Evolutionary history of anglerfishes (Teleostei: Lophiiformes): A mitogenomic perspective

Abstract

The teleost order Lophiiformes, commonly known as the anglerfishes, contains a diverse array of marine fishes, ranging from benthic shallow-water dwellers to highly modified deep-sea midwater species. They comprise 321 living species placed in 68 genera, 18 families and 5 suborders, but approximately half of the species diversity is occupied by deep-sea ceratioids distributed among 11 families. The evolutionary origins of such remarkable habitat and species diversity, however, remain elusive because of the lack of fresh material for a majority of the deep-sea ceratioids and incompleteness of the fossil record across all of the Lophiiformes. To obtain a comprehensive picture of the phylogeny and evolutionary history of the anglerfishes, we assembled whole mitochondrial genome (mitogenome) sequences from 39 lophiiforms (33 newly determined during this study) representing all five suborders and 17 of the 18 families. Sequences of 77 higher teleosts including the 39 lophiiform sequences were unambiguously aligned and subjected to phylogenetic analysis and divergence time estimation.
Partitioned maximum likelihood analysis confidently recovered monophyly for all of the higher taxa (including the order itself) with the exception of the Thaumatichthyidae (Lasiognathus was deeply nested within the Oneirodidae). The mitogenomic trees strongly support the most basal and an apical position of the Lophioidei and a clade comprising Chaunacoidei + Ceratioidei, respectively, although alternative phylogenetic positions of the remaining two suborders (Antennarioidei and Ogcocephaloidei) with respect to the above two lineages are statistically indistinguishable. While morphology-based intra-subordinal relationships for relatively shallow, benthic dwellers (Lophioidei, Antennarioidei, Ogcocephaloidei, Chaunacoidei) are either congruent with or statistically indistinguishable from the present mitogenomic tree, those of the principally deep-sea midwater dwellers (Ceratioidei) cannot be reconciled with the molecular phylogeny. A relaxed molecular-clock Bayesian analysis of the divergence times suggests that all of the subordinal diversifications have occurred during a relatively short time period between 100 and 130 Myr ago (early to mid Cretaceous).
The mitogenomic analyses revealed previously unappreciated phylogenetic relationships among the lophiiform suborders and ceratioid familes. Although the latter relationships cannot be reconciled with the earlier hypotheses based on morphology, we found that simple exclusion of the reductive or simplified characters can alleviate some of the conflict. The acquisition of novel features, such as male dwarfism, bioluminescent lures, and unique reproductive modes allowed the deep-sea ceratioids to diversify rapidly in a largely unexploited, food-poor bathypelagic zone (200-2000 m depth) relative to the other lophiiforms occurring in shallow coastal areas.

Full text

RESEARC H ARTIC LE Open Access
Evolutionary history of anglerfishes (Teleostei:
Lophiiformes): a mitogenomic perspective
Masaki Miya
1*
, Theodore W Pietsch
2
, James W Orr
3
, Rachel J Arnold
2
, Takashi P Satoh
4
, Andrew M Shedlock
5
,
Hsuan-Ching Ho
6
, Mitsuomi Shimazaki
7
, Mamoru Yabe
7
, Mutsumi Nishida
8
Abstract
Background: The teleost order Lophiiformes, commonly known as the anglerfishes, contains a diverse array of
marine fishes, ranging from benthic shallow-water dwellers to highly modified deep-sea midwater species. They
comprise 321 living species placed in 68 genera, 18 families and 5 suborders, but approximately half of the species
diversity is occupied by deep-sea ceratioids distributed among 11 families. The evolutionary origins of such
remarkable habitat and species diversity, however, remain elusive because of the lack of fresh material for a
majority of the deep-sea ceratioids and incompleteness of the fossil record across all of the Lophiiformes. To
obtain a comprehensive picture of the phylogeny and evolutionary history of the anglerfishes, we assembled
whole mitochondrial genome (mitogenome) sequences from 39 lophiiforms (33 newly determined during this
study) representing all five suborders and 17 of the 18 families. Sequences of 77 higher teleosts including the 39
lophiiform sequences were unambiguously aligned and subjected to phylogenetic analysis and divergence time
estimation.
Results: Partitioned maximum likelihood analysis confidently recovered monophyly for all of the higher taxa
(including the order itself) with the exception of the Thaumatichthyidae (Lasiognathus was deeply nested within
the Oneirodidae). The mitogenomic trees strongly support the most basal and an apical position of the Lophioidei
and a clade comprising Chaunacoidei + Ceratioidei, respectively, although alternative phylogenetic positions of the
remaining two suborders (Antennarioidei and Ogcocephaloidei) with respect to the above two lineages are
statistically indistinguishable. While morphology-based intra-subordinal relationships for relatively shallow, benthic
dwellers (Lophioidei, Antennarioidei, Ogcocephaloidei, Chaunacoidei) are either congruent with or statistically
indistinguishable from the present mitogenomic tree, those of the principally deep-sea midwater dwellers
(Ceratioidei) cannot be reconciled with the molecular phylogeny. A relaxed molecular-clock Bayesian analysis of the
divergence times suggests that all of the subordinal diversifications have occurred during a relatively short time
period between 100 and 130 Myr ago (early to mid Cretaceous).
Conclusions: The mitogenomic analyses revealed previously unappreciated phylogenetic relationships among the
lophiiform suborders and ceratioid familes. Although the latter relationships cannot be reconciled with the earlier
hypotheses based on morphology, we found that simple exclusion of the reductive or simplified characters can
alleviate some of the conflict. The acquisition of novel features, such as male dwarfism, bioluminescent lures, and
unique reproductive modes allowed the deep-sea ceratioids to diversify rapidly in a largely unexploited, food-poor
bathypelagic zone (200-2000 m depth) relative to the other lophiiforms occurring in shallow coastal areas.
* Correspondence: miya@chiba-muse.or.jp
1
Natural History Museum and Institute, Chiba, 955-2 Aoba-cho, Chuo-ku,
Chiba 260-8682, Japan
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
© 2010 Miya et al; licensee BioM ed Central Ltd. This is an Open Access article distri buted under the terms of the Creative Commons
Attribution L icense (http://creati vecommons.org/licenses/by/2.0), which perm its unrestricted use, di stribution, and reproduction in
any medium, provided the original work is properly cited.

Background
The order Lophiiformes contains a diverse array of mar-
ine fishes, ranging from benthic shallow-water dwellers
to several groups of deep-shelf and slope inhabitants as
well as a highly modified assemblage of open-water,
meso- and bathypelagic species. Commonly referred to
as anglerfishes, the group is characterized most strik-
inglybythestructureofthefirstdorsal-finspine,typi-
cally placed out on the tip of the snout and modified to
serve as a luring apparatus for the attraction of prey.
The order comprises approximately 325 living species,
distributed among 68 genera and 18 families (Table 1).
The families themselves are distributed among five sub-
orders [1-3]: the Lophioidei (one family), relatively shal-
low-water, dorso-ventrally flattened forms, commonly
referred to as the goosefishes or monkfishes (Figure 1A);
the Antennarioidei (four families), nearly all laterally
compressed, shallow- to moderately deep-water, benthic
forms, with a host of common names including frog-
fishes (Figure 1B), sea-mice, sea-toads, warty angler-
fishes, and handfishes (Figure 1C); the Chaunacoidei or
coffinfishes (one family), more or less globose, deep-
water benthic forms (Figure 1D); the Ogcocephaloidei
or batfishes (one family), dorsoventrally flattened, deep-
water benthic forms (Figure 1E); and the Ceratioidei (11
families), the deep-sea anglerfishes (Figures 2, 3), charac-
terized most distinctly by their extremely dwarfed males
attaching themselves (either temporarily or permanently)
to the bodies of relatively gigantic females [4].
Table 1 Diversity of the Lophiiformes
Suborder Family Genus % Species %
Lophioidei Lophiidae 4 (4) 100.0 4 (25) 16.0
Antennarioidei Antennariidae 2 (12) 16.7 3 (45) 6.7
Tetrabrachiidae 1 (2) 50.0 1 (2) 50.0
Brachionichthyidae 1 (2) 50.0 1 (5) 20.0
Lophichthyidae 0 (1) 0.0 0 (1) 0.0
Chaunacoidei Chaunacidae 1 (2) 50.0 3 (14) 21.4
Ogcocephaloidei Ogcocephalidae 4 (10) 40.0 4 (68) 5.9
Ceratioidei Caulophrynidae 1 (2) 50.0 2 (5) 40.0
Neoceratiidae 1 (1) 100.0 1 (1) 100.0
Melanocetidae 1 (1) 100.0 2 (6) 33.3
Himantolophidae 1 (1) 100.0 2 (18) 11.1
Diceratiidae 2 (2) 100.0 2 (6) 33.3
Oneirodidae 4 (16) 25.0 4 (63) 6.3
Thaumatichthyidae 2 (2) 100.0 2 (8) 25.0
Centrophrynidae 1 (1) 100.0 1 (1) 100.0
Ceratiidae 2 (2) 100.0 2 (4) 50.0
Gigantactinidae 2 (2) 100.0 2 (21) 9.5
Linophrynidae 3 (5) 60.0 3 (27) 11.1
Total 33 (68) 48.5 39 (321) 12.1
Numbers of genera and species of 18 lophiiform families used in this study,
with taxonomic diversity (numbers in parentheses) estimated by Pietsch [2]
Figure 1 Representatives of the lophiiform suborders
Lophioidei (A), Antennarioidei (B, C), Chaunacoidei (D), and
Ogcocephaloidei (E). (A) Lophiodes reticulatus Caruso and Suttkus,
157 mm SL, UF 158902, dorsal and lateral views (photo by J. H.
Caruso); (B) Antennarius commerson (Latreille), 111 mm SL, UW
20983 (photo by D. B. Grobecker); (C) Sympterichthys politus
(Richardson), specimen not retained (photo by R. Kuiter); (D)
Chaunax suttkusi Caruso, 107 mm SL, TU 198058 (photo by J. H.
Caruso); (E) Halieutichthys aculeatus (Mitchill), 80 mm SL, specimen
not retained, dorsal view (photo by J. H. Caruso). Courtesy of the
American Society of Ichthyologists and Herpetologists.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 2 of 27

