Article

Vaccination against a hit-and-run viral cancer

Department of Pathology, University of Cambridge, UK.
Journal of General Virology (Impact Factor: 3.18). 09/2010; 91(Pt 9):2176-85. DOI: 10.1099/vir.0.023507-0
Source: PubMed

ABSTRACT

Cancers with viral aetiologies can potentially be prevented by antiviral vaccines. Therefore, it is important to understand how viral infections and cancers might be linked. Some cancers frequently carry gammaherpesvirus genomes. However, they generally express the same viral genes as non-transformed cells, and differ mainly in also carrying oncogenic host mutations. Infection, therefore, seems to play a triggering or accessory role in disease. The hit-and-run hypothesis proposes that cumulative host mutations can allow viral genomes to be lost entirely, such that cancers remaining virus-positive represent only a fraction of those to which infection contributes. This would have considerable implications for disease control. However, the hit-and-run hypothesis has so far lacked experimental support. Here, we tested it by using Cre-lox recombination to trigger transforming mutations in virus-infected cells. Thus, 'floxed' oncogene mice were infected with Cre recombinase-positive murid herpesvirus-4 (MuHV-4). The emerging cancers showed the expected genetic changes but, by the time of presentation, almost all lacked viral genomes. Vaccination with a non-persistent MuHV-4 mutant nonetheless conferred complete protection. Equivalent human gammaherpesvirus vaccines could therefore potentially prevent not only viral genome-positive cancers, but possibly also some cancers less suspected of a viral origin because of viral genome loss.

Full-text

Available from: Stacey Efstathiou, Apr 16, 2016
Vaccination against a hit-and-run viral cancer
Philip G. Stevenson, Janet S. May, Viv Connor and Stacey Efstathiou
Correspondence
Philip G. Stevenson
pgs27@cam.ac.uk
Received 11 May 2010
Accepted 21 June 2010
Division of Virology, Department of Pathology, University of Cambridge, UK
Cancers with viral aetiologies can potentially be prevented by antiviral vaccines. Therefore, it is
important to understand how viral infections and cancers might be linked. Some cancers
frequently carry gammaherpesvirus genomes. However, they generally express the same viral
genes as non-transformed cells, and differ mainly in also carrying oncogenic host mutations.
Infection, therefore, seems to play a triggering or accessory role in disease. The hit-and-run
hypothesis proposes that cumulative host mutations can allow viral genomes to be lost entirely,
such that cancers remaining virus-positive represent only a fraction of those to which infection
contributes. This would have considerable implications for disease control. However, the hit-and-
run hypothesis has so far lacked experimental support. Here, we tested it by using Cre–lox
recombination to trigger transforming mutations in virus-infected cells. Thus, ‘floxed’ oncogene
mice were infected with Cre recombinase-positive murid herpesvirus-4 (MuHV-4). The emerging
cancers showed the expected genetic changes but, by the time of presentation, almost all lacked
viral genomes. Vaccination with a non-persistent MuHV-4 mutant nonetheless conferred
complete protection. Equivalent human gammaherpesvirus vaccines could therefore potentially
prevent not only viral genome-positive cancers, but possibly also some cancers less suspected of
a viral origin because of viral genome loss.
INTRODUCTION
The identification of viral aetiologies for hepatic
(Blumberg, 1997) and cervical (Frazer, 2004) cancers has
made antiviral vaccination a relatively simple and effective
means of disease prevention. Human gammaherpesviruses
Epstein–Barr virus (EBV) and Kaposi’s sarcoma-asso-
ciated herpesvirus (KSHV) are also oncogenic, but
the lack of single, unifying features of the associated
cancers has made it unclear how directly infection and
disease are linked and so what vaccination might achieve.
The robust persistence of herpesviruses in immunocom-
petent hosts also makes vaccination a considerable
challenge.
EBV transforms B cells in vitro and, in immunocomprom-
ised patients, the viral genes responsible for transformation
can cause disease (Carbone et al., 2009 ). However, EBV-
infected cancers in immunocompetent hosts tend to
express the same viral genes as non-transformed cells.
They differ in also carrying oncogenic host mutations;
indeed, Burkitt’s lymphoma is associated more strongly
with c-myc translocation than with EBV infection
(Thorley-Lawson & Allday, 2008). Thus, viral genes seem
mostly to have triggering or accessory roles in disease, with
host oncogenes being the main drivers. The hit-and-run
hypothesis proposes that viral genomes initiating disease
can be lost entirely to obscure a cancer’s viral origin
(Ambinder, 2000). Early on, viral genes are likely to be
essential for cancer-cell survival (Hammerschmidt &
Sugden, 2004). However, cancers accumulate vast numbers
of host mutations (Pleasance et al., 2010), some of w hich
will inevitably promote more autonomous growth. Thus, it
seems inevitable that a cancer will, with time, evolve
increasing independence from viral gene functions that
could allow viral genome loss.
The main problem with the hit-and-run hypothesis has been
a lack of experimental support. Analyses of gammaherpes-
virus-induced cancers have focused on African Burkitt’s
lymphoma, nasopharyngeal carcinoma and Kaposi’s sarcoma,
because their high frequencies of viral genome retention make
plausible a causal link between infection and disease.
However, focusing on virus-positive cancers tells us little
about genome loss, as here most presenting cancers would be
virus-negative. Instead, it is necessary to track prospectively
the fate of viral genomes in transformed cells. In vitro,B-cell
cancers tend to maintain gammaherpesvirus genomes,
whereas Kaposi’s sarcoma and nasopharyngeal carcinoma
tend to lose them (Ganem, 2006; Dittmer et al., 2008). In vivo,
murid herpesvirus-4 (MuHV-4) infection increases the
incidence of virus-negative cancers (Sunil-Chandra et al.,
1994; Tarakanova et al., 2005). However, the difficulty of
analysing spontaneous cancers, where the molecular changes
driving transformation are almost always unknown, makes
firm functional conclusions hard to draw. To ensure that the
host factors contributing to cancer remained known, we used
Cre–lox recombination in a well-established conditional
mouse cancer model (reviewed by DuPage et al., 2009) to
transform virus-infected cells, and then analysed the emerging
cancers for viral genome retention.
