Exposure to HIV-1 Directly Impairs Mucosal Epithelial Barrier Integrity Allowing Microbial Translocation

Article (PDF Available)inPLoS Pathogens 6(4):e1000852 · April 2010with49 Reads
DOI: 10.1371/journal.ppat.1000852 · Source: PubMed
Abstract
While several clinical studies have shown that HIV-1 infection is associated with increased permeability of the intestinal tract, there is very little understanding of the mechanisms underlying HIV-induced impairment of mucosal barriers. Here we demonstrate that exposure to HIV-1 can directly breach the integrity of mucosal epithelial barrier, allowing translocation of virus and bacteria. Purified primary epithelial cells (EC) isolated from female genital tract and T84 intestinal cell line were grown to form polarized, confluent monolayers and exposed to HIV-1. HIV-1 X4 and R5 tropic laboratory strains and clinical isolates were seen to reduce transepithelial resistance (TER), a measure of monolayer integrity, by 30-60% following exposure for 24 hours, without affecting viability of cells. The decrease in TER correlated with disruption of tight junction proteins (claudin 1, 2, 4, occludin and ZO-1) and increased permeability. Treatment of ECs with HIV envelope protein gp120, but not HIV tat, also resulted in impairment of barrier function. Neutralization of gp120 significantly abrogated the effect of HIV. No changes to the barrier function were observed when ECs were exposed to Env defective mutant of HIV. Significant upregulation of inflammatory cytokines, including TNF-alpha, were seen in both intestinal and genital epithelial cells following exposure to HIV-1. Neutralization of TNF-alpha reversed the reduction in TERs. The disruption in barrier functions was associated with viral and bacterial translocation across the epithelial monolayers. Collectively, our data shows that mucosal epithelial cells respond directly to envelope glycoprotein of HIV-1 by upregulating inflammatory cytokines that lead to impairment of barrier functions. The increased permeability could be responsible for small but significant crossing of mucosal epithelium by virus and bacteria present in the lumen of mucosa. This mechanism could be particularly relevant to mucosal transmission of HIV-1 as well as immune activation seen in HIV-1 infected individuals.
Exposure to HIV-1 Directly Impairs Mucosal Epithelial
Barrier Integrity Allowing Microbial Translocation
Aisha Nazli
1,2
, Olivia Chan
1,2
, Wendy N. Dobson-Belaire
3
, Michel Ouellet
4
, Michel J. Tremblay
4
, Scott D.
Gray-Owen
3
, A. Larry Arsenault
2
, Charu Kaushic
1,2
*
1 Center For Gene Therapeutics, Michael G. DeGroote Center for Learning and Discovery, McMaster University, Hamilton, Ontario, Canada, 2 Department of Pathology and
Molecular Medicine, McMaster University, Hamilton, Ontario, Canada, 3 Department of Molecular Genetics, University of Toronto, Medical Sciences Building, Toronto,
Ontario, Canada, 4 Department of Medical Biology, Laval University, Quebec City, Quebec, Canada
Abstract
While several clinical studies have shown that HIV-1 infection is associated with increased permeability of the intestinal tract,
there is very little understanding of the mechanisms underlying HIV-induced impairment of mucosal barriers. Here we
demonstrate that exposure to HIV-1 can directly breach the integrity of mucosal epithelial barrier, allowing translocation of
virus and bacteria. Purified primary epithelial cells (EC) isolated from female genital tract and T84 intestinal cell line were
grown to form polarized, confluent monolayers and exposed to HIV-1. HIV-1 X4 and R5 tropic laboratory strains and clinical
isolates were seen to reduce transepithelial resistance (TER), a measure of monolayer integrity, by 30–60% following
exposure for 24 hours, without affecting viability of cells. The decrease in TER correlated with disruption of tight junction
proteins (claudin 1, 2, 4, occludin and ZO-1) and increased permeability. Treatment of ECs with HIV envelope protein gp120,
but not HIV tat, also resulted in impairment of barrier function. Neutralization of gp120 significantly abrogated the effect of
HIV. No changes to the barrier function were observed when ECs were exposed to Env defective mutant of HIV. Significant
upregulation of inflammatory cytokines, including TNF-a, were seen in both intestinal and genital epithelial cells following
exposure to HIV-1. Neutralization of TNF-a reversed the reduction in TERs. The disruption in barrier functions was associated
with viral and bacterial translocation across the epithelial monolayers. Collectively, our data shows that mucosal epithelial
cells respond directly to envelope glycoprotein of HIV-1 by upregulating inflammatory cytokines that lead to impairment of
barrier functions. The increased permeability could be responsible for small but significant crossing of mucosal epithelium
by virus and bacteria present in the lumen of mucosa. This mechanism could be particularly relevant to mucosal
transmission of HIV-1 as well as immune activation seen in HIV-1 infected individuals.
Citation: Nazli A, Chan O, Dobson-Belaire WN, Ouellet M, Tremblay MJ, et al. (2010) Exposure to HIV-1 Directly Impairs Mucosal Epithelial Barrier Integrity
Allowing Microbial Translocation. PLoS Pathog 6(4): e1000852. doi:10.1371/journal.ppat.1000852
Editor: Thomas J. Hope, Northwestern University, United States of America
Received May 20, 2009; Accepted March 8, 2010; Published April 8, 2010
Copyright: ß 2010 Nazli et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by operating grants from the Canadian Institute of Health Research (CIHR; http://www.cihr-irsc.gc.ca/e/193.html), Ontario HIV
Treatment Network (OHTN; http://www.ohtn.on.ca/) and Canadian Foundation for AIDS Research (CANFAR; http://www.canfar.ca/index.php?option = com_
frontpage&Itemid = 1& = en) (to CK) and CIHR HIV Emerging Team Grant HET-85518. CK is supported by a CIHR New Investigator Grant. The funders had no role in
study design, data collection and analysis, decision to publish or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: kaushic@mcmaster.ca
Introduction
The mucosa presents a primary barrier against a multitude of
micro-organisms present on the mucosal surfaces of the human
body [1]. The intestinal and upper reproductive tract are lined by
a continuous monolayer of columnar epithelial cells that is
responsible for maintaining the physical and functional barrier
to harmful microorganisms, such as bacteria and their products,
including bacterial toxins as well as commensal organisms [2–4].
The preservation of the barrier function is dependent on the
intactness of apical plasma membrane on the epithelial cells as well
as the intercellular tight junctions. The disruption of the tight
junctions can cause increased permeability, leading to ‘‘leakiness’’
such that normally excluded molecules can cross the mucosal
epithelium by paracellular permeation, and could lead to
inflammatory conditions in the mucosa.
Various pathogenic organisms have developed strategies to
either infect or traverse through the epithelial cells at mucosal
surfaces, as part of the strategy to establish infection in the host. In
fact, mucosal transmission account for majority of infections in
humans [5]. Viruses such as rotavirus and astrovirus as well as
bacteria such as enteropathogenic E. Coli and C. difficile are known
to increase intestinal permeability by disrupting tight junctions, as
part of their pathogenesis [6–9]. Increased permeability is also
related to a number of other disease conditions that may or may
not be related to infection by a pathogen. Crohn’s disease, a
chronic inflammatory condition of the intestines is characterized
by defective tight junction barrier functions, manifested by
increased intestinal permeability, although the etiology of the
disease is not clearly understood [10].
HIV-1 infection is initiated primarily on mucosal surfaces,
through heterosexual or homosexual transmission [1,11]. In
fact, mucosal transmission accounts for greater than 90% of
HIV infection [12,13]. A number of clinical studies have
reported intestinal barrier dysfunction, especially during chronic
stage of HIV infection [14–19]. However, the pathophysiologic
mechanism associated with compromised barrier function and
whether HIV-1 plays a direct role in this is still unclear.
PLoS Pathogens | www.plospathogens.org 1 April 2010 | Volume 6 | Issue 4 | e1000852
Currently, epithelial barrier defect during HIV-1 infection is
thought to be a consequence of mucosal T cell activation
following infection, which could lead to increased production of
inflammatory cytokines [19,20]. The intestinal barrier dysfunc-
tion has also been implicated as the cause of systemic immune
activation during chronic phase of HIV infection, although a
recent study has raised the possibility that this may not be
universal phenomenon [20,21]. Studies that have demonstrated
immune activation propose this to be the main driving force for
progressive immune failure leading to the immunodeficiency
stage [22–24]. In these studies, HIV disease progression was
shown to correlate with increased circulating level of LPS,
considered an indicator of microbial translocation, in chronic
HIV-infected individuals [25]. Interestingly, immune activation
wasobservedinboththechronicaswellasacutephaseofHIV
infection [25]. The source of or mechanism whereby microbial
products could cross the epithelial barrier leading to immune
activation have not been elucidated thus far.
In the present study, we investigated the direct effects of HIV-1
exposure on intestinal and genital mucosal epithelia, where
primary HIV-1 infection is frequently initiated. We show that in
fact the impairment of epithelial barrier function can be a direct
result of exposure to HIV-1. Using ex-vivo cultures of pure
primary genital epithelium as well as an intestinal epithelial cell
line, we show significantly decreased barrier functions and
enhanced permeability that is not unique to the intestinal
epithelium; similar increase in permeability was seen in the genital
epithelium as well. Small amounts of both bacterial and viral
translocation were seen following HIV-1 exposure. The mecha-
nism appears to be mediated by increased production of
inflammatory cytokines directly from the epithelial cells following
exposure to HIV-1, including TNF-alpha, known to disrupt
barrier functions. Further, we show that HIV-1 envelope protein
gp120 was able to impair barrier functions in epithelial cells on its
own. Neutralization of gp120 or exposure to HIV-1 lacking gp160
surface envelope glycoprotein did not have any effect on epithelial
cells. These results provide strong evidence that exposure to HIV-
1 may lead to impairment in barrier function of mucosal
epithelium which could result both in translocation of HIV-1
and/or luminal bacteria that could serve as the source of immune
activation during HIV-1 infection.
Results
Genital and intestinal epithelial monolayer transepithelial
resistances (TER) are decreased following exposure to
different strains of HIV-1
In order to study HIV-1 induced barrier defect in epithelial
monolayers, HIV-1 (10
6
infectious viral units/ml) was added
apically to confluent monolayers of differentiated primary
female genital epithelial cells (ECs) or T84 intestinal epithelial
cells grown in transwells. Transepithelial resistance (TER), a
measure of epithelial monolayer integrity, was measured before
and 24h post-infection and calculated as a percentage of
pretreatment TER. Transepithelial resistances of primary
endometrial epithelial monolayers exposed to various strains
of HIV-1 were significantly reduced (p,0.001 with all HIV-1
strains) by 30–60%, 24h post-exposure (Figure 1A). The TER
decrease in primary endometrial epithelial monolayers was
more pronounced following exposure to clinical strains of
HIV-1 [11242 (60.363.16%), 11249 (62.163.0%), 4648
(33.361.2%), 7681 (50.861%)] as compared to laboratory
strains (R5 tropic: Bal, ADA; X4 tropic: NLH4-3, IIIB and
MN) of HIV-1 (44.1–33.761.2–6.3%). Similar TER decrease
(39.0–47.8+1.6–6.0%, p,0.001, Figure 1B) was observed in
T84 monolayers with an array of laboratory and clinical strains.
