Article

Sulfide:quinone Oxidoreductase from Echiuran Worm Urechis unicinctus

Key Laboratory of Marine Genetics and Breeding, Ministry of Education, Ocean University of China, Qingdao, 266003, China.
Marine Biotechnology (Impact Factor: 3.27). 04/2010; 13(1):93-107. DOI: 10.1007/s10126-010-9273-3
Source: PubMed

ABSTRACT

Sulfide is a natural, widely distributed, poisonous substance, and sulfide:quinone oxidoreductase (SQR) has been identified to be responsible for the initial oxidation of sulfide in mitochondria. In this study, full-length SQR cDNA was cloned from the echiuran worm Urechis unicinctus, a benthic organism living in marine sediments. The protein consisted of 451 amino acids with a theoretical pI of 8.98 and molecular weight of 50.5 kDa. Subsequently, the SQR mRNA expression in different tissues was assessed by real-time reverse transcription and polymerase chain reaction and showed that the highest expression was in midgut, followed by anal sacs and coelomic fluid cells, and then body wall and hindgut. Furthermore, activated SQR was obtained by dilution refolding of recombinant SQR expression in E. coli, and the refolded product showed optimal activity at 37 °C and pH 8.5 and K
m for ubiquinone and sulfide at 15.6 µM and 40.3 µM, respectively. EDTA and GSH had an activating effect on refolded SQR, while Zn2+ caused decreased activity. Western blot showed that SQR in vivo was located in mitochondria and was ∼10 kDa heavier than the recombinant protein. In addition, SQR, detected by immunohistochemistry, was mainly located in the epithelium of all tissues examined. Ultrastructural observations of these tissues’ epithelium by transmission electron microscopy provided indirect cytological evidence for its mitochondrial location. Interesting aspects of the U. unicinctus SQR amino acid sequence, its catalytic mechanism, and the different roles of these tissues in sulfide metabolic adaptation are also discussed.

Full-text

Available from: Zhifeng Zhang, Aug 01, 2014
ORIGINAL ARTICLE
Sulfide:quinone Oxidoreductase from Echiuran Worm
Urechis unicinctus
Yu-Bin Ma & Zhi-Feng Zhang & Ming-Yu Shao &
Kyoung-Ho Kang & Zhi Tan & Jin-Long Li
Received: 14 October 2009 / Accepted: 3 January 2010 /Published online: 25 April 2010
#
Springer Science+Business Media, LLC 2010
Abstract Sulfide is a natural, widely distributed, poisonous
substance, and sulfide:quinone oxidoreductase (SQR) has
been identified to be responsible for the initial oxidation of
sulfide in mitochondria. In this study, full-length SQR cDNA
was cloned from the echiuran worm Urechis unicinctus,a
benthic organism living in marine sediments. The protein
consisted of 451 amino acids with a theoretical pI of 8.98
and molecular weight of 50.5 kDa. Subsequently, the SQR
mRNA expression in different tissues was assessed by real-
time reverse transcription and polymerase chain reaction and
showed that the highest expression was in midgut, followed
by anal sacs and coelomic fluid cells, and then body wall
and hindgut. Furthermore, activated SQR was obtained
by diluti on refolding of recombinant SQR expression in
E. coli, and the refolded product showed optimal activity
at 37 °C and pH 8.5 and K
m
for ubiquinon e and sulfid e at
15.6 µM and 40.3 µM, respectively. EDTA and GSH had
an activating effect on refolded SQR, while Zn
2+
caused
decreased activity. Western blot showed that SQR in vivo
was located in mitochondria and was 10 kDa heavier
than the recombinant protein. In addition, SQR, detected
by immunohistochemistry, was mainly located in the
epithelium of all tissues examined. Ultrastructural obser-
vations of these tissues epithelium by transmission
electron microscopy provided indirect cytological evi-
dence for its mitochondrial location. Interesting aspects of
the U. unicinctus SQR amino acid sequence, its catalytic
mechanism, and the different roles of these tissues in
sulfide metabolic adaptation are also discussed.
Keywords Mitochondria
.
Sulfide:quinone oxidoreductase
(SQR)
.
Sulfide
.
Urechis unicinctus
Introduction
Although endogenous hydrogen sulfide acts as a gaseous
transmitter and regulates several physiologi cal processes in
mammals (Wang 2002), exogenous sulfide (H
2
S, HS
-
, and
S
2-
) is a well-known toxin with potential to harm organisms
through, for example, reversible inhibition of cytochrome c
oxidase (Evans 1967; Nicholls 1975), decreased hemoglo-
bin oxygen affinity (Carrico et al. 1978), sulfhemoglobin
formation (Bagarinao 1992 ; Kraus et al. 1996), mitochon-
drial depolarization (Julian et al. 2005), coelomocyte death,
decreased cell proliferation (Hance et al. 2008), inhibition
of almost 20 enzymes involved in aerobic metabolism
(Bagarinao 1992), and oxidative damage to RNA and DNA
(Joyner-Matos et al. 2010). Animals, inhabiting environ-
ments such as mudflats, marshes, cold seeps, and hydro-
thermal vents can be periodically or continuously exposed
to sulfide (Nicholls and Kim 1982). Mitochondrial sulfide
oxidation is an important mechanism for reducing sulfide
toxicity in sulfide-adapted animals (Grieshaber and Völkel
1998). Some invertebrates, such as the gutless clam Solemya
reidi and the lugworm Arenicola marina, use mitochondria
to oxidize sulfide and even produce ATP from the substrate
(Powell and Somero 1986; Völkel and Grieshaber 1997). In
A. marina mitochondria, electrons from sulfide are trans-
ferred to ubiquinone concurrent with thiosulfate production
(Wohlgemuth et al. 2000).
Y.-B. Ma
:
Z.-F. Zhang (*)
:
M.-Y. Shao
:
Z. Tan
:
J.-L. Li
Key Laboratory of Marine Genetics and Breeding,
Ministry of Education, Ocean University of China,
Qingdao 266003, China
e-mail: zzfp107@ouc.edu.cn
K.-H. Kang
Department of Aquaculture, Chonnam National University,
Yeosu 550749, South Korea
Mar Biotechnol (2011) 13:93107
DOI 10.1007/s10126-010-9273-3
Page 1
In A. marina, sulfide:quinone oxidoreductase (SQR),
similar to well-investigated bacterial SQR, has been
shown to be involved in electron t ransfer from sulfide to
ubiquinone and converts sulfide to persulfides (Theissen
and M artin 2008). Subsequently, a putative sulfur dioxy-
genase oxidizes a persul fide molecule into sulfit e and a
second persulfide is added to sulfite by a sulfur transferase
rhodanese, producing thiosulfate (Hildebrandt and Grieshaber
2008b). Also, in this species, the cellular redox state has
been shown to regulate mitochondrial sulfide oxidation
(Hildebrandt and Grieshaber 2008a).
SQR homologs have been reported in many prokaryote
and eukaryote genomes, including fungi, insects, and mam-
mals, and three distinct groups of amino acid sequence
diversity have been identified. Two cysteines and a FAD-
binding domain III are conserved in all reported SQR
sequences (Theissen et al. 2003). Compared with prokaryotic
SQR, however, eukaryotic SQR has been investigated only
in fission y east Schizosac charomyces pombe and the
lugworm A. marina (Vande Weghe and Ow 1999;Theissen
and Martin 2008). In A. marina, two conserved cysteines,
two histidines, an aspartic acid, and a glutamic acid have
been identified through site-directed mutagenesis as essential
for the catalytic mechanism of SQR (Theissen and Martin
2008).
The sulfide tolerance of the echiuran worm Urechis caupo,
an inhabitant of the California coast, has been investigated
for many years, including studies of morphological adapta-
tions of the body wall, hindgut, and alimentary canal
(Menon and Arp 1992, 1993, 1998) and hydrogen sulfide
oxidation by heme compounds (Powell and Arp 1989;Arp
et al. 1995,review).Notably,SQR,thekeyenzymein
mitochondrial sulfide oxidation, has never been studied in
echiuran worms. To extend the understanding of sulfide
metabolic adaptations in echiuran worms, the full-length
cDNA of SQR was cloned from the echiuran worm Urechis
unicinctus, a species related to U. caupo, mainly distributed
in China, Korea, Russia, and Japan, and inhabiting marine
sediments, especially in intertidal and subtidal mudflats (Ma
et al. 2005; Zhang et al. 2006). In addition, this report
includes SQR gene expression profiles from several worm
tissues, heterologous expression in Escherichia coli,related
enzyme properties, and tissue-specific protein expression
patterns.