Journal of General Virology (2010), 91, 2176–2185 DOI 10.1099/vir.0.023507-0
2176 023507
G
2010 SGM Printed in Great Britain
Page 1
RESULTS
Generation of Cre
+
MuHV-4
We inserted a human cytomegalovirus (HCMV) IE1
promoter-driven Cre expression cassette between the 39
ends of MuHV-4 ORFs 57 and 58 (Fig. 1a, b). We used an
HCMV IE1 promoter because this can be active in latently
infected cells (Rosa et al., 2007; Smith et al., 2007). Thus,
Cre could be expressed without MuHV-4 lytic genes kill-
ing the infected cells. Two functionally indistiguishable
mutants were obtained. Both showed Cre expression by
excising spontaneously their loxP-flanked bacterial artificial
chromosome (BAC) cassettes, and immunofluorescence
showed Cre expression in infected-cell nuclei (Fig. 1c).
(The Cre coding sequence used incorporates an N-terminal
nuclear-localization signal.)
In vivo loxP recombination by Cre
+
MuHV-4
We tested whether viral Cre expression could recombine
loxP sites in the host genome by infecting mouse
embryonic fibroblasts derived from ROSA26-lacZ
flox/flox
reporter mice (Fig. 2a). b-Galactosidase assays were
strongly positive, indicating loxP recombination. Such
recombination was also achieved by infecting ROSA26-
lacZ
flox/flox
mice intraperitoneally (i.p.) with Cre
+
MuHV-
4 (Fig. 2b): widespread
b-galactosidase expression was
evident on the diaphragm, a site commonly infected by i.p.
MuHV-4 (Milho et al., 2009).
We then infected p53
flox/flox
K-ras
LSL-G12D/+
mice i.p. with
Cre
+
MuHV-4 (Fig. 2c, d). More than 90 % of infected
mice developed cancers within 3 months, compared with
0 % of uninfected or wild-type MuHV-infected controls.
Cancers occurred most frequently on the diaphragm.
Disease was rare within 30 days, and most cancers were
single lesions. In contrast, virus replication was widespread:
3 days after inoculation, spleens yielded (2.1±1.2)610
4
and peritonea l washes (1.7±1.2)610
3
infectious centres
per mouse (mean±
SD titres, n56, with lytic titres ,1%of
infectious centre titres); even 2 months later, spleens
yielded (2.2±1.5)610
2
infectious centres per mouse
(n56). Therefore, cancer growth was much more restricted
than viral latency and functional Cre expressio n.
Analysis of virus-triggered cancers
All of the cancers analysed (n.12) were histological
sarcomas (Fig. 3a). In situ hybridization (Fig. 3b) showed
surprisingly little expression of the MuHV-4 tRNAs normally
abundant in lytic and latent infections (Bowden et al.,1997).
At most, a few positive cells were scattered around the main
cancer mass. Real-time PCR (Fig. 3c) established that
sarcomas contained lower copy numbers of viral genomes
than latently infected spleens of the same mice.
Fig. 1. Characterization of Cre
+
MuHV-4. (a) An HCMV IE1 promoter-driven Cre expression cassette was inserted between
MuHV-4 ORFs 57 and 58. Relevant restriction sites are shown. (b) Viral DNA was digested with HindIII or Bgl II and probed
with either a genomic Bgl II clone or the HCMV IE1–Cre construct, as shown in (a). WT, Wild-type; Cre
+
, recombinant;
Cre
+
ind, independently derived recombinant. (c) BHK-21 cells were infected with wild-type or Cre
+
MuHV-4 (1 p.f.u. per cell,
16 h), then fixed, permeabilized and stained for Cre recombinase or for MuHV-4 antigens using polyclonal rabbit sera. Nuclei
were counterstained with DAPI.
Viral genome loss
http://vir.sgmjournals.org 2177
Page 2
Fresh sarcoma explants included lymphocytes, macro-
phages and fibroblasts (Fig. 4a, b), but only fibroblasts
grew out. Thirteen of 20 explants yielded infectious virus.
Viral spread soon overwhelmed these positive cultures,
consistent with fibroblasts being highly permissive for
MuHV-4 lytic replication. The others remained virus-
negative. At 2 days post-explant, titres were low in all
cultures (,1 p.f.u. per 10
4
cells), and ,5 % of fibroblasts
cloned at this time (39 of 744 clones from eight mice)
yielded infectious virus . Clones lacking infectious virus also
lacked viral genomes by PCR (Fig. 4c) and Southern
blotting (Fig. 4d). Nevertheless, all sarcomas showed the
expected patterns of Cre-induced p53 disruption and k-
ras(G12D) expression (Fig. 5). Therefore, the vast majority
of cancer cells showed genetic changes consistent with
previous virus infection but, by the time of presentation,
were not virus-infected.
A trivial explanation for the lack of viral genomes in
transformed cells would be that Cre uptake from infected-
cell debris was sufficient for transformation. Ho wever,
infecting p53
flox/flox
K-ras
LSL-G12D/+
mice (n524) with
herpes simplex virus (HSV) expressing Cre from an
HCMV IE1 promoter caused no disease. Also, Cre
+
HSV
similarly shows no spread of Cre signal in vivo (Proenc¸a
et al., 2008), and Cre
+
MuHV-4 plaque assays on
ROSA26-lacZ
flox/flox
fibroblasts showed no obvious spread
of
b-galactosidase expression to uninfected cells.
Even when virus was recovered from cancer cells, it might
have come from infiltrating, non-transformed cells rather
than being that responsible for the original oncogenic hit.
We exami ned this possibility by infecting mice with a mix
of Cre
+
and Cre
2
MuHV-4 and typing the virus recovered
from sarcomas for Cre expression. Cre
+
MuHV-4 showed
approximately 30-fold lower late nt titres than Cre
2
virus,
so we used an input Cre
+
/Cre
2
mixture of 30 : 1. Only one
of 18 virus-positive sarcoma explants was Cre
+
by
immunofluorescence. PCR and DNA sequencing of the
ORF57/58 junction showed that the Cre
2
viruses were
wild-type. This did not cause sarcomas (Fig. 2), so even
when virus infection was observed in sarcoma explants, it
appeared rarely to be that responsible for transformation.
