.9 ± 0.4
OR10R2 1.9 ± 0.1
PLAC8 0.5 ± 0.1
RAG1 11.1 ± 2.7
SH3BP5 1.2 ± 0.1
SLC44A1 1.5 ± 0.1
Fold downregulation was defined as the ratio of the qRT-PCR
values obtained for untreated cells (DMSO) versus cells treated
for 2 days with 50 μM of the MYC inhibitor 10058-F4.
Page 8
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 9 of 17
to CD1b surface expression as well. First, we character-
ized the surface phenotype of ALL-SIL cells in greater
detail. Although the majority of the cells (~70%) are
CD4
+
CD8
+
CD1b
+/-
(DP-like), we found that ~30% exhibit
a CD4
+
CD8
-
CD1b
+
ISP-like phenotype and ~2% exhibit a
CD4
-
CD8
+
CD1b
-
SP-like phenotype. When the
CD4
+
CD8
-
CD1b
+
ISP-like population was sorted (>90%
purity) and returned to continuous culture for 2 weeks,
the phenotypic heterogeneity remerged with ~55% of the
cells exhibiting a DP-like CD4
+
CD8
+
CD1b
+/-
phenotype
(Figure 5A). Additionally, sorted DP-like populations pro-
duced about 2% SP-like cells (data not shown). Thus, the
observed heterogeneity of the surface phenotype of the
ALL-SIL line resembles a dynamic system of states remi-
niscent of a hierarchical organization of malignant T-ALL
cells [70], with the majority of cells arrested at the early
DP stage typical for TLX1
+
T-ALL [32-36]. Downregula-
tion of TLX1 by transduction with an shRNA95-express-
ing vector followed by puromycin selection or an
shRNA93- plus CFP-expressing vector followed by FACS
caused a marked decrease in CD1b levels in both ISP-like
and DP-like populations. In addition, we found that 2
weeks of GSI treatment decreased CD1b surface expres-
sion, predominantly affecting the ISP-like populations;
however, when TLX1 was knocked down, GSI treatment
caused a decrease in the surface expression of CD1b in
both DP- and ISP-like populations. Moreover, the effect
of GSI treatment was irreversible in the TLX1 knock-
down populations since, even when the cells fully recov-
ered 1 month after GSI treatment, CD1b could not be
detected on the cell surface. This is illustrated in Figure
5B, where it can be seen that the ALL-SIL population bal-
ance was shifted toward more mature phenotypes, with
reduced percentages of ISP-like, and increased percent-
ages of DP- and SP-like populations.
To determine whether other developmental genes were
regulated in a similar manner, we searched for genes that
were coregulated with CD1 family members during nor-
mal thymocyte development. RAG1 was identified previ-
ously as a gene whose expression closely resembles the
expression pattern of CD1 [31,32]; specifically, downreg-
ulation of both genes occurs at the DP stage, with RAG1
downregulation being required for the DP to SP transi-
tion [71,72]. We sorted ISP-like and DP-like populations
from ALL-SIL cells with or without TLX1 knockdown
and transient NOTCH inhibition (2 weeks of GSI treat-
ment or DMSO and 1 month recovery). We examined
CD1B and RAG1 mRNA levels in these populations and
observed a striking concordance in their expression
changes; e.g., temporary inhibition of NOTCH signaling
in TLX1 knockdown populations led to irreversible
repression of CD1B and RAG1 (Figure 5C). In addition,
ectopic reexpression of TLX1 in CD1b
-
cells failed to
reactivate these genes (data not shown). Thus, we found
that transient downregulation of NOTCH in concert with
TLX1 knockdown is required and sufficient to induce
irreversible repression of CD1B and RAG1. Since the
silencing of these genes is an important aspect of the nor-
mal T-cell differentiation program, the data suggest that
TLX1/NOTCH-coregulated maintenance of their expres-
sion exemplifies a mechanism underlying the ALL-SIL
differentiation arrest. Interestingly, downregulation of
TLE caused a significant decrease in the percentage of
CD1b
+
cells, suggesting that TLX1-TLE interaction is
involved in the TLX1-imposed differentiation arrest (Fig-
ure 5D).
Discussion
Several lines of evidence indicate that TLX1 functions as
a transcriptional regulator that can either activate or
repress gene expression [49,50,53-55,60,73-76]. The situ-
ation is complicated by the fact that TLX1 may switch its
mode of regulation of the same gene depending on as yet
ill-defined tissue-specific factors that may include the
availability of transcriptional cofactors, the presence or
state of activation of cis-regulatory DNA elements, and/
or the expression levels of the TLX1 protein itself (our
unpublished observations and [54]). Recently, for two of
the best characterized DNA binding-dependent TLX1
targets, Aldh1a1 and Fhl1, we reported that TLX1 acti-
vates transcription via interaction with the transcrip-
tional corepressor TLE [49]. However, the significance of
this observation for TLX1-associated leukemogenesis as
well as the leukemia-specific downstream targets of
TLX1 still remained elusive. In the present work, using a
human cell line derived from a TLX1
+
T-ALL patient
sample we have identified several genes that were upreg-
ulated by TLX1 in a DNA binding-dependent manner.
Although statistical significance was only reached for a
subset of genes examined, an intact Eh1 TLE-binding
motif was necessary for maximal effect in all cases with
the exception of L1TD1. Additionally, we identified a
potential direct TLX1 target gene, GAS1, which was
repressed by TLX1 in a classical TLE and DNA binding-
dependent manner [48]. Interestingly, we found that our
attempts to overexpress TLE1 by retroviral-mediated
gene delivery resulted in massive cell death in TLX1
knockdown derivatives but not in parental ALL-SIL cells
(our unpublished observations). Taken together, our data
suggest that TLX1 interaction with TLE may be an inte-
gral component of TLX1 leukemic function (Figure 6). To
explain how TLX1-TLE binding may cause transcrip-
tional activation, we can envisage at least two mecha-
nisms: 1) TLX1-TLE-mediated repression of unknown
intermediary transcriptional repressors (referred to as
the repressor-of-repressor mechanism [77]); and/or 2) A
Page 9
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 10 of 17
Figure 5 TLX1 and NOTCH coregulate expression of T-cell developmental genes. (A) FACS analysis of a CD4
+
CD8
-
CD1b
+
ISP-like subpopulation
of TLX1
+
ALL-SIL cells immediately after sorting (left) and after culture for 2 weeks (right). (B) Transient inhibition of NOTCH and downregulation of
TLX1 shifts ALL-SIL populations toward a more differentiated phenotype. Flow cytometry-based comparison of TLX1
+
ALL-SIL cells expressing CFP and
TLX1 knockdown cells expressing shRNA93 treated by a pulse of GSI. The pulse of GSI consisted of 2 weeks treatment with 500 nM Compound E fol-
lowed by culture for 1 month. (C) qRT-PCR detection of RAG1 and CD1B in the same cell lines as in B. The data shown is a representative example for
CD4
+
CD8
+
(DP) and for CD4
+
(ISP-like and SP-like) populations. RNA was extracted from the cells 24 hours after sorting (P values for all comparisons
are provided in Additional file 4; n = 2 biological replicates, each comprising 3 technical replicates). (D) The role of TLE corepressors in TLX1-mediated
regulation of CD1b surface expression. Flow cytometric analysis of ALL-SIL expressing shRNA targeting TLX1 or panTLE. The percentage of CD1b
+
pop-
ulations are shown for CD4
+
CD8
+
(green) and for CD4
+
(red) populations of ALL-SIL cells.
B
A
D
455
40
ISP-like
ISP-like
Early DP-like
CD8-like
shTLX1
GSI pulse
CD4
+
CD8
-
CD1b
+
sorted cells
cultured for two weeks
CD8-like
Late DP-like
DP-like
CD4-like
765
27
0
20
40
60
80
100
CD1b
+
(%)
CFP
shTLE
shTLX1
CD4
+
CD4
+
CD8
+
C
RAG1
CD1B
0
40
80
120
Relative Expression Levels
(qRT-PCR)
shTLX1
+ GSI
pLKO
+ GSI
shTLX1
+ DMSO
shTLX1
+ GSI
pLKO
+ GSI
shTLX1
pLKO
+ DMSO
+ DMSO
pLKO
+ DMSO
CD4
+
CD4
+
CD8
+
10
90
55
45
Page 10
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 11 of 17
derepression strategy involving competitive sequestra-
tion of TLE from other TLE-dependent transcriptional
repressors. To illustrate the validity of the second mecha-
nism, we previously used a well-established HES1-TLE-
dependent repressor model involving the ASCL1/HASH1
gene and showed that ectopic expression of TLX1 dis-
missed TLE from the ASCL1 promoter, preventing HES1-
mediated ASCL1 repression [49].
