Content uploaded by Sung-Kee Chung
Author content
All content in this area was uploaded by Sung-Kee Chung on Jan 05, 2016
Content may be subject to copyright.
Elimination of a Hydroxyl Group in FTY720 Dramatically
Improves the Phosphorylation Rate
Eve Jary, Thomas Bee, Scott R. Walker, Sung-Kee Chung, Kyung-Chang Seo,
Jonathan C. Morris, and Anthony S. Don
Lowy Cancer Research Centre and Prince of Wales Clinical School, Faculty of Medicine (E.J., T.B., A.S.D.), and Department of
Chemistry (S.R.W., J.C.M.), University of New South Wales, Sydney, Australia; and Department of Chemistry, Pohang
University of Science & Technology, Pohang, Korea (S.K.C., K.C.S.)
Received March 18, 2010; accepted July 7, 2010
ABSTRACT
The new immunosuppressant FTY720 (fingolimod), an analog
of the endogenous lipid sphingosine, induces transient
lymphopenia through the sequestration of lymphocytes in sec-
ondary lymphoid organs. Phosphorylation of FTY720 by sphin-
gosine kinase 2 (SphK2) yields the active metabolite FTY720-
phosphate (FTY-P), which induces lymphopenia through
agonism of the sphingosine 1-phosphate receptor S1P
1
on
endothelial cells and lymphocytes. Dephosphorylation of circu-
lating FTY-P creates an equilibrium between FTY720 and its
phosphate, and results with human patients indicate that phos-
phorylation of FTY720 could be rate limiting for efficacy. We
report that the FTY720 derivative 2-amino-4-(4-heptyloxyphe-
nyl)-2-methylbutanol [AAL(R)] is phosphorylated much more
rapidly than FTY720 in cultured human cells and whole blood.
The K
cat
for AAL(R) with recombinant SphK2 is 8-fold higher
than for FTY720, whereas the K
m
for the two substrates is very
similar, indicating that the increased rate of phosphorylation
results from faster turnover by SphK2 rather than a higher
binding affinity. Consequently, treating cells with AAL(R), but
not FTY720, triggers an apoptotic pathway that is dependent
on excessive intracellular accumulation of long-chain base
phosphates. In agreement with the in vitro results, phosphory-
lation of AAL(R) is more complete than that of FTY720 in vivo
(mice), and AAL(R) is a more potent inducer of lymphopenia.
These differences may be magnified in humans, because phos-
phorylation of FTY720 is much less efficient in humans com-
pared with rodents. Our results suggest that AAL(R) is a better
tool than FTY720 for in vivo studies with S1P analogs and
would probably be a more effective immunosuppressant than
FTY720.
Introduction
FTY720 (fingolimod) is a new type of immunosuppressant
that induces a transient, reversible lymphopenia by trapping
lymphocytes in the secondary lymphoid organs and thereby
keeping them out of the circulation. This mode of immuno-
suppression is unique among pharmacological immunosup-
pressants and has made FTY720 the subject of intense inter-
est, from both a therapeutic and a mechanistic/physiological
perspective. Lymphopenia induced by FTY720 is dependent
on the phosphorylation of the compound by sphingosine ki-
nase 2 (SphK2) (Billich et al., 2003; Zemann et al., 2006). The
phosphorylated compound acts as an agonist at four of the
five sphingosine 1-phosphate (S1P) receptors, a family of
G-protein-coupled receptors that respond to extracellular
S1P (Brinkmann et al., 2002; Mandala et al., 2002). Activa-
tion (agonism) of the S1P
1
receptor is responsible for seques-
tration of T cells in the peripheral lymphoid organs, demon-
strated with the observations that a range of S1P
1
-selective
agonists can induce lymphopenia, that this is reversible with
an S1P
1
antagonist, and that S1P
1
-deficient lymphocytes are
resistant to the effects of FTY720 (Matloubian et al., 2004;
Pan et al., 2006; Sanna et al., 2006). Two models have been
put forward to explain exactly how S1P
1
agonists induce
lymphopenia (Brinkmann, 2007; Rosen et al., 2008): in one
model activation of S1P
1
receptors on endothelial cells ex-
This project was supported by the Cancer Institute New South Wales
[Grant 08/ECF/1-03]; the Australian Research Council [Grant DP0770653];
and the National Health and Medical Research Council, Australia [Fellowship
300606]. Work at POSTECH, Korea, was supported by the BK21 program and
the Korea Science and Engineering Foundation BT-Glycobiology Program
[Grant 200402087].
Article, publication date, and citation information can be found at
http://molpharm.aspetjournals.org.
doi:10.1124/mol.110.064873.
ABBREVIATIONS: FTY720, fingolimod; SphK, sphingosine kinase; S1P, sphingosine 1-phosphate; FTY-P, FTY720-phosphate; AAL(R), (R)-2-
amino-4-(4-heptyloxyphenyl)-2-methylbutanol; AAL(S), (S)-2-amino-4-(4-heptyloxyphenyl)-2-methylbutanol; AAL-P, phosphorylated (R)-2-amino-
4-(4-heptyloxyphenyl)-2-methylbutanol; dhSph, dihydrosphingosine; FBS, fetal bovine serum; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra
zolium; PI, propidium iodide; PCR, polymerase chain reaction; siRNA, small interfering RNA; LC, liquid chromatography; TLC, thin-layer
chromatography; HMEC, human microvascular endothelial cell.
0026-895X/10/7804-685–692$20.00
MOLECULAR PHARMACOLOGY Vol. 78, No. 4
Copyright © 2010 The American Society for Pharmacology and Experimental Therapeutics 64873/3624060
Mol Pharmacol 78:685–692, 2010 Printed in U.S.A.
685
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
posed to the blood or lymph results in the closure of endothe-
lial gates through which lymphocytes exit the lymph nodes;
the other model invokes lymphocyte migration from the low
S1P environment of the lymph nodes toward the higher S1P
concentration of the blood or lymph, requiring stimulation of
their S1P
1
receptors. In a simple interpretation of this model,
the presence of FTY720-phosphate (FTY-P) in lymph nodes
disrupts this gradient. However, another interpretation is
derived from the observation that FTY-P acts as a superago-
nist of S1P
1
, promoting internalization and degradation of
the receptor. This impairs the ability of lymphocytes to re-
spond to the proposed S1P gradient (Gonzalez-Cabrera et al.,
2007; Oo et al., 2007).