Materials and Methods
Animals
U. unicinctus, collected from a coastal intertidal flat in
Yantai, China, had a mean fresh mass of 33.4±10.4 g and
were maintained for 1 week in an aerated, recirculating
seawater aquarium (20±1 °C, pH 8.0, salinity 25) and fed
microalgae (Chlorella vulgaris and Mtzschia closterium).
Feeding was discontinued 24 h prior to experimentation.
Tissue samples for RNA and protein isolation were excised,
frozen in liquid nitrogen, and stored at 80 °C until use.
RNA Isolation and Cloning of Full-Length cDNA
Total RNA was extracted from hindgut tissues with Trizol
(Invitrogen) according to manufacturers protocol. RNA
quality was assessed by 1% agarose gel electrophoresis and
the RNA concentration and purity determined from the
absorbances at 260 and 280 nm. First-strand cDNA was
synthesized using a reverse transcription system (Promega).
Cloning of the SQR cDNA fragment was achieved using
degenerate primers designed against evolutionarily con-
served domains from known SQR sequences, as obtained
from the National Center for Biotechnology Information
(NCBI). Primary and nested PCR were conducted to obtain
thecDNAfragment.TheprimaryPCRwithrTaqDNA
Polymerase (Takara) was performed using sense (5-AART
GYSCIGGIGCICCNC A-3) and antisense primer (5-
ADIGGRCAIGAIGHRTAICC-3) with hindgut cDNA as
the template. PCR amplification was performed by denatur-
ation at 94 °C for 5 min, then 35 cycles of 94 °C for 30 s,
58 °C for 30 s, and 72 °C for 60 s, and a final extension step
at 72 °C for 10 min. Nested PCR was carried out using the
50X diluted primary PCR product as the template and the
sense (5-AAYGCHITITWYACNTTYCC-3) and antisense
primer (5-TARTCRAAYTCIGCANRNAT-3). PCR ampli-
fication was carried out with the identical schedule described
above and the PCR product purified, subcloned into a
pMD18-T vector (Takara), and then transformed into E. coli
DH5α competent cells, following the manufacturersinstruc-
tions. Positive clones were selected and sequenced with an
ABI PRISM 3730 DNA sequencer. For comparative
analysis, sequences were searched in the NCBI using
BLASTX.
The full-length cDNA of SQR was obtained using a 5 and
3-rapid amplification of the cDNA ends (RACE) PCR
technique, which included a switching mechanism at the 5
end of the RNA Transcript (SMART) cDNA amplification kit
(Clontech). The 3 and 5-RACE-Ready cDNA was prepared
according to the manufacturers instructions. Two gene
specific primers, GSP-5 (5-GTTTTAGCGGTAGGGG
CGTTTGTGC-3) and GSP-3 (5-CTGTTGGACACTCC
CACCGAGAATG-3), were designed to clone the 5 and 3
end of SQR cDNA, respectively. The 3 and 5-RACE reaction
mixture (final volume 20 μl) contained 10X Advantage 2
PCR buffer, 0.2 mM (each) dNTPs, 10X Universal Primer A
Mix (Clontech), 0.4 μM primers of GSP-3 or GSP-5,50X
Advantage two polymerase mix, and 2 μlof3 or 5
-RACE-
Read y cDNA as the template . Here, the PCR cycling
94 Mar Biotechnol (2011) 13:93107
Page 2
parameters were denaturation at 94 °C for 5 min, 30
cyclesof9Cfor30s,6Cfor30s,and7Cfor
3 min, and a final extension step at 72 °C for 10 min. The 3
and 5-RACE products were gel-purified, subcloned,
sequenced, and assembled.
Sequence Analysis
Searches for nucleotide and amino acid sequence similarities
were conducted with BLAST programs at the NCBI (http://
www.ncbi.nlm.nih.gov/BLAST/;Bensonetal.1999). The
subcellular location of protein was predicted with TargetP
(http://www.cbs.dtu.dk/services/TargetP; Emanuelsson et al.
2007). The transmembrane region was determined with
TMHMM-2.0 (www.cbs.dtu.dk/srevices/TMHMM -2.0;
Emanuelsson et al. 2007). The signal peptide was identified
with SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/;
Emanuelsson et al. 2007). Glycosylation Predictor was used
to predict N-glycosylation modification sites (http://comp.
chem.nottingham.ac.uk/glyco/; Hamby and Hirst 2008).
Multiple alignment of SQR was performed with Clus-
talx1.83. The phylogenetic tree was constructed using the
MEGA program, version 3.1, based on amino acid align-
ment of U. unicinctus SQR with other known SQR
sequences.
Quantitative Analysis of SQR mRNA Expression
in Different Tissues
Hindgut, body wall, midgut, and anal sacs (crissal bursa)
tissue samples were collected from three adult worms for total
RNA isolation. Coelomic fluids from three adult worms were
centrifuged at 3,000g and 4 °C for 10 min to obtain coelomic
fluid cells. The first-strand cDNA synthesis was carried out
as described above and the cDNA mixture diluted (1:5) and
stored at 20°C for later RT-PCR.
Real-time RT-PCR was performed using a fluorescence
temperature cycler (Applied Biosystems) and SYBR Green
I as a double-stranded DNA-specific binding dye according
to manufacturer s in structions (Toyob o). The prim er
sequences were: 5-CTGGCAGCATGTCAAGAAAA-3
(sense) and 5-GAGCTCCAGCACATTTGACA-3 (anti-
sense) for sqr;and5-TTCTT GGGAAT GGAATCTG
C-3 (sense) and 5-CTTCTGCATACGGTCAGCAA-3
(antisense) for β-actin. Amplifications were carried out
using 10 μl of 2X SYBR Green PCR Master Mix, 1 μlof
each primer (2 μM), 1 μl of cDNA in a total volume of
20 μl. Real-time PCR conditions were 95 °C for 10 min,
followed by 40 cycles at 95 °C for 15 s, and 60°C for
1 min. Full-length sequences of sqr
and β-actin, which
were subcloned to a pMD18-T simple vector (Takara) as
described above, were used as external cDNA standards for
sqr and β-actin. After the PCR procedure, data from two
replicates from each sample were analyzed using the 7500
System Sequence Detection Software Version 1.4.0.25
(Applied Biosystems) to estimate transcript copy numbers.
U. unicinctus β-actin was quantified to normalize sqr
mRNA concentrations, which were expressed as the ratio
of the copy number of a specific sqr mRNA to β-acti n .
Construction of Expression Vector
The open reading frame of U. unicinctus SQR cDNA was
amplified using Ex Taq DNA polymeras e (Takara) with the
upstream primer 5-
GAATTCATGGCATGTACGAGGA
CAGT-3 (EcoRI site underlined) and the downstream
primer 5-
CTCGAGAGCCACTCCAAATCTGAATA-3
(XhoI site underlined). The reaction conditions involved
initial denaturation at 94 °C for 5 min, followed by 30
cycles of d enaturation at 94 °C for 30 s, annealing for 30 s
at 60 °C, extension at 72 °C for 1.5 min, and a final
extension step at 72 °C for 10 min. The PCR product was
subcloned into the pMD18-T vector (Takara) followed by
digestion with EcoRI and XhoI, and then, subcloned into
the expression vector pET28a (Novagen ), previously cut
with the same restriction enzymes. The identity of the insert
was confirmed by sequencing and the expression vector
designated pET28a-SQR.