The TLE protein family plays a role in a negative loop of
regulation of NOTCH as well as facilitating NOTCH
repressor function [38,41]. We found that TLX1 coregu-
lated a large proportion of NOTCH-responsive genes. As
was confirmed by qRT-PCR, all of the TLX1 targets
requiring the Eh1 TLE-binding motif for their full activa-
tion were also positively regulated by NOTCH, implicat-
ing TLX1-TLE interaction in the derepression of
NOTCH-induced genes. Downregulation of TLE levels
by pan-TLE targeting shRNA was associated with partial
transcriptional derepression of the GAS1 gene, support-
ing the idea that TLE is directly involved in NOTCH- and
TLX1-mediated corepression of certain genes. The genes
induced by TLX1 in a TLE binding-dependent manner
also responded to reduced TLE levels but the effects were
variable, consistent with multiple indirect modes of TLE
involvement. Also, one of the strongest transcriptional
activation responses to TLX1 and NOTCH, exhibited by
the L1TD1 gene, does not require the Eh1 TLE-binding
motif for maximal effect. However, expression of L1TD1
and most of the other TLX1-NOTCH signature genes
studied were strongly inhibited by the 10058-F4 MYC
inhibitor [65,66]. Since we found that TLX1 expression
enhances MYC protein levels in ALL-SIL cells and that
this is a central facet of TLX1-mediated growth control,
we conclude that augmentation of MYC activity is an
additional and important aspect of TLX1/NOTCH coop-
eration. It was previously appreciated that high levels of
expression of MYC target genes is a characteristic feature
of TLX1
+
T-ALLs [33,60]. Thus, our results provide an
explanation for these observations and link TLX1 to the
NOTCH-MYC signaling axis (Figure 6) [14,58]. In retro-
spect, since the majority of NOTCH-induced genes in T-
ALL are also targeted by MYC [58], it is perhaps not sur-
prising to find that virtually all of the TLX1/NOTCH sig-
nature genes that we validated by qRT-PCR negatively
responded to inhibition of MYC by compound 10058-F4
treatment. Another level of complexity has arisen with a
recent publication showing that mammalian MYC and
TLE proteins directly bind in vitro [44]. In that study, the
investigators also reported that TLE antagonized MYC
transcriptional activation of growth-promoting genes in
Drosophila [44]. It is possible therefore that TLX1-medi-
ated modulation of TLE interactions may derepress MYC
target genes as well as NOTCH-responsive genes in T-
ALL cells (Figure 6). Finally, promoter analysis of the
genes whose expression positively correlated with TLX1
expression showed enrichment for NOTCH-responsive
elements (our unpublished observations). Others have
shown that TLX1 interacts with SHARP, a corepressor
protein directly controlling NOTCH target genes via this
element [78,79]. Thus, we speculate that TLX1-SHARP
interaction may be an additional point of intersection
with the NOTCH signaling pathway.
Since GSI targets all NOTCH receptor family mem-
bers, we deliberately avoided specifying throughout
which NOTCH receptor cooperates with TLX1 in ALL-
SIL cells. However, the fact that NOTCH1 is mutated in
these cells [11], considered together with our Western
blot results showing that GSI treatment markedly
decreased intracellular levels of NOTCH1, strongly
implicates activated NOTCH1 in the observed coopera-
tion with TLX1 [11]. It is important to point out, how-
ever, that others have suggested that TLX1 may enhance
NOTCH3 signaling in T-ALL cells, although no informa-
tion regarding protein levels or functional activation of
the NOTCH3 receptor was provided [78].
TLX1-activating mutations in T-ALL are associated
with an early cortical phenotype, suggesting a direct
inhibitory effect preventing the differentiation of thymo-
cytes past this developmental stage [32-36]. In experi-
mental models, we and others have observed that TLX1
Figure 6 Schematic summary of regulatory network controlling
TLX1/NOTCH signature genes. NOTCH1 activates transcription of
downstream transcriptional regulators MYC and HES. TLX1 augments
MYC protein levels. HES represses transcription via interaction with TLE
[41-43]. TLX1 interacts with TLE to mediate repression and activation of
transcription [49]. MYC binds TLE directly in vitro [45]. However, it is not
known whether TLE is required for MYC repressor activity (indicated by
"?"). We speculate that the genes coregulated by the TLX1/TLE/
NOTCH/MYC network are critical for TLX1/NOTCH transforming func-
tion in T-ALL.
NOTCH
HES
TLE
TLE
TLE
MYC
Transcriptional Regulation
TLX1
?
Page 11
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 12 of 17
expression may lead to differentiation arrest of a broad
spectrum of hematopoietic precursors, and that extinc-
tion of TLX1 expression released the block allowing con-
tinuation of the differentiation program in erythroid
precursors conditionally expressing TLX1 [76,80]. More-
over, we recently showed that TLX1 downregulation in
ALL-SIL cells correlates with acquisition of a surface phe-
notype associated with early cortical to late cortical thy-
mocyte development epitomized by downregulation of
CD1 family members, partially recapitulating the T-cell
differentiation program [50]. Here, we have extended the
latter studies to demonstrate that the CD1B marker of
early cortical thymocytes is coregulated by TLX1 and
NOTCH concomitant with maintenance of RAG1 expres-
sion. Downregulation of RAG1 in cortical thymocytes is
one of the earliest signs of positive selection during nor-
mal thymocyte development [71,72]. In this context, we
found that downregulation of TLX1 and NOTCH in
ALL-SIL cells leads to irreversible repression of the CD1B
and RAG1 genes, since reexpression of TLX1 in the
sorted CD1b
-
cells or resumption of NOTCH signaling
was not sufficient to reactivate their expression. There-
fore, the data is consistent with a role of TLX1/NOTCH
cooperation in preventing the differentiation-pro-
grammed repression of the CD1B and RAG1 genes rather
than one involving transcriptional activation of CD1 and
RAG family members. In addition, we found that CD1B
and RAG1 were negatively regulated by MYC inhibition.
Collectively, these findings implicate the TLX1/NOTCH-
MYC network in maintaining the CD1
+
early cortical
stage of TLX1
+
T-ALL cells.
A major motivation for these studies was to identify
potential therapeutic targets that are critical to the malig-
nant phenotype in T-ALL. The study design was modeled
after that of Land and colleagues who demonstrated in
experimental models of murine and human colon cancer
that malignancy was strongly correlated with a class of
genes they referred to as 'cooperation response genes'
which were synergistically regulated by cooperating
oncogenic mutations [56]. Based on their observations
that the malignant state depended on a similar set of
genes in both experimental systems, the investigators
suggested that cooperation response genes may broadly
contribute to the generation and maintenance of the can-
cer cell phenotype in a variety of contexts. It is notable
therefore that HMGA2 and PLAC8 were among the genes
that we identified. HMGA2 belongs to the high mobility
group AT-hook family of architectural nuclear factors
involved in chromatin remodeling and gene transcrip-
tion. It is predominantly expressed during normal embry-
onic development, but has been implicated as
contributing to the transformed phenotype and poor
prognosis of a wide variety of human neoplasms [81,82]
including hematologic malignancies [83-85]. The PLAC8
gene encodes a cysteine-rich protein of unknown func-
tion which has been suggested to be involved in cell sur-
vival and transformation [69]. It was the top-ranked
cooperation response gene identified by Land and col-
leagues whose perturbation in both murine and human
colon cancer cells inhibited tumor formation in mice [56].
Increased expression of PLAC8 has been reported in
putative cancer stem cells in liver and breast cancer cell
lines [86,87]. More intriguing, the PLAC8 gene was
among the gene signatures predictive of relapse in ALL
patients in two recent studies [88,89]. In particular, in a
study of 50 T-ALL patients, PLAC8 was one of 5 genes
that accurately predicted clinical outcome [89]. The accu-
mulated data thus support the idea that HMGA2 and
PLAC8 may play a central role in the malignant pheno-
type of a broad spectrum of cancers of diverse origins.