Controls included mock-treatment of monolayers with same
volume of media, without HIV-1 (media control). Additional
controls included treating confluent monolayers with virus-free
supernatant from cultures used for preparing virus stocks
(Figure 1B, R5 and X4 mock control). All mock-infected
cultures maintained or showed increase in TERs at 100–120%
pretreatment values in both primary endometrial and T84
epithelial cells.
To exclude the possibility that changes in the barrier function
resulted from any cytotoxic effect of HIV-1 exposure that would
result in breach of the integrity of the monolayers, we tested the
viability of both intestinal and endometrial epithelial cultures
following HIV-1 exposure by an MTT assay. The results
indicated that exposure to HIV-1 for 24h did not have any
affect on cell viability relative to controls (Figure 1C). Thus
reduction in TERs following HIV-1 exposure in both intestinal
and genital epithelial cultures was not due to compromised
viability of epithelial cells.
We also determined if exposure to HIV on the basolateral side
of the epithelial cell monolayer decreased TERs of epithelial
monolayers. T84 intestinal EC monolayers were exposed to HIV
on both apical and basolateral surface and TERs were compared
24 hours later. Basolateral exposure to HIV led to no significant
decrease in TER (Figure 1D). This lack of response to basolateral
stimulation appeared to be specific for HIV-1, since exposure to
TNF-a decreased TERs of confluent epithelial monolayers,
regardless of whether the stimulation was delivered on apical or
basolateral surface of cells (Figure 1D).
HIV-1 exposure down-regulates tight junction mRNA and
protein levels in epithelial monolayers
We next examined the effect of HIV-1 exposure on gene and
protein expression of tight junctions in genital and intestinal
epithelial monolayers. Confluent monolayers of primary endo-
metrial epithelial cells were mock-treated or exposed to HIV-1
for 8h and total mRNA was extracted and subjected to
quantitative real time RT-PCR using primers specific to
Author Summary
Clinical studies have shown that HIV-1 infected patients
have increased intestinal permeability. In chronically
infected patients that progress to AIDS, there is activation
of immune cells consistent with leakage of microbes via
the gut. However, the mechanism by which this occurs is
not clear. Here, we show that direct exposure of intestinal
and genital epithelial cells to HIV leads to breaching of the
mucosal barrier and increased leakage of both bacteria
and virus across the epithelium. The mechanism of this
breakdown appears to be due to inflammatory factors
produced by epithelial cells themselves, in response to
HIV-1 exposure, that destroy the tight junctions between
epithelial cells, thereby allowing microbes access to the
inside of the body. Interestingly, we found that treatment
of epithelial cells with just the surface glycoprotein from
HIV could lead to similar breakdown of the barrier. This
implies that when mucosal epithelial cells come in direct
contact with large amounts of HIV-1, the virus can cross
into the inside of the body and cause direct infection of
target cells. The crossing of the bacteria by similar
mechanism can lead to chronic inflammation and activa-
tion of immune cells of the body.
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 2 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 1. Primary endometrial epithelial monolayers (A) and T84 intestinal epithelial cell line (B) were exposed to 10
6
infectious
viral units/ml of HIV-1 laboratory strains Bal, NL4-3, ADA (R5 tropic) and IIIB, MN (X4 tropic) and four clinical strains 4648 (R5
tropic) 11242, 7681 (X4 tropic) and 11249 (dual tropic). Corresponding p24 values were as follows for R5 tropic: Bal (0.6ng/ml), ADA (two
different viral stocks 0.3 ng/ml and 1040 ng/ml), 4648 (49ng/ml); X4 tropic: IIIB (0.7ng/ml and 161ng/ml), MN (103ng/ml and 1110ng/ml), NLH4-3
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 3 April 2010 | Volume 6 | Issue 4 | e1000852
different tight junction genes including Claudin 1, 2, 3, 4, 5,
Occludin and ZO-1 (Table 1). The expression of all seven
junction genes that were examined was down-regulated 2–17
fold in HIV-1 exposed monolayers when compared to mock-
treated controls (Figure 2A). Claudin-1, Claudin-2, Claudin-3,
Claudin-4, Claudin-5, Occludin and ZO-1 all showed signifi-
cantly lower expression (P,0.0001–0.01). Similar decrease in
mRNA expression was seen with intestinal epithelial monolayers
exposed to HIV-1 (data not shown).
To correlate the decreased mRNA levels with tight junction
protein expression, intestinal and endometrial monolayers were
stained for different tight junction proteins 24h after HIV-1
exposure and compared with mock-treated monolayers by
confocal microscopy. The protein expression correlated well with
real-time quantitative RT-PCR results, showing distinct decrease
in localization of Claudin 2 and Occludin and ZO-1 (Figure 2B–
D). The disruption of ZO-1 localization in HIV-1 exposed
monolayers was particularly severe and clearly visible. These
results indicated overall disruption of tight junctions.
HIV-1 mediated decrease in TERs correlates with
increased leakage of Blue Dextran
Next, we conducted a time course study to determine if HIV-1
mediated decrease in TER correlated with alterations in
permeability of the monolayers. Polarized, confluent monolayers
of primary endometrial and T84 intestinal epithelial monolayers
were exposed to HIV-1 for different lengths of time. The TERs
were measured prior to treatment and at 2h, 4h, 6h, 8h, 16h, 24h
and 48h post-exposure. A reduction in TER was first evident after
2h of HIV-1 exposure of genital epithelial cells (Figure 3A)
(p,0.001). TERs continued to decrease with longer exposure
times, reaching a low of ,40% of pre-treatment value at 24–
48hours. The TERs of control mock-treated group remained
relatively unchanged or showed slight increase through the
duration of the experiment (Figure 4A).
The decrease in TER was correlated with leakage of Blue
Dextran dye into basolateral compartment. Blue Dextran dye
(mol. wt. 2000 kDa), added to the apical side of intact epithelial
monolayers, normally cannot pass through the tight junctions
between epithelial cells that prevent its paracellular transport
[26]. A disruption of tight junctions allows leakage of this dye to
the basolateral compartment which can be detected by
densitometric measurement. To determine if HIV-1 exposure
led to increased permeability, Blue Dextran dye was added to
mock-treatedcontrolaswellasHIV-1(ADA)exposed
monolayers on apical side and its leakage was detected in
basolateral compartment after different time intervals. Blue
Dextran leakage became evident 2h post-exposure (p,0.01) and
gradually increased with increasedexposuretime(Figure3B).
ThekineticsofBlueDextranaccumulation in the basolateral
compartment closely paralleled the decrease in the TERs post-
exposure.
(93ng/ml), 7681 (773ng/ml), 11242 (342ng/ml); dual tropic 11249 (200ng/ml). Control include cultures that were mock-treated with medium without
virus (mock) or virus-free supernatants (R5 and X4 control). Transepithelial resistance (TER), was measured prior to and 24 hours post- exposure to
HIV-1. *p,0.001, n = 3–9. Viability of primary female genital epithelial cells and T84 intestinal epithelial cells was assessed by MTT assay 24 hours after
exposure with two HIV strains IIIB (X4-tropic) and ADA (R5-tropic) and compared with mock-infected epithelial monolayers (C). The effect of apical
and basolateral exposure was determined. (D). Differentiated T84 epithelial monolayers were mock infected or exposed apically or basolaterally to
HIV (ADA strain, 10
6
infectious viral particles/ml). TER was measured at 0, 24 and 48 hours post exposure. *P,0.001, **P,0.0001, n = 3.
doi:10.1371/journal.ppat.1000852.g001
Table 1. Primers used for Real Time PCR for different tight junction genes.
Tight junction genes Primer names Primer sequence 59 -39 References
ZO-1 ZO-1F TGTGAGTCCTTCAGCTGTGGAA Pu H, Tian J, Andras AS, Hayashi IK, et al, (2005) HIV-1 Tat protein-
induced alterations of ZO-1 expression are mediated by redox-
regulated ERK 1/2 activation. J Cerebral Blood Flow & Metabolism
25:1325–1335
ZO-1R GGAACTCAACACACCATTG
Occludin Occlu F CATTGCCATCTTTGCCTGTG Bai L, Zhang Z, Zhang H, et al. (2008) HIV-1 Tat protein alter the tight
junction integrity and function of retinal pigment epithelium: an in
vitro study. BMC Infec. Dis..8:77–89
Occlu R AGCCATAACCATAGCCATAGC
Claudin 1 Claudin 1F CAGGCTACGACCCGAAC Bai L, et al (2008) BMC Infec. Dis..8:77–89
Claudin 1R CAGGCTACGCAAGGA
Claudin 2 Claudin 2F CCCAAACCCACTAATCACATC Bai L. et al (2008) BMC Infec. Dis..8:77–89
Claudin 2R GCCACTGCTTCTCCTTCC
Claudin 3 Claudin 3F CAGGCTACGACCGCAAGGAC Bai L. et al (2008) BMC Infec. Dis..8:77–89
Claudin 3R GGTGGTGGTGGTGGTGTTGG
Claudin 4 Claudin 4F GGCGTGGTGTTCCTGTTG Bai L. et al (2008) BMC Infec. Dis..8:77–89
Claudin 4R AGCGGATTGTAGAAGTCTTGG
Claudin 5 Claudin 5F TACCGCAGGAAGAGGAGCAG Bai L. et al (2008) BMC Infec. Dis..8:77–89
Claudin 5R GCCCGAAGCAGCCAATCC
GAPDH GAPDH F TCTCTGCTCCTCCTGTTC Bai L. et al (2008) BMC Infec. Dis..8:77–89
GAPDH R CTCCGACCTTCACCTTCC
doi:10.1371/journal.ppat.1000852.t001
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 4 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 2. Confluent monolayers grown from primary endometrial epithelial cells were either mock-treated or exposed to HIV-1
(ADA strain, 10
6
infectious viral units/ml, p24 280ng/ml) for 8 hours. Total RNA was extracted and cDNA was synthesized. Quantitative Real-
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 5 April 2010 | Volume 6 | Issue 4 | e1000852
Disruption of tight junctions is due to de-localization of
ZO-1 at earlier time points followed by decrease in ZO-1
protein
Among the tight junction proteins, the normal pattern of ZO-1
localization was very prominent in both primary genital ECs and
intestinal T84 cells. Equally striking and apparent was its
disruption following HIV-1 exposure. Therefore, ZO-1 was
localized and quantified in confluent EC monolayers post-HIV-1
treatment and compared with control cultures to determine the
disruption of tight junctions. The results are shown for an earlier
time point (4 hour) and a later time point (24 hour) in control and
HIV-1 exposed monolayers (Figure 4). Confocal scanning was
performed and images were captured as Z-stacks to ensure that the
entire depth of the cell monolayer was encompassed. Control
monolayers were characterized by well-defined, lacey and
interconnected ZO-1 staining pattern located at the perimeter of
each cell (Figure 4 A and D) that remained unchanged over time.