Expression, Purification, and Refolding
of Recombinant SQR
E. coli BL21 (DE3) cells were transformed with plasmid
pET28a-SQR and a single colony containing pET28a-SQR
transformed cells was cultured overnight in LB broth
containing kanamycin (30 μg/ml). The resulting cells were
diluted 1:100 with LB broth/kanamycin and subjected to
further incubation at 37 °C until the optical density at
600 nm was 0.4. SQR expression was induced by adding
isopropyl β-
D-thiogalactoside (IPTG) to the medium at a
final concentration of 1.0 mM and incubation at 37 °C for
5 h. The cells were then harvested by centrifugation,
resuspended in 50 mM phosphate buffered solution (PBS,
pH 7.4), and ultrasonicated on ice. The inclusion body
proteins were collected by centrifugation at 15,000g and
4 °C for 10 min, and 200 mg of collected protein dissolved
in 5 ml of buffer composed of 8 M urea, 10 mM Tris
HCl (pH 8.0), 0.1 M trisodium phosphate, 1 mM β-
mercaptoethanol with slow shaking at 4 °C for 12 h. The
dissolved mixture was centrifuged again at 15,000g,4°C
for 20 min to remove insoluble debris and the remaining β-
mercaptoethanol removed by dialysis. Finally, this SQR was
purified by Ni-NTA affinity chromatography according to
manufacturers instructions (Novagen), and the purity of
eluted samples analyzed by 10% SDS-PAGE stained with
Coomassie brilliant blue R-250.
Mar Biotechnol (2011) 13:93107 95
Page 3
Dilution refolding was performed to renature recombi-
nant SQR. Unfolded and reduced SQR was diluted to
0.05 mg/ml SQR in 20 ml of renaturation buffer containing
20 mM TrisHCl (pH 8.0), 0.4 M
L-arginine, 1 mM phenyl-
methanesulfonyl fluoride (PMSF), and 5.5 mM total
glutathione in a 10:1 ratio of reduced to oxidized glutathione
(GSH:GSSG). After incubation at 4 °C for 96 h, the soluble
and aggregated fractions of the renaturation mixture were
separated by centrifugation (15,000g, 4 °C, and 10 min) and
analyzed by 10% SDS-PAGE. The soluble fraction was
successfully refolded SQR.
Protein concentrations were determined by the met hod
of Bradfo rd using bovine serum albumin (BSA) as a
standard (Bradford 1976 ).
SQR Enz yme Activity Assay
SQR enzyme activity was measured under air at room
temperature (25 °C). A 0.3 ml reaction mixture was produced
containing 0.02 M TrisHCl (pH 8.0), 100 μM coenzyme Q
2
(Sigma), 2 mM KCN, and 0.5 μgofrefoldedSQR.The
reaction was initiated with 400 μM sulfide (prepared freshly
with N
2
-flushed H
2
O), and the decrease in 285 nm absorp-
tion followed for 3 min at 30-s intervals (modified from
Vande Weghe and Ow 1999 and Theissen and Martin 2008).
The millimolar extinction coefficient of coenzyme Q
2
in
reaction buffer at 285 nm was 8.85.
The optimal pH of the cyanide-dependent SQR reaction
was determined over a pH range from 7 to 11 at room
temperature. The optimal temperature was determined by
conducting the reaction under a temperature range from 22
to 42 °C at the optimal pH 8.5. The effects of different
inhibitors and activators on SQR activity were examined by
performing the reaction as described above with added
Zn
2+
, GSH, or EDTA, each at final concentrations of 1 and
5 mM (Table 1). The K
m
value for ubiquinone and sulfide
was determined from the LineweaverBurk plot under
optimal pH (8.5) and temperature (37 °C). Each enzyme
activity assay was performed in triplicate.
Polyclonal Antibody Preparation
Purified recombinant SQR was used for producing polyclonal
antibodies in two New Zealand white rabbits. An emulsion of
equal volumes of 200 μg purified SQR and Freundscomplete
adjuvant (Sigma) was injected subcutaneously at multiple
sites of each rabbit. Two booster injections of 100 μg antigen
mixed with Freunds incomplete adjuvant (Sigma) were
administered subcutaneously at 2 week intervals. One week
after the final booster, blood was collected, and serum
prepared. The sera antibody titer was determined by indirect
enzyme-linked immunoassay and the antisera aliquoted and
stored at 80 °C.
Western Blot Analysis
Approximately 100 mg of U. unicinctus body wall tissue
was homogenized in 1 ml of lysis buffer (150 mM sodium
chloride, 1% NP-40, 0.5% sodium deoxycholate, 0.1%
SDS, 1 mM EDTA, 1 mM PMSF, and 50 mM Tris, pH 7.4)
on ice, centrifuged at 12,000g for 5 min, and the
supernatant assayed for total protein. Mitochondria were
isolated from the body wall acco rding to the methods of
Schroff and Schöttler (1977) with slight modifications : the
isolation medium consisted of 0.0584 M saccharose,
0.1402 M glycine, 40 mM Tris (pH 7.4), 2 mM EGTA,
and 0.2% BSA . Separate samples of 200 ng of purified
recombinant SQR, 100 μg of total protein from body wall,
and 100 μg of mitochondria were prepared in sample
buffer containing SDS and β-mercaptoethanol and then
resolved on 10% SDS-PAGE. The gels were washed for
5 min in a transfer buffer of 15.6 mM TrisHCl containing
120 mM glycine and 20% methanol (pH 8.3), and the
proteins blotted on PVDF membranes (Millipore). The
blotted membranes were incubated at room temperature in
100 mM PBS containing 0.05% Tween-20 (pH 7.4, PBS/
Tween-20) plus 5% defatted milk powder (DMP) for 2 h,
washed three times with PBS/Tween-20, and then cross-
reacted with polyclonal antibody diluted 1:20,000 with
PBS/Tween-20 plus 5% DMP at room temperature for 2 h.
After washing in PBS/Tween-20, the membranes were
incubated at room temperature for 2 h with peroxidase-
conjugated goat anti-rabbit IgG (Jackson) diluted 1:5000
with PBS/Tween-20 plus 5% DMP. After washing, bands
were visualized using 0.06% DAB in 50 mM TrisHCl
buffer (pH 7.6) and 0.03% H
2
O
2
. The molecular mass
standards were rabbit phosphorylase b (97.2 kDa), BSA
(66.4 kDa), rabbit actin (43 kDa), bovine carbonic anhydrase
(31 kDa), trypsin inhibitor (20.1 kDa), and hen egg white
lysozyme (14.4 kDa).
Immunohistochemistry
Tissues from the body wall, hindgut, anal sacs, and midgut
were cut into small pieces (5 mm
2
) and fixed in freshly
prepared 4% paraformaldehyde (w/v) at 4 °C for 24 h. After
dehydration, the samp les were embedded in paraffin,
sectioned at 7 μm, and the sections mounted on slides
and dried at 37 °C overnight. After dewaxing in xylene for
30 min (solvent refreshed at 15 min), the samples were
immersed in absolute ethanol for 10 min (solvent refreshed
at 5 min), then rehydrated in 95, 85, 70, 50, and 30%
ethanol (3 min each), and finally placed in distilled water.
After two 5 min washes in PBS/Tween-20, the endogenous
peroxidase activity in the sections was quenched with
incubation in methanol with 3% H
2
O
2
(v/v) at room
temperature for 10 min, followed by two 5 min washes in
96 Mar Biotechnol (2011) 13:93107
Page 4
PBS/Tween-20. Subsequently, the sections were incubated
in PBS/Tween-20 plus 3% BSA at room temperature for
30 min, and then incubated in a humidified chamber at
room temperature for 1 h with rabbit anti-SQR antibody
diluted 1:200 by PBS/Tween-20 plus 3% BSA. The control
sections were similarly incubated with preimmune rabbit
serum, and both experimental and control sections washed
five times for 5 min each in PBS/Tween-20 and then
incubate d furt her at room temperature for 1 h with
peroxidase-conjugated goat anti-rabbit IgG (Jackson) dilut-
ed 1:5,000 with PBS/Tween-20. A chromogenic reaction
was achieved by the addition of 0.05% DAB (w/v)
containing 0.01% H
2
O
2
(v/v) in PBS/Tween-20 and main-
tained in the dark for 5 min. Sections were then washed in
PBS/Tween-20, counterstained with hematoxylin, dehy-
drated through an ascending ethanol series, cleared in
xylene, mounted in neutral balsam, and observed and
photographed with a Nikon 80i microscope.
Transmission Electron Microscope (TEM) Preparation
Worms were anesthetized with 400 mM MgCl
2
and small
pieces dissected from body wall, hindgut, midgut, and anal
sacs. The samples were fixed for TEM using a 2.5%
glutaraldehyde soak for 2 h, rinsing, post-fixing in 1%
osmium acid for 2 h, washed again, and dehydrated through
an ascending ethanol series. After embedding in Epon 812,
sectioning was performed using a LKB microtome followed
by uranyl acetate and lead citrate staining before observation
in a Hitech H-7000 TEM.