S1P receptor modulating compounds such as FTY-P have
found application in a wide variety of experimental settings,
which include immunosuppression during organ transplant
(Pan et al., 2006; Brinkmann, 2007), treatment of autoim-
mune conditions (Fujino et al., 2003; Maki et al., 2005),
recovery after ischemia/reperfusion injury (Hofmann et al.,
2009), and as a means of increasing endothelial barrier func-
tion (Sanna et al., 2006). In the clinic, there have been trials
of FTY720 in patients undergoing kidney transplant and
patients with multiple sclerosis (Brinkmann, 2007). The tri-
als in patients undergoing transplant failed to show any
improvement in efficacy over the current standard of care,
but the compound has showed great promise in phase III
trials in patients with relapsing-remitting multiple sclerosis
(Cohen et al., 2010; Kappos et al., 2010). Fewer relapses were
reported with FTY720 than with the current treatment, in-
tramuscular interferon

(Cohen et al., 2010).
The FTY720 analog AAL(R) has been used in a number of
studies, because its chiral enantiomer AAL(S) is not a sub-
strate for SphK2 and therefore acts as a useful control for
effects of the compound that are not attributed to its phos-
phorylation (Kiuchi et al., 2000; Brinkmann et al., 2002; Don
et al., 2007). Because FTY720 and AAL(R) are very similar
compounds, they have been used interchangeably. In this
study, we showed that AAL(R) is a much better substrate for
SphK2 than FTY720, which translates into a faster rate of
phosphorylation by cultured cells and in whole blood and
almost complete phosphorylation in living mice. Phosphory-
lation of FTY720 occurs much more rapidly in rodent than in
human blood, suggesting that AAL(R) would prove signifi-
cantly more effective than FTY720 as a sphingosine 1-phos-
phate receptor agonist in humans.
Materials and Methods
Materials. FTY720 was purchased from Millipore Bioscience Re-
search Reagents (Temecula, CA), whereas AAL(R) was a gift from
Professor Hugh Rosen (The Scripps Research Institute, La Jolla,
CA). AAL-P to use as a standard for mass spectrometry was prepared
by chemical phosphorylation: The amino group of AAL was protected
(Boc
2
O, NaHCO
3
, 56%), then reaction with N,N-diisopropyl phos-
phoramidite dichloride and 5-ethylthio-1H-tetrazole, followed by ox-
idation with hydrogen peroxide, gave protected AAL-P in 19% yield.
The compound was deprotected with trifluoroacetic acid. Dihy-
drosphingosine (dhSph) was purchased from Avanti Polar Lipids
(Alabaster, AL). Synthesis of 3-deoxy-dhSph has been reported pre-
viously (Lim et al., 2004).
Cell Culture and Viability Assays. Jurkat cells and primary
splenocytes were cultured in RPMI 1640 medium supplemented with
10% fetal bovine serum (FBS), 2 mM L-glutamine, and penicillin/
streptomycin solution. The human microvascular endothelial cell
line HMEC-1 (Ades et al., 1992) was cultured in MCDB131 medium
(Invitrogen) supplemented with 10% FBS, glutamine, and antibiot-
ics. Rat splenocytes were isolated by crushing the spleen between
frosted glass slides and filtering through a 70
M filter, followed by
two rounds of red cell lysis in 0.17 M NH
4
Cl, 10 mM NaHCO
3
, and
0.1 mM EDTA for 5 min on ice. Isolated splenocytes were resus-
pended at a density of 1.5 ⫻10
6
viable cells/ml in complete RPMI
medium, cultured in the presence of AAL(R), AAL(S), or FTY720 for
20 h, then stained with propidium iodide (PI) for flow cytometry. For
MTT assays, cells were cultured in 96-well plates, using 0.1 ml of
medium per well. Ten microliters of 0.5% (w/v) MTT reagent (Sigma,
St. Louis, MO) in PBS was added to each well, and cells were
returned to the incubator for 2 h. MTT was solubilized by adding 0.1
ml of 10% SDS/10 mM HCl to each well and shaking overnight, and
absorbance was read at 650 nM. Alternatively, viability was assessed
by flow cytometry: cells were resuspended in 100
lof20mM
HEPES, pH 7.4, 150 mM NaCl, and 2.5 mM CaCl
2
and incubated for
15 min on ice with 2
l of Annexin V-allophycocyanin and 1
g/ml PI,
then subjected to flow cytometry.
siRNA Treatment of HeLa Cells and Real-Time Quantita-
tive PCR. Cells were transfected in six-well plates, in 2 ml of
OptiMEM I medium, using siRNA molecules purchased from
QIAGEN at a final concentration of 100 nM. siRNAs were premixed
in 200
l of OptiMEM with 4
l of lipofectamine 2000 (Invitrogen) for
30 min, then added to the cells for 6 h, after which the medium was
replaced with standard growth medium. On the day after transfec-
tion, the cells were detached and reseeded into a 96-well plate at a
density of 10
4
cells/well for MTT assay. Cells were treated with
FTY720 or AAL(R) at 48 h after transfection, and viability was
assayed with MTT reagent at 72 h after transfection. Real-time PCR
was used to measure transcript levels, using the following primers
taken from PrimerBank (Spandidos et al., 2010): SphK1: fwd, AG-
GCTGAAATCTCCTTCACGC; rev, GTCTCCAGACATGACCAC-
CAG; SphK2: fwd: GCTGCTGCGCCTTTTCTTG; rev, CCTGTAGCG-
GCCCATACTC; and glyceraldehyde 3-phosphate dehydrogenase:
fwd, TGTTGCCATCAATGACCCCTT; rev, CTCCACGACGTACT-
CAGCG. RNA was prepared with an RNEasy Mini Kit (QIAGEN);
cDNA was prepared with Moloney murine leukemia virus reverse
transcriptase (Invitrogen); and a SYBR Green with ROX Kit (Invitro-
gen) was used for quantitative PCR, on an Mx3000 cycler (Strata-
gene, La Jolla, CA).
Assays of Compound Phosphorylation In Vitro. Jurkat cells
were cultured for2hinmedium containing 5
M FTY720 or AAL(R),
in triplicate, at a density of 4 ⫻10
5
cells/ml. The cells were then
pelleted and resuspended at the same density in fresh medium.