Vaccination against virus-triggered cancers
The high efficiency of virus-triggered oncogenesis in our
model suggested that vaccine-induced protection might be
difficult to achieve. However, when Cre was substituted for
ORF50 to make a replication-deficient Cre
+
MuHV-4,
both i.p. and intranasal (i.n.) infections gave no disease in
p53
flox/flox
K-ras
LSL-G12D/+
mice over 5 months (n530).
Fig. 2. Cre recombinase-triggered cancers in MuHV-4-infected
mice. (a) Embryonic fibroblasts from ROSA26-lacZ
flox/flox
mice
were infected (0.3 p.f.u. per cell, 16 h) with either wild-type or
Cre
+
MuHV-4, then fixed and incubated with X-Gal to reveal b-
galactosidase expression, indicating Cre-mediated recombination.
Arrowheads show examples of positive staining. (b) ROSA26-
lacZ
flox/flox
mice were infected i.p. with Cre
+
MuHV-4. Three days
later, diaphragms were stained post-mortem for b-galactosidase
expression with X-Gal. Representative images from two mice are
shown. (c) p53
flox/flox
K-ras
LSL-G12D/+
mice were infected i.p. with
wild-type or Cre
+
MuHV-4. All of the former mice remained
healthy; all but one of those infected with Cre
+
MuHV-4
developed cancers within 3 months. Equivalent results were
obtained in three further experiments. (d) A typical i.p. cancer.
P. G. Stevenson and others
2178 Journal of General Virology 91
Page 3
This lack of disease without lytic spread suggested that
vaccination might still work for example, the cells first
encountered by incoming virions might not be trans-
formed by k-ras. We therefore immunized p53
flox/flox
K-ras
LSL-G12D/+
mice either i.n. or i.p. with ORF73
2
Cre
2
MuHV-4, which lacks episome maintenance and so fails to
persist in vivo (Fowler et al., 2003; Moorman et al., 2003).
This protected completely against Cre
+
virus challenge
(Fig. 6).
As a further test of vaccine efficacy, we established an i.n.
Cre
+
virus challenge mod el (Fig. 7). This caused a more
rapid illness than i.p. infection, with weight loss and
respiratory difficulties as early as 7 days post-inocu-
lation. The lungs of infected mice became grossly
enlarged, and histological examination (Fig. 7a) sho wed
extensive cell proliferation obliterating the alveolar air
spaces. p53
flox/flox
K-ras
LSL-G12D/+
mice infected with
Cre
2
MuHV-4 and p53
flox/flox
mice infected with Cre
+
MuHV-4 remained clinically well, so disease again
reflected k-ras activation. In situ h ybridization (Fig. 7b)
showed viral tRNA exp ression in acutely infected lungs
and lymphoid tissue, but not in diseased lungs.
Therefore, viral genomes were again lost rapidly from
the transformed cells. Vaccination i.p. with Cre
2
ORF73
2
MuHV-4 protected completely against both macroscopic
and microscopic disease (Fig. 7c–e). It also protected
against t he milder histological changes induced by Cre
+
MuHV-4 in p53
flox/flox
mice (Fig. 8).
DISCUSSION
A viral aetiology is rarely considered for cancers that lack
viral genomes. Our data show that cells driven to
proliferate by host oncogenes readily lose gammaherpes-
virus genomes in vivo. Relying on viral genome detection to
establish aetiolo gy could therefore underestimate the
number of cancers to which gammaherpesviruses contrib-
ute. Most analyses of human cancers have focused on
examples of genome retention. The hypothesis that these
viral genomes contribute to disease (Hammerschmidt &
Sugden, 2004) makes sense, as there must be a growth
advantage to offset any immune recognition of viral
antigens. Thus, whilst EBV genes seem not to drive the
growth of EBV
+
Burkitt’s lymphoma directly (Kang et al.,
2005), they may still provide important co-factors
(Thorley-Lawson & Allday, 2008). However, the retention
of viral genomes by some cancer types does not establish
that viral genome retention is the norm. Interestingly,
whilst EBV
+
Burkitt’s lymphoma is associated strongly
with immunosuppressive malaria infection, EBV
2
Burkitt’s
Fig. 3. MuHV-4-triggered sarcomas. (a) Representative haematoxylin/eosin-stained sections from p53
flox/flox
K-ras
LSL-G12D/+
mice infected with Cre
+
MuHV-4. Bar, 100 mm. (b) Cancer or spleen sections of Cre
+
MuHV-4-infected p53
flox/flox
K-ras
LSL-G12D/+
mice were probed for MuHV-4 tRNAs 1–4. Representative images are shown. Arrowheads show positive
cells. Bar, 100 mm. (c) DNA samples from paired cancers and spleens were analysed for viral genome copy number by
quantitative PCR. Each viral copy number is expressed relative to the cellular DNA copy number in the same sample.
Viral genome loss
http://vir.sgmjournals.org 2179
Page 4
lymphoma occurs later and shows no such association.
Thus, in immunocompetent hosts, EBV ge nome loss may
be required for cancers to evolve.
Viral antigen recognition (Rickinson & Moss, 1997)
provides a context for understanding both genome-positive
and genome-negative cancers. Cells driven to proliferate by
the EBV growth programme are normally killed by
antiviral T cells, so EBV- driven cancers are limited to the
immunocompromised. In contrast, host mutations drive
non-immunogenic cell proliferation even when the viral
growth programme is turned off. This creates a new
balance: viral genes are now required only for accessory
roles, allowing viral antigen recognition to be reduced.
However, some immune control may still occur for
example, the evasion of antigen presentation by gamma-
herpesvirus episome-maintenance proteins (Yin et al.,
2003; Bennett et al., 2005) can fail at high proliferation
rates (Mu
¨
nz, 2004). Also, the accumulation of host
mutations is unlikely to stop. If host mutations alone
remain insufficient to maintain tra nsformation, cancer
cells losing viral genomes will themselves be lost; however,
if host mutations become sufficient, then antiviral T cells
can select for viral gen ome loss.