Statistical Analysis
Data were presented as the mean ± standard error of the
mean of triplicate samples. Significant differences between
means were tested using one-w ay analysis of variance
followed by least significant difference tests, using the
SPSS statistical package (version 13.0) at a significance
level of p<0.05.
Results
Sequence and Phylogeny of SQR
A cDNA fragment of 505 bp was obtained by RT-PCR
from U. unicinctus hindgut. Based on the partial sequence,
two fragments 1247 bp and 1274 bp were cloned by means
of 3 and 5-RACE. The full-length SQR cDNA was
assembled from the overlapped cDNA fragments and
deposited in GenBank (accession number: EF487538) as a
2315 bp consisting of an open reading frame of 1356 bp
encoding a putative protein of 451 amino acids, which had a
theoretical pI of 8.98 and molecular weight of 50.5 kDa. The
sequence contained a 237 bp 5 untranslated region (UTR)
and a 722 bp 3 UTR. The nucleotide and deduced amino acid
sequence, shown in Fig. 1, contained conserved FAD-binding
domains (domain I, DIVIVGGGCAGSAIANKFA-
PYLGQGKV, domain II, GDKLKYDYLLVSMG, and
domain III, NFVTVNRDTLQHTKYPNVFGMGD), cys-
teines (Cys202 and Cys380), and quinine binding site
(Phe422 and Ile390). In addition, conserved histidines
(His80 and His294) and glutamic acid (Glu159) present in
eukaryotic SQR were also contained in this U. unicinctus
SQR. The sequence prediction results showed that U.
unicinctus SQR was located in the mitochondria, with a
score of 0.759, as a protein without a signal peptide or
transmembrane region. Glycosylation modification predic-
tion showed that U. unicinctus SQR was characterized by the
presence of six N-glycosylation sites (125 NNSV, 216
NFSK, 231 NTSL, 255 NITV, 285 NVSF, and 360 NLSL).
Homology analysis of the deduced amino acid sequence
of U. unicinctus SQR, compared with other known SQRs
using the BLAST program, revealed that U. unicinctus SQR
was 55% identical to A. marina,50%toCanis familiaris,
49% to Rattus norvegicus and Homo sapiens, and 48% to
Mus musculus. Conserved cysteine, histidine, and glutamic
acid residues and a FAD-binding domain were present in
the SQR from all eukaryotes in the alignment produced by
CLUSTALW analysis (Fig. 2a). A phylogenetic tree was
constructed based on amino acid alignment using the
MEGA program, and it was observed that U. unicinctus
Chemicals Final concentrations in reaction mix (mM) Relative activity (%)
Zn
2+
1 95.45±2.45
Zn
2+
5 80.32±3.56*
GSH 1 105.89±5.06
GSH 5 110.52±3.20*
EDTA 1 105.25±3.20
EDTA 5 109.33±2.50*
Control 0 101.55±2.53
Table 1 Effect of Chemicals
on the Activity of Refolded
SQR
Data are given as means±S.E.
M, n=3
Asterisk (*) shows that the
difference is statistically signifi-
cant with the control
(p<0.05)
Mar Biotechnol (2011) 13:93107 97
Page 5
SQR clustered primarily with A. marina and formed a sister
group to Caenorhabditis elegans and other SQRs (Fig. 2b).
Overall, the relationships displayed in the phylogenetic tree
were generally in accordance with classic taxonomy.
Tissue Distribution of SQR mRNA
SQR mRNA was detected by real-time RT-PCR in all
tissues examined, with the highest SQR mRNA expression
Fig. 1 The full-length cDNA
sequence and deduced amino
acid sequence of U. unicinctus
SQR. Start ATG and stop TAG
codons, double lines; RACE
primers underlined; conserved
FAD-binding domains,
cysteines, histidines, glutamic
acid, and quinone binding site
(phenylalanine and isoleucine)
in black boxes
98 Mar Biotechnol (2011) 13:93107
Page 6
in the midgut followed by the anal sacs and coelomic fluid
cells, and, finally, the body wall and hindgut with a
relatively low level of expression (Fig. 3).
Characterization of Recombinant SQR
To further the understanding of SQR function, a prokar-
yocyte expression vector was constructed by cloning U.
unicinctus SQR open reading frame cDNA into pET28a,
and then transforming the vector into E. coli BL21 (DE3).
SQR was expressed as inclusion bodies with the induction
of 1 mM IPTG at 37 °C and the recombinant protein
purified by Ni-NTA affinity chromatography after dissolv-
ing the inclusion body in 8 M urea. The purified
recombinant SQR yielded a single band of 50 kDa on
SDS-PAGE gel after Coomassie blue staining (Fig. 4).
Activated SQR was obtai ned by dilution refolding of the
purified recombinant SQR and exhibited specific activity at
5.12 µM/min/mg (25 °C, pH 8.0), optimal temperature at
37 °C (Fig. 5a ), optimal pH of 8.5 (Fig. 5b), and K
m
for
ubiquinone and sulfide determined as 15.6 µM and
40.3 µM, respectively from LineweaverBurk plotting
(Fig. 6). EDTA and GSH had an activating effect, whereas
Zn
2+
acted as an inhibitor, decreasing the activity of this
SQR (Table 1). In addition, a low enzyme activity was
detected in the absence of added KCN as 1.75 µM/min/mg
(25 °C, pH 8.0).
Tissue Expression of SQR
Rabbit antisera against the purified recom binant SQR were
obtained with a titer of 1:96,000. Western blot show ed that
rabbit antisera reacted with recombinant SQR purified by
Ni-NTA affinity chroma tography, forming a ban d at
50 kDa (Fig. 7), and also reacted with the total protein
and mitochondria from body wall samples, but yielding a
single band of 60 kDa (Fig. 7).
SQR was detected by immunohistochemistry in all
tissues examined. In body wall samples, SQR was mainly
detected in the free surfaces of simple columnar epithelium
and underlying connective tissue but not in muscle and
coelomic membranes (Fig. 8b). Similarly, in hindgut, SQR
was present in the free surfaces of pseudostratified
columnar epithelium but not in muscle and chorion
(Fig. 8e). Also, in midgut, SQR was present in the free
surfaces of simple columnar epithelium but not in muscle
and chorion (Fig. 8h). However, in anal sacs, SQR was
localized in whole stratified epithelium but not in muscle
fibers (Fig. 8k).
SQR was located in mitochondria according to the
results of sequence prediction and Western blot analysis,
to obtain further demonstration from cytology, we detected
the mitochondrial distribution of body wall, hindgut,
midgut, and anal sacs by TEM. TEM observations revealed
that plentiful mitochondria were dist ributed in the surface
and subsurface of epithelia of body wall, hindgut, midgut,
and anal sacs (Fig. 9). The mitochondrial distribution was
in accord with the SQR locations detected here by
immunohistochemistry.
Discussion
This study reported the cloning, characterization, and
expression of the mRNA and protein from echiuran worm
U. unicinctus SQR full-length cDNA and provided a
molecular biological foundation for the study of sulfide
metabolic adaptation mechanisms in echiuran worms. This
is the first report that we know of regarding the isolation of
eukaryotic SQR cDNA using only PCR amplification,
providing a method more convenient than cDNA library
screening, as reported by Theissen and Martin (2008), to
investigate eukaryotes without having genome data. In
addition, successful production of activated U. unicinctus
SQR from the refolding of recombinant expressed protein
from E. coli demonstrated another means of obtaining
activated multicellular eukaryotic SQR, as an alternative to
yeast expression reported by Theissen and Martin (2008).
Compared with reported A. marina SQR, the slightly
different optimal pH (8.5 in U. unicinctus and 9.0 in A.
marina) may have resulted from different modifications of
the recombinan t protein by different expression systems.
The high 15.6 µM K
m
for ubiquinone and 40.3 µM K
m
for
sulfide in refolded U. unicinctus SQR compared to 6.4 µM
for ubiquinone and 23 µM K
m
for sulfide in A. marina
(Theissen and Martin 2008) may have resulted from species
differences.
Interesting Aspects in the U. unicinctus SQR Amino Acid
Sequence
Sequence prediction suggested that U. unicinctus SQR was
located in mitochondria. The result was vali dated by
Western blot of body wall tissue proteins (Fig. 7) and was
in accordance with previous studies in other organisms.