Samples (0.4 ml) were removed from the culture at the times indi-
cated in Fig. 3, snap-frozen, and stored at ⫺80°C. Samples were
extracted with ethyl acetate/isopropanol (Bielawski et al., 2006). In
total, the culture medium was extracted four times with ethyl ace-
tate/isopropanol, twice under acidic conditions. The four organic
extracts were combined, dried under vacuum, and resuspended in
100
l of 80% methanol/20% water (mobile phase for LC). Lipids
were quantified by LC-tandem mass spectrometry, using a C8 col-
umn coupled to a Thermo Quantum TSQ mass spectrometer
(Thermo Fisher Scientific, Waltham, MA) operating in positive ion
multiple reaction monitoring mode. The compounds were separated
with a gradient of 80% methanol/20% water increasing to 85.5%
methanol over 5 min. Precursor and product ion m/zvalues were as
follows: FTY720, 308.3 and 255.1; FTY720-P, 388.0 and 255.1;
AAL(R), 394.0 and 161.1; AAL-P, 374.1 and 161.1.
To assay phosphorylation of compounds in whole blood, human or
rat blood was collected into heparin-coated tubes, then mixed 1:1
with RPMI 1640 medium. One nanomole of FTY720 or AAL(R) was
added directly to 250
l of blood/RPMI 1640 mix and incubated at
35°C for the indicated times. Reactions were stopped with the addi-
tion of 1 ml of ice-cold methanol, and the mixture was cleared by
centrifuging at 21,000gfor 15 min. The insoluble pellets were re-
686 Jary et al.
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
extracted by sonicating in 1 ml of methanol. The supernatants from
both steps were combined in 4 ml of glass tubes, dried down in a
SpeedVac SC210 (Thermo Fisher Scientific), and the extracts were
resuspended in 200
l of 80% methanol/20% water (LC mobile
phase). Extraction efficiency was determined by spiking blood with
compounds, then immediately extracting.
Sphingosine Kinase Assays. The radioactive kinase assays
were based on published methods (Olivera et al., 2000; Siow and
Wattenberg, 2007). Kinase assays were set up in 50 mM Tris, pH 7.4,
150 mM NaCl, 10 mM MgCl
2
, 1 mM DTT, 2 mM ATP, 0.1% fatty
acid-free BSA, and 5
Ci/reaction radiolabeled [
32
P]ATP (PerkinElmer
Life and Analytical Sciences). Reactions (0.1 ml) were started with
the addition of recombinant human SphK2, produced in insect cells
(BIOMOL Research Laboratories, Plymouth Meeting, PA). The final
enzyme concentrations were 0.2
g/ml for dhSph and 3-deoxy-dhSph
and 1
g/ml for AAL(R) and FTY720. Reactions were run for 30 min
at 35°C for dhSph, 3-deoxy-dhSph, and AAL(R) and for 150 min for
FTY720. Note that the different enzyme concentrations and times
were used to ensure that enzyme, and not available substrate, was
rate limiting. Reactions were stopped with the addition of 350
lof
methanol/HCl (150:1), followed by 250
l of 2M KCl, and 350
lof
chloroform. Tubes were vortexed, then spun in a refrigerated Mi-
crofuge (Beckman Coulter, Fullerton, CA) at 14,000 rpm to resolve
the phases. The upper aqueous phase was discarded, and 4
lofthe
(lower) organic phase was spotted onto Silica Gel 60 TLC plates
(Fluka, Buchs, Switzerland). TLC plates were resolved in butanol/
acetic acid/water (3:1:1), then exposed to Fuji Imaging Plates and
imaged by filmless autoradiographic analysis with a Fuji FLA7000
(Fujifilm, Tokyo, Japan). The concentration of product in each spot
was derived from a standard curve constructed with the [
32
P]ATP
reaction mix.
Lipid Phosphatase Assay. To prepare radiolabeled FTY-P and
AAL-P, solutions of 50
M FTY720 or AAL(R) were phosphorylated
in kinase assay buffer containing 10
Ci/400
l of reaction [
32
P]ATP,
for4hat35°C, using 3.75
g/ml (for FTY720) or 0.75
g/ml [for
AAL(R)] recombinant SphK2. Reactions were stopped and extracted
with addition of 400
l of methanol, 40
l of 3 M NaOH, and 400
l
of chloroform. Tubes were vortexed, phases were separated by cen-
trifugation, and the upper aqueous phase, containing the radiola-
beled phosphates, was transferred to a new tube. This aqueous
extract was re-extracted by adding 80
l of concentrated HCl and 400
l of chloroform, this time discarding the aqueous phase and retain-
ing the lower organic phase. This method effectively separates the
sphingoid bases from their phosphates (Maceyka et al., 2007). The
organic extract was dried down and resuspended in 400
lof50mM
Tris, pH 7.4, 150 mM NaCl, and 0.1% fatty acid free BSA, and the
concentration of the radiolabeled phosphate was measured by resolv-
ing the resuspended compound on TLC and quantification of FTY-P
or AAL-P spots by filmless autoradiographic analysis.
To assay dephosphorylation, HMEC-1 cells were seeded in a 24-
well plate at a density of 2 ⫻10
5
cells/well. On the following day, the
medium was replaced with 0.3 ml of fresh growth medium containing
100 nM radiolabeled FTY-P or AAL-P. Samples (2.5
l) were re-
moved at indicated times and spotted onto a TLC plate, then resolved
and imaged as described above.
In Vivo Measurement of Compounds and Circulating Lym-
phocytes. AAL(R) or FTY720 were administered by intraperitoneal
injection, in 0.1 ml of sterile water, to groups of four C57BL6 mice
(per treatment). Mice were euthanized, and blood was drawn by
cardiac puncture 18 h after dosing. A 0.1-ml aliquot of blood from
each mouse receiving 0.3 mg/kg AAL(R) or FTY720 was immediately
mixed with 0.4 ml of ice-cold methanol, and the samples were pro-
cessed for mass spectrometry as described above. To assay the pro-
portion of T cells in the blood, 0.3-ml blood samples were first
subjected to three rounds of red cell lysis (each 5 min at room
temperature) in 0.17 M NH
4
Cl, 10 mM NaHCO
3
, and 0.1 mM EDTA.
The resulting leukocytes were then incubated for 30 min with a 1:100
dilution of both anti-mouse CD4-PE and anti-mouse CD8-eFluor450
(eBioscience, San Diego, CA) in PBS/2% FBS. Cells were washed,
then fixed for 10 min at room temperature with 1% paraformalde-
hyde in PBS, washed once more, and analyzed the following day
using a FACSCanto II flow cytometer (BD Biosciences, San Jose, CA)
and FlowJo software (TreeStar Inc., Ashland, OR). Total T cells
shown are the sum of CD4- and CD8-positive cells. These experi-
ments were approved by the Animal Care and Ethics Committee of
the University of New South Wales.