The predominance of sarcomas in our model was
surprising, as MuHV-4 classically persists in B cells
(Sunil-Chandra et al., 1992). However, stromal cells may
also be an important site of persistence (Stewart et al.,
1998; Sua
´
rez and van Dyk, 2008) consistent with such an
idea, ORF50
2
MuHV-4 genomes were well-maintained
over 3 weeks in both BHK-21 and p53
2/2
K-ras
LSL-G12D/+
fibroblasts (data not shown). Stromal cells may also be
more sensitive than B cells to transformation by k-ras
(Nicolaides et al., 1994; Janssen et al., 2005). A key point is
that known viral tropisms do not necessarily predict the
cell type of virus- triggered cancers. Thus, hit-and-run
oncogenesis may be more relevant to rarely EBV
+
cancers
Fig. 4. Analysis of explanted cancer cells from Cre
+
MuHV-4-infected p53
flox/flox
K-ras
LSL-G12D/+
mice. (a) A typical
phase-contrast image of a primary cancer culture 1 day post-explant. (b) Immunostaining of a primary cancer culture at
3 days post-explant shows typical VCAM-1
+
CD44
+
CD138
+
fibroblasts, and some F4/80
+
macrophages. Occasional
fibroblasts (,1 %) were viral antigen-positive, shown here by staining for the ORF75c tegument protein. (c) Cloned
cancer cells were analysed for viral genomes by quantitative PCR. Viral DNA copy numbers are expressed relative to
cellular DNA copy numbers. Only clone 10 yielded infectious v irus; below the dashed line (,1 viral genome per 100 cell
genomes), clones were considered virus-negative. (d) A subset of the clones in (c) was further analysed by probing PstI-
digested DNA (1 mg per lane5500 000 cells) for the MuHV -4 1 .2 kb terminal repeat (approx. 30 copies per genome) by
Southern blotting. One picogram of plasmid DNA5200 000 copies, so no detectable viral genomes implies ,1copyper
75 cells.
P. G. Stevenson and others
2180 Journal of General Virology 91
Page 5
such as gastric adenocarcinoma (Deyrup, 2008; Shah &
Young, 2009) than to those of B cells. Even in
transformed fibroblasts, MuHV-4 (unlike HSV) is far
from uniformly lytic (May et al. , 2004), and productive
MuHV-4 spread is strongly constrained in vivo by h ost
immunity. Therefore, it would seem quite feasible for a
virus-positive cancer to develop in a cell type permissive
for lytic replication.
There is no certain way to identify a human cancer as
previously virus-positive once it becomes virus-negative, so
human gammaherpesvirus disease burdens may only be
revealed by vaccination. This is not necessarily straight-
forward: subunit vaccines have so far failed to limit
gammaherpesvirus persistence (Sokal et al.,2007;
Stevenson et al., 2009). However, live-attenuated vaccines
can reduce MuHV-4 latent loads (Tibbetts et al., 2003;
Boname et al., 2004; Fowler & Efstathiou, 2004; Rickabaugh
et al., 2004). Here, we extended this protection to a high-
penetrance cancer. Latency-deficient EBV and KSHV
vaccines therefore deserve serious consideration. The pos-
sibility that gammaherpesviruses contribute to more cancers
than simply those remaining viral genome-positive argues
that such vaccines might greatly benefit human health.
METHODS
Mice. p53
flox/flox
(Marino et al., 2000), K-ras
LSL-G12D/+
(Jackson
et al., 2001) and ROSA26- lacZ
flox/flox
(Soriano, 1999) mice were
infected with MuHV-4 either i.n. under general anaesthesia
(10
4
p.f.u.) or i.p. (10
6
p.f.u.). All experiments conformed to local
and national ethical regulations. Mice were killed when they showed
macroscopic cancers or other signs of ill health. All mice were
examined post-mortem for clinically inapparent cancers. The PCR
primer sequences for detecting loxP recombination were: p53 59-
CACAAAAACAGGTTAAACCCAG and 59-GAAGACAGAAAAGGG-
GAGGG to detect only the recombined locus (612 bp); and k-ras
59-CCATGGCTTGAGTAAGTCTGC and 59-CGCAGACTGTAGA-
GCAGCG to detect the ‘floxed’ (flanked by loxP sites) G12D k-ras
cassette (550 bp) before but not after recombination, or 59-
GTCTTTCCCCAGCACAGTGC, 59-CTCTTGCCTACGCCACCAGC-
TC and 59-AGCTAGCCACCATGGCTTGAGTAAGTCTGCA to amp-
lify from the floxed G12D k-ras cassette a 500 bp band before
recombination and a 650 bp band after recombination.
Cells. For ex vivo explants, tiss ues were minced finely and digested
with trypsin before cultu re. Embryonic fibroblasts were d erived
fro m 14 day embryos. All cell s were grown in Dulbecco’s modified
Eagle’s medium supplemented with 10 % fetal calf serum, 2 mM
glutamine, 50
mM b -mercaptoethanol (Sigma), 100 U penicillin
ml
21
and 100 mg streptomycin ml
21
. All media and reagents listed
here except
b-mercaptoethanol were from PAA Laboratories
GmbH.
Fig. 5. PCR detection of Cre-mediate d recombination in samples from Cre
+
MuHV-4-infected p53
flox/flox
K-ras
LSL-G12D/+
mice. (a) PCR ana lysis of the p53 locus of two p53
flox/flox
K-ras
LSL-G12D/+
mice, their primary cancers and fibroblast clones
deriv ed from them. The primers amplify the floxed p53 locu s only after recombination (612 bp). Identical data were obtained
for a further 10 mice. Negative images of ethidiu m bromide-stained PCR produ cts are shown. (b) PCR analysis of the floxe d
G12D k-ras cassette of the same samples. The primers amplify the cassette (550 bp) be fore but not after recombination. (c)
Multiplex PCR analysis of the ras locus of the same samples plus additional controls. The primers amplify from the wild-type k-
ras locus a 622 bp band, and from the floxed G12D k-ras cassette a 500 bp band before recombination and a 650 bp ba nd
after recombination. The clones lack the 500 bp band of the parental cancers because they contain no cells with
unrecombined G12D k-ras. WT, p53
flox/f lox
G12D k-ras
/
littermate; mut, purified 500 bp band; control DNA, non-transgenic
mice.