Recombinant A. marina SQR has been expressed in yeast
mitochondria (Theissen and Martin 2008). Similarly, S.
pombe SQR has been shown by Western blot analyses to be
located in mitochondria (Vande We ghe and Ow 1999).
Notably, the prediction of no transmembrane region in
U. unicinctus SQR conflicted with previous reports in
which SQR from Aquifex aeolicus (Marcia et al. 2009) and
Acidianus ambivalens (Brito et al. 2009) were described as
transmembrane proteins by X-ray structure analyses, while
sequence prediction by TMHMM-2.0 indicated that both
SQRs were not transmembrane proteins. Marcia et al.
Mar Biotechnol (2011) 13:93107 99
Page 7
Homo sapiens
Mus musculus
Gallus gallus
Xenopus tropicalis
Danio rerio
Tetraodon nigroviridis
Ciona intestinalis
Anopheles gambiae
Drosophila melanogaster
Caenorhabditis elegans
Urechis unicinctus
Arenicola marina
Schizosaccharomyces pombe
Aspergillus oryzae
Cryptococcus neoformans
90
100
100
100
100
73
96
100
59
50
47
55
0.1
b
100 Mar Biotechnol (2011) 13:93107
Page 8
(2009) has suggested that the SQR transmembrane region
differs substantially from other membrane proteins and that
protein evolution of membrane attachment occurred later
than differentiation of protein function.
Signal peptide prediction reveal ed that U. unicinct us
SQR was a mature protein lacking a signal peptide, w hich
was consistent with the well-investigated prokaryotic SQR
which also lacks a signal peptide involved in its
translocat io n (Griesbeck et al. 2000). This result was very
interesting as how could U. unicinctus SQR, normally a
mitochondrial protein wi thout a signal peptide, knock at
the door of mitochondria and locate there in a special
posit ion? Search of o ther published eukaryotic SQR
sequences by SignalP 3.0 showed that a signal peptide
exists only in mammals, birds, and annelids, such as H.
sapiens (129 aa), C. familiaris (127 aa), Gallus gallus
(119 aa), and A. marina (124 aa), but not in fish and
arthropods. This jump of a SQR signal peptide in different
species has not been previously reported. Some intriguing,
thus far unknown, mechanisms may be involved in this
interesting phenomenon.
Glycosylation modification prediction revealed six N-
glycosylation sites in U. unicinctus SQR. Such modifica-
tions have effects on protein transport by influe ncing
protein folding, stability, or transit through the sorting
pathway (Olden et al. 1982; Dorner et al. 1987; Matzuk and
Boime 1988; Gieselmann et al. 1992). Further studies will
be required to determine whether the mitochondrial
location of U. unicinctus SQR has a relationship with
glycosylation modification. Western blot of U. unicinct us
SQR in body wall tissue indicated that post-translation
modification exist ed in the mature protein as a 10 kDa
difference between the purified recombinant SQR and
SQRinvivo(Fig.7), a difference whi ch may result from
post-trans la tiona l m od if icati on , especially gly cos yl ati on,
which is a common natural phenomenon (Olden et al.
1982; Jiménez-Castañoa et al. 2007). Moreover, it has
been reported that aberrant mobility in SDS-PAGE is a
characteristic property of m embrane protein-like SQR
(Bronstein et al. 2000). It remains to be determined
whether or not this phenomenon is related to post-
translational modi fication.
Proposed U. unicinctus SQR Catalytic Mechanism
Although a low enzyme activity was detected in the absence
of added KCN, refolded U. unicinctus SQR showed cyanide-
dependent activity similar to that reported in Pseudomonas
putida (Shibata and Kobayashi 2006
)andBacillus stear-
othermophilus SQR(Shibataetal.2007), in which cyanide
increases enzyme activity; these enzymes, like U. unicinctus,
belonged to the sequence group II designated previously
(Theissen et al. 2003). Also, GSH and EDTA had an
Fig. 4 SDS-PAGE analysis of the U. unicinctus SQR recombinant
protein. 1, protein marker; 2, non-induced product of pET28a/BL21
(DE3); 3, non-induced product of pET28a-SQR/BL21 (DE3); 4,
induced product after 5 h of pET28a-SQR/BL21 (DE3); 5, precipita-
tion of induced product after 5 h of pET28a-SQR/BL21 (DE3); 6,
supernatant of ultrasonicated induced product after 5 h of pET28a-
SQR/BL21 (DE3); 7, Ni-NTA purified target protein; 8, refolded
protein
Fig. 3 Expression of SQR mRNA in di fferent ti ssue s of U.
unicinctus. Expression of SQR mRNA relative to β-actin gene
expression as housekeeping reference gene; values, mean±S.E.M,
n=3; different letters indicate significant differences between tissues
(p<0.05)
Fig. 2 Sequence comparison of protein encoded by SQR from
different species. a Sequences aligned using CLUSTALW (1.81)
program; conserved FAD-binding domains, cysteines, histidines, and a
glutamic acid, black boxes, identical residues shaded. b SQR
phylogenetic relationships of all species constructed with MEGA 3.1
programs based on amino acid sequences aligned using CLUSTAL W
(1.81). Accession numbers: Anopheles gambiae str. PEST
(EAA08424.4), Arenicola marina (NP_596067), Aspergillus oryzae
(EED53200.1), Caenorhabditis elegans (NP_502729.1), Ciona intes-
tinalis (XP_002129153.1), Cryptococcus neoformans (XP_567904.1),
Danio rerio (AAH93431.1), Drosophila melanogaster
(NP_647877.1), Gallus gallus (XP_413825.1), Homo sapiens
(AAH16836.1), Mus musculus (AAH11153.1), Schizosaccharomyces
pombe (CAA21882), Tetraodon nigroviridis (CAG05541.1), Urechis
unicinctus (EF487538), and Xenopus tropicalis (CAJ83872.1)
Mar Biotechnol (2011) 13:93107 101
Page 9
activation effect on U. unicinctus SQR and Zn
2+
inhibited its
enzyme activity. GSH can activate enzymes with a mercapto
group involved in the catalytic reaction (Scheibe 1987), and
it has been proposed that a mercapto group is generated in
the SQR catalytic reaction (Griesbeck et al. 2002); the
present results were consistent with the former report. In A.
marina mitochondria, physiological GSH concentrations can
improve its sulfide oxidation ab ility (Hildebrandt and
Grieshaber 2008a), possibly due to increasing SQR enzyme
activity in vivo. In addition, Zn
2+
can inhibit enzyme activity
by binding to a mercaptan compound generated during
catalysis (Gazaryan et al. 2002). In the SQR enzyme
catalytic reaction, an intermediate mercaptan compound is
also generated (Griesbeck et al. 2002). Furthermore, EDTA,
which chelates metal ions and often inhibits enzyme
catalysis, had little influence on U. unicinctus SQR activity.
The influence of different chemicals on enzyme activity was
consistent with observations of sulfur oxygenasereductase
in Acidianus tengchongensisi, in which cysteine residues
also played crucial roles in its catalysis, similar to SQR
(Chen et al. 2005).
Three cysteine residues, two histidine, and one glutamic
acid have been proposed to be key amino acids residues for
the SQR catalytic mechanism (Griesbeck et al. 2002).
However, Griesbeck et al. (2002) mention that eventually
only two cysteine residues would be necessary for the SQR
catalytic react ion. More recently, it was demonstrated that
the third cysteine residue was covalently attached to FAD,
based on the SQR structures in A. aeolicus (Marcia et al.
2009) and A. ambivalens (Brito et al. 2009), and, thus, it
has been proposed that only two cysteine residues are
needed for SQR catalysis (Brito et al. 2009). In eukaryotes,
the two cysteine (Theissen et al. 2003), two histidine
residues, and one glutamic acid identified from the
alignment results here were conserved among all reported
SQRs. The third cysteine residue, however, was not present
in eukaryotes, but other amino acids involved in SQR
catalysis, quinone binding site (shown in Fig. 1,Marcia
et al. 2009) and FAD-binding domains were conserved
(shown in Fig. 2).
Based on previous reports and the results here, we
propose a SQR reductive half-reaction in U. unicinctus
involving Cys202, Cys380, and Glu159 (Fig. 10). The
oxidative half-reaction may be similar to the proposed
bacterial oxidative reaction, involving two histidines in an
acidbase catalysis (Griesbeck et al. 2002).