Results
AAL(R) but Not FTY720 Treatment Triggers SphK2-
Dependent Cell Death. We have shown previously that
phosphorylation of AAL(R) by SphK2 is required for this
compound to induce a loss of viability in cultured murine
splenocytes, based on two observations: first, AAL(R) was
much more efficient than its nonphosphorylatable enantio-
mer, AAL(S), at inducing loss of viability; second, splenocytes
derived from SphK2 knockout mice were resistant to AAL(R)
(Don et al., 2007). These findings led us to propose that a
specific apoptotic response is triggered by excessive intracel-
lular accumulation of AAL-P. To our surprise, we have found
Fig. 1. AAL(R) but not FTY720 triggers a SphK2-dependent apoptosis
pathway in lymphocytes. A, viability of mouse splenocytes incubated for
24 h with FTY720 (ⴛ), AAL(R) (f), or AAL(S) (E) was assessed by PI
exclusion. Proportion of viable cells was normalized relative to vehicle-
treated. B, viability of Jurkat cells treated for 24 h with FTY720 (ⴛ),
AAL(R) (f), or AAL(S) (E) was assessed by annexin V/PI staining. Non-
viable cells are those that were positive for annexin V, PI, or both. C, MTT
assay was used to asses viability of Jurkat cells (closed symbols) or the
SphK2-deficient Jurkat derivative cell line SBR1 (open symbols) (Don et
al., 2007), after a 20-h treatment with FTY720 (circles) or AAL(R)
(squares). D, Jurkat or SBR1 cells were treated for 24 h with 0 or 8
M
AAL(R) or FTY720. Viability was assessed by annexin V/PI staining. All
results shown are the combined results of three separate experiments,
each consisting of triplicate treatments (i.e., n⫽9 per data point).
Two-way analysis of variance with Bonferroni post test was used to
determine the statistical significance of differences between AAL(R) and
both FTY720 and AAL(S) (in A and B) and between AAL(R)-treated
Jurkat and SBR1 cells (in C and D); ⴱ,P⬍0.05; ⴱⴱ,P⬍0.01; ⴱⴱⴱ,P⬍
0.0001.
Deoxy FTY720 Derivative Is Much More Rapidly Phosphorylated 687
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
that FTY720 is much less potent than AAL(R), and equipo-
tent with AAL(S), at inducing loss of viability in cultured
mouse splenocytes (Fig. 1A). FTY720 was also less efficient
than AAL(R) at inducing apoptosis in the Jurkat T-lympho-
blast cell line, at concentrations below 10
M (Fig. 1, B and
C). As observed previously (Don et al., 2007), the SphK2-
deficient Jurkat cell line SBR1 was resistant to apoptosis
induced with AAL(R). However, these cells were not resistant
to FTY720 (Fig. 1, C and D). These results indicated that a
SphK2-dependent apoptotic pathway is triggered by treating
cells with AAL(R), but not FTY720. At higher concentrations,
apoptosis induced with AAL(R) becomes SphK2-indepen-
dent, suggesting activation of a second apoptotic pathway,
which is the same as that triggered by treating cells with
FTY720 or AAL(S). Similar results were seen in HeLa cells
pretreated with siRNA to SphK2, then treated for 24 h with
AAL(R) or FTY720 (Fig. 2). As a potential explanation for
why AAL(R) but not FTY720 triggers a SphK2-dependent
apoptotic response, we investigated whether AAL-P accumu-
lates inside cells to a greater extent than FTY-P.
AAL(R) Is More Rapidly Phosphorylated than
FTY720. We found that AAL(R) is phosphorylated much
more rapidly than FTY720 by cultured Jurkat cells, using
LC-tandem mass spectrometry (Fig. 3A). We therefore com-
pared the phosphorylation rate for these compounds in whole
blood, which is rich in sphingosine kinase 2 activity (Billich
et al., 2003). The rate of phosphorylation in human blood was
8.9-fold faster with AAL(R) than with FTY720 as substrate
(Fig. 3B and Table 1). Both compounds were phosphorylated
much more rapidly in rat blood, compared with human blood:
the rate of phosphorylation was 35-fold higher for FTY720
and 27-fold higher for AAL(R), in rat versus human blood.
The more rapid conversion of FTY720 by mouse or rat blood,
compared with human blood, has been reported previously,
although without quantification of the difference in rate (Bil-
lich et al., 2003). The difference was attributed to the higher
SphK2 activity of rodent blood compared with human blood,
rather than any difference in the rate of FTY720 phosphor-
ylation by rodent versus human SphK2.
We next investigated whether AAL(R) is a better substrate
for SphK2 than FTY720, using an in vitro reaction with
recombinant human SphK2 (Fig. 4A). The enzyme turnover
rate was 7.9 times higher with AAL(R) as the substrate,
whereas the ability of the enzyme to bind the substrate
(measured as K
m
) was very similar (Table 2). This difference
in phosphorylation rate is very similar to that observed with
whole human blood [8.9-fold higher with AAL(R) as sub-
strate]. Similar results were seen when lysates of human
embryonic kidney 293 cells overexpressing human SphK2
were used as the source of SphK2 activity: the turnover rate
was 14 times higher with AAL(R) than with FTY720 as the
substrate, whereas the K
m
was similar [7.4
M for AAL(R);
13.2
M for FTY720]. These results indicate that although
there seems to be no difference in the affinity of SphK2 for
the two substrates, the active site is better able to turn over
AAL(R) than FTY720.
The key structural difference between FTY720 and AAL(R)
is a hydroxymethyl to methyl substitution on the quaternary
Fig. 2. AAL(R) but not FTY720 triggers a SphK2-dependent apoptosis pathway in HeLa cells. HeLa cells were pretreated for 48 h with two different
siRNA molecules targeting SphK2 (or ⴛ, universal negative control siRNA (E), or lipofectamine only (f), then incubated for 24 h in the presence
of AAL(R) (A) or FTY720 (B). Viability was determined by MTT assay and normalized to vehicle control-treated cells. Results shown are the combined
results of two separate experiments, each consisting of triplicate treatments (i.e., n⫽6 per data point). C, expression of SphK2 (closed bars) and, as
a control, SphK1 (open bars) was measured 48 h after siRNA treatment, using real-time PCR. Expression was normalized relative to glyceraldehyde
3-phosphate dehydrogenase (G3PDH) and is expressed proportional to the lipofectamine only control (Mock). Results shown are mean and S.E. of four
data points, derived from two separate experiments for each siRNA. Two-way analysis of variance with Bonferroni post test was used to determine
the statistical significance of differences between negative control and both SK2-specific siRNAs (A and B) or all siRNAs compared with mock
transfected (C); ⴱ,P⬍0.05; ⴱⴱ,P⬍0.01; ⴱⴱⴱ,P⬍0.0001.