Figure 2 Representatives of ceratioid familiesasrecognizedinthisstudy-1. (A) Centrophrynidae: Centrophryne spinulosa Regan and
Trewavas, 136 mm SL, LACM 30379-1; (B) Ceratiidae: Cryptopsaras couesii Gill, 34.5 mm SL, BMNH 2006.10.19.1 (photo by E. A. Widder); (C)
Himantolophidae: Himantolophus appelii (Clarke), 124 mm SL, CSIRO H.5652-01; (D) Diceratiidae: Diceratias trilobus Balushkin and Fedorov, 86 mm
SL, AMS I.31144-004; (E) Diceratiidae: Bufoceratias wedli (Pietschmann), 96 mm SL, CSIRO H.2285-02; (F) Diceratiidae: Bufoceratias shaoi Pietsch, Ho,
and Chen, 101 mm SL, ASIZP 61796 (photo by H.-C. Ho); (G) Melanocetidae: Melanocetus eustales Pietsch and Van Duzer, 93 mm SL, SIO 55-229;
(H) Thaumatichthyidae: Lasiognathus amphirhamphus Pietsch, 157 mm SL, BMNH 2003.11.16.12; (I) Thaumatichthyidae: Thaumatichthys binghami
Parr, 83 mm SL, UW 47537 (photo by C. Kenaley); (J) Oneirodidae: Chaenophryne quasiramifera Pietsch, 157 mm SL, SIO 72-180. Courtesy of the
American Society of Ichthyologists and Herpetologists.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 3 of 27

Figure 3 Representatives of ceratioid families as recognized in this study-2. (A) Oneirodidae: Oneirodes sp., 31 mm SL, MCZ 57783 (photo
by C. P. Kenaley); (B) Oneirodidae: Spiniphryne duhameli Pietsch and Baldwin, 117 mm SL, SIO 60-239; (C) Caulophrynidae: Caulophryne pelagica
(Brauer), 183 mm SL, BMNH 2000.1.14.106 (photo by D. Shale); (D) Neoceratiidae: Neoceratias spinifer Pappenheim, 52 mm SL, with 15.5-mm SL
parasitic male, ZMUC P921726 (after Bertelsen, 1951); (E) Gigantactinidae: Gigantactis gargantua Bertelsen, Pietsch, and Lavenberg, 166 mm SL,
LACM 9748-028; (F) Linophrynidae: Photocorynus spiniceps Regan, 46-mm SL, with 6.2-mm SL parasitic male, SIO 70-326; (G) Linophrynidae:
Haplophryne mollis (Brauer), 36 mm SL, MNHN 2004-0811; (H) Linophrynidae: Linophryne macrodon Regan, 28 mm SL, UW 47538 (photo by C. P.
Kenaley); (I) Linophrynidae: Linophryne polypogon Regan, 33 mm SL, BMNH 2004.9.12.167 (photo by P. David). Courtesy of the American Society
of Ichthyologists and Herpetologists.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 4 of 27

Within the higher teleosts, the Lophiiformes has tradi-
tionally been allied with toadfishes of the order Batra-
choidiformes, based primarily on osteological characters
of the cranium [5-7]. Following the publication of the
seminal work on higher-level relationships of teleosts by
Greenwood et al. [8] and the advent of cladistic theory
[9], both groups have been placed in the Paracanthop-
terygii, a presumed sister-group of the more derived
Acanthopterygii [7]. Other than the Lophiiformes and
Batrachoidiformes, the original Paracanthopterygii [7]
included those groups of fishes thought to be relatively
primitive in the higher teleosts, such as Polymixiiformes,
Percopsiformes, Ophidiiformes, Gadiformes, Zeioidei,
Zoarcoidei and Gobiesocoidei. Subsequently, the taxo-
nomic contents of the Paracanthopterygii have under-
gone significant changes, being finally reduced to five
core orders (Percopsiformes, Ophidiiformes, Gadiformes,
Batrachoidiformes, Lophiiformes) in an attempt to make
the group monophyletic [10], and this taxonomic propo-
sal has been followed in many reference books [11-14].
Thus the paracanthopterygian Lophiiformes (and its
close association with the Batrachoidiformes) has been a
prevailing view in the ichthyological community despite
the lack of convincing evidence [1,15,16].
Recent molecular phylogenetic studies, however, have
repeatedly cast doubt on such a paracanthoperygian
position of the Lophiiformes within the higher teleosts
[17-27]. These studies based on nucleotide sequences
from both whole mitogenomes and various nuclear
genes have strongly suggested that lophiiforms are
highly derived teleosts, deeply nested in one of the lar-
ger percomorph clades, and that they are closely related
to various percomorphs, such as the Tetraodontiformes,
Caproidei, Acanthuroidei, Chaetodontidae, Pomacanthi-
dae, Ephippidae and Drepanidae, all of them showing no
indications of close affinity with the Lophiiformes before
the advent of molecular phylogenetics. Significantly a
mitochondrial phylogenomic study by Miya et al. [25]
demonstrated that the Batrachoidiformes was deeply
nested within a different percomorph clade consisting of
the Synbranchiformes and Indostomiidae and a sister-
group relationship between the Lophiiformes and Batra-
choidiformes was confidently rejected by the Bayesian
analyses. These novel relationships, however, have not
been reflected in the most recently published classifica-
tion of fishes [14].
Within the Lophiiformes, interrelationships among 18
families and five suborders have been inadequately stu-
died, owing to limited availability of specimens from the
most taxonomically rich suborder Ceratioidei. Neverthe-
less Pietsch and his colleagues [1,3,28] have analyzed
morphological characters in several attempts to resolve
subordinal and family relationships. In their preferred
cladogram, the Lophioidei occupies the most basal
position, followed by Antennarioidei and Chaunacoidei,
with the Ogcocephaloidei and Ceratioidei forming a sis-
ter-group at the top of the tree (Figure 4A). More
recently Shedlock et al. [29] compared short fragments
of the mitochondrial 16S rRNA genes from 18 lophii-
forms including all five suborders, and analyzed 513
aligned nucleotide sites using the maximum likelihood
(ML) method, with two batrachoidiforms species as out-
groups. The resulting tree (Figure 4B), however, signifi-
cantly departed from both the results based on
morphological (Figure 4A) and molecular data [24-26],
although the latter studies dealt with only six species in
three suborders (Lophioidei, Chaunacoidei, Ceratioidei).
Within each subordinal lineage, several authors have
published phylogenetic hypotheses based on morpholo-
gical characters (Figure 4C-G), including those of Car-
uso [30] for the Lophioidei, Pietsch and Grobecker [3]
for the Antennarioidei, Endo and Shinohara [31] for the
Ogcocephaloidei, Bertelsen [32] and Pietsch and Orr
[33], and Pietsch [2] for the Ceratioidei. There has been
no attempt, however, to resolve their phylogenies using
molecular data.
In addition to the lack of available material of numer-
ous rare taxa, the evolutionary history of the lophiiform
fishes has remained elusive because of poor representa-
tion in the fossil record (but see [34-38]). Recent devel-
opments in the molecular estimation of divergence
times, however, have provided promising tools to intro-
duce time scales for the phylogenetic trees [39], thereby
offering new insights into evolutionary history that can-
not be inferred by the fossil data alone. Among the
most significant advances common to these new meth-
ods is a departure from the molecular clock assumption
and the use of time constraints at multiple nodes for
rate calibration, usually based on fossil record. In higher
teleosts, however, including lophiiforms, the fossil
record is scarce and fragmentary, and alternative calibra-
tion points based on biogeographic events have proven
useful for divergence time estimation. Azuma et al. [40]
recently found that estimated divergence times of cichlid
fishes showed excellent agreement with the history of
Gondwanian fragmentation, arguing that such biogeo-
graphic events can be used as effective time constraints
in dating teleostean divergences, which may be useful
for dating lophiiform divergence times.
To address questions regarding the subordinal and
familial relationships and evolutionary history of the
Lophiiformes, we assembled the whole mitochondrial
genome sequences from the 39 lophiiform species (33
sequences newly-determined during this study), repre-
senting all of the five suborders and 17 of the 18
families. Unambiguously aligned sequences (14,611 bp)
from those 39 species plus 38 outgroups (total 77 spe-
cies) were subjected to partitioned maximum likelihood
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 5 of 27

(ML) analysis using RAxML [41]. The resulting tree
topology was then used to estimate the divergence time
of the Lophiiformes using a Bayesian relaxed molecular-
clock method to infer their evolutionary history, and
patterns and rates of diversifications.
Methods
Taxon sampling
Our taxon sampling followed results from recent mito-
chondrial phylogenomic studies by Miya et al. [25,26]
who first proposed that the Lophiiformes was a highly
advanced percomorph group and confidently rejected
their affinity with paracanthopterygians. They also pro-
posed that the order was closely related to members of
previously unallied groups such as Caproidei and Tetra-
odontiformes, a hypothesis that was subsequently sup-
ported by Yamanoue et al. [27] in their study of
Tetraodontiformes based on the 44 whole mitogenome
sequences. Thus, in the present study, we incorporated
all of the 44 species (including six lophiiforms) used by
Yamanoue et al. [27] and added 33 species of lophii-
forms for a total 77 species (Table 2). Despite limited
Figure 4 Previously proposed phylogenetic hypotheses within the Lophiiformes. Inter-subordinal relationships based on (A) morphology
[3] and (B) the mitochondrial 16 rDNA sequences [29]. Intra-subordinal relationships based on (C) morphologies for the Lophioidei [30], (D)
Antennarioidei [3], (E) Ogcocephaloidei [31] and (F, G) Ceratioidei [32,33].
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 6 of 27