Conclusions
Despite the fact that the oncogenic function of TLX1 and
NOTCH1 is well established in T-ALL, the mechanistic
basis of their cooperation remained to be clarified. Our
data suggest that in the process of leukemic transforma-
tion TLX1 enhances NOTCH signaling output and that
both factors contribute to T-ALL cell survival and differ-
entiation arrest. We believe that a search for the common
gates targeted by these cooperating genetic lesions will
help to better understand the nature of the disease and
lead to the development of more effective and less toxic
therapeutic regimens. The TLX1/NOTCH 'cooperation
response genes' listed in Table 1, especially HMGA2 and
PLAC8, represent attractive candidates for further studies
along these lines.
Methods
shRNA knockdown and gene transfer experiments
ALL-SIL cells were cultured as previously described [60].
TLX1 shRNA knockdown analyses were performed as
previously reported [50] with the following modifica-
tions. TLX1 shRNAs were obtained from the MISSION
TRC TLX1 shRNA target set (Cat. No. NM_005521,
Sigma-Aldrich) cloned into the pLKO.1-puro lentiviral
vector backbone [90]: TRCN0000014993
(designated
TLX1 shRNA93) targets sequences within the TLX1 3'
noncoding region and TRCN0000014995
(designated
TLX1 shRNA95) targets the TLX1 coding region. The
pLKO.1-CFP-TLX1 shRNA93, pLKO.1-CFP-TLX1
shRNA95 and pLKO.1-CFP lentiviral vectors were cre-
ated by replacing the puromycin resistance genes in the
corresponding pLKO.1-puro plasmids with the enhanced
cyan fluorescent protein (CFP) gene from the MCIN ret-
roviral vector [91,92]. The resulting pLKO.1-CFP lentivi-
ral vector backbone was also used to generate panTLE
knockdown ALL-SIL cells. The TLE shRNAs were based
on an shRNA (TLE1/4si2) previously shown to efficiently
Page 12
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 13 of 17
knock down TLE1 and TLE4 in human leukemia cells
[47]. The TLE shRNA target sequences were as follows:
shRNA1/4, GGTCTGCTTCTCATGCTGCAG, which
targets sequences in common to both TLE1 and TLE4;
shRNA2, GGTTTGCTTCTCCTGCTGCAG, and
shRNA3, AGTCTGCTTCTCCTGCTGCAG, which tar-
get the corresponding regions in TLE2 and TLE3. Dou-
ble-stranded DNAs including the 21-mer TLE shRNA
sequences [90] were ligated into the AgeI-EcoRI sites of
pLKO.1-CFP. The TLX1 wild-type, and the TLX1 N51A
and TLX1 F19E mutant coding regions were previously
described [49,53]; these were inserted into the MSCV-
GW retroviral vector that coexpresses the enhanced
green fluorescent protein (GFP) gene [93]. MYC retrovi-
ral expression vectors were constructed by cloning the
MYC wild-type and MYC ΔC (amino acids 127-189
deleted) mutant coding regions [67] (provided by Dr. Wil-
liam Tansey, Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY) into the MSCV-RW retroviral vector in
which the GFP gene in MSCV-GW was replaced with the
DsRed-Express2 red fluorescent protein (RFP) gene [94]
(provided by Dr. Benjamin Glick, The University of Chi-
cago, Chicago, IL). A lentiviral vector that coexpresses a
constitutively active form of NOTCH1 encoding the
intracellular domain of the human NOTCH1 receptor
(ICN1; codons 1770-2555) (provided by Dr. Warren Pear,
University of Pennsylvania School of Medicine, Philadel-
phia, PA) [95] and RFP was previously described [49].
Vesicular stomatitis virus (VSV)-G glycoprotein-
pseudotyped lentiviral vector particles were produced by
transiently transfecting the lentiviral vector plasmids (15
μg), the packaging plasmid pCMVΔR8.91 (10 μg) and the
VSV-G protein envelope plasmid pMD.G (5 μg) into sub-
confluent human embryonic kidney 293T cells by the cal-
cium phosphate precipitation method [96], and were
used to transduce ALL-SIL cells as previously described
[50]. Amphotropic retroviral particles were similarly pro-
duced by transiently transfecting 293T cells with retrovi-
ral vector plasmids (10 μg) and the pCL-Ampho
packaging construct (10 μg), and were used to transduce
ALL-SIL cells as previously described [60].
Fluorescence activated cell sorting and analysis
Vector-transduced ALL-SIL cells expressing CFP, GFP
and/or RFP were sorted on a FACSAria instrument (BD
Biosciences) equipped with 407-nm solid state, 488-nm
solid state and 633-nm HeNe lasers [91,92]. Where indi-
cated, the cells were stained with anti-CD1b-Alexa Fluor
647 and anti-CD55-PE monoclonal antibodies prior to
sorting. Other monoclonal antibodies included, anti-
CD4-FITC, anti-CD4-PE, anti-CD8-FITC and anti-CD8-
PE (all purchased from eBioscience). Cell staining was
carried out with saturating concentrations of reagents as
described [97] and flow cytometry data was analyzed
using FACSDiva software (BD Biosciences).
Cell growth assays
ALL-SIL cell populations expressing fluorescent protein
reporters (CFP, GFP or RFP) were mixed in equal propor-
tions and periodically analyzed by flow cytometric moni-
toring. In some experiments, cell growth was measured
using the alamarBlue cell viability and proliferation
reagent (Invitrogen) as previously described [50]. Where
indicated, ALL-SIL cell populations were treated with the
GSI, Compound E, at 500 nM for 24 hours [14] or 2
weeks [11], or with the MYC chemical inhibitor 10058-F4
(both from Calbiochem, EMD Chemicals) at the indi-
cated concentrations as previously described [65,66].
MG132 and cycloheximide were from Sigma-Aldrich.
Mock-treated cultures contained 0.05% dimethylsulfox-
ide (DMSO) as solvent vehicle control.
Quantitative real-time RT-PCR validation and analysis of
genes
Real-time qRT-PCR was performed using the Power
SYBR Green reagent (Applied Biosystems) on an ABI
Prism 7000 Sequence Detection System as previously
described [76,98]. Primers: TLX1 coding (CATCGAC-
CAGATCCTCAACA, CAGCCAAGGCCGTATTCTC);
TLX1 3' noncoding (GTCACTGTCCCTCCTGGTGT,
GCCTGATCGTAAGGTCCAAA); L1TD1 (ACGCCAG-
GGTGACTACAAAC, GCTGTCCATCCTTCTGGG
TA); OR10R2 (CTTTCTGTGGCCAGGACAAT, AAC-
CCATCACACCCAATAGC); HMGA2 (ACTTCAGC-
CCAGGGACAAC, CTTCCCCTGGGTCTCTTAGG);
DTX1 (GCTAATTGTCTTCGGCCAAC, GCTGGCA
TCCCTTTAAATCTT); CD1B (GCTCCTTTTGCTAT-
GCCTTG, TATTGCGAATGGGAGAGGAG); RAG1 (T
GTTTAATGGCTTCCAAGAGC, ACACAGGTCCCCT
GAATCAA); SH3BP5 (GATGCGGTGTTGGTGCTG,
AGAAATGGCATCAGGCTCAG); SLC44A1 (TCAAA
TGCTTGCTATACAATCTGA, CGTAGAACTCTGGA-
TACTCAATGAA); PLAC8 (GGAGAGCCATGCG-
TACTTTC, CAAGCTGAAGAGGTGTCTGCT); GAS1
(CGGAGCTTGACTTCTTGGAC, CGTCCTGAACA
CTGCAGCTA). qRT-PCR controls, MAPK1, PGK1 and
POLR2A, were selected based on the cDNA hybridiza-
tion data and confirmed not to show any changes in
expression under the experimental conditions studied.