Fig. 3. AAL(R) is more rapidly phosphorylated than
FTY720. A, phosphorylation of AAL(R) or FTY720 by cul-
tured Jurkat cells was measured over time, by quantifying
the amount of AAL-P (f) or FTY-P (F) in both cells and
culture medium. Results are mean and S.E. derived from
triplicate cell treatments and representative of two inde-
pendent experiments. B, formation of AAL-P (squares) or
FTY-P (circles) in human (solid symbols) or rat (open sym-
bols) blood was measured as a function of time after addi-
tion of 1 nmol of AAL(R) or FTY720 to 125
l of whole
blood, as described under Materials and Methods. Results
shown are combined data from two separate experiments
(n⫽5, rat blood; n⫽6, human blood).
688 Jary et al.
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
(second) carbon of the headgroup (Fig. 4C), suggesting that
the presence of this second hydroxyl group interferes with
catalysis or release of the product. In the natural substrates
sphingosine and dhSph, a second hydroxyl group located on
the third carbon of the acyl chain is not accessible for phos-
phorylation by sphingosine kinases. To gain some insight
into whether this 3-OH group influences the phosphorylation
rate or substrate affinity, we determined the Michaelis-Men-
ten kinetics for phosphorylation of dhSph and 3-deoxy-dhSph
(Fig. 4D) by SphK2 (Fig. 4B and table 2). Removal of the
hydroxyl group reduced the enzyme turnover rate and
slightly increased the K
m
, but the effects were not dramatic,
indicating that the 3-OH group plays a minor role in sub-
strate recognition and turnover by SphK2.
FTY720 Is Dephosphorylated Faster than AAL(R).
The steady-state level of FTY-P achieved in living organisms
is a function not only of phosphorylation but also of dephos-
phorylation. A likely candidate organ for dephosphorylation
of circulating FTY-P is the endothelium, which on the other
hand has very little SphK2 activity and is therefore unlikely
to contribute significantly to the compound’s phosphorylation
(Anada et al., 2007). FTY-P is a membrane-impermeant com-
pound, and recent evidence indicates that it may be dephos-
phorylated extracellularly by endothelial lipid phosphate
phosphatases, specifically subtypes 1a and 3 (Mechtcheri-
akova et al., 2007; Yamanaka et al., 2008). To determine
whether there are any differences in the ability of lipid phos-
phatases to dephosphorylate the two compounds, we tested
the ectophosphatase activity of cultured human endothelial
cells toward both FTY-P and AAL-P (Fig. 5). In direct con-
trast to the rate of phosphorylation by SphK2, the rate of
dephosphorylation was faster with FTY-P. Using a one-phase
exponential decay model to fit the data, the difference in
dephosphorylation rate was 1.5, 1.6, and 2.9-fold (faster in
the case of FTY-P) in three separate experiments, and was
statistically significant (P⬍0.001, sum-of-squares test).
AAL(R) Is More Fully Phosphorylated In Vivo. Our in
vitro results indicated that AAL(R) should be more com-
pletely phosphorylated than FTY720, at steady state, in vivo.
To test this, we administered a single 0.3 mg/kg dose of
AAL(R) or FTY720 to mice, and measured the amount of
AAL(R) and AAL-P, or FTY720 and FTY-P, in the blood 18 h
later (Fig. 6). For AAL(R), 3.7 ⫾1.3% of the compound
remained unphosphorylated (i.e., 96% phosphorylated),
whereas for FTY720, this was 19.1 ⫾3.1% (81% phosphory-
lated), a statistically significant difference (P⬍0.001, un-
paired ttest). Measurements of FTY720 phosphorylation in
mice at 2 h (82%) and 6 h (83%) indicated that a steady-state
balance was rapidly achieved, and although the total amount
of compound in blood declined over time, the proportion of
phosphorylated compound remained steady.
Discussion
Induction of lymphopenia with FTY720 is dependent on
stimulation of the S1P
1
receptor by FTY-P. The potency
(EC
50
) and efficacy (E
max
) for AAL-P, FTY-P, and S1P on the
human S1P
1
receptor are essentially identical (Brinkmann et
al., 2002). Despite this, two publications have reported that
the EC
50
for induction of lymphopenia in rats is three times
lower with AAL(R) than with FTY720 (Kiuchi et al., 2000;
Ho¨ genauer et al., 2008). Our own measurements of blood T
cells in mice confirm the greater potency of AAL(R) as an
inducer of lymphopenia: the EC
50
for depletion of blood T
cells after 18 h was 27
g/kg with AAL(R) and 51
g/kg with
FTY720 (n⫽4, P⫽0.036, by sum-of-squares F test). These
results support the conclusion that the more rapid phosphor-
ylation of AAL(R) in vitro translates into a greater proportion
of phosphorylated compound in vivo, and a consequent in-
crease in potency. Although AAL(R) is a better substrate
than FTY720 for phosphorylation, dephosphorylation of
FTY-P by human endothelial cells was faster than for AAL-P
Fig. 4. Turnover rate by SphK2 is higher with AAL(R) than
with FTY720. A, phosphorylation of AAL(R) (f) or FTY720
(E) by recombinant human SphK2, as a function of sub-
strate concentration. B, phosphorylation of dhSph (f)or
3-deoxy-dhSph (E) by recombinant human SphK2 as a
function of substrate concentration. Michaelis-Menten
curves were fitted to 12 data points with Prism (GraphPad
Software, San Diego, CA), and V
max
and K
m
values are
shown in Table 2. C, structures for FTY720 and AAL(R). D,
structures for dhSph and 3-deoxy-dhSph.
TABLE 1
Rate of FTY720 and AAL(R) phosphorylation in whole blood
Phosphorylation rates were calculated using only the linear portion of the phosphor-
ylation curves shown in Fig. 3B. Data are presented as mean ⫾S.E.
Blood FTY720 AAL(R)
nmol product/h/ml of blood
Human 0.056 ⫾0.001 0.496 ⫾0.014
Rat 1.93 ⫾0.040 13.3 ⫾1.13
Deoxy FTY720 Derivative Is Much More Rapidly Phosphorylated 689
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
(Fig. 5), suggesting that FTY-P is a better substrate for lipid
phosphate phosphatases. This would further exacerbate the
difference between the two compounds in terms of steady-
state phosphorylation.