Table 2 List of species used in this study
Family
a
Species Accession
No.
Outgroup (38 spp.)
Order Polymixiiformes
Polymixiidae Polymixia japonica AB034826
Order Beryciformes
Berycidae Beryx splendens AP002939
Order Scorpaeniformes
Triglidae Satyrichthys amiscus AP004441
Order Perciformes
Suborder Zoarcoidei
Zoarcidae Enedrias crassispina AP004449
Suborder Percoidei
Centropomidae Coreoperca kawamebari AP005990
Acropomatidae Doederleinia berycoides AP009181
Lutjanidae Lutjanus rivulatus AP006000
Pterocaesio tile AP004447
Emmelichthyidae Emmelichthys struhsakeri AP004446
Haemulidae Diagramma pictum AP009167
Parapristipoma
trilineatum
AP009168
Sparidae Pagrus major AP002949
Centracanthidae Spicara maena AP009164
Lethrinidae Lethrinus obsoletus AP009165
Monotaxis grandoculis AP009166
Monodactylidae Monodactylus argenteus AP009169
Chaetodontidae Chaetodon auripes AP006004
Heniochus diphreutes AP006005
Pomacanthidae Chaetodontoplus
septentrionalis
AP006007
Centropyge loriculus AP006006
Suborder Acanthuroidei
Luvaridae Luvarus imperialis AP009161
Zanclidae Zanclus cornutus AP009162
Acanthuridae Naso lopezi AP009163
Zebrasoma flavescens AP006032
Suborder Caproidei
Caproidae Antigonia capros AP002943
Capros aper AP009159
Order Tetraodontiformes
Superfamily Triacanthoidea
Triacanthodidae Triacanthodes anomalus AP009172
Macrorhamphosodes
uradoi
AP009171
Triacanthidae Triacanthus biaculeatus AP009174
Trixiphichthys weberi AP009173
Superfamily Balistoidea
Balistidae Sufflamen fraenatum AP004456
Monacanthidae Stephanolepis cirrhifer AP002952
Ostraciidae Ostracion immaculatus AP009176
Kentrocapros aculeatus AP009175
Table 2: List of species used in this study (Continued)
Superfamily Triodontidae
Triodontidae Triodon macropterus AP009170
Tetraodontidae Takifugu rubripes AP006045
Diodontidae Diodon holocanthus AP009177
Molidae Ranzania laevis AP006047
Ingroup (39 spp.)
Order Lophiiformes
Suborder Lophioidei
Lophiidae Lophius americanus AP004414
Lophiomus setigerus
b
AP004413
Lophiodes caulinaris AB282826
Sladenia gardineri AB282827
Suborder
Antennarioidei
Antennariidae Antennarius striatus AB282828
Antennarius coccineus* AB282830
Histrio histrio AB282829
Tetrabrachiidae Tetrabrachium ocellatum AB282831
Brachionichthyidae Brachionichthys hirsutus* AB282832
Suborder Chaunacoidei
Chaunacidae Chaunax abei AP004415
Chaunax tosaensis* AP004416
Chaunax pictus* AB282833
Suborder
Ogcocephaloidei
Ogcocephalidae Malthopsis jordani AP005978
Halieutaea stellata* AP005977
Coelophrys
brevicaudata*
AB282834
Zalieutes elater AB282835
Suborder Ceratioidei
Caulophrynidae Caulophryne jordani
c
AP004417
Caulophryne pelagica* AB282836
Neoceratiidae Neoceratias spinifer* AB282837
Melanocetidae Melanocetus murrayi AP004418
Melanocetus johnsonii AB282838
Himantolophidae Himantolophus albinares AB282839
Himantolophus
groenlandicus
AB282840
Diceratiidae Bufoceratias thele* AB282841
Diceratias pileatus AB282842
Oneirodidae Oneirodes thompsoni AB282843
Puck pinnata AB282844
Chaenophryne
melanorhabdus
AB282845
Bertella idiomorpha AB282846
Thaumatichthyidae Thaumatichthys
pagidostomus
AB282847
Lasiognathus sp. AB282848
Centrophrynidae Centrophryne spinulosus AB282849
Ceratiidae Cryptopsaras couesii AB282850
Ceratias uranoscopus AB282851
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 7 of 27

availability of fresh materials from bathypelagic cera-
tioids, we were able to collect tissues of all 11 families,
lacking for the entire order only the rare monotypic
antennarioid family Lophichthyidae (Table 1). Accord-
ingly, we sampled all of the five suborders, 17 of the 18
families (94.4%), 33 of the 68 genera (48.5%), and 39 of
the 321 species (12.1%), a coverage sufficient to address
higher-level relationships of the Lophiiformes. We
acknowledge that the taxon sampling is still sparse for
three species-rich families, the Antennariidae (6.7%),
Ogcocephalidae (5.9%), and Oneirodidae (6.3%) (see
Table 1). The final rooting was done using a non-perco-
morph Polymixia japonica (Polymixiidae).
DNA extraction, PCR, and Sequencing
We excised a small piece of epaxial musculature or fin-
ray (ca. 0.25 g) from fresh or ethanol-fixed specimens of
each species and preserved them in 99.5% ethanol. We
extracted total genomic DNA from the tissue using
QIAamp or DNeasy (Qiagen) following the manufac-
turer’s protocol. We amplified the mitogenomes of the
33 lophiiform species in their entirety using a long PCR
technique [42]. We basically used seven fish-versatile
PCR primers for the long PCR in the following four
combinations (for locations of these primers, see
[43-46]): L2508-16S (5’-CTC GGC AAA CAT AAG
CCT CGC CTG TTT ACC AAA AAC-3’) + H12293-
Leu (5’-TTG CAC CAA GAG TTT TTG GTT CCT
AAG ACC-3’); L2508-16S + H15149-CYB (5’-GGT
GGC KCC TCA GAA GGA CAT TTG KCC TCA-3’);
L8343-Lys (5’-AGC GTT GGC CTT TTA AGC TAA
WGA TWG GTG-3’) + H1065-12S (5’-GGC ATA GTG
GGG TAT CTA ATC CCA GTT TGT-3’); and L12321-
Leu (5’-GGT CTT AGG AAC CAA AAA CTC TTG
GTG CAA-3’) + S-LA-16S-H (5’-TGC ACC ATT RGG
ATG TCC TGA TCC AAC ATC-3’). When we failed to
cover the entire mitogenomes with these primer pairs,
we used an additional five long PCR primers specifically
designed to amplify the lophiiform mitogenomes:
H8319-ANG-Lys (5’-GKA GKC ACC AKT TTT TAG
MTT AAA AGG C-3’); L7567-ANG-Asp (5’-ACG CTG
TTK TGT CAA GGC ARR AYT GTG GGT-3’);
L10054-ANG-Gly (5’-CAC CWG GTC TTG GTT
WAAMTCCMAGGAAAG-3’); H15149-ANG-CYB
(5’-AGG TTK GTG ATG ACK GTK GCK CCT CA-3’);
and L14850-ANG-CYB (5’-AAT ATC TCG GTK TGG
TGG AAY TTT GGK TC-3’). Long PCR reaction condi-
tions followed Miya and Nishida [47]. Dilution of the
long PCR products with TE buffer (1:10 to 100 depend-
ing on the concentration of the long PCR products)
served as templates for subsequent short PCRs.
We used a standard set of 24 pairs of fish-versatile
primers for short PCRs to amplify contiguous, overlap-
ping segments of the entire mitogenome for each lophii-
form species (Table 3). When some of the short PCR
reaction failed, we managed to amplify those regions
with the existing fish-versatile primers. We designed
new species-specific primers when none of the primer
pairs amplified the short segments. Short PCR reaction
conditions followed Miya and Nishida [47]. A list of
PCR primers for each species is available upon request
to MM.
We purified double-stranded short PCR products
using a Pre-Sequencing kit (USB) for direct cycle
sequencing with dye-labeled terminators (Applied Bio-
systems). We performed all sequencing reactions
according to the manufacture’sinstructionswiththe
same primers as those for the short PCRs. We analyzed
labeled fragments on model 373/377/3100/3130xl
sequencers (Applied Biosystems).
Sequence editing and alignment
We edited each sequence electropherogram with Edit-
View (ver. 1.01; Applied Biosystems) and concatenated
the multiple sequences using AutoAssembler (ver. 2.1;
Applied Biosystems). We carefully checked the concate-
nated sequences using DNASIS (ver. 3.2; Hitachi Soft-
ware Engineering) and created a sequence file for each
gene. We compared the sequence files among closely
related species to minimize sequence errors. Genes (or a
portionofgenes)thatwewereunabletosequence
owing to technical difficulties were coded as missing.
To check sensitivity of additional taxon sampling of a
number of the lophiiforms to the results reported in
Yamanoue et al. [27], we used their pre-aligned
sequences as a basis for further alignment with the
newly determined sequences from 33 lophiiforms.
Yamanoue et al. [27] aligned 13 protein-coding, two
rRNA, and 22 tRNA genes using ProAlign ver. 0.5 [48]
and they used only those positions with posterior prob-
abilities ≥70%. An exception to this was the alignment
of tRNA genes, for which Yamanoue et al. [27] modified
Table 2: List of species used in this study (Continued)
Gigantactinidae Gigantactis vanhoeffeni AB282852
Rhynchactis macrothrix AB282853
Linophrynidae Linophryne bicornis AB282854
Acentrophryne
dolichonema
AB282855
Haplophryne mollis AB282856
a
Classification follows Nelson [14] except for recognition of five suborders in
the Lophiiformes [2].
b
Originally published as Lophius litulon by Miya et al. [26], but subsequently
reidentified as Lophiomus setigerus by MM based on reexamination of the
voucher specimen (CBM-ZF 10732).
c
Originally published as Caulophryne pelagica by Miya et al. [26], but
subsequently reidentified as C. jordani by TWP based on reexamination of the
voucher specimen (CBM-ZF 12209).
* Those species used for divergence time estimation for crown nodes of the
Lophiiformes and its five suborders.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 8 of 27