Primers: MAPK1 (CCAGATCCTCAGAGGGTTAAAA,
ATCACAGGTGGTGTTGAGCA); POLR2A (AAGATC-
CTTCCTTGCCTGTG, GCTTTGTTCTTCCCGAG-
GAT) and PGK1 (CAGTTTGGAGCTCCTGGAAG, AG
TTGACTTAGGGGCTGTGC). The data were normal-
ized per MAPK1 expression levels.
Western blotting
Western blotting was performed essentially as previously
described [53,60,76,97]. Antibodies were: TLX1(c-18,
sc880), MYC (c-33, sc-42 and N-262, sc-764),
TLE1(M101, sc-9121) and TLE (C-19, sc-13373) from
Page 13
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 14 of 17
Santa Cruz; and anti-Cleaved NOTCH1 (Val1744) from
Cell Signaling.
Microarray gene expression analysis
RNA samples were analyzed with a cDNA microarray
(TIGR 40 K microarray) as previously described [51]. In
brief, total RNA was prepared using Trizol reagent (Invit-
rogen) and the RNeasy mini kit (QIAGEN) as per the
manufacturers' instructions. Expression analysis of ALL-
SIL cells for a particular TLX1 level was derived from
three to four independent GSI and DMSO control treat-
ments. For statistical analysis, a biological replicate
hybridization experiment was defined as an independent
treatment. A hybridization experiment consisted of Cy5-
labeled cDNA that was reverse transcribed from 15 μg of
total RNA and cohybridized with Cy3-labeled cDNA syn-
thesized from an equal amount of the Stratagene Univer-
sal Human Reference RNA, as described [99,100].
Hybridizations were performed for 18-24 hours at 42°C
followed by washing in decreasing concentrations of SSC
at room temperature and spun dry. Microarray platform,
image scanning, fluorescence intensity measurements,
normalization across replicate experiments, experimental
noise determination, cluster analysis and candidate signa-
ture gene identification were performed as previously
described [101-104].
Statistical analysis
Unless noted otherwise, the Student's unpaired t test was
used to compare differences between indicated groups. A
P value < 0.05 was considered significant.
Additional material
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
IR designed the overall study, performed most of the experiments, analyzed
and interpreted data, and wrote the manuscript. TSH performed the FACS and
flow cytometric analyses, and edited the manuscript. TVL performed the cDNA
microarray experiments. NHL contributed to the design of the cDNA microar-
ray experiments, performed statistical analyses of the microarray data, and
edited the manuscript. RGH supervised and contributed to the conception
and design of the overall study, analyzed and interpreted data, and edited the
manuscript. All the authors read and approved the final version of the paper.
Acknowledgements
We gratefully acknowledge Ali Ramezani for consultation and help with the
TLE shRNA lentiviral vector constructions, and we thank Sara Karandish for
technical assistance. This work was supported in part by National Institutes of
Health grants R01HL66305 (RGH), R01HL65519 (RGH) and R01CA120316 (NHL),
and by an Elaine H. Snyder Cancer Research Award and the King Fahd Endow-
ment Fund from The George Washington University Medical Center (RGH).
Author Details
1
Department of Anatomy and Regenerative Biology, The George Washington
University Medical Center, Washington, DC, USA,
2
Flow Cytometry Core Facility,
The George Washington University Medical Center, Washington, DC, USA and
3
Department of Pharmacology and Physiology, The George Washington
University Medical Center, Washington, DC, USA
References
1. Hueber SD, Bezdan D, Henz SR, Blank M, Wu H, Lohmann I: Comparative
analysis of Hox downstream genes in Drosophila. Development 2007,
134:381-392.
2. Hombria JC, Lovegrove B: Beyond homeosis--HOX function in
morphogenesis and organogenesis. Differentiation 2003, 71:461-476.
3. Owens BM, Hawley RG: HOX and non-HOX homeobox genes in leukemic
hematopoiesis. Stem Cells 2002, 20:364-379.
4. Shah N, Sukumar S: The Hox genes and their roles in oncogenesis. Nat
Rev Cancer 2010, 10:361-371.
5. Holland PW, Booth HA, Bruford EA: Classification and nomenclature of
all human homeobox genes. BMC Biol 2007, 5:47.
6. Roberts CW, Shutter JR, Korsmeyer SJ: Hox11 controls the genesis of the
spleen. Nature 1994, 368:747-749.
7. Cheng L, Arata A, Mizuguchi R, Qian Y, Karunaratne A, Gray PA, Arata S,
Shirasawa S, Bouchard M, Luo P, Chen CL, Busslinger M, Goulding M,
Onimaru H, Ma Q: Tlx3 and Tlx1 are post-mitotic selector genes
determining glutamatergic over GABAergic cell fates. Nat Neurosci
2004, 7:510-517.
8. Aifantis I, Raetz E, Buonamici S: Molecular pathogenesis of T-cell
leukaemia and lymphoma. Nat Rev Immunol 2008, 8:380-390.
9. Hawley RG, Fong AZC, Lu M, Hawley TS: The HOX11 homeobox-
containing gene of human leukemia immortalizes murine
hematopoietic precursors. Oncogene 1994, 9:1-12.
10. Hawley RG, Fong AZC, Reis MD, Zhang N, Lu M, Hawley TS: Transforming
function of the HOX11/TCL3 homeobox gene. Cancer Res 1997,
57:337-345.
11. Weng AP, Ferrando AA, Lee W, Morris JP, Silverman LB, Sanchez-Irizarry C,
Blacklow SC, Look AT, Aster JC: Activating mutations of NOTCH1 in
human T cell acute lymphoblastic leukemia. Science 2004, 306:269-271.
12. Aster JC, Pear WS, Blacklow SC: Notch signaling in leukemia. Annu Rev
Pathol 2008, 3:587-613.
Additional file 1 TLX1 target genes derived from cDNA platform
hybridization experiments of ALL-SIL cells with or without GSI treat-
ment. TLX1 targets were selected based on correlations of expression levels
with TLX1 protein levels (r > 0.7 or < -0.7; 1%, 5% or 10% false discovery rate
[FDR]; n = 3-4). The data is organized in 4 spreadsheets: "PositiveCorrel
DMSO control", genes whose expression levels positively correlated with
TLX1 protein levels in untreated ALL-SIL cells; "NegativeCorrel DMSO con-
trol", genes whose expression levels negatively correlated with TLX1 protein
levels in untreated ALL-SIL cells; "PositiveCorrel GSI treated", genes whose
expression levels positively correlated with TLX1 protein levels in GSI-
treated ALL-SIL cells; "NegativeCorrel GSI treated", genes whose expression
levels negatively correlated with TLX1 protein levels in GSI-treated ALL-SIL
cells.
Additional file 2 GSI-responsive genes. The data is organized in 3
spreadsheets: each spreadsheet represents GSI-responsive genes identified
under low ("TLDvsTLG"), medium ("TMDvsTMG") or high ("THDvsTHG") lev-
els of TLX1 expression (1%, 5% or 10% FDR; n = 3-4).
Additional file 3 Genes differentially expressed under conditions
where TLX1 is expressed and NOTCH is activated versus conditions
where TLX1 and NOTCH are both inhibited. The data is organized in 2
spreadsheets: "THDvsTLG", relative expression levels of genes under condi-
tions of high TLX1 levels and treatment with DMSO versus low TLX1 levels
and treatment with GSI; "TMDvsTLG", relative expression levels of genes
under conditions of medium TLX1 levels and treatment with DMSO versus
low TLX1 levels and treatment with GSI.
Additional file 4 P values for qRT-PCR analyses of TLX1/NOTCH-coreg-
ulated genes studied in Figures 1E, 2C and 5C.
Additional file 5 ChIP-on-chip significance analysis of MYC, HES1
and/or NOTCH1 promoter occupancy in TLX3
+
HPB-ALL T-ALL cells for
selected TLX1 target genes. Data are from Margolin et al. (Proc Natl Acad
Sci USA 2009, 106:244-249).