Punctate distribution of intracellular ZO-1 was also commonly
noted in confluent ECs. Quantitative analysis of the ZO-1 (green)
and nuclear (red) fluorescence in the Z-stacks indicated that ZO-1
staining was localized in the apical cell layers (5–10
mm) of the EC,
with the peak signal observed in cell layers 7–8
mm, while the peak
of nuclear staining was more towards the center of the cells (cell
layers 10–12
mm). Four hours following HIV-1 exposure there was
a marked decrease in ZO-1 signal (Figure 4E). Even more
remarkable was the clear disruption in the ZO-1 localization, seen
as discontinuous distribution pattern around the perimeter of cells.
The inter-nodal connections between cells, indicating intact tight
junctions, were also notably decreased (17 in HIV-1-treated versus
203 in control monolayer). Interestingly, the signal for ZO-1
staining was present not just in the apical layers but in basal cell
layers as well, indicating a displacement of ZO-1 protein from the
tight junctions. The reduction in ZO-1 signal was progressive and
analysis of 24 hours post-treatment cultures indicated virtual
absence of ZO-1 signal (Figure 4 C and F), consistent with
decreased transcription of the mRNA seen at 8 hours post-
treatment (Figure 2A).
The decrease in TER and reduction in tight junction
staining is related to virus concentration
Next we determined whether the impairment of barrier function
of the epithelium was dependent on the exposure dose of HIV.
Various concentrations of HIV-1 strain ADA (10
2
–10
7
infectious
viral units/ml corresponding with MOI of 1:10
24
to 1:10 and p24
values of 0.2ng–2800ng/ml) were added on apical side of
confluent EC monolayers. The TER values were measured 24h
post-exposure and expressed as percent pretreatment TER
(Figure 5A). Exposure to HIV-1 concentrations from 10
7
–10
3
infectious viral units/ml showed significant reduction in TER
compared with uninfected controls (P,0.001, 10
7
–10
4
infectious
virus units/ml; P,0.05, 10
3
infectious virus units/ml). Exposure to
the lowest concentration corresponding to MOI of 1:10
24
(p24
value of 0.2ng/ml) did not cause any significant decrease in TER.
To confirm that decreased TER corresponded with disruption in
tight junctions, epithelial monolayers exposed to various concen-
trations of HIV-1 were stained for ZO-1. The ZO-1 disruption
was clearly visible at higher exposure doses of HIV-1 (Figure 5B).
HIV-1 induced barrier permeability is independent of viral
replication
To determine if productive viral replication was required for
increased permeability, polarized T84 cells were treated apically
with infectious HIV or an equivalent amount of UV-inactivated
virus (Figure 6A). Monolayers treated with UV-inactivated HIV
demonstrated decrease in TER nearly identical to those of the live,
infectious virus (p,0.001). The disruption of ZO-1 in epithelial
cell monolayers treated with UV inactivated was similar to that
seen with live HIV (Figure 6B). This was also clearly visible in the
z-axis reconstructions where mock-treated monolayers showed
abundant ZO-1 staining on the apical lateral membranes which
was virtually absent in EC monolayers exposed to live and UV
inactivated HIV-1 (Figure 6B, Z-section). These results indicated
that the increased epithelial cell permeability could be due to
initial attachment of the virus. This was further investigated by
exposing epithelial cells to HIV surface glycoprotein.
Gp120 but not Tat treatment compromises epithelial
barrier function
Previous studies examining effect of HIV-1 on blood brain
barrier demonstrated that HIV-1 gp120, a surface envelope
glycoprotein and tat, an HIV regulatory protein that is produced
by infected cells, could directly increase permeability of endothelial
cells [27–29]. We therefore determined if either of these two viral
proteins could exert similar effects on epithelial cell barrier
function. Transepithelial resistances were significantly reduced
following treatment with gp120 alone or in combination with tat
(P,0.001). Tat alone did not have any effect on barrier functions
compared with untreated controls. The results were comparable in
primary endometrial (Figure 6C) and in T84 intestinal epithelial
cells (Figure 6D). Disruption of tight junctions by gp120 was
confirmed by ZO-1 staining while tat-treated epithelial monolay-
ers did not show any alterations in ZO-1 localization (Figure 6E).
HIV-1 induced barrier permeability is dependent on virus
envelope glycoprotein
To confirm that the barrier defect was mediated by HIV-1 viral
envelope glycoprotein, we neutralized gp120 on HIV prior to
exposure to epithelial cells (Figure 7A). Epithelial monolayers were
treated with HIV-1 or equivalent amount of virus that had been
pre-incubated with gp120 neutralizing monoclonal antibody or
isotype control. Gp120 neutralizing antibody significantly abro-
gated the increase in permeability (p,0.01), while similar effect
was not seen with isotype control, further confirming the role of
gp120 in increased barrier permeability.
The final confirmation that viral surface glycoprotein was
critical for changes in epithelial cell permeability was obtained by
treating epithelial cells with an Env-defective mutant of HIV
(Env
2
) (Figure 7B,C) [30]. This mutant is characterized by lack of
Env polyprotein which results in absence of both gp120 and
gp41, the complex that initiates attachment and binding of HIV-
1 to host cell and subsequent entry. Epithelial cells exposure to
Env
2
HIV showed no changes in TERs compared to wild type
HIV (p.0.05), while the wild type HIV showed significant
decrease in TERs (p, 0.01) (Figure 7B). This was further
time RT-PCR was conducted for tight junction gene expression by measuring mRNA for Claudin 1–5, Occludin and ZO-1. GAPDH, a house keeping
gene, was measured for internal control (A). * p,0.01; ** p,0.001; *** p,0.0001). Immunofluorescent staining of tight junction proteins following
HIV-1 exposure compared to mock-treated epithelial monolayers. Representative staining is shown for claudin-2 (B), Occludin (C), and ZO-1 (D) at
24 hours post-exposure. Magnification: 12606. Data shown is representative of 3 separate experiments, each experiment had 3–5 replicate cultures
for each experimental condition. For RNA extraction, 6–8 replicate cultures were pooled.
doi:10.1371/journal.ppat.1000852.g002
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 6 April 2010 | Volume 6 | Issue 4 | e1000852
confirmed by intact ZO-1 staining seen in epithelial monolayers
exposed to Env
2
HIV, similar to mock-treated cells (Figure 7C).
Combined with the results from gp120 neutralizing antibody
described above, these results indicate that the HIV-1 surface
glycoprotein is responsible for disruption of epithelial barrier
leading to increased permeability.
HIV-1 exposure induces inflammatory cytokines in
genital and intestinal epithelial monolayers
Epithelial cells are known to secrete a variety of cytokines at
constitutive levels. Many of these are upregulated or induced de
novo in response to pathogens such as Neisseria gonorrhea [31].
Additionally, inflammatory cytokines have been shown to mediate
Figure 3. Primary genital epithelial monolayers were exposed to HIV-ADA (R5 strain, 10
6
infectious viral units/ml, p24 280ng/ml )
for 2h, 4h, 6h, 8h, 16h, 24h and 48h. To measure barrier functions, TER was measured prior to and post exposure, ZO-1 staining was done and
Dextran Blue dye leakage was measured across the monolayers at all time points. (A) TER values. p,0.001. (B) Paracellular permeability measured by
addition of Blue Dextran dye on the apical side of monolayers. At different time intervals post-exposure, basolateral supernatants were sampled and
absorbance was measured and compared to apical absorbance at initial time point (Time ‘‘0’’). Blue Dextran leakage was calculated as a percentage
of apical values. Data shown is representative of 3–4 separate experiments, each experiment had 3–5 replicate cultures for each experimental
condition.
doi:10.1371/journal.ppat.1000852.g003
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 7 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 4. Genital EC monolayers were fixed after 4 or 24 hours post-HIV-1 exposure and stained for ZO-1 (green) and nucleus (red).
A–C. Series of stack planes (XY) taken through the apical extent of the monolayer. D–F. Quantification of ZO-1 (dark line) and nuclear (grey bars)
staining shown as graphs. Each cell layer (1–20) corresponds to series of images from Z-stack sections taken at 1
mm thickness through the cell
monolayer shown on the right. X-axis illustrates cell layers from apical to basolateral. Y-axis illustrates the number of pixels present over the entire
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 8 April 2010 | Volume 6 | Issue 4 | e1000852
enhanced permeability of intestinal epithelial cells [32]. We
therefore examined the cytokine secretion profile of epithelial
cells following HIV-1 exposure. Apical and basolateral superna-
tants of genital and intestinal monolayers were collected 24h post
HIV-1 exposure and examined for presence of six cytokines
known to be secreted by epithelial cells (Figure 8A–F). The T84
intestinal cell line constitutively secreted low levels of IL-10 and
IL-1b. In comparison, the primary endometrial epithelial
monolayers showed constitutive production of a larger array of
cytokines, some of them in high amounts (IL-6, IL-8, MCP-1).
Following HIV-1 exposure, there was a significant increase in
production of TNF-a, IL-6, IL-8 and MCP-1 in T84 intestinal
epithelial monolayers (Figures 8A–D). In primary endometrial ECs
there was a significant increase in production of TNF-a, IL-6,
MCP-1, IL-10, and IL-1b secretion after 24 hours of HIV-1
exposure (Figures 8A, B, E, F).
HIV-1 mediated TER decrease is reversed by treatment
with anti-TNF antibody
Of the cytokines that showed increased production in genital
and intestinal epithelial cells following HIV-1 exposure, TNF-a is
well known to disrupt epithelial cell tight junction assembly and
increase intestinal cell permeability [33]. Since TNF-a was
significantly up-regulated following HIV-1 exposure in both
genital and intestinal ECs, we neutralized TNF-a to see whether
this would affect barrier function alterations. Confluent T84
intestinal epithelial monolayers were treated with TNF-a (20 ng/
ml), TNF-a+anti-TNF antibody (mouse anti-human TNF-a ,
25
mg/ml), TNF-a+mouse serum (control), HIV-1 alone, HIV-
1+anti-TNF antibody (mouse anti-human TNF-a antibody,
25
mg/ml) and HIV-1+mouse serum (control). The TER mea-
surements were taken prior to and 24 hours following the
treatments. As expected both TNF-a and HIV-1 caused a
significant drop in TER values compared to untreated control
monolayers (Figure 9). When epithelial monolayers were pre-
treated with anti-TNF-a antibody prior to treatment with TNF-a
and HIV-1, the TER values did not decrease significantly over
24 hours of exposure. Incubation of monolayers with normal
mouse serum did not show the same effect as the anti-TNF-a
antibody. These results provide direct evidence that TNF-a
secreted by epithelial cells in response to HIV-1 exposure
contributed significantly to the disruption of barrier function in
epithelial cells.