Table 3 Standard set of 24 short PCR primer pairs for lophiiforms
No. Primer
a
Sequence (5’to 3’) Reference
1 L1083-12S ACAAACTGGGATTAGATAC [47]
H2590-16S ACAAGTGATTGCGCTACCTT [47]
2 L2949-16S GGGATAACAGCGCAATC [47]
H3976-ND1 ATGTTGGCGTATTCKGCKAGGAA [43]
3 L2949-16S GGGATAACAGCGCAATC [47]
H4432-Met TTTAACCGWCATGTTCGGGGTATG [46]
4 L4299-Ile AAGGRCCACTTTGATAGAGT This study
H5669-Asn AACTGAGAGTTTGWAGGATCGAGGCC [53]
5 L4633-ND2 CACCACCCWCGAGCAGTTGA [47]
H5669-Asn AACTGAGAGTTTGWAGGATCGAGGCC [53]
6 L5549-Trp AAGACCAGGAGCCTTCAAAG This study
H6558-CO1 CCKCCWGCKGGGTCAAAGAA [53]
7 L6205-CO1 TTCCCWCGAATAAATAACATAAG [87]
H7447-Ser AWGGGGGTTCRATTCCTYCCTTTCTC [87]
8 L7255-CO1 GATGCCTACACMCTGTGAAA [47]
H8312-Lys CACCWGTTTTTGGCTTAAAAGGCTAAYGCT [87]
9 L8202-CO2 TGYGGAGCWAATCAYAGCTT [87]
H9375-CO3 CGGATRATGTCTCGTCATCA [53]
10 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
H9639-CO3 CTGTGGTGAGCYCAKGT [47]
11 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
H10019-Gly CAAGACKGKGTGATTGGAAG [47]
12 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
H10433-Arg AACCATGGWTTTTTGAGCCGAAAT [47]
13 L10054-Gly CACCWGGTCTTGGTTWAAMTCCMAGGAAAG This study
H11534-ND4M GCTAGKGTAATAAWKGGGTA [87]
14 L10440-Arg AAGATTWTTGATTTCGGCT [27]
H11534-ND4M GCTAGKGTAATAAWKGGGTA [87]
15 L11424-ND4 TGACTTCCWAAAGCCCATGTAGA [47]
H12632-ND5 GATCAGGTTACGTAKAGKGC [47]
16 L12329-Leu CTCTTGGTGCAAMTCCAAGT [47]
H13396-ND5 CCTATTTTTCGGATGTCTTG [53]
17 L12329-Leu CTCTTGGTGCAAMTCCAAGT [47]
H13727-ND5 GCGATKATGCTTCCTCAGGC [47]
18 L13553-ND5 AACACMTCTTAYCTWAACGC [53]
H14768-CYB TTKGCGATTTTWAGKAGGGGGTG [87]
19 L13553-ND5 AACACMTCTTAYCTWAACGC [53]
H15149-CYB GGTGGCKCCTCAGAAGGACATTTGKCCTCA [53]
20 L14504-ND6 GCCAAWGCTGCWGAATAMGCAAA [53]
H15560-CYB TAGGCRAATAGGAARTATCA [47]
21 L14718-Glu TTTTTGTAGTTGAATWACAACGGT This study
H15913-Thr CCGGTSTTCGGMTTACAAGACCG [87]
22 L15369-CYB ACAGGMTCAAAYAACCC [53]
H16484-CR GAGCCAAATGCMAGGAATARWTCA [87]
23 L15998-Pro AACTCTTACCMTTGGCTCCCAARGC [53]
H885-12S TAACCGCGGYGGCTGGCACGA [87]
24 L16507-CR TGAWYTATTCCTGGCATTTGGYTC [87]
H1358-12S CGACGGCGGTATATAGGC [47]
a
L and H denote light and heavy strands, respectively. Positions with mixed bases are labeled with their IUB codes
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 9 of 27

the alignment on the basis of the secondary structure,
estimated with DNASIS. They used all the stem regions
even if the aligned sequences were <70% posterior prob-
abilities. Because the aligned sequences of Yamanoue et
al. [27] included several overlapping positions between
the two open reading frames (ATPase 8/6, ND4L/4, and
ND5/6), we excluded those positions from the down-
stream genes (ATPase 6, ND4, and ND6).
To combine pre-aligned sequences from Yamanoue
et al. [27] with the new sequences, we rearranged the
dataset of Yamanoue et al. [27] into typical gene order
of vertebrates (beginning from tRNA-Phe) and saved it
in a FASTA format. The 33 newly determined
sequences in the same format were concatenated to the
rearranged, pre-aligned sequences and the dataset was
subjected to the multiple alignment using MAFFT ver. 6
[49]. We imported the aligned sequences into MacClade
ver. 4.08 [50] and removed the redundant regions
appeared as gaps with slight modifications by eye to cor-
rectly reproduce the aligned sequences used in Yama-
noue et al. [27]. All the resulting gap positions from the
alignment were coded as missing.
Phylogenetic analysis
We divided unambiguously aligned sequences into five
partitions (first, second, third codon positions, rRNA
and tRNA genes) assuming that functional constraints
on sequence evolution are more similar within codon
positions (or types of molecules) across genes than
across codon positions (or types of molecules) within
genes. We converted nucleotides at the third codon
positions into purine (A/G) with “R”and pyrimidine (C/
T) with “Y”(RY-coding; Phillips and Penny [51]) to take
only transversions into account in the phylogenetic ana-
lysis following the recommendation of Saitoh et al. [52].
This coding effectively removes likely “noise”from the
dataset [53], and avoids the apparent lack of signal by
retaining all available positions in the dataset. The “R”
and “Y”were further recoded with “A”and “C,”respec-
tively, to avoid unnecessary estimation of transitional
changes during the calculations using RAxML with the
exception of an outgroup species (Polymixia japonicus)
for running the program (RAxML does not accept all
“A/C”partitions). We also constructed an additional
two datasets that treat quickly saturated third codon
positions differently (with or without third codon posi-
tions) to check sensitivity of the datasets to the phyloge-
netic analysis. The three datasets are designated as
follows: 1) RY-coding (12
n
3
r
RT
n
); 2) all positions
included (123
n
RT
n
); and 3) third codon positions
excluded (12
n
RT
n
).
We subjected the above datasets to the partitioned
maximum-likelihood (ML) analysis using RAxML ver.
7.0.4 [41]. A general time reversible model with sites
following a discrete gamma distribution (GTR + Γ;the
model recommended by the author) was used and a
rapidbootstrap(BS)analysiswasconductedwith500
replications (-f a option). This option performs BS ana-
lysis using GTRCAT, which is GTR approximation with
optimization of individual per-site substitution rates,
and classification of those individual rates into certain
number of rate categories. After implementing the BS
analysis, the program uses every fifth BS tree as a start-
ing point to search for the ML tree using GTR + Γ
model of sequence evolution and saves the top 10 best-
scoring ML trees (fast ML searches). Finally RAxML cal-
culates more correct likelihood scores (slow ML
searches) for those 10 trees and puts BS probabilities on
the best-scoring ML tree.
Testing alternative phylogenetic hypotheses
We considered that the best-scoring ML tree resulting
from 12
n
3
r
RT
n
(RY-coding) dataset as the best estimate
of phylogeny because this coding effectively removes
likely “noise”from the dataset and avoids the apparent
lack of signal by retaining all available positions in the
dataset (see discussions in Saitoh et al. [52]). Alternative
tree topologies were thus individually compared to the
resulting best-scoring ML tree derived from the
12
n
3
r
RT
n
dataset using the likelihood-based approxi-
mately unbiased (AU) test as implemented in CONSEL
[54]. The p-values from this test are calculated using the
multi-scale bootstrap technique and are less biased than
those of the conventional methods such as the bootstrap
probability (BP), the Kishino-Hasegawa (KH) test and
the Shimodaira-Hasegawa (SH) test [55].
We manually created the constrained tree topologies
with reference to the alternative hypotheses using Mac-
Clade and then performed the RAxML analysis with
each constraint using the -g option. We conducted the
fast bootstrappings with 100 replicates as described
above and the resulting best-scoring ML tree was con-
sidered as the constrained ML tree. The constrained
and unconstrained ML trees (best-scoring ML tree with-
out constraint) were used to compute the per-site log
likelihood scores for each tree using the -f g option in
RAxML and the output was subjected to CONSEL ana-
lysis to calculate statistical significance of the differences
in the likelihood scores.
Tracing character evolution
Male sexual parasitism has been found among only the
Ceratioidei [4]. Its evolution was reconstructed on the
best-scoring ML tree derived from 12
n
3
r
RT
n
dataset
under an ML optimality criterion using Mesquite ver.
2.6 [56]. The ML reconstruction methods find the
ancestral states that maximize the probability the
observed states would evolve under a stochastic model
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 10 of 27

of evolution [57,58]. The Mk1 model ("Markov k-state 1
parameter model”), a k-state generalization of the Jukes-
Cantor model that corresponds to Lewis’sMkmodel
[59], was used to trace the character evolution. Four
character states were assigned to the male sexual para-
sitism based on extensive observations made by Pietsch
[4] and Pietsch and Orr [33]: males never attach to
females (character state 0); males attach temporarily
(state 1); males are facultative parasites (state 2); and
males are obligate parasites (state 3).
Divergence time estimation
Because lophiiforms are rarely represented in the fossil
record [34-37], the age of divergence of the lophiiform
clades cannot be established precisely based on paleon-
tological data alone. Thus external calibration points
should be used at multiple nodes to estimate the diver-
gence times of the Lophiiformes correctly. To that end,
we used the mitogenomic dataset of Azuma et al. [40]
who extensively sampled actinopterygians from the base
to the top of the tree. Significantly the dataset of Azuma
et al. [40] includes 1) all major lineages of the basal acti-
nopterygians whose fossils and their relative phyloge-
neticpositionsaremorereliablethanthoseofthe
higher teleosts; and 2) all continental cichlids whose
divergences show excellent agreement with the history
of Gondwanian fragmentations.
Mitogenome sequences from the 39 lophiiforms were
concatenated with the pre-aligned sequences used in
Azuma et al. [40] in a FASTA format and the dataset was
subjected to multiple alignment using MAFFT ver. 6 [49]
as described above. The dataset comprises 6966 positions
from first and second codon positions of the 12 protein-
coding genes, 1673 positions from the two rRNA genes
and 1407 positions from the 22 tRNA genes (total 10,046
positions). The third codon positions of the protein-cod-
ing genes were entirely excluded because of their extre-
mely accelerated rates of changes that may cause a high
level of homoplasy at this taxonomic scale [53] and over-
estimation of divergence times [60].
Ideally all node ages for the 39 lophiiform species can
be estimated in a single step; however, recent studies
demonstrated that dense taxon sampling in a particular
lineage (as has been done for the Lophiiformes in this
study) tend to lead to overestimation of its age com-
pared to the rest of the tree ("node-density effect”
[61,62]). To avoid such unnecessary overestimation, we
retained a minimum number of taxa from each suborder
in proportion to the logarithms of the species’diversity
(Table 1). We selected the most distantly related species
from each suborder to estimate crown node ages as cor-
rectly as possible. The nine selected species (three spe-
cies from the most species-rich Ceratioidei and two
from the rest of four suborders) are shown in Table 2
with asterisks. The resulting dataset contains 54 species
used in Azuma et al [40] plus nine lophiiforms, with the
total number of species being 63.
We used a relaxed molecular-clock method for dating
analysis developed by Thorne and Kishino [63] to esti-
mate divergence times. This method accommodates
unlinked rate variation across different loci ("partitions”
in this study), allows the use of time constraints on mul-
tiple divergences, and uses a Bayesian MCMC approach
to approximate the posterior distribution of divergence
times and rates based on a single tree topology esti-
mated from the other method (ML tree in this study). A
series of application in the software package multidistri-
bute (v9/25/2003) were used for these analyses.
Baseml in PAML ver. 3.14 was used to estimate model
parameters for each partition separately under the F84 +
Γmodel of sequence evolution (the most parameter-rich
model implemented in multidistribute). Based on the
outputs from baseml, branch lengths and the variance-
covariance matrix were estimated using estbranches in
multidistribute for each partition. Finally multidivtime
in multidistribute was used to perform Bayesian MCMC
analyses to approximate the posterior distribution of
substitution rates, divergence times, and 95% credible
intervals. In this step, multidivtime uses estimated
branch lengths and the variance-covariance matrices
from all partitions without information from the aligned
sequences.
MCMC approximation with a burnin period of
100,000 cycles was obtained and every 100 cycles was
taken to create a total of 10,000 samples. To diagnose
possiblefailureoftheMarkovchainstoconvergeto
their stationary distribution, at least two replicate
MCMC runs were performed with two different random
seeds for each analysis.
Application of multidivtime requires values for the
mean of the prior distribution for the time separating
the ingroup root from the present (rttm) and its stan-
dard deviation (rttmsd), and we set conservative esti-
mates of 4.2 (= 420 Myr ago [Ma]) and 4.2 SD,
respectively. The tip-root branch lengths were calculated
using TreeStat v. 1.1 http://tree.bio.ed.ac.uk/software/
treestat/ for all terminals and their average was divided
by rttm (4.2) to estimate rate of the root node (rtrate)
and its standard deviation (rtratesd), which were set to
0.074 and 0.074, respectively. The priors for the mean of
the Brownian motion constant, brownmean and
brownsd, were both set to 0.5, specifying a relatively
flexible prior.
Themultidivtimeprogramallows for both minimum
(lower) and maximum (upper) time constraints and it
has been argued that multiple calibration points would
provide overall more realistic divergence time estimates.
We therefore sought to obtain an optimal phylogenetic
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 11 of 27