The more rapid phosphorylation of AAL(R) by SphK2 is
supported by our initial observation that AAL(R) induces a
SphK2-dependent apoptosis pathway, whereas FTY720 does
not. The apoptotic response seems to be triggered by exces-
sive intracellular accumulation of long-chain base phos-
phates such as AAL-P (Don et al., 2007), cis-4-methylsphin-
gosine 1-phosphate (van Echten-Deckert et al., 1997), or, in
yeast, phytosphingosine 1-phosphate (Zhang et al., 2001).
Further experiments have shown that apoptosis triggered by
AAL(R) proceeds through mitochondrial depolarization (not
shown), but the precise nature of the intracellular target for
AAL-P that triggers apoptosis is currently unknown. AAL(R)
and FTY720 both trigger a SphK2-independent apoptotic
pathway at concentrations of approximately 10
M. Apopto-
sis induced with FTY720 forms the basis for its anticancer
properties, and is believed to occur through activation of the
broad-spectrum serine/threonine protein phosphatase 2A, at
least in leukemia cells (Matsuoka et al., 2003; Neviani et al.,
2007; Liu et al., 2008). Our results are in agreement with
those of others, who have shown that FTY720 does not need
to be phosphorylated to induce apoptosis in leukemia cells
(Neviani et al., 2007; Liu et al., 2008). Neither the SphK2-
dependent nor the SphK2-independent apoptotic pathway
is relevant to immunosuppression, because these path-
ways are activated at concentrations of the drug that are 1
to 2 orders of magnitude higher than the concentration
required to achieve effective immunosuppression in hu-
mans or rodents.
There are two structural differences between AAL(R) and
FTY720 (Fig. 4C): the introduction of an ether linkage (re-
placing a carbon) between the lipid tail and the aromatic ring
in AAL(R), and elimination of one of the FTY720 hydroxyl
headgroups. It has been shown previously (Kiuchi et al.,
2000) that introduction of the ether linkage into FTY720 does
not improve, or significantly alter, its potency as an inducer
of lymphopenia. We therefore conclude that elimination of
one of the hydroxyl groups improves catalysis by SphK2. The
hydroxyl group on the third carbon of dhSph does not slow
down its phosphorylation by SphK2 relative to 3-deoxy-dh-
Sph (Fig. 4B), indicating that it is the position of the second
hydroxyl group in FTY720 that interferes with catalysis. It is
likely that the presence of two hydroxyl groups in FTY720,
both accessible to the SphK2 catalytic site, interferes with
release of the product or the transfer of phosphate from ATP.
In rodents, a cycle of phosphorylation and dephosphoryla-
tion maintains an equilibrium between FTY720 and FTY-P
in the blood, with 20 to 30% of the compound in the nonphos-
phorylated form (Brinkmann et al., 2002; Mandala et al.,
2002). In the current study, we show that when AAL(R) is
used, the equilibrium is shifted in favor of the phosphate
(Fig. 6), and this gives rise to an increase in potency. For
this reason, AAL(R) is probably superior to FTY720 as a
research tool for determining the effects the sphingosine
1-phosphate receptor agonists on animal physiology and
pathophysiology, especially given the availability of a
chemically identical, nonphosphorylatable control com-
pound in the form of the S-enantiomer. We note that
asymmetric synthesis of AAL(R) or AAL(S) is not difficult
and can be achieved by starting with the chiral headgroup
and adding the lipophilic portion of the molecule to this.
This approach circumvents the need for any chiral separa-
tion (Hinterding et al., 2003).
In human patients, FTY720 phosphorylation seems to be rate
limiting for efficacy. Human blood possesses a much lower in-
trinsic SphK2 activity than rodent blood (Billich et al., 2003),
resulting in a much slower rate of phosphorylation for both
FTY720 and AAL(R) (Fig. 3B). Results with human patients
indicate that the equilibrium between FTY720 and its phos-
phate rests more heavily in favor of dephosphorylation: the
plasma concentration of FTY-P drops below that of FTY720 12
to 24 h after a single 5-mg dose of FTY720; thereafter, FTY-P
declines as a proportion of the FTY720 concentration (Kovarik
et al., 2008, 2009). On this basis, one would predict that AAL(R)
would achieve effective immunosuppression at a significantly
lower dose in humans than FTY720. Lymphopenia in humans
is achieved with doses of FTY720 at or above 1 mg/day. At this
dose, the steady-state FTY720 concentration in plasma reaches
5.7 ng/ml (18.6 nM). More effective lymphopenia is achieved at
2.5 mg/day (steady state FTY720 concentration of 36.5 nM in
plasma) (Kahan et al., 2003; Brinkmann, 2007). At this concen-
tration FTY720 may have effects that are not dependent on its
phosphorylation, such as inhibition of cytosolic phospholipase
A
2
, with consequent inhibition of prostaglandin and prostacy-
clin synthesis (Payne et al., 2007), or inhibition of protein ki-
nase C isoforms (Sensken and Gra¨ ler, 2010).
In summary, in this article we report that the R-enantio-
mer of the FTY720 derivative 2-amino-1,3-propanediol is a
Fig. 5. Dephosphorylation of FTY-P and AAL-P. Radiola-
beled AAL-P (f) or FTY-P (E) was added at 100 nM to the
medium of cultured HMEC-1 cells. The medium was sam-
pled at indicated times and loss of the phosphorylated
substrate from the growth medium was assessed by TLC
and filmless autoradiographic analysis. Image from the
48-h incubation, plus no-cell control, is shown on the right,
and graph shows loss of radiolabeled substrate over time.
Results shown are mean of triplicate incubations and are
representative of three independent experiments. Data
points were fitted to a one phase decay model using Graph-
Pad Prism.
TABLE 2
Michaelis-Menten kinetics for phosphorylation of dhSph, 3-deoxy-
dhSph, FTY720, and AAL(R) by purified recombinant human SphK2
Michaelis-Menten curves were fitted to 12 data points for each compound with the
use of GraphPad Prism. Values shown are best fit values ⫾S.E.