Increased permeability correlates with translocation of
virus and bacteria across the epithelial monolayers
To correlate barrier dysfunction with increased permeability to
luminal antigens, we examined bacterial and viral translocation
across the epithelial monolayers post-exposure to HIV-1. Intestinal
epithelial monolayers grown to confluence were exposed to HIV-
1. TNF-a was used as a positive control since it is known to disrupt
tight junctions and increase permeability. Because direct exposure
to TNF-a for prolonged period of time causes irreversible damage
to epithelial cells, TNF-a treatment was limited to 6 hours prior to
addition of non-pathogenic E. Coli to allow observation of bacterial
translocation. Exposure time for HIV-1 was chosen at 6 hours (for
comparison with TNF-a) and 24 hours (based on our results of
maximum permeability with continued viability). Six hours after
addition of E. Coli to the apical compartment, basolateral
supernatants were collected and plated on LB agar and bacterial
colonies were quantified. Transepithelial resistance measured prior
to and 24 hours following treatments to determine if addition of E.
Coli had any effect on TERs (Figure 10A). In HIV-1 exposed
monolayers TER decreased significantly within 6h of exposure as
expected; further reduction was seen at 24 hours. In comparison,
HIV-1 unexposed monolayers only and those that were untreated
except with E. Coli, TER values were maintained at 106% and
89% percent respectively, of pre-treatment TER values. Bacterial
translocation was seen only in monolayers following 24hours of
HIV-1 exposure and 6 hours of TNF-a treatment (Figure 10B).
Bacterial translocation seen following 24 hours of HIV-1 treat-
ment was about 50% of that seen following 6 hours of TNF
treatment. No significant bacterial translocation was seen after 6h
of HIV-1 exposure.
In a separate experiment, lipopolysaccaride (LPS) leakage in
HIV-1 exposed endometrial monolayers was determined. LPS was
added on apical side of HIV-1 exposed and control monolayers
and one hour later basolateral supernatants were collected and
LPS leakage was measured. The LPS levels in basolateral
supernatants were increased by 47.360.922% in HIV-1 exposed
monolayers in comparison with LPS leakage in mock-treated
control monolayers.
We also measured translocation of HIV-1 through the primary
endometrial monolayers (Figure 10C). At various time points
following HIV-1 exposure on the apical side, basolateral
supernatant was collected and HIV-1 infectious viral counts were
determined TZMb-1 indicator cell assay. The results are presented
as percent of inoculum virus added on apical side. Infectious viral
counts were seen starting at 6 hours following exposure to HIV-1
(0.03% of inoculum) and infectious virus continued to accumulate
in the basolateral compartment (0.08% of inoculum) up to
48 hours time, which was the last time point examined.
Discussion
To summarize, we were able to demonstrate that exposure to
HIV-1 directly decreased the transepithelial resistance across
intestinal and genital epithelial monolayers. The reduction in TER
correlated with significant decrease in tight junction protein
expression and increased permeability, indicating functional
impairment of the barrier. The effect was specific for HIV-1 and
reached significant levels within 2–4 hours following HIV-1
exposure. Similar reduction in tight junction functioning was
observed following treatment of ECs with HIV-1 envelope protein
gp120 but not tat, a regulatory protein. Neutralization of gp120
and exposure to an Env
2
HIV significantly abrogated the
impairment of epithelial barrier, indicating that the effect was
mediated by HIV-1 envelope glycoprotein. We further determined
that exposure of the epithelial monolayers to HIV-1 led to
enhanced production of a number of inflammatory cytokines,
including TNF-a, by both intestinal and genital epithelial cells.
When epithelial cells were exposed to HIV-1 in presence of anti-
TNF antibody, there was no significant decrease in TER,
indicating that TNF played a major role in impairing the barrier
functions. In experiments designed to determine whether the
disruption of epithelial barrier function could be directly associated
with microbial leakage across the mucosa, we found evidence for
area of image. A, D. Control mock infected monolayer, 24 hours post-treatment. B,E. HIV-1 exposed monolayer, 4 hours post-treatment. C,F. HIV-1
exposed monolayer, 24 hours post-treatment. Results shown are representative of 3 separate Z-stacks collected and analyzed from each replicate,
each treatment group had 3–5 replicates and the experiment was repeated 3 times. (Magnification :12606).
doi:10.1371/journal.ppat.1000852.g004
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 9 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 5. Primary endometrial EC monolayers were exposed to different concentrations of HIV-1 (ADA) for 24 hours. TER values were
measured, starting at viral concentration of 10
3
up to 10
7
infectious viral units/ml (equivalent to p24 values of 0.2ng–2800 ng/ml) (A).* p,0.001
**p,0.05. ZO-1 staining following exposure to different concentration of virus (B). Data shown is representative of three separate experiments, each
experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g005
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 10 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 6. HIV-1 induced barrier permeability is independent of viral replication. Differentiated T84 cells were mock infected or exposed to
live or UV inactivated HIV (IIIB strain, 10
6
infectious viral particles/ml). (A) TER values following exposure to both live and UV-inactivated HIV compared
to mock treated monolayer (P,0.001). (B) ZO-1 staining in epithelial cells exposed to live and UV-inactivated HIV, but not mock infected cultures. The
corresponding Z-stack series below each panel clearly shows majority of ZO-1 staining (green) in mock treated cultures on the apical side of the
monolayer, while the nuclei are seen more basolaterally (red). Magnification:12606. Primary endometrial EC monolayers (C) or intestinal T84 cells (D)
were treated with either gp120 (0.1
mg/ml, 0.8nM) or Tat (1.4ug/ml, 100nM) or a combination of both, for 24 hours. TER values were measured prior to
and post-treatment. p,0.001, n = 6. (E) ZO-1 staining after gp120 treatment and Tat treatment. Magnification: 25206. Data shown is representative of
two (A,B) and six (C,D) separate experiments, each experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g006
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 11 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 7. (A) Epithelial monolayers were treated with medium alone, HIV-1 (IIIB, 10
6
infectious viral particles/ml), HIV-1 in combination with gp120
neutralizing antibody (35
mg/ml) or isotype control antibody (35mg/ml), gp120 or isotype antibody alone. TER measurements were taken as a measure
of change in permeability and presented as percent of pre-treatment TER. p,0.01. (B) Confluent T84 epithelial cell cultures were mock infected or
exposed to NL4-3 (p24, 79 ng/ml) or NL4-3 Env
2
mutant (p24, 79 ng/ml) and TER measurements were taken prior to and 24 hours post-exposure.
P,0.001 (C) ZO-1 localization after exposure to wildtype HIV-1 NL4-3 or Env
2
NL4-3 mutant. Data shown is representative of four separate
experiments, each experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g007
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 12 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 8. Primary endometrial EC and T84 intestinal monolayers were exposed to HIV-1 (ADA, 10
6
infectious viral units/ml, p24
280ng/ml) and apical and basolateral supernatants were collected 24 hours post-exposure and assayed by Luminex multi-analyte
kit for the following cytokines: (A) TNF-a (B) IL-6, (C) IL-8, (D) MCP-1, (E) IL-10, (F) IL-1b. *p,0.01, **p,0.001. Data shown is representative
of three separate experiments from different tissues, each experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g008
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 13 April 2010 | Volume 6 | Issue 4 | e1000852
small but significant bacterial and viral translocation across
epithelial monolayers following HIV-1 exposure.
To the best of our knowledge, this is the first study to
demonstrate that HIV-1 can directly disrupt mucosal epithelial
barrier functions that can lead to enhanced microbial transloca-
tion. Previous clinical studies have documented that in HIV-1
infected patients intestinal permeability is altered, characterized by
diarrhea-induction [15–17] . A recent study showed impairment of
barrier function in intestinal biopsies of HAART-naı
¨
ve patients
compared to those on HAART treatment [14]. Increased
production of cytokines IL-2, IL-4, IL-5 and TNF-a was found
in supernatants of cultured intestinal biopsies in this study. Their
conclusion was that following infection, HIV replication in target
cells leads to local increase of inflammatory cytokines in the
intestinal mucosa, which induce barrier impairment. This supports
previous studies where PBMCs co-cultured with HIV-infected
macrophages resulted in increased production of a number of
cytokines, including TNF-a, IL-1b, IFN-a and IFN-c which were
shown to compromise epithelial barrier function [34]. The
prevailing opinion from these studies is that the effect on epithelial
barrier is likely mediated via immune cell activation due to viral
replication [14,25]. Of note are other studies that were unable to
show that mononuclear cells isolated from colon of infected
patients produce increased amount of cytokines [35,36]. Thus far
the cellular source of inflammatory cytokines that could lead to
barrier disruption in HIV infected patients remains controversial
[20]. Based on our results, we would like to propose that the
primary sources of the inflammatory cytokines that disrupt the
mucosal barrier are the epithelial cells themselves. Our studies
demonstrate that epithelial cells respond directly and rapidly to
HIV envelope glycoprotein by production of increased levels of
cytokines which lead to loss of barrier functions, rather than an
indirect effect mediated by immune cells following HIV replica-
tion. This provides an alternate and more direct explanation as to
why decrease in viral load following HAART treatment restores
intestinal barrier functions [14]. Our results that demonstrate that
barrier dysfunction can allow bacterial translocation could also
provide explanation for increased levels of immune activation
during acute infection, an observation noted in a previous study
which examined immune activation following HIV infection in
North American cohorts [25]. The mechanism demonstrated in
the present study does not exclude the possibility that cytokines
released from immune cells in the HIV-infected intestines could
also contribute to further disruption of the barrier, more likely in
the chronic phase of the infection.