In vitro, the SQR reductive half-reaction demonstrated
two styles of reaction, a slow reaction and a fast reaction
with or without KCN, respectively (Fig. 10). In this study,
low enzyme activity was detected without KCN, slightly
Fig. 5 Effect of pH (a)
and temperature (b) on refolded
SQR activity. Data as mean±S.
E.M, n=3; *, statistically
significant difference
from previous value (p<0.05)
Fig. 6 LineweaverBurk plots
for determination of K
m
for sulfide (a) and ubiquinone
(b). a K
m
for sulfide
with an ubiquinone constant
concentration of 100 μM,
sulfide concentration variety
(5, 10, 20, 40, 80, 100, 200,
400, and 800 μM). b K
m
for ubiquinone with a sulfide
constant concentration
of 400 μM, ubiquinone
concentration variety (5, 10, 20,
40, 80, 100, and 200 μM)
102 Mar Biotechnol (2011) 13:93107
Page 10
similar to S. pombe SQR, which had low activity and
substrate affinity (K
m
of 2 mM, Vande Weghe and Ow 1999)
without an added reagent such as KCN. The generation of
the fast reaction with added KCN may be due to KCN
participated in catalytic reaction similar to A. marina SQR
(Theissen and Martin 2008) and, as the amino acids involved
in this catalysis are conserved among eukaryote species
(Fig. 2a), the probability that eukaryotes utilize the same
mechanism is very high.
However, the slow reaction in vivo must be the principle
route as, in U. unicinctus in vivo, sulfide was oxidized to
thiosulfate (Wang et al. unpublished). In mammals and
invertebrates, three mitochondrial enzymatic activities
catalyze sulfide oxidation to thiosulfate, with sul fide
initially oxidized to persulfide and then catalysis by sulfur
dioxygenase and sulfur transferase to generate the end
product thiosulfate (Hildebrandt and Grieshab er 2008b). It
is suggested here that, in vivo, these enzymes, including
sulfur dioxygenase and sulfur transferase, which catalyze
the subsequent pathway reactions of the pathway, may have
functioned as a persulfide acceptor instead of cyanide. In
vivo, with the rapid consumption of persulfide by the
subsequent enzyme, the slow reaction could have acceler-
ated to an acceptable physiological velocity. The fast
reaction was thus only an alternative to the slow reaction
in vivo.
Proposed Role of Different Tissues in Sulfide Metabolic
Adaptation
In U. caupo, sulfide oxidation activity shows a tissue
difference, as measured by a benzyl viologen assay, of
2.69±0.49 in midgut, 2.43±2.82 in coelomic fluid, 1.08±
1.09 in hindgut, and 0.42±0.08 U/g fresh weight in body
wall (Powell and Arp 1989). In this study, both the mRNA
and protein of SQR, a key enzyme in sulfide oxidation, were
detected in all U. unicinctus tissues examined. Although it
was difficult to distinguish tissue differences in protein
concentrations by Western blot (data not shown) due to low
SQR values, U. unicinctus SQR mRNA expression (Fig. 3)
was similar to the various trends in protein expression in
different tissues revealed by immunohistochemistry (Fig. 8),
seen as high expression in anal sacs and midgut and
relatively low expression in hindgut and body wall. The
results from U. unicinctus SQR in mRNA and protein
concentration studies were also consistent with those of
sulfide oxidation activity in U. caupo (Powell and Arp
1989).
U. unicinctus SQR was mainly located in the epithelium
of all tissues examined by immunohistochemistry, which
was consistent with a report of S. reidi foot tissue in which
sulfide oxidation activity was distributed diffusely through-
out the superficial cell layers (Powell and So mero 1985). It
was concluded here that SQR expression in epit helium
contributed to protection of other cells in the tissues. In
addition, the position of U. unicinctus SQR expression was
consistent with the mitochondrial distribution observed by
electronic microscopy, providing indirect cytological evi-
dence for U. unicinctus SQRs mitochondrial location. The
mitochondrial distribution of SQR in the U. unicinctus
body wall and hindgut conformed to reported results in U.
caupo (Menon and Arp 1992, 1993).
The body wall provides physical protection for the
internal organs, regulating the exchange of materials
between the organism and its environment and acting as
a barrier to ingress of various environmental agents
(Menon and Arp 1993
). In U. unicinctus body wall, SQR
mRNA and protein expression were relatively low
compared with other t issues (Fig. 3), but the SQR
abundance was very high in rugose epithelium and under-
lying connective tissue (Fig. 8b), which could rapidly
oxidize sulfide to protect the inner tissue regions. The
hindgut, which functions as a type of water lung, having a
thin walled, highly convoluted structure capable of
considerable dilatation (Menon and Arp 1992), showed
SQR expression similar to the results from the body wall
(Figs. 3 and 8e). Epithelium in the hindgut plays the same
role as in the body wall, protecting the inner tissues, and
both tissues act as the first barrier in sulfide metabolic
adaptation due to their being the first to be exposed to
sulfide. Lacking a vascular system, the coelomic fluid plays
a vascular-like role in the worm and can oxidize sulfide
using hemoglobin and hematin to protect the tissues and
organs it bathes, effectively acting as a second sulfide barrier
and a part of sulfide metabolic adaptation due to its high
activity (Powell and Arp 1989; Arp et al. 1995). In addition,
coelomic fluid cells also joined in sulfide adaptation through
Fig. 7 Western blot analysis of SQR. 1, protein marker; 2, purified
recombinant protein (200 ng); 3, body wall total protein (100 μg); 4,
body wall mitochondrial fraction (100 μg)
Mar Biotechnol (2011) 13:93107 103
Page 11
high SQR expression, deduced here from the observed
mRNA expression (Fig. 3). From the high SQR expression
observed here in whole stratified epithelium (Fig. 8k),
anal sacs, previously considered an excretory organ in the
worm (Arp et al. 1995), also presented as a detoxification
organ. This conclusion was confirmed by the higher
detoxification enzyme activities (superoxide dismutase,
catalase, and glutathione peroxidase) relative to other
tissues (unpublished data from our laboratory), yielding
this tissue to appear to function as a third barrie r in sulfide
metabolic adaptation. Notably, the midgut, a peptic organ
in the worm constantly bathed in coelomic fluid, is
infrequently exposed to high sulfide concentrations but
was found here to have high SQR expression (Fig. 8h). We
presume that the midgut may act as an assistant tissue to
the coelomic fluid in sul fide metabolic adaptation and that,
in SQR processes, this tissue m ay have unknown functions
whichneedtobeexplored.
Fig. 8 Location of U. unicinctus SQR in different tissues. ac body
wall; df hindgut; gi midgut; jl anal sacs; first photo, hematoxylin-
eosin stain; second positive results of immunohistochemistry, insets,
selected magnified sites; third negative control; labels, C (chorion),
CM (ceolomic membrane), CT (underlying connective tissue), DSCE
(developed simple columnar epithelium), IC (inner circular muscle),
M (muscle), ML (middle longitudinal muscle), OC (outer circular
muscle), PCE (pseudostratified ciliated epithelium), SCE (simple
columnar epithelium), SE (stratified epithelium); scar bars in ac
400 µm, dl, 200 µm, insets 30 µm
104 Mar Biotechnol (2011) 13:93107
Page 12
Fig. 9 Ultrastructure
of epithelium in different
tissues. a body wall; b hindgut;
c midgut; d anal sacs; arrows
show mitochondria (MIT)
and microvilli (MV); scar bars,
0.5 µm
N
NH
N
NH
N
NH
NH
N
N
N
N
NH
R
R
R
O
O
O
O
O
O
N
N
N
NH
R
O
O
N
N
N
NH
R
O
O
N
N
N
NH
R
O
O
Glu
Glu
Glu
Glu
Glu
Glu
Cys
Cys
Cys
Cys
Cys
Cys
Cys
Cys
Cys
Cys
Cys
Cys
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
SS
H
H
2
2
S
S
202
380
159
H
H
H
H
H
H
HCN
H
H
C
N
H
H
H
H
H
HSCN
(1)
(2)
(3)
(4)
(5)
(6)
Fig. 10 Proposed slow reaction and fast reaction mechanism of the
reductive half-reaction of SQR modified from Griesbeck et al. (2002).