Viral genome loss
http://vir.sgmjournals.org 2181
Page 6
Viruses. ORF73
2
MuHV-4 has been described previously (Fowler
et al., 2003). To make Cre
+
MuHV-4, an HCMV IE1 promoter-
driven Cre expression cassette was excised from pGS403 (Smith &
Enquist, 2000) with SalI/SacII, end-repaired and cloned into the
intergenic MfeI site (genomic co-ordinate 77176 of GenBank
accession no. U97553) of a BglII MuHV-4 genomic clone (co-ordinates
75338–78717). All other genomic co-ordinates are also given relative to
GenBank accession no. U97553. The Cre expression cassette plus
genomic flanks was then subcloned with SphI/ScaI (78413–75785) into
the SphI/SmaI sites of pST76K-SR and recombined into an MuHV-4
BAC (Adler et al., 2000). Infectious virus was recovered by transfecting
BAC DNA into BHK-21 cells. The BAC cassette was removed by virus
passage through NIH-3T3-CRE cells (Stevenson et al., 2002) and virus
stocks were grown in BHK-21 cells (de Lima et al., 2004). Replication-
deficient, Cre
+
MuHV-4 was made by digesting a HincII genomic
fragment (63844–70433) in pUC9 with BsmI (67792) and ClaI (69177)
to remove most of ORF50 exon 2 (67661–69376). The Cre coding
sequence plus a 39 poly(A) site from pGS403 was ligated in its place in
frame with the ORF50 AUG. The Cre coding sequence plus genomic
flanks (66120–70433) was then subcloned with KpnI into pST76K-SR,
and recombined into the MuHV-4 BAC. ORF50
2
Cre
+
virus was
recovered by transfecting BAC DNA into NIH-3T3-TET50 cells and
inducing ORF50 expression with doxycycline (Milho et al., 2009).
Virus assays. Virus stocks were titrated by plaque assay on BHK-21
cells (de Lima et al., 2004). Latent virus was measured by infectious
centre assay (de Lima et al., 2004). Plaque titres of freeze–thawed
spleen cells were always ,1 % of infectious centre assay titres. Viral
genome loads were measured by quantitative PCR (Milho et al.,
2009). Briefly, MuHV-4 genomic co-ordinates 4166–4252 were
amplified from 50–100 ng DNA and quantified by hybridization
with a Taqman probe (genomic coordinates 4218–4189) (Rotor Gene
3000; Corbett Research), in comparison with a standard curve of
cloned plasmid template amplified in parallel. Cellular DNA was
quantified in the same way by amplifying part of the adenosine
phosphoribosyltransferase gene (forward primer, 59-GGGGCAA-
AACCAAAAAAGGA; reverse primer, 59-TGTGTGTGGGGCCTGA-
GTC; probe, 59-TGCCTAAACACAAGCATCCCTACCTCAA).
To quantify viral DNA by Southern blotting, DNA was extracted from
cells (Wizard Genomic DNA purification kit; Promega), digested with
PstI, electrophoresed, transferred to Hybond nylon membranes (Roche
Diagnostics), then probed with a
[
32
P
]
dCTP random-primed 1.2 kb PstI
genomic fragment corresponding to the MuHV-4 terminal repeat unit
(Efstathiou et al.,1990),washed(65uC, 0.2 % SSC, 0.1 % SDS) and
exposed to X-ray film. Recombinant viruses were analysed qualitatively
for genomic structure in a similar way, except that viral DNA was
digested with BglII or HindIII and probed with a BglII-restricted genomic
fragment (co-ordinates 75338–78717) or the HCMV IE1–Cre construct.
Cells expressing viral tRNAs 1–4 were detected by in situ hybridization
of formaldehyde-fixed, paraffin-embedded spleen cell sections, using a
digoxigenin-labelled riboprobe transcribed from pEH1.4 (Bowden et
al., 1997). Hybridized probe was detected with alkaline phosphatase-
conjugated anti-digoxigenin Fab fragments (Roche Diagnostics).
b-Galactosidase assay. In vitro samples were fixed in 4 %
formaldehyde (30 min), then washed in PBS and incubated (3 h,
37 uC) in PBS with 0.01 % sodium deoxycholate, 0.02 % Nonidet P-
40, 2 mM MgCl
2
, 4.5 mM potassium ferricyanide, 4.5 mM potassium
ferrocyanide, 1 mg X-Gal ml
21
, before washing. In vivo samples were
fixed in 4 % formaldehyde (18 h) then frozen in OCT medium,
sectioned, washed in PBS and developed as described above before
washing and mounting.
Immunofluorescence. Cells were plated onto glass cover slides, then
fixed (4 % formaldehyde, 30 min), permeabilized (0.1 % Triton X-
100, 15 min), blocked (3 % BSA in PBS, 15 min) and stained for
syndecan-1, CD44, VCAM-1 (all mAbs from BD Biosciences) or with
the macrophage-specific mAb F4/80 (AbCam) plus Alexa Fluor 568-
conjugated goat anti-rat IgG pAb (Invitrogen), for the MuHV-4
ORF75c using mAb BN-6C12 (Gaspar et al., 2008) plus Alexa Fluor
568-conjugated goat anti-mouse IgG pAb (Invitrogen), for MuHV-4
Fig. 6. Vaccination against MuHV-4-triggered sarcomas. (a)
p53
flox/flox
K-ras
LSL-G12D/+
mice were not vaccinated or vaccinated
i.p. with ORF73
Cre
MuHV-4, then 2 months later challenged
i.p. with Cre
+
MuHV-4 and followed for cancer incidence.
At 4 months, the vaccinated mice showed no disease. The
data are from one of two equivalent experiments. (b)
p53
flox/flox
K-ras
LSL-G12D/+
mice were not vaccinated or vaccinated
i.n. with ORF73
Cre
MuHV-4, then 2 months later challenged i.p.
with Cre
+
MuHV-4 as in (a). The data are from one of two
equivalent experiments. (c) In an equivalent experiment to (b),
spleens were were analysed for viral DNA content by quantitative
PCR 1 month after Cre
+
virus challenge. Viral genomes per cell
genome are shown for each mouse (means of three replicate
reactions). The dashed line shows the sensitivity limit of one viral
genome per 500 cell genomes.