That viral exposure could directly lead to compromised barrier
function has been shown before [6,8,9]. Many other viruses and
even bacteria have been shown to directly compromise both
epithelial and endothelial barrier integrity. Astrovirus, a single
stranded RNA virus and a causative organism of common
diarrhea was recently shown to increase epithelial barrier
permeability in Caco-2 intestinal cells, modulated by its capsid
protein, independent of viral replication [6]. Coxsackievirus has
also been shown to directly compromise endothelial tight junctions
[8]. Previous studies have shown that HIV-1 infection can
compromise the blood-brain barrier thereby leading to progres-
sion of HIV-1 encephalitis (reviewed in [37]). The functioning of
the tight junctions between endothelial cells, that form the blood-
brain barrier, is quite similar to those present between mucosal
epithelial cells. However, the mechanism elucidated by these
Figure 9. Primary endometrial epithelial monolayers were exposed to TNF-a or HIV-1 alone; TNF-a or HIV-1 (ADA,10
6
infectious
viral units/ml, p24 280ng/ml) in combination with anti-TNF-a neutralizing antibody; TNF-a or HIV-1 in combination with normal
mouse serum for 24 hours. TER measurements were taken as a measure of change in permeability and presented as percentage of pre-treatment
TER. Data shown is representative of two separate experiments, each experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g009
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 14 April 2010 | Volume 6 | Issue 4 | e1000852
Figure 10. Bacterial and viral translocation across mucosal epithelial monolayers following HIV-1 exposure. (A) Bacterial translocation
was measured in T84 intestinal monolayers. Confluent monolayers were left untreated or treated for 6 hours with TNF-a (20ng/ml), E. coli (10
8
CFU/
ml) , TNF-a (20ng/ml) +E. coli (10
8
CFU/ml), HIV-1 or HIV-1 (6 or 24 hours)+E. coli (10
8
CFU/ml). (A) TER measurements following various treatments in
the presence or absence of E. Coli. * p,0.001. (B) Basolateral supernatants were collected and bacterial counts were done. (C) Viral translocation was
determined in endometrial EC monolayers exposed to HIV-1 (ADA, 10
6
infectious viral units/ml, p24 280ng/ml) on the apical side. Basolateral
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 15 April 2010 | Volume 6 | Issue 4 | e1000852
studies was not a direct effect of HIV, but facilitated by production
of TNF-a during chronic infection that mediated opening of
paracellular route in endothelial lining, for viral entry into the
brain. Interestingly, a recent study elucidated that HIV-1 tat
protein can directly compromise the retinal epithelial barrier
function [38]. Despite this evidence, no studies have so far
examined the direct effect of HIV-1 exposure on mucosal
epithelium. Our results show that increased permeability is
mediated directly by HIV viral envelope glycoprotein. Further,
given that significant disruption of tight junction proteins and
decreased TERs occurred following treatment with UV inactivat-
ed virus, this phenomenon is independent of viral replication.
Whether HIV-1 entry is required for the epithelial cell response is
currently being examined.
In our study, both the intestinal cell line and primary genital
epithelial cells showed similar response to different strains of HIV-
1: disruption of tight junctions, and increased permeability.
However, we found the profile of cytokines produced constitutively
by intestinal and genital epithelial cells was quite distinct. While
the intestinal cell line T84 did not constitutively produce TNF-a,
IL-6, IL-8 and MCP-1, there was significant induction of these
cytokines following HIV-1 exposure. Primary genital epithelial
cultures, on the other hand, constitutively produced TNF-a, IL-6,
IL-8 and MCP-1 and production of TNF-a and IL-6 was
significantly upregulated following HIV-1 exposure. Both types
of ECs secreted minimal levels of IL-10 and IL-1b which was
upregulated following HIV-1 exposure only in primary genital
epithelial cells. The differences in the constitutive cytokine profile
between genital and intestinal epithelial cells could be due to
distinct characteristics of primary cells compared to cell lines.
Alternatively, intestinal epithelial cells are likely to be more
quiescent in terms of baseline cytokine production given their
microenvironment where a variety of commensal organisms are
always present in the lumen [39]. In comparison, upper genital
tract epithelium exist in a relatively sterile environment and are
known to actively secrete an array of cytokines [2]. Nevertheless,
following exposure to HIV-1 both types of ECs responded with
enhanced induction of inflammatory cytokines that mediated
disruption of tight junctions. This indicates that as long as the viral
load and exposure times are sufficient, HIV can likely disrupt any
mucosal barrier in the body, independent of infection and
replication.
Among the cytokines that were upregulated, the direct effect of
TNF-a on disruption of intestinal epithelial tight junction and
increased permeability has been extensively characterized [33].
TNF-induced increase in permeability of Caco-2 cells is known to
be mediated by NF-kB activation that downregulates ZO-1
protein expression [40]. ZO-1 proteins are integral part of the
tight junction assembly and function as a scaffolding protein
critical in maintaining the integrity of the tight junctions. The
results from ZO-1 quantification (Figure 4) indicate that the
disruption of tight junctions following HIV-1 exposure likely
happens in two stages: initially there may be a displacement of
ZO-1 that leads to disruption of tight junction integrity followed
by marked reduction in the amount of ZO-1 and other tight
junction proteins due to decreased transcription. Thus, TNF-a
produced by the ECs in response to HIV-1 envelope glycoprotein
could induce NF-kB activation and subsequent downregulation of
tight junction proteins, including ZO-1. Our ongoing studies show
that NF-kB translocation occurs within 1 hour of HIV-1 exposure
(Nazli and Kaushic, unpublished). Whether there are distinct steps
in this process that have discrete mechanisms is currently under
investigation. Regardless of the detailed mechanism, the outcome
of tight junction disruption is decrease in TER and leakage across
the epithelial barrier.
The finding that disruption of barrier function can result in
small but significant amount of both viral and bacterial
translocation across ECs following exposure to HIV-1 has
profound implications. Although previous studies have demon-
strated presence of LPS in serum of HIV infected patients and
correlated it with immune activation in North American cohorts,
the inference that microbial flora in the intestines was the source of
LPS was indirect [25]. Our studies provide direct evidence that
both bacteria and virus present on the apical side of mucosal
epithelial cells during HIV-1 exposure could leak through because
of the impairment of epithelial tight junctions and increased
permeability. This could allow HIV-1 access to target cells located
in the lamina propria of the mucosa as well allow bacterial
translocation that could cause local immune activation.
While the viral-epithelial interactions described here are novel,
further investigation is needed to determine what role increased
barrier permeability plays in initiating HIV-1 infection. HIV-1
transmission across intestinal and genital mucosa occurs predom-
inantly via infected semen; currently the role of seminal plasma in
HIV-1 transmission is far from clear. Recent studies indicate that
seminal plasma can lead to inflammatory responses and facilitate
HIV-1 transmission [41–43]. However, seminal plasma compo-
nents such as TGF-b and HGF also enhance epithelial barrier
functions [44]. Further, given the low efficiency of viral
translocation seen in the ex-vivo model described here, the ability
of HIV-1 to cross over in significant numbers, in vivo, would be
depend presence of high viral load in the semen, most likely in
acute phase of infection. While plasma and semen loads show
overall correlation, compartmentalization between genital and
blood viral loads is well recognized and more recent studies show
that seminal plasma viral load can persist following treatment with
HAART [45–47]. While the results from the present study
elucidate a new mechanism that could lead to viral translocation
across the epithelial barrier, more information is needed to
understand how other factors like seminal plasma, stage of the
infection and viral load may influence any viral leakage across the
mucosal barrier. If under physiological conditions, viral leakage
does occur because of barrier disruption, it could play a critical
role in initiation of infection, especially in the presence of existing
inflammation from other viral or bacterial co-infections [48].
In conclusion, the current study provides evidence for the first
time that HIV-1 exposure at the mucosal surface leads to direct
response by the mucosal epithelium, seen by production of
inflammatory cytokines. This response is rapid, independent of
viral infection and likely plays a key role in initiation of mucosal
damage. This information will be critical for strategies to target
control of mucosal damage.
Methods
Primary genital epithelial and intestinal cell line cultures
Reproductive tract tissues were obtained from women aged 30–
59 years (mean age 42.9+7.2) undergoing hysterectomy for benign
supernatants were collected after different time intervals infectious and viral counts were done on TZM/b-l indicator cell line. Viral counts are
depicted as percentage of inoculum added to the apical compartment of monolayers. Data shown is representative of two separate experiments,
each experiment had 3–5 replicate cultures for each experimental condition.
doi:10.1371/journal.ppat.1000852.g010
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 16 April 2010 | Volume 6 | Issue 4 | e1000852
gynecological reasons at Hamilton Health Sciences Hospital.
Written informed consent was obtained from all patients, with the
approval of Hamilton Health Sciences Research Ethics Board.
The most common reasons for surgery were uterine fibroids and
heavy bleeding. Tissues were first examined by pathologists and if
they were deemed free from any malignant or other clinically
observed disease, coin-sized pieces were collected for further
processing.
Detailed protocol for isolation and culture of genital epithelial
cells (GEC) has been described previously [49]. Briefly, endome-
trial and cervical tissues were obtained from women undergoing
hysterectomy and minced into small pieces and digested in an
enzyme mixture for 1 hour at 37uC. Epithelial cells (EC) were
isolated by a series of separations through nylon mesh filters of
different pore sizes. EC were grown onto Matrigel
TM
(Becton,
Dickinson and Company) coated, 0.4-
mm pore-size polycarbonate
membrane tissue culture inserts (BD Falcon, Mississauga, Canada)
with primary tissue culture medium (DMEM/F12; Invitrogen,
Canada) supplemented with 10
mM HEPES (Invitrogen, Canada),
2
mM l-glutamine (Invitrogen, Canada), 100 units/ml penicillin/
streptomycin (Sigma–Aldrich, Oakville, Canada), 2.5% Nu Serum
culture supplement (Becton, Dickinson and company, Franklin
Lakes, USA), and 2.5% Hyclone defined fetal bovine serum
(Hyclone, Logan, USA). Polarized monolayers were formed within
5–7 days. The purity of GEC monolayers was between 95% and
98%. There was no trace of any hematopoietic cells in the
confluent monolayers. The methodology used for monitoring the
purity of the epithelial monolayers and absence of CD45 staining
in confluent cultures has been described in detail before [49].
The human colon-derived crypt-like T84 epithelial cell line was
maintained and cultured as described previously [50]. Briefly T84
intestinal cells were grown and maintained in a 1:1 (vol/vol)
mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12
medium, supplemented with 10% fetal bovine serum, 1.5%
HEPES, and 2% penicillin-streptomycin (Life Technologies,
Grand Island, NY) at 37uCin5%CO
2
. T84 cells were seeded
onto filter supports (0.5610
6
cells/well, 0.4-mm pore-size polycar-
bonate membrane tissue culture inserts, BD Falcon, Mississauga,
Canada) and grown for approximately 5–6 days till they reached
confluency. The confluency of EC cultures and T84 monolayers
was monitored microscopically and by trans-epithelial resistance
(TER) across monolayers grown on cell culture inserts, using a volt
ohm meter (EVOM; World Precision Instruments, Sarasota, FL,
USA). Epithelial monolayers showing TER values higher than
1000 V/cm
2
were considered completely confluent and used for
further experiments.