coverage of calibration points across our tree, although
we could set maximum constraints based on fossil
records only for the three basal splits between Sarcop-
terygii and Actinopterygii, Polypteriformes and Actinop-
teri, Acipenseriformes and Neopterygii (A-C in Table 4).
We also set lower and upper time constraints for three
nodes in cichlid divergence, which show excellent agree-
ment with the Gondwanian fragmentation, assuming
that they have never dispersed across oceans. Accord-
ingly we set a total of 31 time constrains based on both
the fossil record and biogeographic events as shown in
Table 4. The resulting node ages for the Lophiiformes
and its five suborders (posterior means) were used as
the time constraints to estimate divergence times of all
the 39 lophiiform species.
Net diversification rates
We estimated per-clade net diversification rates (r=b-
d,wherebis the speciation rate and dis the extinction
rate) under relative extinction rates (ε=d/b)of0and
0.95 using Magallón and Sanderson’s[64]method-of-
moment estimator for each suborder. The equation is
derived from
rt

=−+11/(log[( ) ])n
where nis the final number of lineages (present-day
species diversity; Table 1) and tis the time interval con-
sidered (stem-group age).
Results and discussion
In the following sections, we describe and discuss the
mitogenomic phylogenies and evolutionary history of
the Lophiiformes. Whole mitogenomic phylogenetic
analysis has been extremely useful in illuminating new
ideas of interrelationships of fishes in particular, and
renewed morphological analysis of these proposed rela-
tionships has often provided additional morphological
support to challenge prevailing ideas of evolutionary
relationships [27,65]. We acknowledge, however, a
Table 4 List of time constraints used in divergence time estimation
Node Constraints
a
Calibration information
A U 472 The minimum age for the basal split of bony fish based on the earliest known acanthodian remains from
Late Ordovician [88]
L 419 The †Psarolepis fossil (sarcopterygian [89]) from Ludlow (Silurian) [90]
B U 419 The minimum age for the Sarcopterygii/Actinopterygii split
L 392 The †Moythomasia fossil (actinopteran) from the Givetian/Eifelian boundary [90]
C U 392 The minimum age for the Polypteriformes/Actinopteri split
L 345 The †Cosmoptychius fossil (neopterygian or actinopteran) from Tournasian [90]
D L 130 The †Protopsephurus fossil (Polyodontidae) from Hauterivian (Cretaceous) [90]
E L 284 The †Brachydegma fossil (stem amiids) from Artinskian (Permian) [90]
F L 136 The †Yanbiania fossil (Hiodontidae) from the Lower Cretaceous [90]
G L 112 The †Laeliichthys fossil (Osteoglossidae) from the Aptian (Cretaceous) [91]
H L 151 The †Anaethalion,†Elopsomolos, and †Eoprotelops fossil (Elopomorpha) from Kimmeridgian (Jurassic) [90]
I L 94 The †Lebonichthys (Albulidae) fossil from the Cenomanian (Cretaceous) [91]
J L 49 The Conger (Congridae) and Anguilla (Anguillidae) fossils from the Ypresian (Tertiary) [91]
K L 146 The †Tischlingerichthys fossil (Ostariophysi) from Tithonian (Jurassic) [90]
L L 56 The †Knightia fossil (Clupeidae) from the Thanetian (Tertiary) [91]
M L 49 The †Parabarbus fossil (Cyprinidae) from the Ypresian (Tertiary) [91]
N L 74 The †Esteseox foxi fossil (Esociformes) from the Campanian (Cretaceous) [92]
O L 94 The †Berycopsis fossil (Polymixiidae) from the Cenomanian (Cretaceous) [91]
P L 50 The pleuronectiform fossil from the Ypresian (Tertiary) [91]
Q L 98 The tetraodontiform fossil from the Cenomanian [83]
R L 32 The estimated divergence time between Takifugu and Tetraodon [93]
S U 95 L 85 The upper and lower bounds of separation between Madagascar and Indian [85,86,94]
T U 145 L 112 The upper and lower bounds of separation between Indo-Madagascar landmass and Gondwanaland [85,86,94]
U U 120 L 100 The upper and lower bounds of separation between African and South American landmasses [85,86]
V L 40 The lophiid fossil from Lutetian (Eocene) [95]
W L 40 The Brachionichthys fossil from Lutetian (Eocene) [28,34,95]
X L 40 The ogcocephalid fossil from Lutetian (Eocene) [95]
Y L 7.6 The ceratioid fossil from upper Mohnian [38]
a
U and L indicate maximum and minimum time constrains in million years (Myr), respectively (see Figure 9 for corresponding nodes).
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 12 of 27

phylogeny derived from the whole mitogenome only
represents the mtDNA genealogy and may not necessa-
rily match the evolution of the species under analysis.
Because of the lack of recombination, the entire mole-
cule of mtDNA has one molecular history that may be
unusual because of various factors [66]. Incongruence is
a recurring problem at both higher and lower phyloge-
netic levels [67-70]. As noted by many authors, a broad
approach to illuminating and reconciling this incongru-
ence is to analyze other genetic evidence, such as that
provided by nuclear DNA.
Mitogenome organization
We newly determined the complete (or nearly complete)
L-strand nucleotide sequences for mitogenomes of the 33
lophiiform species during this study and the sequences
have been deposited in DDBJ/EMBL/GenBank under the
accession numbers of AB282826-56 and AP005977-8
(Table 2). For Brachionichthys hirsutus (AB282832),
however, we were unable to sequence a region spanning
from tRNA-Gly to the control region (approximately 40%
of the complete sequence) owing to technical difficulties
and degradation of the tissues. The genome contents
includetworRNA,22tRNA,and13protein-coding
genes, plus the putative control region(s), as found in
other vertebrates, and most of the genes are encoded on
the H-strand, except for the ND6 and eight tRNA genes.
The gene arrangements of the 33 species are identical
to those of typical vertebrates, except for three species
in two different suborders, a tetrabrachiid Tetrabra-
chium ocellatum (Antennarioidei) and two ceratiids,
Ceratias uranoscopus and Cryptopsaras couesii (Cera-
tioidei), in which significant numbers of tRNA genes
and the control regions in the latter two taxa are trans-
located from the typical vertebrate positions. Also,
unlike typical vertebrates, 17 examples of relatively long
non-coding sequences (>100 bp) other than the control
regions occur in 12 ceratioid species in five families
(Caulophrynidae, Melanocetidae, Oneirodidae, Gigantac-
tinidae, Linophrynidae; Table 5). Among these 17 exam-
ples, insertion sequences between the ATPase 6 and
COIII genes (118-682 bp; the two genes located adjacent
to each other without insertions in most vertebrates)
were observed in six species in four families (Caulophry-
nidae, Melanocetidae, Oneirodidae, Linophrynidae),
while 11 other sequences were restricted to either all or
some member(s) of single families (Oneirodidae, Gigan-
tactinidae, Linophrynidae).
Such gene rearrangements and patterns of insertion
sequences have been employed as useful phylogenetic
Table 5 Patterns of intergenic non-coding sequences (≥100 bp) and their lengths (bp) in 23 oneiroid species
Family Species Insertion (bp)
Caulophrynidae Caulophryne jordani A6/C3 (131)
C. pelagica A6/C3 (118)
Neoceratiidae Neoceratias spinifer –
Melanocetidae Melanocetus murrayi A6/C3 (332)
M. johnsonii A6/C3 (406)
Himantolophidae Himantolophus albinares –
H. groenlandicus –
Diceratiidae Bufoceratias thele –
Diceratias pileatus –
Oneirodidae Oneirodes thompsoni Met/N2 (111); A6/C3 (473); Glu/CB (257)
Puck pinnata Ala/Asn (255); Tyr/C1 (314); N6/Glu (489)
Chaenophryne melanorhabdus Lys/A8 (445)
Bertella idiomorpha –
Lasiognathus sp. –
Thaumatichthyidae Thaumatichthys pagidostomus –
Centrophrynidae Centrophryne spinulosus –
Ceratiidae Ceratias uranoscopus –
Cryptopsaras couesii –
Gigantactinidae Gigantactis vanhoeffeni Ser/Leu (593)
Rhynchactis macrothrix Ler/N5 (268)
Linophrynidae Linophryne bicornis N6/Glu (186)
Acentrophryne dolichonema A6/C3 (682); N6/Glu (186)
Haplophryne mollis N6/Glu (144)
Abbreviation of genes: Met = tRNA-Met; N2 = NADH dehydrogenase subunit 2; Ala = tRNA-Ala; Asn = tRNA-Asn; Tyr = tRNA-Tyr; C1 = cytochrome c oxidase
subunit I; Lys = tRNA-Lys; A8 = ATPase subunit 8; A6 = ATPase subunit 6; C3 = cytochrome c oxidase subunit III; Ser = tRNA-S er (AGY); Leu = tRNA-Leu (CUN);
N5 = NADH dehydrogenase subunit 5; N6 = NADH dehydrogenase subunit 6; Glu = tRNA-Glu; CB = cytochrome bgenes
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 13 of 27