Received: 12 April 2010 Accepted: 9 July 2010
Published: 9 July 2010
This article is available from: http://www.molecular-cancer.com/content/9/1/181
© 2010 Riz et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Molecular Cancer 2010, 9:181
Page 14
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 15 of 17
13. Asnafi V, Buzyn A, Le NS, Baleydier F, Simon A, Beldjord K, Reman O, Witz F,
Fagot T, Tavernier E, Turlure P, Leguay T, Huguet F, Vernant JP, Daniel F,
Bene MC, Ifrah N, Thomas X, Dombret H, Macintyre E: NOTCH1FBXW7
mutation identifies a large subgroup with favorable outcome in adult
T-cell acute lymphoblastic leukemia (T-ALL): a Group for Research on
Adult Acute Lymphoblastic Leukemia (GRAALL) study. Blood 2009,
113:3918-3924.
14. Palomero T, Lim WK, Odom DT, Sulis ML, Real PJ, Margolin A, Barnes KC,
O'Neil J, Neuberg D, Weng AP, Aster JC, Sigaux F, Soulier J, Look AT, Young
RA, Califano A, Ferrando AA: NOTCH1 directly regulates c-MYC and
activates a feed-forward-loop transcriptional network promoting
leukemic cell growth. Proc Natl Acad Sci USA 2006, 103:18261-18266.
15. Weng AP, Millholland JM, Yashiro-Ohtani Y, Arcangeli ML, Lau A, Wai C, Del
BC, Rodriguez CG, Sai H, Tobias J, Li Y, Wolfe MS, Shachaf C, Felsher D,
Blacklow SC, Pear WS, Aster JC: c-Myc is an important direct target of
Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev
2006, 20:2096-2109.
16. Chan SM, Weng AP, Tibshirani R, Aster JC, Utz PJ: Notch signals positively
regulate activity of the mTOR pathway in T-cell acute lymphoblastic
leukemia. Blood 2007, 110:278-286.
17. Palomero T, Sulis ML, Cortina M, Real PJ, Barnes K, Ciofani M, Caparros E,
Buteau J, Brown K, Perkins SL, Bhagat G, Agarwal AM, Basso G, Castillo M,
Nagase S, Cordon-Cardo C, Parsons R, Zuniga-Pflucker JC, Dominguez M,
Ferrando AA: Mutational loss of PTEN induces resistance to NOTCH1
inhibition in T-cell leukemia. Nat Med 2007, 13:1203-1210.
18. Vilimas T, Mascarenhas J, Palomero T, Mandal M, Buonamici S, Meng F,
Thompson B, Spaulding C, Macaroun S, Alegre ML, Kee BL, Ferrando A,
Miele L, Aifantis I: Targeting the NF-κB signaling pathway in Notch1-
induced T-cell leukemia. Nat Med 2007, 13:70-77.
19. Buonamici S, Trimarchi T, Ruocco MG, Reavie L, Cathelin S, Mar BG, Klinakis
A, Lukyanov Y, Tseng JC, Sen F, Gehrie E, Li M, Newcomb E, Zavadil J,
Meruelo D, Lipp M, Ibrahim S, Efstratiadis A, Zagzag D, Bromberg JS,
Dustin ML, Aifantis I: CCR7 signalling as an essential regulator of CNS
infiltration in T-cell leukaemia. Nature 2009, 459:1000-1004.
20. Radtke F, Wilson A, Mancini SJ, MacDonald HR: Notch regulation of
lymphocyte development and function. Nat Immunol 2004, 5:247-253.
21. Maillard I, Fang T, Pear WS: Regulation of lymphoid development
differentiation, and function by the Notch pathway. Annu Rev Immunol
2005, 23:945-974.
22. Staal FJ, Weerkamp F, Langerak AW, Hendriks RW, Clevers HC:
Transcriptional control of T lymphocyte differentiation. Stem Cells 2001,
19:165-179.
23. Carrasco YR, Navarro MN, de Yebenes V, Ramiro AR, Toribio ML:
Regulation of surface expression of the human pre-T cell receptor
complex. Semin Immunol 2002, 14:325-334.
24. Ciofani M, Schmitt TM, Ciofani A, Michie AM, Cuburu N, Aublin A,
Maryanski JL, Zúñiga-Pflücker JC: Obligatory role for cooperative
signaling by pre-TCR and Notch during thymocyte differentiation. J
Immunol 2004, 172:5230-5239.
25. Rothenberg EV: Negotiation of the T lineage fate decision by
transcription-factor interplay and microenvironmental signals.
Immunity 2007, 26:690-702.
26. Maillard I, Tu L, Sambandam A, Yashiro-Ohtani Y, Millholland J, Keeshan K,
Shestova O, Xu L, Bhandoola A, Pear WS: The requirement for Notch
signaling at the β-selection checkpoint in vivo is absolute and
independent of the pre-T cell receptor. J Exp Med 2006, 203:2239-2245.
27. Ciofani M, Zúñiga-Pflücker JC: Notch promotes survival of pre-T cells at
the β-selection checkpoint by regulating cellular metabolism. Nat
Immunol 2005, 6:881-888.
28. Li F, Wang Y, Zeller KI, Potter JJ, Wonsey DR, O'Donnell KA, Kim JW, Yustein
JT, Lee LA, Dang CV: Myc stimulates nuclearly encoded mitochondrial
genes and mitochondrial biogenesis. Mol Cell Biol 2005, 25:6225-6234.
29. Douglas NC, Jacobs H, Bothwell AL, Hayday AC: Defining the specific
physiological requirements for c-Myc in T cell development. Nat
Immunol 2001, 2:307-315.
30. Dose M, Khan I, Guo Z, Kovalovsky D, Krueger A, von BH, Khazaie K,
Gounari F: c-Myc mediates pre-TCR-induced proliferation but not
developmental progression. Blood 2006, 108:2669-2677.
31. Lee MS, Hanspers K, Barker CS, Korn AP, McCune JM: Gene expression
profiles during human CD4
+
T cell differentiation. Int Immunol 2004,
16:1109-1124.
32. Soulier J, Clappier E, Cayuela JM, Regnault A, Garcia-Peydro M, Dombret H,
Baruchel A, Toribio ML, Sigaux F: HOXA genes are included in genetic
and biologic networks defining human acute T-cell leukemia (T-ALL).
Blood 2005, 106:274-286.
33. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC,
Behm FG, Pui CH, Downing JR, Gilliland DG, Lander ES, Golub TR, Look AT:
Gene expression signatures define novel oncogenic pathways in T cell
acute lymphoblastic leukemia. Cancer Cell 2002, 1:75-87.
34. Asnafi V, Beldjord K, Libura M, Villarese P, Millien C, Ballerini P, Kuhlein E,
Lafage-Pochitaloff M, Delabesse E, Bernard O, Macintyre E: Age-related
phenotypic and oncogenic differences in T-acute lymphoblastic
leukemias may reflect thymic atrophy. Blood 2004, 104:4173-4180.
35. Bergeron J, Clappier E, Radford I, Buzyn A, Millien C, Soler G, Ballerini P,
Thomas X, Soulier J, Dombret H, Macintyre EA, Asnafi V: Prognostic and
oncogenic relevance of TLX1/HOX11 expression level in T-ALLs. Blood
2007, 110:2324-2330.
36. van Grotel M, Meijerink JP, van Wering ER, Langerak AW, Beverloo HB,
Buijs-Gladdines JG, Burger NB, Passier M, van Lieshout EM, Kamps WA,
Veerman AJ, van Noesel MM, Pieters R: Prognostic significance of
molecular-cytogenetic abnormalities in pediatric T-ALL is not
explained by immunophenotypic differences. Leukemia 2008,
22:124-131.
37. Bray SJ: Notch signalling: a simple pathway becomes complex. Nat Rev
Mol Cell Biol 2006, 7:678-689.
38. Barolo S, Stone T, Bang AG, Posakony JW: Default repression and Notch
signaling: Hairless acts as an adaptor to recruit the corepressors
Groucho and dCtBP to Suppressor of Hairless. Genes Dev 2002,
16:1964-1976.
39. Oswald F, Kostezka U, Astrahantseff K, Bourteele S, Dillinger K, Zechner U,
Ludwig L, Wilda M, Hameister H, Knochel W, Liptay S, Schmid RM: SHARP
is a novel component of the Notch/RBP-Jκ signalling pathway. EMBO J
2002, 21:5417-5426.
40. Borggrefe T, Oswald F: The Notch signaling pathway: transcriptional
regulation at Notch target genes. Cell Mol Life Sci 2009, 66:1631-1646.