P. G. Stevenson and others
2182 Journal of General Virology 91
Page 7
antigens using a polyclonal rabbit serum (Sunil-Chandra et al., 1992)
and for Cre recombinase using a polyclonal rabbit serum (AbCam)
plus goat anti-rabbit IgG pAb (Invitrogen). The cells were mounted in
ProLong Gold anti-fade reagent with DAPI (Invitrogen) and imaged
using an Olympus IX70 microscope plus a Retiga 2000R camera line
(QImaging).
ACKNOWLEDGEMENTS
We thank Heather Coleman for generating ORF50
2
Cre
+
MuHV-4,
Dave Tuveson and Doug Winton for providing mice, and Barry
Potter and Ming Du for help with histology. P. G. S. is a Wellcome
Trust Senior Clinical Fellow (GR076956MA). This work was also
Fig. 7. Vaccination against i.n. Cre
+
MuHV-4 challenge. (a) p53
flox/flox
K-ras
LSL-G12D/+
or p53
flox/flox
mice were infected i.n. with
Cre
+
MuHV-4. Lungs were examined by haematoxylin/eosin staining at 15 or 35 days post-infection. The p53
flox/flox
mice
showed moderate abnormalities but remained clinically well. Bar, 100 mm. Sections are representative of at least six mice per
group. (b) p53
flox/flox
K-ras
LSL-G12D/+
mice were not infected or infected i.n. with Cre
+
MuHV-4. Lungs and mediastinal lymph
nodes (MLN) were analysed for viral tRNAs by in situ hybridization. The sections are each representative of at least five mice per
group. The arrows show examples of positive cells. Bar, 100 mm. (c) p53
flox/flox
K-ras
LSL-G12D/+
mice were vaccinated i.p. with
ORF73
Cre
MuHV-4, and 2 months later challenged i.n. with Cre
+
MuHV-4. Mice were killed when they showed .20 %
weight loss or progressive respiratory difficulties. The vaccinated mice remained entirely well. Equivalent data were obtained in
one further experiment. (d) Ex vivo p53
flox/flox
K-ras
LSL-G12D/+
lungs (three per group) are shown 1 month after i.n. Cre
+
MuHV-4,
after the same challenge but vaccinated i.p. with Cre
ORF73
MuHV-4 2 months earlier, or without infection. Equivalent results
were obtained in three further experiments. (e) Lungs of p53
flox/flox
K-ras
LSL-G12D/+
mice were examined by haematoxylin/eosin
staining 35 days post-infection with Cre
+
MuHV-4. The lungs of vaccinated mice were macroscopically and histologically normal.
Three representative images are shown for each group. Equivalent results were obtained in two further experiments, each with five
mice per group. Bar, 100 mm.
Viral genome loss
http://vir.sgmjournals.org 2183
Page 8
supported by the Medical Research Council (G0701185) and the
Wellcome Trust (WT089111MA).
REFERENCES
Adler, H., Messerle, M., Wagner, M. & Koszinowski, U. H. (2000).
Cloning and mutagenesis of the murine gammaherpesvirus 68 genome
as an infectious bacterial artificial chromosome. J Virol 74, 6964–6974.
Ambinder, R. F. (2000). Gammaherpesviruses and ‘‘hit-and-run’’
oncogenesis. Am J Pathol 156, 1–3.
Bennett, N. J., May, J. S. & Stevenson, P. G. (2005). Gamma-
herpesvirus latency requires T cell evasion during episome mainten-
ance. PLoS Biol 3, e120.
Blumberg, B. S. (1997). Hepatitis B virus, the vaccine, and the
control of primary cancer of the liver. Proc Natl Acad Sci U S A 94,
7121–7125.
Boname, J. M., Coleman, H. M., May, J. S. & Stevenson, P. G. (2004).
Protection against wild-type murine gammaherpesvirus-68 latency by
a latency-deficient mutant. J Gen Virol 85, 131–135.
Bowden, R. J., Simas, J. P., Davis, A. J. & Efstathiou, S. (1997).
Murine gammaherpesvirus 68 encodes tRNA-like sequences that are
expressed during latency. J Gen Virol 78, 1675–1687.
Carbone, A., Cesarman, E., Spina, M., Gloghini, A. & Schulz, T. F.
(2009).
HIV-associated lymphomas and gamma-herpesviruses. Blood
113, 1213–1224.
de Lima, B. D., May, J. S. & Stevenson, P. G. (2004). Murine
gammaherpesvirus 68 lacking gp150 shows defective virion release
but establishes normal latency in vivo. J Virol 78, 5103–5112.
Deyrup, A. T. (2008). Epstein–Barr virus-associated epithelial and
mesenchymal neoplasms. Hum Pathol 39, 473–483.
Dittmer, D. P., Hilscher, C. J., Gulley, M. L., Yang, E. V., Chen, M. &
Glaser, R. (2008).
Multiple pathways for Epstein–Barr virus episome
loss from nasopharyngeal carcinoma. Int J Cancer 123, 2105–2112.
DuPage, M., Dooley, A. L. & Jacks, T. (2009). Conditional mouse lung
cancer models using adenoviral or lentiviral delivery of Cre
recombinase. Nat Protoc 4, 1064–1072.
Efstathiou, S., Ho, Y. M. & Minson, A. C. (1990). Cloning and
molecular characterization of the murine herpesvirus 68 genome.
J Gen Virol 71, 1355–1364.
Fowler, P. & Efstathiou, S. (2004). Vaccine potential of a murine
gammaherpesvirus-68 mutant deficient for ORF73. J Gen Virol 85,
609–613.
Fowler, P., Marques, S., Simas, J. P. & Efstathiou, S. (2003). ORF73
of murine herpesvirus-68 is critical for the establishment and
maintenance of latency. J Gen Virol 84, 3405–3416.
Frazer, I. H. (2004). Prevention of cervical cancer through
papillomavirus vaccination. Nat Rev Immunol 4, 46–54.
Ganem, D. (2006). KSHV infection and the pathogenesis of Kaposi’s
sarcoma. Annu Rev Pathol 1, 273–296.
Gaspar, M., Gill, M. B., Lo
¨
sing, J. B., May, J. S. & Stevenson, P. G.
(2008).