markers in other fishes, as well as various metazoan ani-
mals, because they may represent uniquely derived char-
acters shared by members of monophyletic groups (for
reviews, see [71] but see also [72]). These genomic fea-
tures also have been demonstrated to be useful in deli-
miting unexpected monophyletic groups in some
teleosts, such as congroid eels [73] and macrouroid cods
[74]. However, the distributions of these unique geno-
mic features across ceratioid families (not within-
families; Table 5) are incongruent with the inferred
inter-familial relationships derived from the nucleotide
sequences (see below), suggesting either independent
acquisitions or a single gain followed by independent
losses of such unique features in a parsimony frame-
work. Details of the gene rearrangements and patterns
of insertion sequences in the Ceratioidei will be dis-
cussed elsewhere.
Monophyly and phylogenetic position of the
Lophiiformes
Our taxon sampling assumes the percomorph Lophii-
formes (not paracanthopterygian Lophiiformes as advo-
cated by Patterson and Rosen [10]; Rosen and Patterson
[7]) and the datasets comprise 44 whole mitogenome
sequences used in Yamanoue et al. [27] plus those
sequences from the 33 lophiiforms (Table 2). To check
sensitivity of additional taxon sampling from a number
of the lophiiforms to the results reported in Yamanoue
et al. [27], we used their pre-aligned sequences as a
basis for further alignment with the 33 sequences. As
expected from this multiple alignment procedure, the
resulting phylogenies outside the lophiiforms (Figure 5;
derived from 12
n
3
r
RT
n
dataset) are identical to those
reported in Yamanoue et al. [27] and the order Lophii-
formes is confidently recovered as a monophyletic group
with 100% bootstrap probabilities (BPs) in all datasets.
Pietsch and Orr [33] stated that a monophyletic origin
of the Lophiiformes seems certain based on six morpho-
logically complex synapomorphic features [1-3,28] and
this study is the first convincing demonstration of
monophyly of the Lophiiformes based on molecular data
from all the currently-recognized five suborders and
appropriate taxonomic representation from outgroups in
a molecular phylogenetic context.
Concerning the sister-group relationships of the
Lophiiformes, no morphological study has provided a
view that departs significantly from the previous para-
canthopterygian notion advocated by Rosen and Patter-
son [7] and subsequently modified by Patterson and
Rosen [10]. Both mitogenomic [25] and nuclear gene
[23] phylogenies, however, have convincingly demon-
strated a percomorph relationship for the Lophiiformes
and nullified the hypothesis of common ancestry with
the Batrachoidiformes. In fact, use of the two whole
mitogenome sequences from the Batrachoidiformes as
only outgroups to root the lophiiform phylogenies dis-
rupted the monophyletic Antennarioidei at the most
basal position (as in Shedlock et al. [29]), followed by
divergence of the Lophioidei, Ogcocephaloidei, and a
clade comprising the Chaunacoidei and Ceratioidei at
the top of the tree (results not shown). These subordinal
relationships, particularly the non-monophyletic and
most basal position of the Antennarioidei, are similar to
those reported by Shedlock et al. [29] who used the
batrachoidiform sequence as an only outgroup to root
their tree.
We therefore excluded those two batrachoidiform
sequences in the present study, thereby revealing a sis-
ter-group relationship either with the Caproidei alone
(12
n
3
r
RT
n
and 123
n
RT
n
datasets) or with the Caproidei
plus Tetraodontiformes (12
n
RT
n
dataset), as shown also
by Yamanoue et al. [27]. Nevertheless all nodal support
values for these relationships were less than 50% boot-
strap probabilities (BPs) and addition of unsampled
members of the Percoidei (particularly putative mem-
bers of Clade H in Kawahara et al. [75]; Yagishita et al.
[76]) may eventually alter this picture of sister-group
relationship of the Lophiiformes. Recently Li et al. [23]
used 10 nuclear genes to analyze higher-level relation-
ships of the actinopterygians and the only included
lophiiform (a lophiid Lophius gastrophysus) was recov-
ered as a sister species of two tetraodontiforms (Taki-
fugu rubripes and Tetraodon nigroviridis). Although
their dataset did not include a caproid sequence, it does
appear from these and the other studies mentioned
above that the tetraodontiforms are close relatives of the
lophiiforms, within the Percomorpha.
Monophyly and interrelationships of the five suborders
The mitogenomic data strongly support monophyly for
eachofthefivesuborders,the most basal position of
the Lophioidei, and monophyly of a clade comprising
the rest of the four suborders (Ogcocephaloidei, Anten-
narioidei, Chaunacoidei and Ceratioidei) with 100% BPs
(Figures 5, 6) in all datasets. The recent morphological
study of Pietsch and Orr [33] also recovered monophyly
of the latter clade (and the resulting most basal position
of the Lophioidei) with six unambiguous synapomor-
phies (their characters 27, 41, 54, 70, 82 and 83). Thus
this pattern of the basal divergence within the Lophii-
formes (Figures 5, 6) is supported by two different lines
of evidence and seems to reflect the true phylogeny.
Within a clade comprising the above four suborders, a
sister-group relationship between the Chaunacoidei and
Ceratioidei is consistently recovered in all datasets with
high BPs (90-100%; Figure 6). Phylogenetic positions of
the rest of the two suborders (Ogcocephaloidei and
Antennarioidei), on the other hand, are quite ambiguous
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 14 of 27

Figure 5 The best-scoring maximum likelihood (ML) tree derived from 12
n
3
r
RT
n
dataset. Numerals beside internal branches indicate
bootstrap probabilities ≥50% based on 500 replicates. Scale indicates expected number of substitutions per site. Extremely long branch from
Tetrabrachium ocellatum is shortened to one third of the original length.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 15 of 27

and three alternative hypotheses of relationships among
three lineages (Ogcocephaloidei, Antennarioidei, and
Chaunacoidei plus Ceratioidei) are almost equally likely
in a statistical sense (AU test, P= 0.520-0.589; Table 6).
Significantly, when monophyly of the Chaunacoidei plus
Ceratioidei is not constrained in the statistical compari-
sons, all of the 12 alternative relationships are confi-
dently rejected by AU tests (P= 0.000-0.030; the bottom
12 rows in Table 6), which include the morphology-
based hypotheses [3,33](P= 0.002). Therefore the Chau-
nacoidei is most likely to represent the sister-group of
the Ceratioidei in a mitogenomic context.
We acknowledge, however, that no morphological data
supports a sister-group relationship between the Chauna-
coidei and Ceratioidei ([33] but see [32]). Instead, morpho-
logical data have indicated monophyly of the
Figure 6 A strict consensus of the three best-scoring maximum likelihood (ML) trees. The strict consensus trees are derived from the
three datasets that treat third codon positions differently (12
n
3
r
RT
n
, 123
n
RT
n
,12
n
RT
n
). Lasiognathus sp. was considered as a member of the
Oneirodidae because it is deeply nested within the family and monophyly of the traditional Thaumatichthyidae (Thaumatichthys and
Lasiognathus) is confidently rejected by AU test (diff -ln L= 500.1; P> 0.0000).
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 16 of 27