Reaction with sulfide leads to persulfide at Cys380 and thiol at
Cys202 (state 3); nucleophilic attack of second sulfide (slow reaction)
or HCN (fast reaction) on persulfide, thiol group at Cys380 restored,
free persulfide (slow reaction) or HSCN (fast reaction) as primary
product released from enzyme; active site base Glu159 abstracts
proton from Cys202 thiol group, leading to charge transfer complex
with Cys202 thiolate as donor and oxidized FAD as acceptor (state 4);
FAD reduction via covalent adduct between flavin C (4) and Cys202
(state 5), resulting in reduced flavin and disulfide bridge between
Cys202 and Cys380 (state 6)
Mar Biotechnol (2011) 13:93107 105
Page 13
Conclusions
In this study, we cloned U. unicinctus SQR full-length
cDNA of 2315 bp by a homologous cloning approach
combined with RT-PCR and 3 and 5-RACE. SQR was
found to be located in mitochondria from the analysis of
sequence prediction, Western blot, immunohistochemistry,
and TEM. Activated SQR was obtained by dilution refolding
of recombinant protein expressed in E. coli, and exhibited
optimal enzymatic activity at 37°C and pH 8.5. RT-PCR and
immunohistochemistry revealed that there were distinct
tissue differences in SQR expression among the tissues
examined at the mRNA and protein levels. These results
implied that different tissues played dissimilar roles in
sulfide metabolic adaptation. However, it remains unknown
how U. unicinctus SQR exhibits during sulfide exposure.
Further studies will focus on this problem.
Acknowledgements We thank Dr. Jianxin Sui for technical assis-
tance in polyclonal antibody preparation. This work is supported by
the Natural Science Foundation of China (NSFC) [40776074].
References
Arp AJ, Menon JG, Julian D (1995) Multiple mechanisms provide
tolerance to environmental sulfide in Urechis caupo. Integr
Comp Biol 35:132144
Bagarinao T (1992) Sulfide as an environmental factor and toxicant:
tolerance and adaptations in aquatic organisms. Aquat Toxicol
24:2162
Benson DA, Boguski MS, Lipman DJ, Ostell J, Ouellette BF, Rapp
BA, Wheeler DL (1999) GenBank. Nucleic Acids Res 27:1217
Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Chem 72:248254
Brito JA, Sousa FL, Stelter M, Bandeiras TM, Vonrhein C, Teixeira
M, Pereira MM, Archer M (2009) Structural and functional
insights into sulfide:quinone oxidoreductase. Biochemistry
48:56135622
Bronstein M, Schütz M, Hauska G, Padan E, Shahak Y (2000)
Cyanobacterial sulfide-quinone reductase: cloning and heterolo-
gous expression. J Bacteriol 182:33363344
Carrico RJ, Blumberg WE, Peisach J (1978) The reversible binding of
oxygen to sulfhemoglobin. J Biol Chem 253:72127215
Chen ZW, Jiang CY, She Q, Liu SJ, Zhou PJ (2005) Key role of cysteine
residues in catalysis and subcellular local ization of sulfur
oxygenase-reductase of Acidianus tengchongensis. Appl Environ
Microbiol 71:621628
Dorner AJ, Bole DG, Kaufman RJ (1987) The relationship of N-
linked glycosylation and heavy chain-binding protein association
with the secretion of glycoproteins. J Cell Biol 105:26652674
Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating
proteins in the cell using TargetP, SignalP and related tools. Nat
Protoc 2:953971
Evans CL (1967) The toxicity of hydrogen sulphide and other
sulphides. J Exp Physiol 52:231248
Gazaryan IG, Krasnikov BF, Ashby GA, Thorneley RNF, Kristal
BS, Brown AM (2002) Zinc is a potent inhibitor of thiol
oxidoreductase activity and stimulates reactive oxygen species
production by lipoamide dehydrogenase. J Biol Chem 277:
1006410072
Gieselmann V, Schmidt B, Von Figura K (1992) In vitro mutagenesis
of potential N-glycosylation sites of arylsulfatase A. Effects on
glycosylation, phosphorylation, and intracellular sorting. J Biol
Chem 267:1326213266
GriesbeckC,HauskaG,Schütz M (2000) Biological sulfide
oxidation:sulfide-quinone reductase (SQR), the primary reaction.
In: Pandalai SG (ed) Recent research developments in microbi-
ology vol 4, rearch signpost. Trivadrum, India, pp 179203
Griesbeck C, Schütz M, Schodl T, Bathe S, Nausch L, Mederer N,
Vielreicher M, Hauska G (2002) Mechanism of sulfide-quinone
reductase investigated using site-directed mutagenesis and sulfur
analysis. Biochemistry 41:1155211565
Grieshaber MK, Völkel S (1998) Animal adaptations for tolerance
and exploitation of poisonous sulfide. Annu Rev Physiol
60:3353
Hance JM, Andrzejewski JE, Predmore BL, Dunlap KJ, Misiak KL,
Julian D (2008) Cytotoxicity from sulfide exposure in a sulfide-
tolerant marine invertebrate. J Exp Mar Biol 359:102109
Hamby SE, Hirst JD (2008) Prediction of glycosylation sites using
random forests. BMC Bioinformatics 9:500
Hildebrandt TM, Grieshaber MK (2008a) Redox regulation of
mitochondrial sulfide oxidation in the lugworm, Arenicola
marina. J Exp Biol 211:26172623
Hildebrandt TM, Grieshaber MK (2008b) Three enzymatic activities
catalyze the oxidation of sulfide to thiosulfate in mammalian and
invertebrate mitochondria. FEBS J 275:33523361
Jiménez-Castañoa L, Villamiel M, López-Fandiño R (2007) Glyco-
sylation of individual whey proteins by Maillard reaction using
dextran of different molecular mass. Food Hydrocoll 21:433
443
Joyner-Matos J, Predmore BL, Stein JR, Leeuwenburgh C, Julian D
(2010) Hydrogen sulfide induces oxidative damage to RNA and
DNA in a sulfide-tolerant marine invertebrate. Physiol Biochem
Zool. doi:10.1086/597529 (in press)
Julian D, April KL, Patel S, Stein JR, Wohlgemuth SE (2005)
Mitochondrial depolarization following hydrogen sulfide expo-
sure in erythrocytes from a sulfide-tolerant marine invertebrate. J
Exp Biol 208:41094122
Kraus D, Doeller J, Powell C (1996) Sulfide may directly modify
cytoplasmic hemoglobin deoxygenation in Solemya reidi gills. J
Exp Biol 199:13431352
Ma ZJ, Bao ZM, Kang KH, Yu L, Zhang ZF (2005) The changes of
three components in coelomic fluid of U rechis unicinctus
exposed to different concentrations of sulfide. Chin J Oceanol
Limnol 23:104109
Marcia M, Ermler U, Peng G, Michel H (2009) The structure of
Aquifex aeolicu s sulfide:quinone oxido reductase, a basis to
understand sulfide detoxification and respiration. Proc Natl Acad
Sci U S A 106:96259630
Matzuk MM, Boime I (1988) The role of the asparagine-linked
oligosaccharides of the alpha subuni t in the secretion and
assembly of human chorionic gonado trophin. J Cell Bio l
106:10491059
Menon JG, Arp AJ (1992) Morphological adaptations of the
respiratory hindgut of a marine echiuran worm. J Morphol
214:131138
Menon JG, Arp AJ (1993) The integument of the marine echiuran
worm Urechis caupo. J Morphol 185:440454
Menon J , Arp AJ (1998) Ultrastructural evid ence of detoxification
in the alimentary canal of Urechis caupo. Integr Biol 117:307
317
Nicholls P (1975) The effect of sulphide on cytochrome aa3 isosteric
and allosteric shifts of the reduced alpha-peak. Biochim Biophys
Acta 396:2435
106 Mar Biotechnol (2011) 13:93107
Page 14
Nicholls P, Kim JK (1982) Sulphide as an inhibitor and electron donor for
the cytochrome c oxidase system. Biochem Cell Biol 60:613623
Olden K, Parent JB, White SL (1982) Carbohydrate moieties of
glycoproteins a re-evaluation of their function. BBA-Rev
Biomembranes 650:209232
Powell MA, Arp AJ (1989) Hydrogen sulfide oxidation by abundant
nonhemoglobin heme compounds in marine invertebrates from
sulfide-rich habitats. J Exp Zool 249:121132
Powell MA, Somero GN (1985) Sulfide oxidation occurs in the animal
tissue of the gutless clam, Solemya reidi.BiolBull169:164181
Powell MA, Somero GN (1986) Hydrogen sulfide oxidat ion is
coupled to oxidative phosphorylation in mitochondria of Solemya
reidi. Science 233:563566
Scheibe R (1987) NADP
+
-malate dehydrogenase in C3-plants: regulation
and role of a light-activated enzyme. Physiol Plant 71:393400
Schroff G, Schöttler U (1977) Anaerobic reduction of fumarate in the