41. Fraga MF, Berdasco M, Ballestar E, Ropero S, Lopez-Nieva P, Lopez-Serra L,
Martin-Subero JI, Calasanz MJ, Lopez dS I, Setien F, Casado S, Fernandez
AF, Siebert R, Stifani S, Esteller M: Epigenetic inactivation of the Groucho
homologue gene TLE1 in hematologic malignancies. Cancer Res 2008,
68:4116-4122.
42. Agrawal S, Archer C, Schaffer DV: Computational models of the Notch
network elucidate mechanisms of context-dependent signaling. PLoS
Comput Biol 2009, 5:e1000390.
43. Grbavec D, Stifani S: Molecular interaction between TLE1 and the
carboxyl-terminal domain of HES-1 containing the WRPW motif.
Biochem Biophys Res Commun 1996, 223:701-705.
44. Hasson P, Paroush Z: Crosstalk between the EGFR and other signalling
pathways at the level of the global transcriptional corepressor
Groucho/TLE. Br J Cancer 2006, 94:771-775.
45. Orian A, Delrow JJ, Rosales Nieves AE, Abed M, Metzger D, Paroush Z,
Eisenman RN, Parkhurst SM: A Myc-Groucho complex integrates EGF
and Notch signaling to regulate neural development. Proc Natl Acad Sci
USA 2007, 104:15771-15776.
46. Buscarlet M, Stifani S: The 'Marx' of Groucho on development and
disease. Trends Cell Biol 2007, 17:353-361.
47. Dayyani F, Wang J, Yeh JR, Ahn EY, Tobey E, Zhang DE, Bernstein ID,
Peterson RT, Sweetser DA: Loss of TLE1 and TLE4 from the del(9q)
commonly deleted region in AML cooperates with AML1-ETO to affect
myeloid cell proliferation and survival. Blood 2008, 111:4338-4347.
48. Smith ST, Jaynes JB: A conserved region of engrailed shared among all
en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins mediates active
transcriptional repression in vivo. Development 1996, 122:3141-3150.
49. Riz I, Lee HJ, Baxter KK, Behnam R, Hawley TS, Hawley RG: Transcriptional
activation by TLX1/HOX11 involves Gro/TLE corepressors. Biochem
Biophys Res Commun 2009, 380:361-365.
50. Riz I, Hawley TS, Johnston H, Hawley RG: Role of TLX1 in T-cell acute
lymphoblastic leukaemia pathogenesis. Br J Haematol 2009,
145:140-143.
51. Teramoto H, Miwa H, Patel V, Letwin N, Castellone MD, Imai N, Shikami M,
Imamura A, Gutkind JS, Nitta M, Lee NH: Gene expression changes in a
patient presenting nonleukaemic nasal granulocytic sarcoma to acute
myelogenous leukaemia using 40 K cDNA microarray. Clin Lab
Haematol 2006, 28:262-266.
Page 15
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 16 of 17
52. Lee JK, Bussey KJ, Gwadry FG, Reinhold W, Riddick G, Pelletier SL,
Nishizuka S, Szakacs G, Annereau JP, Shankavaram U, Lababidi S, Smith LH,
Gottesman MM, Weinstein JN: Comparing cDNA and oligonucleotide
array data: concordance of gene expression across platforms for the
NCI-60 cancer cells. Genome Biol 2003, 4:R82.
53. Owens BM, Zhu YX, Suen TC, Wang PX, Greenblatt JF, Goss PE, Hawley RG:
Specific homeodomain-DNA interactions are required for HOX11-
mediated transformation. Blood 2003, 101:4966-4974.
54. Rice KL, Kees UR, Greene WK: Transcriptional regulation of FHL1 by
TLX1/HOX11 is dosage cell-type and promoter context-dependent.
Biochem Biophys Res Commun 2008, 367:707-713.
55. Greene WK, Bahn S, Masson N, Rabbitts TH: The T-cell oncogenic protein
HOX11 activates Aldh1 expression in NIH 3T3 cells but represses its
expression in mouse spleen development. Mol Cell Biol 1998,
18:7030-7037.
56. McMurray HR, Sampson ER, Compitello G, Kinsey C, Newman L, Smith B,
Chen SR, Klebanov L, Salzman P, Yakovlev A, Land H: Synergistic response
to oncogenic mutations defines gene class critical to cancer
phenotype. Nature 2008, 453:1112-1116.
57. Gupta-Rossi N, Le BO, Gonen H, Brou C, Logeat F, Six E, Ciechanover A,
Israel A: Functional interaction between SEL-10, an F-box protein and
the nuclear form of activated Notch1 receptor. J Biol Chem 2001,
276:34371-34378.
58. Margolin AA, Palomero T, Sumazin P, Califano A, Ferrando AA, Stolovitzky
G: ChIP-on-chip significance analysis reveals large-scale binding and
regulation by human transcription factor oncogenes. Proc Natl Acad Sci
USA 2009, 106:244-249.
59. Dohda T, Maljukova A, Liu L, Heyman M, Grander D, Brodin D, Sangfelt O,
Lendahl U: Notch signaling induces SKP2 expression and promotes
reduction of p27Kip1 in T-cell acute lymphoblastic leukemia cell lines.
Exp Cell Res 2007, 313:3141-3152.
60. Riz I, Hawley RG: G
1
/S transcriptional networks modulated by the
HOX11/TLX1 oncogene of T-cell acute lymphoblastic leukemia.
Oncogene 2005, 24:5561-5575.
61. Zhou X, Benson KF, Ashar HR, Chada K: Mutation responsible for the
mouse pygmy phenotype in the developmentally regulated factor
HMGI-C. Nature 1995, 376:771-774.
62. Zhou X, Benson KF, Przybysz K, Liu J, Hou Y, Cherath L, Chada K: Genomic
structure and expression of the murine Hmgi-cgene. Nucleic Acids Res
1996, 24:4071-4077.
63. Li O, Li J, Droge P: DNA architectural factor and proto-oncogene HMGA2
regulates key developmental genes in pluripotent human embryonic
stem cells. FEBS Lett 2007, 581:3533-3537.
64. Wong DJ, Liu H, Ridky TW, Cassarino D, Segal E, Chang HY: Module map
of stem cell genes guides creation of epithelial cancer stem cells. Cell
Stem Cell 2008, 2:333-344.
65. Gomez-Curet I, Perkins RS, Bennett R, Feidler KL, Dunn SP, Krueger LJ: c-
Myc inhibition negatively impacts lymphoma growth. J Pediatr Surg
2006, 41:207-211.
66. Huang MJ, Cheng YC, Liu CR, Lin S, Liu HE: A small-molecule c-Myc
inhibitor 10058-F4, induces cell-cycle arrest apoptosis, and myeloid
differentiation of human acute myeloid leukemia. Exp Hematol 2006,
34:1480-1489.
67. Tworkowski KA, Salghetti SE, Tansey WP: Stable and unstable pools of
Myc protein exist in human cells. Oncogene 2002, 21:8515-8520.
68. McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD, Cole MD: The
novel ATM-related protein TRRAP is an essential cofactor for the c-Myc
and E2F oncoproteins. Cell 1998, 94:363-374.
69. Rogulski K, Li Y, Rothermund K, Pu L, Watkins S, Yi F, Prochownik EV: Onzin,
a c-Myc-repressed target promotes survival and transformation by
modulating the Akt-Mdm2-p53 pathway. Oncogene 2005,
24:7524-7541.
70. Cox CV, Martin HM, Kearns PR, Virgo P, Evely RS, Blair A: Characterization
of a progenitor cell population in childhood T-cell acute lymphoblastic
leukemia. Blood 2007, 109:674-682.
71. Borgulya P, Kishi H, Uematsu Y, von Boehmer H: Exclusion and inclusion
of α and β T cell receptor alleles. Cell 1992, 69:529-537.
72. Bassing CH, Swat W, Alt FW: The mechanism and regulation of
chromosomal V(D)J recombination. Cell 2002, 109(Suppl):S45-S55.
73. Dear TN, Sanchez-Garcia I, Rabbitts TH: The HOX11 gene encodes a DNA-
binding nuclear transcription factor belonging to a distinct family of
homeobox genes. Proc Natl Acad Sci USA 1993, 90:4431-4435.