Ogcocephaloidei plus Ceratioidei with relatively strong
statistical support (BS = 94%; Bremer index = 4; see [33])
with the following three unambiguous synapomorphies: 1)
the first epibranchial is simple and without ligamentous
connection to the second epibranchial (character 43); 2)
the third cephalic dorsal-fin spine and pterygiophore are
absent (character 60); and 3) the posttemporal is fused to
the cranium (character 63). However, all of these charac-
ters appear in the Ogcocephaloidei and Ceratioidei to
represent simplified or reductive trends, which are perhaps
more likely to have occurred convergently, and the result-
ing homoplasy may undermine the robustness of the phy-
logenetic hypotheses based on morphology [77]. Future
evaluation of homology of these anatomical features,
exploration of new morphological characters, and addition
of molecular data from other genes may help resolve the
conflict between these two different sources of phyloge-
netic information (for related discussion on the relation-
ships within the Ceratioidei, see below).
Lophiid relationships
The Lophioidei contains a single family, the Lophiidae,
with 25 species distributed among four genera [78]
(Table 1). Caruso [30] presented the first cladogram of
lophiid genera based on 19 morphological characters
(Figure 4C), of which 12 showed derived states shared
by two or three genera. The reconstructed cladogram
indicated the most basal position of Sladenia,followed
by the divergence of Lophiodes and Lophiomus plus
Lophius in sequential step-wise fashion, relationships
that are fully congruent with the mitogenomic phyloge-
nies, with all internal branches of the latter supported
by 100% BPs (Figures 5, 6).
Antennaroid relationships
The Antennarioidei contains four families with 53 species
distributed among 17 genera (Table 1). Pietsch and Gro-
becker [3] presented a cladogram of familial relationships
of the suborder based on seven synapomorphies (Figure
4D), in which the Brachionichthyidae occupies the most
basal position, followed by the divergence of Lophichthyi-
dae, with Tetrabrachiidae and Antennariidae forming a
sister-group at the top of the tree [3]. Although we were
unable to collect tissue samples from the only member of
the Lophichthyidae (Lophichthys boschmai), the mitoge-
nomictreeiscompletelycongruentwiththemorphol-
ogy-based phylogeny (Figures 5, 6).
Within the Antennariidae, Antennarius striatus is
recovered as the sister of a terminal clade that includes
Histrio histrio and A. coccineus, thus rendering Anten-
narius paraphyletic. The Antennariidae is by far the lar-
gest family of the suborder, including 45 species in 12
genera, of which only three species and two genera are
included here. While our coverage of the Antennariidae
is poor, an on-going molecular study by one of us
(RJA), based on both mitochondrial and nuclear genes
and considerably more taxa (25 species and 10 genera),
also results in paraphyly for Antennarius.Thus,more
extensive taxon sampling within Antennarius as well as
within other antennariid genera is not likely to alter the
topology shown here.
Ogcocephaloid relationships
TheOgcocephaloideicontainsasinglefamilywith68
species distributed among 10 genera (Table 1). Endo
and Shinohara [31], while describing a new species of
the genus Coelophrys, cladistically analyzed nine mor-
phological characters (all previously used in [79]) from
nine of the 10 genera. As expected from such a small
number of characters, resolution of the resulting clado-
gram was poor at the two most basal nodes (Figure 4E)
and Coelophrys - an unusually globose genus among the
typically dorsoventrally flattened ogcocephaloids - was
placed at the top of the tree (Figure 4E). The placement
of Coelophrys and the more basal Halieutaea in the cla-
dogram (Figure 4E) agree with the mitogenomic phylo-
genies (Figures 5, 6), but the placement of Malthopsis
and Zalieutes do not. A statistical test finds no signifi-
cant difference between the morphological cladogram
(Figure 4E) and the mitogenomic phylogeny (Figure 5)
(AU test, P= 0.182), perhaps owing to the poor resolu-
tion of the morphological cladogram and low taxon
sampling in the molecular phylogenies. Again more
Table 6 Statistical comparisons among 15 alternative
tree topologies of the four more derived suborders
using AU test
Tree
a
Diff -ln LP
(Og,(An,(Ch,Ce)))
b
0.0 0.589
((Og,An)(Ch,Ce))
c
0.0 0.577
(An,(Og,(Ch,Ce))) 0.5 0.520
(Og,(Ce,(An,Ch))) 22.4 0.030
(Og,(Ch,(An,Ce))) 27.5 0.006
(An,(Ce,(Ch,Og))) 42.5 0.015
(An,(Ch,(Og,Ce)))
d
43.8 0.002
((An,Ch)(Og,Ce)) 47.9 0.000
(Ce,(Og,(An,Ch))) 48.9 0.000
((An,Ce)(Ch,Og)) 49.7 0.002
(Ch,(Og,(An,Ce))) 50.4 0.000
(Ch,(Ce,(An,Og))) 53.2 0.004
(Ce,(Ch,(An,Og))) 54.2 0.008
(Ce,(An,(Og,Ch))) 54.6 0.000
(Ch,(An,(Og,Ce))) 55.1 0.002
a
Ogcocephaloidei (Og); Antennarioidei (An); Chaunacoidei (Ch); Ceratioidei
(Ce). The most basal Lophioidei was excluded from the comparisons
b
The best-scoring ML tree derived from 12
n
3
r
RT
n
(Figure 5) and 12
n
RT
n
datasets.
c
The best-scoring ML tree derived from 123
n
RT
n
dataset.
d
Morphology-based hypothesis [3]
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 17 of 27

extensive taxon sampling will be required to obtain a
better picture of their relationships.
Chaunacoid relationships
The Chaunacoidei contains a single family with about
14 species divided between two genera [2] (Table 1).
While we successfully obtained tissue samples from
three species of the more common Chaunax,those
from the rare genus Chaunacops were unavailable. Thus
we are unable to evaluate monophyly for each of the
two genera and to investigate their relationships. There
is no phylogenetic hypothesis for chaunacoids at
present.
Ceratioid relationships
The Ceratioidei contains 11 families with 160 species
distributed among 35 genera [2] (Table 1). The first
attempt to resolve relationships among ceratioid taxa
after the advent of cladistic method [9] was that of Ber-
telsen [32]. He admitted, however, that most of the
derived osteological characters shared by two or more
families are reductive states or loss of parts, and simila-
rities among such characters may in many cases repre-
sent convergent development. Nevertheless, Bertelsen
[32] presented a cladogram of the ceratioid taxa (Figure
4F), stating that the tree should be regarded only as “a
very schematic compilation of expressed view.”He con-
cluded that future studies on additional characters and
as yet unknown taxa may bring answers to at least some
of the many questions about their phylogenetic
relationships.
More recently, Pietsch and Orr [33], with the advan-
tage of more than 20 years of additional accumulated
data since Bertelsen’s attempt [32], coupled with a re-
examination of all previously identified characters and
analyses of new characters, presented the first compu-
ter-assisted cladistic analysis of relationships of ceratioid
families and genera (Figure 4G). In that study, Pietsch
and Orr [33] showed two trees: one based on 71 mor-
phological characters applicable to metamorphosed
females (Figure 4G), and another one based on 17 mor-
phological characters applicable to metamorphosed
males and larvae, in addition to the 71 characters
extracted from females, for a total of 88 characters. The
latter tree was poorly resolved and Pietsch and Orr [33]
thus considered the former as the best estimate of
relationships.
Our dataset includes 23 species in 20 genera from all
11 ceratioid families. Our preferred dataset (12
n
3
r
RT
n
:
RY-coding) reproduces the most basal Caulophrynidae,
followed by divergence of the Ceratiidae, Gigantactini-
dae, Thaumatichthyidae plus Linophrynidae, Neoceratii-
dae plus Centrophrynidae, Oneirodidae (including
Lasiognathus;seebelow),Himantolophidae,and
Melanocetidae plus Diceratiidae at the top of the tree in
sequential step-wise manner (Figure 5). More basal rela-
tionships among the seven families up to a clade com-
prising the Neoceratiidae plus Centrophrynidae are
poorly resolved, with all internal branches supported by
<60% BPs. Different treatments of the 3rd codon posi-
tions even yield different tree topologies, collapsing the
most basal clade within the Ceratioidei in a strict con-
sensus tree (Figure 6).
Interrelationships among the most apical four families
(Oneirodidae, Himantolophidae, Melanocetidae, and
Diceratiidae), on the other hand, are more robust with
allinternalbranchessupportedby99-100%BPsexcept
for a sister-group relationship between the Melanoceti-
dae and Diceratiidae (77-97% BPs; Figure 6). Shedlock et
al. [29] also recovered an identical tree topology among
the first three families (Oneirodidae, Himantolophidae,
Melanocetidae) based on short sequences from the
mitochondrial 16S rRNA gene, although their dataset
lacked a member of the Diceratiidae. Lasiognathus (Fig-
ure 2H), long placed in the Thaumatichthyidae (Figure
2I), is here deeply nested within the Oneirodidae, and
shown as the sister species of the derived oneirodid
Puck pinnata at the top of the clade with 100% BPs
(Figures 5, 6). The placement of Lasiognathus and
Thaumatichthys in separate families was considered by
Bertelsen and Struhsaker [80] who compared the osteol-
ogy and pointed out that Lasiognathus appears more
closely related to the Oneirodidae, but they chose to
separate the two genera into different families. As
expected from the most derived position of Lasiog-
nathus within the oneirodids with the highest BPs
(100%), monophyly of the traditional Thaumatichthyidae
(including Lasiognathus) is confidently rejected by AU
test (diff -ln L= 500.1; P< 0.0000).
Incongruence between morphology and molecule
As pointed out by Pietsch and Orr [33], who compared
their tree with the unpublished molecular phylogeny
provided by M.M. (referred to as Miya unpubl. data),
the morphological hypothesis (Figure 4G) bears very lit-
tle resemblance to the mitogenomic phylogenies (Fig-
ures 5, 6). Statistical differences between the constrained
and unconstrained ML trees are so large (diff -ln L=
793.9, P< 0.0000 for [32]; diff -ln L= 1308.8, P<
0.0000 for [33]) that we are unable to reconcile these
competing hypotheses. In fact, among the clades that
differ between the two analyses, non-homoplastic mor-
phological characters support only one clade (Himanto-
lophidae, Diceratiidae, and Melanocetidae) and that with
only a single character (8: the condition of the ventro-
medial extensions of the frontals).
Such remarkable incongruence between morphological
and molecular hypotheses of ceratioid relationships
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 18 of 27