Multiple functions for ORF75c in murid herpesvirus-4
infection. PLoS One 3, e2781.
Hammerschmidt, W. & Sugden, B. (2004). Epstein–Barr virus
sustains Burkitt’s lymphomas and Hodgkin’s disease. Trends Mol
Med 10, 331–336.
Jackson, E. L., Willis, N., Mercer, K., Bronson, R. T., Crowley, D.,
Montoya, R., Jacks, T. & Tuveson, D. A. (2001).
Analysis of lung
tumor initiation and progression using conditional expression of
oncogenic K-ras. Genes Dev 15, 3243–3248.
Janssen, K. P., Abal, M., El Marjou, F., Louvard, D. & Robine, S.
(2005).
Mouse models of K-ras-initiated carcinogenesis. Biochim
Biophys Acta 1756, 145–154.
Kang, M. S., Lu, H., Yasui, T., Sharpe, A., Warren, H., Cahir-
McFarland, E., Bronson, R., Hung, S. C. & Kieff, E. (2005).
Epstein–
Barr virus nuclear antigen 1 does not induce lymphoma in transgenic
FVB mice. Proc Natl Acad Sci U S A 102, 820–825.
Marino, S., Vooijs, M., van Der Gulden, H., Jonkers, J. & Berns, A.
(2000).
Induction of medulloblastomas in p53-null mutant mice by
somatic inactivation of Rb in the external granular layer cells of the
cerebellum. Genes Dev 14, 994–1004.
May, J. S., Coleman, H. M., Smillie, B., Efstathiou, S. & Stevenson, P. G.
(2004).
Forced lytic replication impairs host colonization by a latency-
deficient mutant of murine gammaherpesvirus-68. JGenVirol85,137
146.
Milho, R., Smith, C. M., Marques, S., Alenquer, M., May, J. S., Gillet, L.,
Gaspar, M., Efstathiou, S., Simas, J. P. & Stevenson, P. G. (2009).
In
vivo imaging of murid herpesvirus-4 infection. J Gen Virol 90, 21–32.
Moorman, N. J., Willer, D. O. & Speck, S. H. (2003). The
gammaherpesvirus 68 latency-associated nuclear antigen homolog is
Fig. 8. Protection of p53
flox/flox
mice against i.n. Cre
+
MuHV-4 by an ORF73
Cre
vaccine. p53
flox/flox
mice were not
vaccinated or vaccinated i.p. with ORF73
Cre
MuHV-4, then 3 months later challenged i.n. with ORF73
+
Cre
+
MuHV-4.
Lungs were examined histologically at 1 month post-challenge. Equivalent p53
flox/flox
K-ras
LSL-G12D/+
lungs are shown in Fig. 7.
Bars, 100 mm. The results are representative of .15 mice per group from three independent experiments.
P. G. Stevenson and others
2184 Journal of General Virology 91
Page 9
critical for the establishment of splenic latency. J Virol 77, 10295–
10303.
Mu¨ nz, C. (2004). Epstein–Barr virus nuclear antigen 1: from
immunologically invisible to a promising T cell target. J Exp Med
199, 1301–1304.
Nicolaides, A., Huang, Y. Q., Li, J. J., Zhang, W. G. & Friedman-Kien,
A. E. (1994). Gene amplification and multiple mutations of the K-ras
oncogene in Kaposi’s sarcoma. Anticancer Res 14, 921–926.
Pleasance, E. D., Cheetham, R. K., Stephens, P. J., McBride, D. J.,
Humphray, S. J., Greenman, C. D., Varela, I., Lin, M. L., Ordo
´
n
˜
ez, G. R.
& other authors (2010).
A comprehensive catalogue of somatic
mutations from a human cancer genome. Nature 463, 191–196.
Proenc¸ a, J. T., Coleman, H. M., Connor, V., Winton, D. J. & Efstathiou, S.
(2008). A historical analysis of herpes simplex virus promoter activation
in vivo reveals distinct populations of latently infected neurones. JGen
Virol 89, 2965–2974.
Rickabaugh, T. M., Brown, H. J., Martinez-Guzman, D., Wu, T. T.,
Tong, L., Yu, F., Cole, S. & Sun, R. (2004). Generation of a latency-
deficient gammaherpesvirus that is protective against secondary
infection. J Virol 78, 9215–9223.
Rickinson, A. B. & Moss, D. J. (1997). Human cytotoxic T lymphocyte
responses to Epstein–Barr virus infection. Annu Rev Immunol 15,
405–431.
Rosa, G. T., Gillet, L., Smith, C. M., de Lima, B. D. & Stevenson, P. G.
(2007).
IgG Fc receptors provide an alternative infection route for
murine gamma-herpesvirus-68. PLoS One 2, e560.
Shah, K. M. & Young, L. S. (2009). Epstein–Barr virus and carcinogenesis:
beyond Burkitt’s lymphoma. Clin Microbiol Infect 15, 982–988.
Smith, G. A. & Enquist, L. W. (2000). A self-recombining bacterial
artificial chromosome and its application for analysis of herpesvirus
pathogenesis. Proc Natl Acad Sci U S A 97, 4873–4878.
Smith, C. M., Gill, M. B., May, J. S. & Stevenson, P. G. (2007). Murine
gammaherpesvirus-68 inhibits antigen presentation by dendritic cells.
PLoS One 2, e1048.
Sokal, E. M., Hoppenbrouwers, K., Vandermeulen, C., Moutschen, M.,
Le
´
onard, P., Moreels, A., Haumont, M., Bollen, A., Smets, F. & Denis,
M. (2007).
Recombinant gp350 vaccine for infectious mononucleosis: a
phase 2, randomized, double-blind, placebo-controlled trial to evaluate
the safety, immunogenicity, and efficacy of an Epstein–Barr virus
vaccine in healthy young adults. J Infect Dis 196, 1749–1753.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre
reporter strain. Nat Genet 21, 70–71.
Stevenson, P. G., May, J. S., Smith, X. G., Marques, S., Adler, H.,
Koszinowski, U. H., Simas, J. P. & Efstathiou, S. (2002). K3-mediated
evasion of CD8
+
T cells aids amplification of a latent c-herpesvirus.
Nat Immu nol 3, 733–740.