Virus strains, propagation and infection
HIV-1 R5 and X4 -tropic laboratory strains were prepared by
one of two methods. R5-tropic ADA and X4-tropic laboratory
strain IIIB viral stocks were prepared by infection of adherent
monocytes from human PBMCs (ADA) or from chronically
infected H9 cell line (IIIB), followed by virus concentration by
Amicon Ultra-15 filtration system (Millipore, Billerica, US). Virus
stock preparations were checked for possible contamination by
cellular factors by multiplex bead-based sandwich immunoassay
(Luminex Corporation, Austin, TX, USA). TNF-a, IL-6, IL-8,
MCP-1, MIP-1a, MIP-1b, RANTES, IL-1a, IL-1b were not
detected in any viral stock (standard range of detection limit for
different factors: 0.1–4.5 pg/ml). Laboratory strains of HIV-1
virus were also prepared by ultracentrifugation method. HIV-1 R5
laboratory strains ADA, Bal, and X4 strains IIIB, MN and NL4-3
and four clinical strains 11242 (dual), 11249 (R5), 4648 (R5), 7681
(X4) (Dr. Donald R. Branch, University of Toronto) were
prepared in human PBMC preparations and concentrated by
ultracentrifugation over 20% sucrose for 1 hour at 19,000 rpm
(33,000g). All HIV-1 stocks were titered for infectious viral count/
ml by TZMb-1 indicator cell assay as described previously [51].
TZMb-1 assay is based on infection of Hela cell line that has been
stably transfected with CD4, CXCR4 and CCR5 receptors for
HIV-1 attachment. The cell line also carries two indicator systems
(b-galactosidase and luciferase systems) under the influence of
HIV-1 promoter. HIV-1 infection is detected by staining the cells
for b-galactosidase activity resulting in cells turning blue,
indicative of HIV-1 replication or alternately by detection of
luciferase activity. Infectious viral units/ml = infectious viral
counts indicated by number of blue cells per well X dilution
factor/ml.
For HIV-1 exposure, primary epithelial cells, isolated from
human female genital tract tissues or intestinal T84 cells were
grown to confluence. Epithelial cell cultures were exposed apically
or basolaterally to HIV-1 virus (10
5
infectious viral units/well/
100
ml, final concentration 10
6
infectious viral units/ml), corre-
sponding to MOI of 1.0 or other viral doses as mentioned in
individual experiments. The p24 values corresponding to this
standard concentration of virus (10
6
infectious viral units/ml)
varied, depending on the viral strain, as determined by p24 ELISA
(Zeptometrix Corp., Buffalo, NY, USA); it corresponded to p24
concentration between 0.7–1110 ng/ml for X4 tropic lab strains
and between 0.3–790 ng/ml for R5 tropic viruses. For clinical
strains p24 concentrations used for HIV exposures were between
49–773 ng/ml. Mock infection controls included exposure to same
volume of media without HIV-1 (media control, mock) or
exposure to same volume of virus (and gp120) free supernatant
from PBMC (for R5 HIV-1) or H-9 (X4 HIV-1) cell line cultures
(R5 and X4 controls).
Env-defective mutant, Env
2
(kind gift of D. Johnson, NCI) was
on an NL4-3 backbone (X4-tropic HIV-1 laboratory strain) and
was compared to wildtype NL4-3 for its effect on epithelial cell
permeability [30]. T84 intestinal epithelial monolayers were
exposed to wildtype (10
6
infectious units/ml, p24 79ng/ml) or
Env
2
NL4-3 (p24, 79ng/ml) and TER were measured prior to
and 24 hours post-exposure. Monolayers were fixed for ZO-1
staining.
UV inactivation of HIV
HIV-1 R5-tropic strain ADA and X4-tropic strain IIIB were
inactivated by UV exposure. 10
6
infectious units/ml of virus was
subjected to 25–100mJ/cm
2
UV with a UV cross-linker (Fisher
Scientific, USA). UV inactivation of virus was confirmed by
titration on TZMb-1 cells.
Gp120 and Tat treatments
HIV-1 proteins gp120 envelope protein and soluble Tat protein
were obtained from NIH AIDS Research & Reference Reagent
Program. Epithelial cell cultures were treated with HIV-1 viral
proteins gp120 (0.8nM, 0.1
mg/ml) or Tat (100 nM, 1.4ug/ml). A
range of Gp120 concentration (50ng–1
mg/ml) was tried based on
those used in previous studies [28]. Concentration of tat was
consistent with that used in other studies for cultured brain
endothelial cells and corneal epithelial cells [29,38]. HIV-1
proteins were allowed to interact with the epithelial cells for
24 hours at 37uC.
Gp120 neutralization assay
To test the role of gp120, HIV-1 IIIB was incubated at 37C
with a recombinant human monoclonal neutralizing antibody
against HIV-1 gp120 (IgG1, clone 2G12, Polymun Scientific,
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 17 April 2010 | Volume 6 | Issue 4 | e1000852
Austria) at a concentration of 35mg/ml or an isotype control
antibody (Southern Biotechnology, Birmingham, USA) at same
concentration for 1 hour. TERs were measured prior to and post-
exposure.
Quantitative real-time reverse transcriptase polymerase
chain reaction of tight junction proteins
Quantitation of tight junction gene expression in epithelial cells
post-HIV-1 exposure and comparison with unexposed control
epithelial cells was done by real time quantitative reverse-
transcriptase polymerase chain reaction (qRT-PCR) with Syber
Green. The tight junction genes examined were Claudin 1, 2, 3, 4,
5, ZO-1, and Occludin. ECs were lysed by Trizol reagent, total
RNA was extracted by RNeasy mini kit (Qiagen Inc., ON,
Canada) and treated with DNase column (RNase-free DNase set,
Qiagen Inc., ON, Canada) to remove DNA contamination. The
cDNA was synthesized by qScript
TM
cDNA supermix (Quanta
Bioscience Inc., Gaithersburg, MD, US) according to manufac-
turer’s protocol. Real-time PCR was performed for each tight
junction gene mRNA and GAPDH (internal control) in AB7700
SDS V1.7 (Applied Biosystems, Foster City, CA) with the
program: 50uC 2 min, 94uC for 10 minutes and 40 cycles at
94uC for 15 s and 60uC for 1 minute. To validate the quantitative
real-time RT-PCR protocol, melting curve analysis was performed
to check for the absence of primer dimers. The sequence of
primers targeting tight junction genes was taken from published
studies (Table 1). The quantitative PCR data was analyzed using
the comparative CT method [52]. Briefly the difference in cycle
times, DCT, was determined as the difference between the tested
gene and the reference house keeping gene GAPDH. DDCT was
obtained by finding the difference between exposed and mock-
treatment groups for each gene. The fold change was calculated as
FC = 2
2DDCT
and results were expressed as fold decrease following
HIV exposure compared to mock-treated control cultures.
Immunofluorescent staining for tight junction prote ins
Following treatment, EC monolayers were fixed in 4%
Paraformaldehyde, permeabilized with 0.1% Triton X-100
(Mallinckrodt Inc., Paris, KY), and blocked for 30 minutes in
blocking solution (5% bovine serum albumin and 5% goat serum
(Sigma-Aldrich, ON, Canada) in 0.1% Triton X-100]. Primary
antibodies (rabbit anti-human claudin-2, rabbit anti-human
Occludin, or rabbit anti-human ZO-1 from Zymed Laboratories,
CA, USA) were diluted (2
mg/ml) in blocking solution and
incubated with monolayers for 1 hour at room temperature.
Normal rabbit serum was used as a negative control to check the
specificity of primary antibodies. Following incubation with
primary antibodies the monolayers were washed with PBS and
secondary antibody, Alexa Fluor 488 goat anti-rabbit IgG (1.5
mg/
ml, Molecular Probes, Eugene, OR) was added for 1 hour at room
temperature. Nuclear counterstaining was done with Propidium
Iodide (500nM, Molecular Probes, Eugene, OR). After extensive
washing, filters were excised from the polystyrene inserts and
mounted on glass slides in mounting medium (Vectashield
mounting medium, Vector Lab, CA, USA). All samples were
imaged on an inverted confocal laser-scanning microscope (LSM
510, Zeiss, Germany) using standard operating conditions (636
objective, optical laser thickness of 1
mm, image dimension of
5126512, lasers: argon (450nm) and HeNe (543nm) for ZO-1 and
nuclear staining, respectively. For each experiment, confocal
microscope settings for image acquisition and processing were
identical between control and treated monolayers and 3 separate,
random images were acquired and analyzed for each experimental
condition. Each experiment was repeated at least 3 times.
Monolayers were scanned in an apical to basolateral sequence
and sequential image sets were analyzed by image analysis
software (Image J, NIH) to measure the areas of both fluorescently
stained ZO-1 and cellular nuclei. Images are presented as either en
face to illustrate the distribution of tight junction protein
immunoreactivity or as a composite Z-stack reconstruction, which
shows the monolayer in transverse profile with the basally located
nuclei identified by propidium iodide staining (red) and tight
junction proteins by fluorescein isothiocyanate labeled secondary
antibodies (green). For Figure 4A–C, optical sections (XY planes)
through the apical regions of monolayers were stacked to represent
complete tight junction ZO-1 staining distribution in order to
make direction comparison between control and experimental
counterparts.
MTT viability assay
MTT assay was used to determine viability of HIV-1 exposed
monolayers and compared to unexposed control monolayers. The
assay was performed according to manufactures instructions
(Biotium Inc., CA, USA). Briefly, human primary endometrial
epithelial cells and T84 intestinal epithelial cells were seeded on
96-well plates at a density of 10
3
cells/well and allowed to attach to
the plate and grown for 5 days. Triplicate wells were treated with
media or exposed with laboratory strains of HIV-1 (10
4
infectious
viral units/ml, MOI 1:1) in 100
ml quantity. After 24 hours
incubation, 10
ml of MTT solution was added and incubated for
4h at 37uC. After incubation, the medium was discarded and the
purple blue sediment was dissolved in 200
ml DMSO. The relative
optical density (OD)/well were determined at a test wavelength of
570 nm in a ELISA reader using a 630 nm reference wavelength.
The MTT assay is based on the cleavage of the yellow tetrazolium
salt (MTT) to purple formazan by metabolically active cells, based
on their mitochondrial activity. Cell viability was expressed as a
percentage of untreated cells, which served as a negative control
group and was designated 100%; the results are expressed as % of
negative control. All assays were performed in triplicate.
Blue Dextran leakage assay
Blue Dextran dye was dissolved in primary medium (2.3 mg/
ml, [26]) and added to the apical surface of confluent epithelial cell
monolayers grown on 0.4
mm pore size culture inserts. At various
time intervals, post-HIV-1 exposure, 50ml of basolateral medium
was sampled and replaced by equal volume of primary growth
media. Blue Dextran dye in basolateral samples was measured
using a microplate reader (Safire, tecan, NC, USA) at 610nm and
the optical density was expressed as a % of density of dye added to
the apical medium at the beginning of experiment (Time ‘‘0’’).
Cytokine analysis
Apical and basolateral supernatants were analyzed for multiple
cytokines using the Luminex multianalyte technology (Luminex
Corporation, Austin, TX, USA) as described before [53].