body wall musculature of Arenicola marina (Polychaeta). J
Comp Physiol B 116:325336
Shibata H, Kobayashi S (2006) Characterization of a HMT2-like
enzyme for sulfide oxidation from Pseudomonas putida. Can J
Microbiol 52:724730
Shibata H, Suzuki K, Kobayashi S (2007) Menaquinone reduction by
an HMT2-like sulfide dehydrogenase from Bacillus stearother-
mophilus. Can J Microbiol 53:10911100
Theissen U, Martin W (2008) Sulfide:quinone oxidoreductase (SQR)
from the lugworm Arenicola marina shows cyanide-and
thioredoxin-dependent activity. FEBS J 275:11311139
Theissen U, Hoffmeister M, Grieshaber M, Martin W (2003) Single
eubacterial origin of eukaryotic sulfide:quinone oxidoreductase, a
mitochondrial enzyme conserved from the early evolution of
eukaryotes during anoxic and sulfidic times. Mol Biol Evol
20:15641574
Vande Weghe JG, Ow DW (1999) A fission yeast gene for
mitochondrial sulfide oxidation. J Bio Chem 274:13250
13257
Völkel S, Grieshaber MK (1997) Sulphide oxidation and oxidative
phosphorylation in the mitochondria of the lugworm Arenicola
marina. J Exp Biol 200:8392
Wang R (2002) Twos company, threes a crowd: can H
2
Sbethe
third endogenous gaseous transmitter? FASEB J 16:1 792
1798
Wohlgemuth SE, Taylor AC, Grieshaber MK (2000) Ventilatory and
metabolic responses to hypoxia and sulphide in the lugworm
Arenicola marina (L.). J Exp Biol 203:31773188
Zhang ZF, Wang SF, Huo JG, Shao MY, Kang KH (2006) Adaptation
of respiratory metabol ism to sulfi de exposure in Urechis
unicinctus. Period Ocean Univ China 36:639644 (in Chinese
with English abstract)
Mar Biotechnol (2011) 13:93107 107
Page 15
  • Source
    • "Sections of the gonadal tissues were made following the method mentioned in Section 2.8. Immunohistochemistry was performed following protocols described by Ma et al. [59] , but the rabbit anti- 17-HSD8 antibody was diluted 1:1000 by PBS/Tween-20 plus 3% BSA. Controls were carried out using negative serum instead of anti- 17-HSD8 antibody. "
    [Show abstract] [Hide abstract] ABSTRACT: 17β-hydroxysteroid dehydrogenases (17β-HSDs) are important enzymes catalyzing steroids biosynthesis and metabolism in vertebrates. Although studies indicate steroids play a potential role in reproduction of molluscs, little is known about the presence and function of 17β-HSDs in molluscs. In the present study, a full-length cDNA encoding 17β-HSD type 8 (17β-HSD8) was identified in the Zhikong scallop Chlamys farreri, which is 1,104bp in length with an open reading frame of 759bp encoding a protein of 252 amino acids. Phylogenetic analysis revealed that the C. farreri 17β-HSD8 (Cf-17β-HSD8) belongs to the short chain dehydrogenase/reductase family (SDR) and shares high homology with other 17β-HSD8 homologues. Catalytic activity assay in vitro demonstrated that the refolded Cf-17β-HSD8 expressed in E. coli could effectively convert estradiol-17β (E2) to estrone (E1), and weakly catalyze the conversion of testosterone (T) to androstenedione (A) in the presence of NAD(+). The Cf-17β-HSD8 mRNA was ubiquitously expressed in all tissues analyzed, including gonads. The expression levels of Cf-17β-HSD8 mRNA and protein increased with gametogenesis in both ovary and testis, and were significantly higher in testis than in ovary at growing stage and mature stage. Moreover, results of in situ hybridization and immunohistochemistry revealed that the mRNA and protein of Cf-17β-HSD8 were expressed in follicle cells and gametes at all stages except spermatozoa. Our findings suggest that Cf-17β-HSD8 may play an important role in regulating gametogenesis through modulating E2 levels in gonad of C. farreri.
    Full-text · Article · Jan 2014 · The Journal of steroid biochemistry and molecular biology
  • Source
    • "The midgut tissue and mitochondrial total protein were extracted using the tissue protein extraction kit (Cwbio, Beijing, China). SDS-PAGE and western blotting were carried out as described [21]. A polyclonal antibody of U. unicinctus SDO was prepared by injecting purified recombinant SDO into New Zealand white rabbits at a titer of 1∶ 25,600. "
    [Show abstract] [Hide abstract] ABSTRACT: Sulfide is a common toxin to animals and is abundant in coastal and aquatic sediments. Sulfur dioxygenase (SDO) is thought to be the key enzyme involved in sulfide oxidation in some organisms. The echiuran worm, Urechis unicinctus, inhabits coastal sediment and tolerates high concentrations of sulfide. The SDO is presumably important for sulfide tolerance in U. unicinctus. The full-length cDNA of SDO from the echiuran worm U. unicinctus, proven to be located in the mitochondria, was cloned and the analysis of its sequence suggests that it belongs to the metallo-β-lactamase superfamily. The enzyme was produced using an E. coli expression system and the measured activity is approximately 0.80 U mg protein(-1). Furthermore, the expression of four sub-segments of the U. unicinctus SDO was accomplished leading to preliminary identification of functional domains of the enzyme. The identification of the conserved metal I (H113, H115, H169 and D188), metal II (D117, H118, H169 and H229) as well as the potential glutathione (GSH) (R197, Y231, M279 and I283) binding sites was determined by enzyme activity and GSH affinity measurements. The key residues responsible for SDO activity were identified by analysis of simultaneous mutations of residues D117 and H118 located close to the metal II binding site. The recombinant SDO from U. unicinctus was produced, purified and characterized. The metal binding sites in the SDO were identified and Y231 recognized as the mostly important amino acid residue for GSH binding. Our results show that SDO is located in the mitochondria where it plays an important role in sulfide detoxification of U. unicinctus.
    Full-text · Article · Dec 2013 · PLoS ONE
  • Source
    • "Subsequently, samples were incubated in 3% BSA for 30 min, and then incubated with anti-Aj-VASA antibody (diluted 1:800) for 1 hr. Preparation of the rabbit anti-Aj-VASA antibody was performed as described previously (Ma et al., 2011); the antibody titer was determined by enzyme-linked immunosorbent assay (1:8,000) while the specificity of antibody was tested by Western blotting. Primary antibody was reacted with peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) (diluted 1:5,000) for 1 hr. "
    [Show abstract] [Hide abstract] ABSTRACT: Vasa has been extensively used as a germline marker to trace the origin and migration pathway of primordial germ cells (PGCs) in many organisms, but little work has been reported on vasa genes and the origin of PGCs in holothurians. Using in situ hybridization and immunohistochemistry, vasa mRNA and protein of the sea cucumber Apostichopus japonicus (Aj-vasa) was detected in the cytoplasm of the unfertilized egg and was equally distributed in the cytoplasm of early embryos, from the 2-cell embryo to the blastula, indicating that Aj-vasa mRNA is maternally supplied. Later, expression of both Aj-vasa mRNA and protein centralizes gradually in newly organized structures from blastula to five-tentacle larva, and then is restricted to PGC-like cells of the original gonad in juveniles with 0.1-cm body length. The structure of the gonad develops further from a simple tubular gonad in 0.5-cm-length juveniles to a branched gonad in 3-cm-length juveniles. Our findings showed that the maternal supply of the vasa gene products in A. japonicus is different from that in sea urchin Strongylocentrotus purpuratus, of echinoderm, and suggested that the specialization of PGCs is an epigenesis mechanism in A. japonicus. Mol. Reprod. Dev. © 2013 Wiley Periodicals, Inc.
    Full-text · Article · Jul 2013 · Molecular Reproduction and Development
Show more