74. Masson N, Greene WK, Rabbitts TH: Optimal activation of an
endogenous gene by HOX11 requires the NH
2
-terminal 50 amino
acids. Mol Cell Biol 1998, 18:3502-3508.
75. Hoffmann K, Dixon DN, Greene WK, Ford J, Taplin R, Kees UR: A microarray
model system identifies potential new target genes of the proto-
oncogene HOX11. Genes Chromosomes Cancer 2004, 41:309-320.
76. Riz I, Akimov SS, Eaker SS, Baxter KK, Lee HJ, Mariño-Ramírez L, Landsman
D, Hawley TS, Hawley RG: TLX1/HOX11-induced hematopoietic
differentiation blockade. Oncogene 2007, 26:4115-4123.
77. Muhr J, Andersson E, Persson M, Jessell TM, Ericson J: Groucho-mediated
transcriptional repression establishes progenitor cell pattern and
neuronal fate in the ventral neural tube. Cell 2001, 104:861-873.
78. Nagel S, Venturini L, Przybylski GK, Grabarczyk P, Meyer C, Kaufmann M,
Battmer K, Schmidt CA, Drexler HG, Scherr M, MacLeod RA: NK-like
homeodomain proteins activate NOTCH3-signaling in leukemic T-cells.
BMC Cancer 2009, 9:371.
79. Kleinmann E, Geimer Le Lay AS, Sellars M, Kastner P, Chan S: Ikaros
represses the transcriptional response to Notch signaling in T-cell
development. Mol Cell Biol 2008, 28:7465-7475.
80. Hawley RG, Hawley TS, Cantor AB: TLX1 (HOX11) immortalization of
embryonic stem cell-derived and primary murine hematopoietic
progenitors. Curr Protoc Stem Cell Biol 2008, 7:1F.7.1-1F.7.19.
81. Yu F, Yao H, Zhu P, Zhang X, Pan Q, Gong C, Huang Y, Hu X, Su F,
Lieberman J, Song E: let-7 regulates self renewal and tumorigenicity of
breast cancer cells. Cell 2007, 131:1109-1123.
82. Fedele M, Fusco A: HMGA and cancer. Biochim Biophys Acta 2010,
1799:48-54.
83. Pierantoni GM, Santulli B, Caliendo I, Pentimalli F, Chiappetta G, Zanesi N,
Santoro M, Bulrich F, Fusco A: HMGA2 locus rearrangement in a case of
acute lymphoblastic leukemia. Int J Oncol 2003, 23:363-367.
84. Odero MD, Grand FH, Iqbal S, Ross F, Roman JP, Vizmanos JL, Andrieux J,
Lai JL, Calasanz MJ, Cross NC: Disruption and aberrant expression of
HMGA2 as a consequence of diverse chromosomal translocations in
myeloid malignancies. Leukemia 2005, 19:245-252.
85. Wang GP, Berry CC, Malani N, Leboulch P, Fischer A, Hacein-Bey-Abina S,
Cavazzana-Calvo M, Bushman FD: Dynamics of gene-modified
progenitor cells analyzed by tracking retroviral integration sites in a
human SCID-X1 gene therapy trial. Blood 2010, 115:4356-4366.
86. Haraguchi N, Inoue H, Tanaka F, Mimori K, Utsunomiya T, Sasaki A, Mori M:
Cancer stem cells in human gastrointestinal cancers. Hum Cell 2006,
19:24-29.
87. Sajithlal GB, Rothermund K, Zhang F, Dabbs DJ, Latimer JJ, Grant SG,
Prochownik EV: Permanently blocked stem cells derived from breast
cancer cell lines. Stem Cells 2010, 28:1008-1018.
88. Staal FJ, de Ridder D, Szczepanski T, Schonewille T, van der Linden EC, van
Wering ER, van der Velden V, van Dongen JJ: Genome-wide expression
analysis of paired diagnosis-relapse samples in ALL indicates
involvement of pathways related to DNA replication, cell cycle and
DNA repair, independent of immune phenotype. Leukemia 2010,
24:491-499.
89. Cleaver AL, Beesley AH, Firth MJ, Sturges NC, O'Leary RA, Hunger SP, Baker
DL, Kees UR: Gene-based outcome prediction in multiple cohorts of
pediatric T-cell acute lymphoblastic leukemia: a Children's Oncology
Group study. Mol Cancer 2010, 9:105.
90. Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B,
Eisenhaure TM, Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA,
Stockwell BR, Hacohen N, Hahn WC, Lander ES, Sabatini DM, Root DE: A
lentiviral RNAi library for human and mouse genes applied to an
arrayed viral high-content screen. Cell 2006, 124:1283-1298.
91. Hawley TS, Telford WG, Ramezani A, Hawley RG: Four-color flow
cytometric detection of retrovirally expressed red, yellow, green and
cyan fluorescent proteins. BioTechniques 2001, 30:1028-1034.
92. Hawley TS, Telford WG, Hawley RG: "Rainbow" reporters for multispectral
marking and lineage analysis of hematopoietic stem cells. Stem Cells
2001, 19:118-124.
93. Owens BM, Hawley TS, Spain LM, Kerkel KA, Hawley RG: TLX1/HOX11-
mediated disruption of primary thymocyte differentiation prior to the
CD4
+
CD8
+
double-positive stage. Br J Haematol 2006, 132:216-229.
94. Strack RL, Strongin DE, Bhattacharyya D, Tao W, Berman A, Broxmeyer HE,
Keenan RJ, Glick BS: A noncytotoxic DsRed variant for whole-cell
labeling. Nat Methods 2008, 5:955-957.
Page 16
Riz et al. Molecular Cancer 2010, 9:181
http://www.molecular-cancer.com/content/9/1/181
Page 17 of 17
95. Pui JC, Allman D, Xu L, DeRocco S, Karnell FG, Bakkour S, Lee JY, Kadesch T,
Hardy RR, Aster JC, Pear WS: Notch1 expression in early lymphopoiesis
influences B versus T lineage determination. Immunity 1999,
11:299-308.
96. Ramezani A, Hawley RG: Generation of HIV-1-based lentiviral vector
particles. Curr Protoc Mol Biol 2002, 60:16.22.1-16.22.15.
97. Akimov SS, Ramezani A, Hawley TS, Hawley RG: Bypass of senescence,
immortalization and transformation of human hematopoietic
progenitor cells. Stem Cells 2005, 23:1423-1433.
98. Krasnoselskaya-Riz I, Spruill A, Chen YW, Schuster D, Teslovich T, Baker C,
Kumar A, Stephan DA: Nuclear factor 90 mediates activation of the
cellular antiviral expression cascade. AIDS Res Hum Retroviruses 2002,
18:591-604.
99. Teramoto H, Malek RL, Behbahani B, Castellone MD, Lee NH, Gutkind JS:
Identification of H-Ras, RhoA, Rac1 and Cdc42 responsive genes.
Oncogene 2003, 22:2689-2697.
100. Hu VW, Nguyen A, Kim KS, Steinberg ME, Sarachana T, Scully MA, Soldin SJ,
Luu T, Lee NH: Gene expression profiling of lymphoblasts from autistic
and nonaffected sib pairs: altered pathways in neuronal development
and steroid biosynthesis. PLoS One 2009, 4:e5775.
101. Teramoto H, Castellone MD, Malek RL, Letwin N, Frank B, Gutkind JS, Lee
NH: Autocrine activation of an osteopontin-CD44-Rac pathway
enhances invasion and transformation by H-RasV12. Oncogene 2005,
24:489-501.
102. Letwin NE, Kafkafi N, Benjamini Y, Mayo C, Frank BC, Luu T, Lee NH, Elmer
GI: Combined application of behavior genetics and microarray analysis
to identify regional expression themes and gene-behavior
associations. J Neurosci 2006, 26:5277-5287.
103. Goutsias J, Lee NH: Computational and experimental approaches for
modeling gene regulatory networks. Curr Pharm Des 2007,
13:1415-1436.
104. Tapocik JD, Letwin N, Mayo CL, Frank B, Luu T, Achinike O, House C,
Williams R, Elmer GI, Lee NH: Identification of candidate genes and gene
networks specifically associated with analgesic tolerance to morphine.