Stevenson, P. G., Simas, J. P. & Efstathiou, S. (2009). Immune
control of mammalian gamma-herpesviruses: lessons from murid
herpesvirus-4. J Gen Virol 90, 2317–2330.
Stewart, J. P., Usherwood, E. J., Ross, A., Dyson, H. & Nash, T.
(1998). Lung epithelial cells are a major site of murine gamma-
herpesvirus persistence. J Exp Med 187, 1941–1951.
Sua
´
rez, A. L. & van Dyk, L. F. (2008). Endothelial cells support
persistent gammaherpesvirus 68 infection. PLoS Pathog 4, e1000152.
Sunil-Chandra, N. P., Efstathiou, S. & Nash, A. A. (1992). Murine
gammaherpesvirus 68 establishes a latent infection in mouse B
lymphocytes in vivo. J Gen Virol 73, 3275–3279.
Sunil-Chandra, N. P., Arno, J., Fazakerley, J. & Nash, A. A. (1994).
Lymphoproliferative disease in mice infected with murine gamma-
herpesvirus 68. Am J Pathol 145, 818–826.
Tarakanova, V. L., Suarez, F., Tibbetts, S. A., Jacoby, M. A., Weck, K. E.,
Hess, J. L., Speck, S. H. & Virgin, H. W., IV (2005). Murine
gammaherpesvirus 68 infection is associated with lymphoproliferative
disease and lymphoma in BALB
b2 microglobulin-deficient mice.
J Virol 79, 14668–14679.
Thorley-Lawson, D. A. & Allday, M. J. (2008). The curious case of the
tumour virus: 50 years of Burkitt’s lymphoma. Nat Rev Microbiol 6,
913–924.
Tibbetts, S. A., McClellan, J. S., Gangappa, S., Speck, S. H. & Virgin,
H. W., IV (2003).
Effective vaccination against long-term gamma-
herpesvirus latency. J Virol 77, 2522–2529.
Yin, Y., Manoury, B. & Fahraeus, R. (2003). Self-inhibition of
synthesis and antigen presentation by Epstein–Barr virus-encoded
EBNA1. Science 301, 1371–1374.
Viral genome loss
http://vir.sgmjournals.org 2185
Page 10
  • Source
    • " In overt cancer, it will lead to a drastic reduction of sensitivity for tests detecting viral genes due to the complete disappearance of the virus in tumor cells [57], shows an evident lack of IHC staining for BKV L-Tag, as compared to B) a tissue specimen from a kidney transplant with virus reactivation (unpublished data provided by the authors). [38]. To support the " hit and run " theory, in the present study we assessed a cumulative prevalence of BKV in PCa. We calculated the risk of cancer development with BKV infection on previous studies regarding the association between BKV and PCa in order to interpret the contrasting results and to explore whether there might be a significan"
    [Show abstract] [Hide abstract] ABSTRACT: The Polyomavirus BK (BKV) has been proposed to be one of the possible co-factors in the genesis of prostate cancer (PCa) but, so far, the only convincing suggestion is the hypothesis of a "hit and run" carcinogenic mechanism induced by the virus at early stages of this disease. To support this hypothesis we conducted an updated systematic review on previous studies regarding the association between BKV and PCa, in order to interpret the contrasting results and to explore whether there might be a significant virus-disease link. This updated analysis provides evidence for a significant link between BKV expression and PCa development, particularly between the BKV infection and the cancer risk. Forthcoming scientific efforts that take cue from this study might overcome the atavistic and fruitless debate regarding the BKV-PCa association.
    Full-text · Article · Apr 2014
  • Source
    • "Hit-and-run oncogenesis is most frequently considered in the context of virally induced cancers.28 The idea that cancer progression can persist in the absence of initiating viral oncoprotein expression is supported by laboratory models in which a transformed cellular phenotype persists despite loss of viral oncoprotein expression for adenoviruses,29,30 herpesviruses,31,32 and the polyomavirus Simian virus 40 (SV40) large T antigen (TAg).33–37 Hit-and-run–mediated pathophysiology has been suggested as a pathway for polyomavirus in human brain tumors and mesotheliomas,38–40 JC virus in colorectal cancer,41 papillomaviruses in Schneiderian inverted papillomas,42 and Hepatitis B in hepatomas.43 "
    [Show abstract] [Hide abstract] ABSTRACT: In a medical sense, biomodulation could be considered a biochemical or cellular response to a disease or therapeutic stimulus. In cancer pathophysiology, the initial oncogenic stimulus leads to cellular and biochemical changes that allow cells, tissue, and organism to accommodate and accept the oncogenic insult. In epithelial cell cancer development, the process of carcinogenesis is frequently characterized by sequential cellular and biochemical adaptations as cells transition through hyperplasia, dysplasia, atypical dysplasia, carcinoma in situ, and invasive cancer. In some cases, the adaptations may persist after the initial oncogenic stimulus is gone in a type of "hit-and-run" oncogenesis. These pathophysiological changes may interfere with cancer prevention therapies targeted solely to the initial oncogenic insult, perhaps contributing to resistance development. Characterization of these accommodating adaptations could provide insight for the development of cancer preventive regimens that might more effectively biomodulate preneoplastic cells toward a more normal state.
    Full-text · Article · Oct 2012 · Annals of the New York Academy of Sciences
  • [Show abstract] [Hide abstract] ABSTRACT: Evaluation of: Stevenson PG, May JS, Connor V, Efstathiou S: Vaccination against a hit-and-run viral cancer. J. Gen. Virol. 91, 2176-2185 (2010). Viral hit-and-run oncogenesis scenarios suggest that transient acquisition of viral genomes can induce a permanent change in the gene expression pattern of the host cell, resulting in malignant conversion. Stevenson et al. developed an in vivo model system based on the introduction of a Cre-recombinase positive murid herpesvirus into genetically engineered mice. They demonstrated that the Cre recombinase could switch on a silent oncogene and inactivate a tumor suppressor gene resulting in sarcomagenesis. However, some of the tumors lacked herpesvirus genomes, suggesting a hit-and-run type oncogenesis. The authors also observed that vaccination could prevent sarcomagenesis in their model.
    No preview · Article · Jan 2011 · Future Virology
Show more

Similar Publications