K
m
V
max
K
cat
M pmol product/min/
g of enzyme
dhSph 28.8 ⫾7.2 1281 ⫾131 89.6
3-Deoxy-dhSph 38.9 ⫾6.8 781 ⫾62.8 54.6
AAL(R) 15.6 ⫾2.7 86.8 ⫾5.0 6.07
FTY720 13.1 ⫾2.3 11.0 ⫾0.61 0.77
690 Jary et al.
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
much better substrate for SphK2 than FTY720 itself. This
results from a faster enzyme turnover rather than higher
affinity and leads to a significantly more rapid rate of phos-
phorylation in human blood. These results have therapeutic
importance, because the efficacy of FTY720 as an immuno-
suppressant is dependent on the phosphate rather than the
parent compound. First, effective immunosuppression could
be achieved with lower doses of AAL(R) than are needed
with FTY720. Second, use of AAL(R) would reduce the
amount of nonphosphorylated compound in circulation,
thus obviating any effects associated with the nonphosphor-
ylated compound.
Acknowledgments
We thank Russell Pickford, Sonia Bustamante, and Lewis Adler of
the Biomedical Mass Spectrometry Facility at the University of New
South Wales for their assistance with mass spectrometry and Sandra
Spathos for assistance with obtaining rat blood.
References
Ades EW, Candal FJ, Swerlick RA, George VG, Summers S, Bosse DC, and Lawley
TJ (1992) HMEC-1: establishment of an immortalized human microvascular en-
dothelial cell line. J Invest Dermatol 99:683–690.
Anada Y, Igarashi Y, and Kihara A (2007) The immunomodulator FTY720 is phos-
phorylated and released from platelets. Eur J Pharmacol 568:106–111.
Bielawski J, Szulc ZM, Hannun YA, and Bielawska A (2006) Simultaneous quanti-
tative analysis of bioactive sphingolipids by high-performance liquid chromatog-
raphy-tandem mass spectrometry. Methods 39:82–91.
Billich A, Bornancin F, De´ vay P, Mechtcheriakova D, Urtz N, and Baumruker T
(2003) Phosphorylation of the immunomodulatory drug FTY720 by sphingosine
kinases. J Biol Chem 278:47408–47415.
Brinkmann V (2007) Sphingosine 1-phosphate receptors in health and disease:
mechanistic insights from gene deletion studies and reverse pharmacology. Phar-
macol Ther 115:84–105.
Brinkmann V, Davis MD, Heise CE, Albert R, Cottens S, Hof R, Bruns C, Prieschl E,
Baumruker T, Hiestand P, et al. (2002) The immune modulator FTY720 targets
sphingosine 1-phosphate receptors. J Biol Chem 277:21453–21457.
Cohen JA, Barkhof F, Comi G, Hartung HP, Khatri BO, Montalban X, Pelletier J,
Capra R, Gallo P, Izquierdo G, et al. (2010) Oral fingolimod or intramuscular
interferon for relapsing multiple sclerosis. N Engl J Med 362:402–415.
Don AS, Martinez-Lamenca C, Webb WR, Proia RL, Roberts E, and Rosen H (2007)
Essential requirement for sphingosine kinase 2 in a sphingolipid apoptosis path-
way activated by FTY720 analogues. J Biol Chem 282:15833–15842.
Fujino M, Funeshima N, Kitazawa Y, Kimura H, Amemiya H, Suzuki S, and Li XK
(2003) Amelioration of experimental autoimmune encephalomyelitis in Lewis rats
by FTY720 treatment. J Pharmacol Exp Ther 305:70–77.
Gonzalez-Cabrera PJ, Hla T, and Rosen H (2007) Mapping pathways downstream of
sphingosine 1-phosphate subtype 1 by differential chemical perturbation and
proteomics. J Biol Chem 282:7254–7264.
Hinterding K, Cottens S, Albert R, Zecri F, Buehlmayer PB, Spanka C, Brinkmann
V, Nussbaumer P, Ettmayer P, Hoegenauer K, et al. (2003) Synthesis of chiral
analogues of FTY720 and its phosphate. Synthesis-Stuttgart 2003:1667–1670.
Hofmann U, Burkard N, Vogt C, Thoma A, Frantz S, Ertl G, Ritter O, and Bonz A
(2009) Protective effects of sphingosine-1-phosphate receptor agonist treatment
after myocardial ischaemia-reperfusion. Cardiovasc Res 83:285–293.
Ho¨ genauer K, Billich A, Pally C, Streiff M, Wagner T, Welzenbach K, and Nuss-
baumer P (2008) Phosphorylation by sphingosine kinase 2 is essential for in vivo
potency of FTY720 analogues. Chem Med Chem 3:1027–1029.
Kahan BD, Karlix JL, Ferguson RM, Leichtman AB, Mulgaonkar S, Gonwa TA,
Skerjanec A, Schmouder RL, and Chodoff L (2003) Pharmacodynamics, pharma-
cokinetics, and safety of multiple doses of FTY720 in stable renal transplant
patients: a multicenter, randomized, placebo-controlled, phase I study. Transplan-
tation 76:1079–1084.
Kappos L, Radue EW, O’Connor P, Polman C, Hohlfeld R, Calabresi P, Selmaj K,
Agoropoulou C, Leyk M, Zhang-Auberson L, et al. (2010) A placebo-controlled trial
of oral fingolimod in relapsing multiple sclerosis. N Engl J Med 362:387–401.
Kiuchi M, Adachi K, Kohara T, Minoguchi M, Hanano T, Aoki Y, Mishina T, Arita M,
Nakao N, Ohtsuki M, et al. (2000) Synthesis and immunosuppressive activity of
2-substituted 2-aminopropane-1,3-diols and 2-aminoethanols. J Med Chem 43:
2946–2961.
Kovarik JM, Dole K, Riviere GJ, Pommier F, Maton S, Jin Y, Lasseter KC, and
Schmouder RL (2009) Ketoconazole increases fingolimod blood levels in a drug
interaction via CYP4F2 inhibition. J Clin Pharmacol 49:212–218.
Kovarik JM, Slade A, Riviere GJ, Neddermann D, Maton S, Hunt TL, and
Schmouder RL (2008) The ability of atropine to prevent and reverse the negative
chronotropic effect of fingolimod in healthy subjects. Br J Clin Pharmacol 66:199–
206.
Lim HS, Park JJ, Ko K, Lee MH, and Chung SK (2004) Syntheses of sphingosine-
1-phosphate analogues and their interaction with EDG/S1P receptors. Bioorg Med
Chem Lett 14:2499–2503.