J Neurosci 2009, 29:5295-5307.
doi: 10.1186/1476-4598-9-181
Cite this article as: Riz et al., TLX1 and NOTCH coregulate transcription in T
cell acute lymphoblastic leukemia cells Molecular Cancer 2010, 9:181
Page 17
    • "Consequently, the effects of Dicer1 knockdown on analgesic tolerance were investigated. Lentiviral production and shRNA vector construction were performed as previously described (Riz et al., 2010) with the following modifications. shRNA design was accomplished using a selection program available at http://jura.wi.mit.edu/bioc/siRNAext/. "
    [Show abstract] [Hide abstract] ABSTRACT: Long-term opioid treatment results in reduced therapeutic efficacy and in turn leads to an increase in the dose required to produce equivalent pain relief and alleviate break-through or insurmountable pain. Altered gene expression is a likely means for inducing long-term neuroadaptations responsible for tolerance. Studies conducted by our laboratory (Tapocik et al., 2009) revealed a network of gene expression changes occurring in canonical pathways involved in neuroplasticity, and uncovered miRNA processing as a potential mechanism. In particular, the mRNA coding the protein responsible for processing miRNAs, Dicer1, was positively correlated with the development of analgesic tolerance. The purpose of the present study was to test the hypothesis that miRNAs play a significant role in the development of analgesic tolerance as measured by thermal nociception. Dicer1 knockdown, miRNA profiling, bioinformatics, and confirmation of high value targets were used to test the proposition. Regionally targeted Dicer1 knockdown (via shRNA) had the anticipated consequence of eliminating the development of tolerance in C57BL/6J (B6) mice, thus supporting the involvement of miRNAs in the development of tolerance. MiRNA expression profiling identified a core set of chronic morphine-regulated miRNAs (miR's 27a, 9, 483, 505, 146b, 202). Bioinformatics approaches were implemented to identify and prioritize their predicted target mRNAs. We focused our attention on miR27a and its predicted target serpin peptidase inhibitor clade I (Serpini1) mRNA, a transcript known to be intricately involved in dendritic spine density regulation in a manner consistent with chronic morphine's consequences and previously found to be correlated with the development of analgesic tolerance. In vitro reporter assay confirmed the targeting of the Serpini1 3′-untranslated region by miR27a. Interestingly miR27a was found to positively regulate Serpini1 mRNA and protein levels in multiple neuronal cell lines. Lastly, Serpini1 knockout mice developed analgesic tolerance at a slower rate than wild-type mice thus confirming a role for the protein in analgesic tolerance. Overall, these results provide evidence to support a specific role for miR27a and Serpini1 in the behavioral response to chronic opioid administration (COA) and suggest that miRNA expression and mRNA targeting may underlie the neuroadaptations that mediate tolerance to the analgesic effects of morphine.
    Full-text · Article · Mar 2016 · Frontiers in Molecular Neuroscience
    • "In the present case, an additional chromosomal translocation t(10;14)(q24;q11), known as sole abnormality in 10% of T-ALL patients, was identified. Also it is present in 5% of pediatric and 30% of adult T-ALL [20, 30, 31]. The TLX1 gene at 10q24 is a transcription factor becoming overexpressed as oncogene due to its juxtaposition to a strong promoter and enhancer elements of the TCR loci at 14q11 [ to be associated with the t(10;14) or TLX1 gene overexpression [5, 20, 35]. "
    [Show abstract] [Hide abstract] ABSTRACT: Acute leukemia often presents with pure chromosomal resolution; thus, aberrations may not be detected by banding cytogenetics. Here, a case of 26-year-old male diagnosed with T-cell acute lymphoblastic leukemia (T-ALL) and a normal karyotype after standard GTG-banding was studied retrospectively in detail by molecular cytogenetic and molecular approaches. Besides fluorescence in situ hybridization (FISH), multiplex ligation-dependent probe amplification (MLPA) and high resolution array-comparative genomic hybridization (aCGH) were applied. Thus, cryptic chromosomal aberrations not observed before were detected: three chromosomes were involved in a cytogenetically balanced occurring translocation t(2;9;18)(p23.2;p21.3;q21.33). Besides a translocation t(10;14)(q24;q11) was identified, an aberration known to be common in T-ALL. Due to the three-way translocation deletion of tumor suppressor genes CDKN2A/INK4A/p16, CDKN2B/INK4B/p15, and MTAP/ARF/p14 in 9p21.3 took place. Additionally RB1 in 13q14 was deleted. This patient, considered to have a normal karyotype after low resolution banding cytogenetics, was treated according to general protocol of anticancer therapy (ALL-BFM 95).
    Full-text · Article · Oct 2014
    • "Silencing of the Eα enhancer in TLX1 + T-ALL cells was associated with increased concentration of H3K27me3, a marker of repressive chromatin, across the TCRα locus [92]. Along these lines, we found that TLX1 interacts with Gro/TLE corepressors [91] and that shRNAmediated knockdown of TLE transcripts in ALL-SIL cells also released the DP differentiation block [54]. As Gro/TLE corepressors facilitate transcriptional silencing via a mechanism that involves in H3K27 methylation [100], it is tempting to speculate that TLX1 recruitment of Gro/TLE family members to the Eα enhancer also contributes to the early cortical DP differentiation block in TLX1 + T-ALL cases. "
    [Show abstract] [Hide abstract] ABSTRACT: Introduction: Inappropriate activation of the TLX1 (T-cell leukemia homeobox 1) gene by chromosomal translocation is a recurrent event in human T-cell Acute Lymphoblastic Leukemia (T-ALL). Ectopic expression of TLX1 in murine bone marrow progenitor cells using a conventional retroviral vector efficiently yields immortalized cell lines and induces T-ALL-like tumors in mice after long latency. Methods: To eliminate a potential contribution of retroviral insertional mutagenesis to TLX1 immortalizing and transforming function, we incorporated the TLX1 gene into an insulated self-inactivating retroviral vector. Results: Retrovirally transduced TLX1-expressing murine bone marrow progenitor cells had a growth/survival advantage and readily gave rise to immortalized cell lines. Extensive characterization of 15 newly established cell lines failed to reveal a common retroviral integration site. This comprehensive analysis greatly extends our previous study involving a limited number of cell lines, providing additional support for the view that constitutive TLX1 expression is sufficient to initiate the series of events culminating in hematopoietic progenitor cell immortalization. When TLX1-immortalized cells were co-cultured on OP9-DL1 monolayers under conditions permissive for T-cell differentiation, a latent T-lineage potential was revealed. However, the cells were unable to transit the DN2 myeloid-T (DN2mt)-DN2 T-lineage determined (DN2t) commitment step. The differentiation block coincided with failure to upregulate the zinc finger transcription factor gene Bcl11b, the human ortholog of which was shown to be a direct transcriptional target of TLX1 downregulated in the TLX1(+) T-ALL cell line ALL-SIL. Other studies have described the ability of TLX1 to promote bypass of mitotic checkpoint arrest, leading to aneuploidy. We likewise found that diploid TLX1-expressing DN2mt cells treated with the mitotic inhibitor paclitaxel bypassed the mitotic checkpoint and displayed chromosomal instability. This was associated with elevated expression of TLX1 transcriptional targets involved in DNA replication and mitosis, including Ccna2 (cyclin A2), Ccnb1 (cyclin B1), Ccnb2 (cyclin B2) and Top2a (topoisomerase IIα). Notably, enforced expression of BCL11B in ALL-SIL T-ALL cells conferred resistance to the topoisomerase IIα poison etoposide. Conclusion: Taken together with previous findings, the data reinforce a mechanism of TLX1 oncogenic activity linked to chromosomal instability resulting from dysregulated expression of target genes involved in mitotic processes. We speculate that repression of BCL11B expression may provide part of the explanation for the observation that aneuploid DNA content in TLX1(+) leukemic T cells does not necessarily portend an unfavorable prognosis. This TLX1 hematopoietic progenitor cell immortalization/T-cell differentiation assay should help further our understanding of the mechanisms of TLX1-mediated evolution to malignancy and has the potential to be a useful predictor of disease response to novel therapeutic agents in TLX1(+) T-ALL.
    Full-text · Article · Feb 2013
Show more

Similar publications

Discover more