Multiplex bead-based sandwich immunoassay kits (Upstate
Biotech, Millipore, MA, USA) were used to measure levels of
IL-1b, IL-6, IL-8, IL-10, MCP-1 and TNF-a, as per the
manufacturer’s instructions. Primary endometrial EC and T84
monolayers were exposed to HIV-1 (ADA strain, 10
6
infectious
viral units/ml) and apical and basolateral supernatants were
collected after 24 hours. Minimum detection limit for the
cytokines were 0.1 pg/ml for TNF-a, 0.2 pg/ml for IL-8,
0.3 pg/ml for IL-6 and IL-10, 0.4 pg/ml for IL-1b, 0.9 pg/ml
for MCP-1. Levels detected at or below this limit were considered
and reported as undetectable.
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 18 April 2010 | Volume 6 | Issue 4 | e1000852
TNF-a neutralization assay
Epithelial cells were grown to confluence and treated with TNF-
a (20ng/ml) or HIV-1 (ADA, 10
6
infectious viral units /ml ) for
24 hours. To test the role of TNF-a, mouse anti-human TNF-a
neutralizing antibody (25
mg/ml) (R&D Systems, USA) or normal
mouse serum (25
mg/ml) was added to confluent monolayers for
1 hour at 37C prior to treatment with TNF-a (20ng/ml) or HIV-
1. Barrier function was determined by TER measurements before
and after treatment.
Bacterial and HIV-1 translocation
For bacterial translocation experiments, non-pathogenic E. coli
strain HB101 was grown and cultured in Luria-Bertani (LB) broth
(Invitrogen, Canada). T84 cells were grown to confluence on 3.0-
mm-pore-size filters (BD Falcon, Canada), transferred to antibiotic-
free Hanks solution, and treated with TNF-a (20ng/ml), E.coli (10
8
CFU/ml), HIV-1 (10
6
infectious virus units/ml) for 6h, HIV-1
(10
6
infectious viral units/ml) for 24h, TNF-a+E.coli, HIV-1 +
E.coli at the same time for 6h and HIV-1 for 24h + E.coli for 6h.
Some wells were left untreated as negative controls. TER was
measured before and after treatment and basolateral supernatants
were collected 6 hours after the addition of E. Coli to detect
bacterial translocation to the basolateral side. The supernatants
were diluted and plated on LB agar and incubated for 24h
followed by enumeration of bacterial colony counts.
For viral translocation, HIV-1 was added to the apical surface of
confluent EC monolayers at a concentration of 10
5
infectious viral
units/well and basolateral supernatants were collected at different
time intervals. Viral counts were determined using TZMb-1
indicator cell assay.
For assessment of LPS leakage, LPS (100ng/ml; from E.coli
O26:B6; Sigma-Aldrich, MO, USA) was added to the apical
surface of confluent EC monolayers, 24h post-exposure to HIV
and compared with unexposed controls. Basolateral supernatants
were collected 1 hour after addition of LPS and LPS leakage was
measured by measuring LPS levels in the basolateral supernatants
by Pyrochrome LPS detection kit (Cape Cod incorporated, MA,
USA) according to the manufacturer’s instructions.
Statistical analysis
GraphPad Prism Version 4 (GraphPad Software, San Diego,
CA) was used to compare three or more means by 2 way analysis
of variance (ANOVA). When an overall statistically significant
difference was seen, post-tests were performed to compare pairs of
treatments, using the Bonferroni method to adjust the p-value for
multiple comparisons. An alpha value of 0.05 was set for statistical
significance. p-Values for each analysis are indicated in figure
legends.
Accession numbers of genes and proteins
TNF-a (NCBI Accession number AAD18091), IL-8 (NCBI
Accession number CAA77745), IL-6 (NCBI Accession number
AAD13886), IL-10 (NCBI Accession number AAA63207), IL-1b
(NCBI Accession number AAC03536), MCP-1 (NCBI Accession
number AABB29926). ZO-1 (GeneBank Accession number NM_
003257), Occludin (GeneBank Accession number NM_002538),
Claudin-1 (Genebank Accession number NM_021101, Claudin-2
(Genebank Accession number NM_020384), Claudin-3 (Genebank
Accession number NM_001306), Claudin-4 (Genebank Accession
number NM_001305), Claudin-5 (Genebank Accession number
NM_003277), GAPDH (Genebank Accession number NM_002046).
Acknowledgments
The authors would like to thank the Clinical Pathology Staff at Hamilton
Health Sciences Center for their assistance in providing genital tract
tissues. We thank the women who donated their tissues for this study. We
would also like to thank Dr. A. Ashkar for useful discussions and Suzanna
Goncharova for technical assistance with Luminex assays.
Author Contributions
Conceived and designed the experiments: AN CK. Performed the
experiments: AN OC. Analyzed the data: AN OC ALA CK. Contributed
reagents/materials/analysis tools: WNDB MO MJT SDGO CK. Wrote
the paper: AN CK.
References
1. Shattock RJ, Haynes BF, Pulendran B, Flores J, Esparza J (2008) Improving
defences at the portal of HIV entry: mucosal and innate immunity. PLoS Med 5:
e81. doi:10.1371/journal.pmed.0050081.
2. Wira CR, Grant-Tschudy KS, Crane-Godreau MA (2005) Epithelial cells in the
female reproductive tract: a central role as sentinels of immune protection.
Am J Reprod Immunol 53: 65–76.
3. Vroling AB, Fokkens WJ, van Drunen CM (2008) How epithelial cells detect
danger: aiding the immune response. Allergy 63: 1110–1123.
4. Yu QH, Yang Q (2009) Diversity of tight junctions (TJs) between gastrointestinal
epithelial cells and their function in maintaining the mucosal barrier. Cell Biol
Int 33: 78–82.
5. Shacklett BL, Critchfield JW, Ferre AL, Hayes TL (2009) Mucosal T-cell
responses to HIV: responding at the front lines. J Intern Med 265: 58–66.
6. Moser LA, Carter M, Schultz-Cherry S (2007) Astrovirus increases epithelial
barrier permeability independently of viral replication. J Virol 81: 11937–11945.
7. Chen ML, Ge Z, Fox JG, Schauer DB (2006) Disruption of tight junctions and
induction of proinflammatory cytokine responses in colonic epithelial cells by
Campylobacter jejuni. Infect Immun 74: 6581–6589.
8. Ju Y, Wang T, Li Y, Xin W, Wang S, et al. (2007) Coxsackievirus B3 affects
endothelial tight junctions: possible relationship to ZO-1 and F-actin, as well as
p38 MAPK activity. Cell Biol Int 31: 1207–1213.
9. Nava P, Lopez S, Arias CF, Islas S, Gonzalez-Mariscal L (2004) The rotavirus
surface protein VP8 modulates the gate and fence function of tight junctions in
epithelial cells. J Cell Sci 117: 5509–5519.
10. Sanders DS (2005) Mucosal integrity and barrier function in the pathogenesis of
early lesions in Crohn’s disease. J Clin Pathol 58: 568–572.
11. Brenchley JM, Douek DC (2008) HIV infection and the gastrointestinal immune
system. Mucosal Immunol 1: 23–30.
12. Hladik F, Hope TJ (2009) HIV infection of the genital mucosa in women. Curr
HIV/AIDS Rep 6: 20–28.
13. Hladik F, McElrath MJ (2008) Setting the stage: host invasion by HIV. Nat Rev
Immunol 8: 447–457.
14. Epple HJ, Schneider T, Troeger H, Kunkel D, Allers K, et al. (2009)
Impairment of the intestinal barrier is evident in untreated but absent in
suppressively treated HIV-infected patients. Gut 58: 220–227.
15. Lim SG, Menzies IS, Lee CA, Johnson MA, Pounder RE (1993) Intestinal
permeability and function in patients infected with human immunodeficiency
virus. A comparison with coeliac disease. Scand J Gastroenterol 28: 573–580.
16. Keating J, Bjarnason I, Somasundaram S, Macpherson A, Francis N, et al.
(1995) Intestinal absorptive capacity, intestinal permeability and jejunal histology
in HIV and their relation to diarrhoea. Gut 37: 623–629.
17. Sharpstone D, Neild P, Crane R, Taylor C, Hodgson C, et al. (1999) Small
intestinal transit, absorption, and permeability in patients with AIDS with and
without diarrhoea. Gut 45: 70–76.
18. Stockmann M, Schmitz H, Fromm M, Schmidt W, Pauli G, et al. (2000)
Mechanisms of epithelial barrier impairment in HIV infection. Ann N Y Acad
Sci 915: 293–303.
19. Stockmann M, Fromm M, Schmitz H, Schmidt W, Riecken EO, et al. (1998)
Duodenal biopsies of HIV-infected patients with diarrhoea exhibit epithelial
barrier defects but no active secretion. Aids 12: 43–51.
20. Brenchley JM, Douek DC (2008) The mucosal barrier and immune activation in
HIV pathogenesis. Curr Opin HIV AIDS 3: 356–361.
21. Redd AD, Dabitao D, Bream JH, Charvat B, Laeyendecker O, et al. (2009)
Microbial translocation, the innate cytokine response, and HIV-1 disease
progression in Africa. Proc Natl Acad Sci U S A 106: 6718–6723.
22. Brenchley J, Price D, Douek D (2006) HIV Disease: Fallout from a mucosal
catastrophe? Nat Immunol 7: 235–239.
23. Hazenberg MD, Otto SA, van Benthem BH, Roos MT, Coutinho RA, et al.
(2003) Persistent immune activation in HIV-1 infection is associated with
progression to AIDS. Aids 17: 1881–1888.
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 19 April 2010 | Volume 6 | Issue 4 | e1000852
24. Giorgi JV, Hultin LE, McKeating JA, Johnson TD, Owens B, et al. (1999)
Shorter survival in advanced human immunodeficiency virus type 1 infection is
more closely associated with T lymphocyte activation than with plasma virus
burden or virus chemokine coreceptor usage. J Infect Dis 179: 859–870.
25. Brenchley JM, Price DA, Schacker TW, Asher TE, Silvestri G, et al. (2006)
Microbial translocation is a cause of systemic immune activation in chronic HIV
infection. Nat Med 12: 1365–1371.
26. Velarde G, Ait-Aissa S, Gillet C, Rogerieux F, Lambre C, et al. (1999) Use of
Transepithelial Electrical resistance in the study of Pentachlorophenol Toxicity.
Toxicology in vitro 13: 723–727.
27. Annunziata P (2003) Blood-brain barrier changes during invasion of the central
nervous system by HIV-1. Old and new insights into the mechanism. J Neurol
250: 901–906.
28. Kanmogne GD, Schall K, Leibhart J, Knipe B, Gendelman HE, et al. (2007)
HIV-1 gp120 compromises blood-brain barrier integrity and enhances
monocyte migration across blood-brain barrier: implication for viral neuro-
pathogenesis. J Cereb Blood Flow Metab 27: 123–134.
29. Pu H, Tian J, Andras IE, Hayashi K, Flora G, et al. (2005) HIV-1 Tat protein-
induced alterations of ZO-1 expression are mediated by redox-regulated ERK
1/2 activation. J Cereb Blood Flow Metab 25: 1325–1335.