Liu Q, Zhao X, Frissora F, Ma Y, Santhanam R, Jarjoura D, Lehman A, Perrotti D,
Chen CS, Dalton JT, et al. (2008) FTY720 demonstrates promising preclinical
activity for chronic lymphocytic leukemia and lymphoblastic leukemia/lymphoma.
Blood 111:275–284.
Maceyka M, Milstien S, and Spiegel S (2007) Measurement of mammalian sphin-
gosine-1-phosphate phosphohydrolase activity in vitro and in vivo. Methods Enzy-
mol 434:243–256.
Maki T, Gottschalk R, Ogawa N, and Monaco AP (2005) Prevention and cure of
autoimmune diabetes in nonobese diabetic mice by continuous administration of
FTY720. Transplantation 79:1051–1055.
Mandala S, Hajdu R, Bergstrom J, Quackenbush E, Xie J, Milligan J, Thornton R,
Shei GJ, Card D, Keohane C, et al. (2002) Alteration of lymphocyte trafficking by
sphingosine-1-phosphate receptor agonists. Science 296:346–349.
Matloubian M, Lo CG, Cinamon G, Lesneski MJ, Xu Y, Brinkmann V, Allende ML,
Proia RL, and Cyster JG (2004) Lymphocyte egress from thymus and peripheral
lymphoid organs is dependent on S1P receptor 1. Nature 427:355–360.
Matsuoka Y, Nagahara Y, Ikekita M, and Shinomiya T (2003) A novel immunosup-
pressive agent FTY720 induced Akt dephosphorylation in leukemia cells. Br J
Pharmacol 138:1303–1312.
Mechtcheriakova D, Wlachos A, Sobanov J, Bornancin F, Zlabinger G, Baumruker T,
and Billich A (2007) FTY720-phosphate is dephosphorylated by lipid phosphate
phosphatase 3. FEBS Lett 581:3063–3068.
Neviani P, Santhanam R, Oaks JJ, Eiring AM, Notari M, Blaser BW, Liu S, Trotta
R, Muthusamy N, Gambacorti-Passerini C, et al. (2007) FTY720, a new alternative
for treating blast crisis chronic myelogenous leukemia and Philadelphia chromo-
some-positive acute lymphocytic leukemia. J Clin Invest 117:2408–2421.
Olivera A, Barlow KD, and Spiegel S (2000) Assaying sphingosine kinase activity.
Methods Enzymol 311:215–223.
Oo ML, Thangada S, Wu MT, Liu CH, Macdonald TL, Lynch KR, Lin CY, and Hla T
(2007) Immunosuppressive and anti-angiogenic sphingosine 1-phosphate recep-
tor-1 agonists induce ubiquitinylation and proteasomal degradation of the recep-
tor. J Biol Chem 282:9082–9089.
Pan S, Mi Y, Pally C, Beerli C, Chen A, Guerini D, Hinterding K, Nuesslein-
Hildesheim B, Tuntland T, Lefebvre S, et al. (2006) A monoselective sphingosine-
1-phosphate receptor-1 agonist prevents allograft rejection in a stringent rat heart
transplantation model. Chem Biol 13:1227–1234.
Payne SG, Oskeritzian CA, Griffiths R, Subramanian P, Barbour SE, Chalfant CE,
Milstien S, and Spiegel S (2007) The immunosuppressant drug FTY720 inhibits
cytosolic phospholipase A2 independently of sphingosine-1-phosphate receptors.
Blood 109:1077–1085.
Rosen H, Gonzalez-Cabrera P, Marsolais D, Cahalan S, Don AS, and Sanna MG
(2008) Modulating tone: the overture of S1P receptor immunotherapeutics. Immu-
nol Rev 223:221–235.
Sanna MG, Wang SK, Gonzalez-Cabrera PJ, Don A, Marsolais D, Matheu MP, Wei
SH, Parker I, Jo E, Cheng WC, et al. (2006) Enhancement of capillary leakage and
restoration of lymphocyte egress by a chiral S1P1 antagonist in vivo. Nat Chem
Biol 2:434–441.
Sensken SC and Gra¨ ler MH (2010) Down-regulation of S1P1 receptor surface ex-
pression by protein kinase C inhibition. J Biol Chem 285:6298–6307.
Siow DL and Wattenberg BW (2007) An assay system for measuring the acute
production of sphingosine 1-phosphate in intact monolayers. Anal Biochem 371:
184–193.
Spandidos A, Wang X, Wang H, and Seed B (2010) PrimerBank: a resource of human
and mouse PCR primer pairs for gene expression detection and quantification.
Nucleic Acids Res 38:D792–D799.
van Echten-Deckert G, Zschoche A, Ba¨ r T, Schmidt RR, Raths A, Heinemann T, and
Sandhoff K (1997) cis-4-Methylsphingosine decreases sphingolipid biosynthesis by
Fig. 6. AAL(R) is more completely phosphorylated in vivo. Amount of
AAL(R) and AAL-P, or FTY720 and FTY-P, in the blood, 18 h after
intraperitoneal administration of 0.3 mg/kg AAL(R) or FTY720 to
C57BL6 mice (n⫽4). Free base (shaded bars) refers to AAL(R) and
FTY720, whereas base phosphate (clear bars) refers to AAL-P and
FTY-P.
Deoxy FTY720 Derivative Is Much More Rapidly Phosphorylated 691
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
specifically interfering with serine palmitoyltransferase activity in primary cul-
tured neurons. J Biol Chem 272:15825–15833.
Yamanaka M, Anada Y, Igarashi Y, and Kihara A (2008) A splicing isoform of LPP1,
LPP1a, exhibits high phosphatase activity toward FTY720 phosphate. Biochem
Biophys Res Commun 375:675–679.
Zemann B, Kinzel B, Mu¨ ller M, Reuschel R, Mechtcheriakova D, Urtz N, Bornancin F,
Baumruker T, and Billich A (2006) Sphingosine kinase type 2 is essential for lym-
phopenia induced by the immunomodulatory drug FTY720. Blood 107:1454–1458.
Zhang X, Skrzypek MS, Lester RL, and Dickson RC (2001) Elevation of endogenous
sphingolipid long-chain base phosphates kills Saccharomyces cerevisiae cells. Curr
Genet 40:221–233.
Address correspondence to: Dr. Anthony Don, Level 2, C25 Lowy Cancer
Institute, Faculty of Medicine, University of New South Wales, Sydney, 2052,
NSW, Australia. E-mail: anthonyd@unsw.edu.au
692 Jary et al.
at ASPET Journals on December 31, 2015molpharm.aspetjournals.orgDownloaded from