30. Ott DE, Chertova EN, Busch LK, Coren LV, Gagliardi TD, et al. (1999)
Mutational analysis of the hydrophobic tail of the human immunodeficiency
virus type 1 p6(Gag) protein produces a mutant that fails to package its envelope
protein. J Virol 73: 19–28.
31. Fichorova RN, Desai PJ, Gibson FCI, Genco CA (2001) Distinct proinflamma-
tory host responses to Neisseria gonorrhoeae infection in immortalized human
cervical and vaginal epithelial cells. Infec Imm 69: 5840–5848.
32. Al-Sadi R, Boivin M, Ma T (2009) Mechanism of cytokine modulation of
epithelial tight junction barrier. Front Biosci 14: 2765–2778.
33. Ye D, Ma I, Ma TY (2006) Molecular mechanism of tumor necrosis factor-alpha
modulation of intestinal epithelial tight junction barrier. Am J Physiol Gastro-
intest Liver Physiol 290: G496–504.
34. Schmitz H, Rokos K, Florian P, Gitter AH, Fromm M, et al. (2002)
Supernatants of HIV-infected immune cells affect barrier function of human
HT-29/B6 intestinal epithelial cells. AIDS 16: 983–991.
35. Steffen M, Reinecker HC, Petersen J, Doehn C, Pfluger I, et al. (1993)
Differences in cytokine secretion by intestinal mononuclear cells, peripheral
blood monocytes and alveolar macrophages from HIV-infected patients. Clin
Exp Immunol 91: 30–36.
36. Snijders F, van Deventer SJ, Bartelsman JF, den Otter P, Jansen J, et al. (1995)
Diarrhoea in HIV-infected patients: no evidence of cytokine-mediated
inflammation in jejunal mucosa. Aids 9: 367–373.
37. Brabers NA, Nottet HS (2006) Role of the pro-inflammatory cytokines TNF-
alpha and IL-1beta in HIV-associated dementia. Eur J Clin Invest 36: 447–458.
38. Bai L, Zhang Z, Zhang H, Li X, Yu Q, et al. (2008) HIV-1 Tat protein alter the
tight junction integrity and function of retinal pigment epithelium: an in vitro
study. BMC Infect Dis 8: 77.
39. Kagnoff MF, Eckmann L (1997) Epithelial cells as sensors for microbial
infection. J Clin Invest 100: 6–10.
40. Ma TY, Iwamoto GK, Hoa NT, Akotia V, Pedram A, et al. (2004) TNF-alpha-
induced increase in intestinal epithelial tight junction permeability requires NF-
kappa B activation. Am J Physiol Gastrointest Liver Physiol 286: G367–376.
41. Sharkey DJ, Macpherson AM, Tremellen KP, Robertson SA (2007) Seminal
plasma differentially regulates inflammatory cytokine gene expression in human
cervical and vaginal epithelial cells. Mol Hum Reprod 13: 491–501.
42. Gutsche S, von Wolff M, Strowitzki T, Thaler CJ (2003) Seminal plasma induces
mRNA expression of IL-1beta, IL-6 and LIF in endometrial epithelial cells in
vitro. Mol Hum Reprod 9: 785–791.
43. Munch J, Rucker E, Standker L, Adermann K, Goffinet C, et al. (2007) Semen-
derived amyloid fibrils drastically enhance HIV infection. Cell 131: 1059–1071.
44. Planchon S, Fiocchi C, Takafuji V, Roche JK (1999) Transforming growth
factor-beta1 preserves epithelial barrier function: identification of receptors,
biochemical intermediates, and cytokine antagonists. J Cell Physiol 181: 55–66.
45. Pilcher CD, Joaki G, Hoffman IF, Martinson FE, Mapanje C, et al. (2007)
Amplified transmission of HIV-1: comparison of HIV-1 concentrations in semen
and blood during acute and chronic infection. Aids 21: 1723–1730.
46. Tachet A, Dulioust E, Salmon D, De Almeida M, Rivalland S, et al. (1999)
Detection and quantification of HIV-1 in semen: identification of a
subpopulation of men at high potential risk of viral sexual transmission. Aids
13: 823–831.
47. Sheth PM, Kovacs C, Kemal KS, Jones RB, Raboud JM, et al. (2009) Persistent
HIV RNA shedding in semen despite effective antiretroviral therapy. Aids 23:
2050–2054.
48. Kaul R, Pettengell C, Sheth PM, Sunderji S, Biringer A, et al. (2008) The genital
tract immune milieu: an important determinant of HIV susceptibility and
secondary transmission. J Reprod Immunol 77: 32–40.
49. MacDonald EM, Savoy A, Gillgrass A, Fernandez S, Smieja M, et al. (2007)
Susceptibility of Human Female Primary Genital Epithelial Cells to Herpes
Simplex Virus, Type-2 and the Effect of TLR3 Ligand and Sex Hormones on
Infection. Biol Reprod 77: 1049–1059.
50. McKay DM, Singh PK (1997) Superantigen activation of immune cells evokes
epithelial (T84) transport and barrier abnormalities via IFN-gamma and TNF
alpha: inhibition of increased permeability, but not diminished secretory
responses by TGF-beta2. J Immunol 159: 2382–2390.
51. Kimpton J, Emerman M (1992) Detection of replication-competent and
pseudotyped human immunodeficiency virus with a sensitive cell line on the
basis of activation of an integrated beta-galactosidase gene. J Virol 66:
2232–2239.
52. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the
comparative C(T) method. Nat Protoc 3: 1101–1108.
53. Nazli A, Yao XD, Smieja M, Rosenthal KL, Ashkar AA, et al. (2009)
Differential induction of innate anti-viral responses by TLR ligands against
Herpes simplex virus, type 2, infection in primary genital epithelium of women.
Antiviral Res 81: 103–112.
HIV Mediated Breach in Epithelial Integrity
PLoS Pathogens | www.plospathogens.org 20 April 2010 | Volume 6 | Issue 4 | e1000852
    • "MBECs in both barrier systems were infected with DENV-4 or D4MB-6 virus, as previously described. Then, 2.4 mg/ml Blue Dextran 2000 (Fine Chemicals) plus 10% FBS were added to the culture medium [22] and changed every 2 h for the first 12 h p.i. and at 24 and 48 h p.i. Absorbance was read at 630 nm in lower chamber media, and TEER values were measured. Additionally, the upper and lower media were collected during each change for virus titration. "
    [Show abstract] [Hide abstract] ABSTRACT: Background: The neurological manifestations of dengue disease are occurring with greater frequency, and currently, no information is available regarding the reasons for this phenomenon. Some viruses infect and/or alter the function of endothelial organs, which results in changes in cellular function, including permeability of the blood-brain barrier (BBB), which allows the entry of infected cells or free viral particles into the nervous system. Methods: In the present study, we standardized two in vitro models, a polarized monolayer of mouse brain endothelial cells (MBECs) and an organized co-culture containing MBECs and astrocytes. Using these cell models, we assessed whether DENV-4 or the neuro-adapted dengue virus (D4MB-6) variant infects cells or induces changes in the structure or function of the endothelial barrier. Results: The results showed that MBECs, but not astrocytes, were susceptible to infection with both viruses, although the percentage of infected cells was higher when the neuro-adapted virus variant was used. In both culture systems, DENV infection changed the localization of the tight junction proteins Zonula occludens (ZO-1) and Claudin-1 (Cln1), and this process was associated with a decrease in transendothelial resistance, an increase in macromolecule permeability and an increase in the paracellular passing of free virus particles. MBEC infection led to transcriptional up-regulation of adhesion molecules (VCAM-1 and PECAM) and immune mediators (MCP-1 and TNF- α) that are associated with immune cell transmigration, mainly in D4MB-6-infected cells. Conclusion: These results indicate that DENV infection in MBECs altered the structure and function of the BBB and activated the endothelium, affecting its transcellular and paracellular permeability and favoring the passage of viruses and the transmigration of immune cells. This phenomenon can be harnessed for neurotropic and neurovirulent strains to infect and induce alterations in the CNS.
    Full-text · Article · Jun 2016
    • "The tight junction-linked surface of such epithelial cells forms an electrochemical barrier, quantifiable via its transepithelial resistance (TER). Added agents acting as chemical [66][67][68]or biological [69] toxicants cause irreversible TER collapse within the first 24 hours of incubation, an effect established to be an in vitro biomarker predictive for clinical outcome in antiretroviral microbicide development [66,67]. During 144 hours of continuous incubation with deferiprone, at 100 μM or 200 μM, TER across ECC-1 monolayers did not differ at any time from the TER in untreated controls (Fig 3). "
    [Show abstract] [Hide abstract] ABSTRACT: Trial registration: ClinicalTrial.gov NCT02191657.
    Full-text · Article · May 2016
    • "Besides the mentioned markers, it is suggested that hyperimmune activation seems to indicate a worse prognosis during HIV infection even under ARV therapy (Hunt 2012). Indirect or direct leakage of mucosal barrier caused by the virus facilitates bacterial translocation (Nazli et al. 2010). Bacteria or parts of them, as lipopolysaccharides (LPS), may induce persistent inflammatory response, which alters somehow the type of immune response to HIV even in those under ARV therapy (Hunt et al. 2008). "
    [Show abstract] [Hide abstract] ABSTRACT: The main objective of the work was to evaluate the use of CD38 on T lymphocytes, IFNγ (+874 A/T), and IL-10 (-1082 A/G) polymorphisms in HIV-infected patients under antiretroviral (ARV) therapy. Sixty-one patients were selected at the outpatient clinic for HIV infection at the Hospital São José de Doenças Infecciosas, Fortaleza, Ceará, Brazil. The patients were classified into two groups, according to viral load after one year of ARV therapy. In the aviremic group (group I), a reduction of 35.5% of CD38+CD4+ T cells was observed (p = 0.02) and 49.3% of CD38+CD8+ T cells (p = 0.001). In the viremic group (group II), a reduction of 37.2% of CD38+CD4+ T cells (p = 0.067), and 21.4% of CD38+CD8+ T cells (p = 0.60) occurred. No association was found between IL-10 (-1082) polymorphism and the type of response to ARV therapy. Regarding the gene polymorphism on IFNγ (+874 T/A), 73.34% of group I and 33.3% of group II presented the AA genotype. The relative risk of the individuals carrying AA genotype or the A allele and not being able to suppress the viral load level after one year of ARV therapy was 3.44 (1.25-9.45; p = 0.014) or 2.35 (1.05-5.26; p = 0.027), respectively. Our data suggested that an augmented frequency of activated CD38+CD8+ T cells as well as the presence of the A allele of IFNγ polymorphism could contribute to a reduced virological suppression in patients under antiretroviral therapy.
    Full-text · Article · Apr 2016
Show more