requires an explanation. Although additional sequence
data from other portions of the genome (e.g., nuclear
genes) should be analyzed to confirm molecular conclu-
sions [67,69], Hedges and Sibley [81] argued that, in
such cases of incongruence, morphological evidence
should also be reevaluated. Following Hedges and Sib-
ley’s argument [81] and Bertelsen’s empirical comments
[32] that reductive states or loss of parts and similarities
among such characters may in many cases represent
convergent development, we have reviewed all of the 71
characters from the metamorphosed females and found
the following 18 characters that are reductive, simplified,
or absent for derived states (with the exception of those
characters showing complete congruence with the mole-
cular phylogenies; e.g., only autapomorphies for single
families): vomerine teeth absent (character 3); parietal
absent (9); pterosphenoids absent (10); endopterygoid
absent (16); interopercle extremely reduced (23); rostral
cartilage absent (26); maxillae considerably reduced (29);
thick anterior maxillomandibular ligament very much
reduced or absent (30); dentaries simple (31); first phar-
yngobranchial absent (39); first epibranchial absent (42);
first epibranchial simple, not bearing a medial process
(43); third hypobranchial absent (45); branchial teeth
absent on the first three ceratobranchial (46); ninth or
lower-most ray in caudal fin reduced (52); cephalic
dorsa-fin spine absent (60); posttemporal is fused to the
cranium (63); and pelvic bones reduced (66).
Assuming that all or some of these 18 reductive or
simplified morphological characters likely represent
homoplasy, we excluded them from the original dataset
and the reduced dataset was subjected to maximum par-
simony (MP) analysis, similar to that conducted by
Pietsch and Orr [33]. The MP analysis produced 11
equally most parsimonious trees, with a total length of
100, a consistency index of 0.610, and a retention index
of 0.835, a strict consensus shown in Figure 4. The
resulting MP tree exhibits some important similarities
with the molecular phylogenies that are not evident in
the trees of Pietsch and Orr [33]. For example, the Cau-
lophrynidae is placed as the most basal lineage within
the Ceratioidei in the revised cladogram (Figure 7).
Pietsch and Orr [33] were surprised with the derived
position of the Caulophrynidae in their cladogram (Fig-
ure 4G) in light of Bertelsen’s view [32,82] that the
absence of an escal light organ in all life-history stages
of the family is not due to secondary loss. Bertelsen’s
opinion [32,82] was reinforced by ontogenetic informa-
tion from other characters, such as the apparent absence
of sexual dimorphism in rudiments of the illicium and
the absence of a distal swelling of the illicial rudiments.
Our preferred mitochondrial dataset (12
n
3
r
RT
n
: RY-cod-
ing) supports the most basal position of Caulophrynidae
within the Ceratioidei (and monophyly of the rest of the
families to the exclusion of the Caulophrynidae),
although statistical support is not convincing (53% BP
in Figure 5).
The revised cladogram (Figure 7) also recovers a
monophyletic group comprising the Himantolophidae,
Melanocetidae and Diceratiidae that is supported by
100% BPs (Figures 5, 6). Pietsch and Orr [33] observed
that these three families uniquely share a single non-
homoplastic morphological character (ventromedial
extensions of the frontal that make no contact with the
parasphenoid). In addition to these ceratioid relation-
ships, monophyly of the Ogcocephaloidei + Ceratioidei
is collapsed to form a trichotomy of these two suborders
plus Chaunacoidei. Thus simple exclusion of reduced or
simplified characters from the morphological dataset
yields a tree that can be better reconciled with the mole-
cular phylogenies (Figures 5, 6). However, simply delet-
ing all reductive characters may also be misleading, by
running the risk of rejecting informative characters.
Homology of reductive morphological characters is
commonly evaluated by ontogenetic analysis, but in the
case of ceratioids, very little ontogenetic material is
available for analysis [2,33]. Considerably more work
will be needed to further reconcile these competing phy-
logenetic hypotheses.
Evolution of male sexual parasitism
The maximum likelihood (ML) reconstruction of the
four reproductive modes in ceratioid males on the mito-
genomic phylogenies reveals that character states at the
two ancestral, most basal nodes (A and B in Figure 8),
are equivocal. The character states 0 (males never attach
to females) and 2 (males are facultative parasites) are
almost equally likely at node A (P
0
=0.356;P
2
=0.381),
as are the character states 1 (males attach temporarily)
and 3 (males are obligate parasites) at node B (P
1
=
0.348; P
3
= 0.390). Thus we are unable to determine
ancestral states of facultative and obligate parasitic
males in the Caulophrynidae (node A) and Ceratiidae
(node B), respectively (Figure 8). With the exception of
these two basal families, evolutionary origins of parasitic
males are unequivocally reconstructed on the mitoge-
nomic phylogenies in more derived clades above node C
(Figure 8). For example, precursors of those taxa with
obligate (Linophrynidae and Neoceratiidae) and faculta-
tive (the oneirodid Bertella) parasitic males are recon-
structed as the temporal attachment of males at nodes
D, E, and F with high probabilities (P
1
= 0.893-0.995;
Figure 8). On the basis of their morphological clado-
gram, Pietsch and Orr [33] stated that whether faculta-
tive parasitism and temporary attachment of males to
females are precursors to obligate parasitism, or the for-
mer are more derived states of the latter, remains
unknown. Our ML reconstruction strongly suggests that
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 19 of 27

temporary attachment of males to females is a precursor
to facultative or obligate parasitism for at least three of
the five cases at the family level (Figure 8).
Pietsch and Orr [33] further argued that the disjunct
pattern of sexual parasitism within ceratioids appears
to be the result of independent acquisition among the
various lineages rather than a repeated loss of this
attribute within the suborder. To support this argu-
ment, Pietsch and Orr [33] listed many differences in
the precise nature of male-female attachment among
the various taxa [4], to the extent of the most extreme
possibility being an independent acquisition of sexual
parasitism within families, such as the Ceratiidae
(Ceratias vs. Cryptopsaras) and Linophrynidae (Haplo-
phryne vs. Linophryne). If so, evolution of sexual para-
sitism has independently occurred as many as seven
times within the suborder (= the number of green or
blue circles at terminal nodes in Figure 8). Similarly,
although our simple character coding does not take
into account such differences in male-female
Figure 7 A strict consensus of the 11 most parsimonious tree derived from maximum parsimony (MP) analysis of 53 morphological
characters. These morphological characters are applicable to the metamorphosed females only (71 characters used in Pietsch and Orr [33]
minus 18 characters that are supposedly show reductive or simplified states; for details see text). The 11 MP trees had a total length of 100, a
consistency index of 0.610, and a retention index of 0.835.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 20 of 27

attachment, our ML reconstruction suggests that
acquisition of this attribute has occurred at least five
times during ceratioid evolution. Shedlock et al. [29]
also found a paraphyletic pattern of sexual parasitism
within the suborder in their much smaller dataset and
suggested that the plasticity of this unique life history
trait among vertebrates is likely shaped by a dynamic
relationship between localized population densities and
the feasibility of maintaining mate choice at low effec-
tive population size in the expanse of the deep ocean.
Of course, it may be possible that availability of more
specimens from these rare organisms will shed a new
light for evolution of the male sexual parasitism.
Divergence time estimation
As Carnevale and Pietsch [34] stated, fishes of the order
Lophiiformes are very rare in the fossil record and all of
the recorded ages fall in the Cenozoic from 7.6 to 40
Myr ago (for details, see Table 4). Assuming a sister
group relationship of the Lophiiformes and Tetraodonti-
formes, however, the origin of the modern Lophiiformes
can be dated to the deep Mesozoic, because an articu-
lated fossil that is convincingly assignable to the modern
Tetraodontiformes was discovered from the mid Cretac-
eous (Cenomanian) 98 Myr ago [83]. This fossil lineage
would have appeared well after the divergence of
the common ancestor of the Lophiiformes and
Figure 8 Maximum likelihood reconstruction of the male sexual parasitism in ceratioid anglerfishes. Four discrete character states were
assigned to each terminal and ancestral character states were reconstructed on the ML tree (Figure 5) under an ML optimality criterion using
Mesquite ver. 2.6 [56].
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 21 of 27

Tetraodontiformes. Fossils are useful only for minimum
time constraints to estimate divergence times of the
Lophiiformes, as generally acknowledged [40,84].
A relaxed molecular-clock Bayesian analysis of diver-
gencetimeestimatesinthepresentstudy(Figure9),
which is based on 31 time constraints (Table 4), shows
excellent agreement with previous studies based on
whole mitogenome sequences (Table 7). Therefore, the
analysis is not sensitive to the taxon sampling strategy
employed to avoid a “node density effect”(i.e., sampling
a minimum number of lophiiform species[61,62]). The
Lophiiformes is estimated to have diverged from an
ancestral lineage of the Tetraodontiformes (the putative
sister-group in the present dataset) 157 Myr ago (145-
172 Myr ago; 95% credible interval) (Figure 9). Although
a common ancestral lineage of the Lophiiformes has
Figure 9 Divergence times of ray-finned fishes. Divergence times were estimated from the partitioned Bayesian analysis using a
multidistribute program package [63]. A total of 25 nodes (A-Y) were used for time constraints (for details, see Table 4). Horizontal bars indicate
95% credible intervals of the divergence time estimation.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 22 of 27

failed to leave extant lineages for about 23 Myr, it has
subsequently diversified into five subordinal lineages in
a relatively short time interval of 18 Myr between 117
and 135 Myr ago: a common ancestor of the order is
estimated to have diverged into the Lophioidei and the
rest of the four suborders 135 Myr ago (121-149 Myr
ago), followed by the divergence into the Ogcocephaloi-
dei and the rest of the three suborders 129 Myr ago
(115-144 Myr ago), the Antennarioidei and the rest of
the two suborders 125 Myr ago (112-140 Myr ago), and
the Chaunacoidei and Ceratioidei 117 Myr ago (104-131
Myr ago). Significantly, ancestral lineages of the modern
Lophiiformes have occupied various marine habitats,
from relatively shallow benthic to (principally) deep
bathypelagic (>1000 m deep) environments, within this
short time period (18 Myr). This time period roughly
corresponds to the beginning of the Gondwanian frag-
mentation [85,86] which, with these vicariant events,
produced diversified coastal marine environments, with
various niches along the continental shelves.
Unique among principally bathypelagic ceratioids are
three species of the genus Thaumatichthys (Thauma-
tichthyidae; Figure 2I) that are abyssal-benthic, presum-
ably staying in deep-sea bottom (> 1000 m) and luring
prey items with esca “inside the mouth”[80]. If this
unusual life style had been attained concurrently in the
origin of the common ancestor of Thaumatichthys,it
took about 33 Myr after leaving the bottom of the sea
around the continental shelves and subsequently return-
ing to that unique benthic life style at greater depths.
Patterns and rates of diversification
The resulting time tree of the Lophiiformes (Figure 10)
allows us to provide some insights into the patterns and
rates of diversification across the order. Although
incomplete taxon sampling from some of the suborders
(Ogcocephaloidei, Antennarioidei, Chaunacoidei) pro-
hibited rigorous evaluation of the patterns of diversifica-
tion across the Lophiiformes, there are remarkable
differences between diversification patterns in the
Lophioidei (= Lophiidae) and Ceratioidei, for which we
successfully sampled all of the genera and families
(Figure 10). An ancestral lineage of the Lophioidei
began to diversify 109 Myr ago, leaving only four mod-
ern genera during a period of about 27 Myr. Almost
concurrently, an ancestral lineage of the Ceratioidei
began to diversify 103 Myr ago, leaving as many as eight
modern families plus a common ancestor of the three
more derived families (Himantolophidae, Melanocetidae,
Diceratiidae) during a periodofabout20Myr,suggest-
ing rapid morphological radiations during an early phase
of ceratioid evolution at bathypelagic depths. Such rapid
familial radiations and the resulting short internal
branches may render the phylogenetic analysis difficult
to resolve the basal relationships (Figure 6).
Per-clade net diversification rates based on stem-node
ages and current species diversity, on the other hand,
can be compared across all subordinal lineages. Accord-
ingly we estimated net diversification rates (b-d,where
bis the speciation rate and dis the extinction rate) per
clade, under the lowest extinction rate (d:b =0)and
under an extremely high relative extinction rate (d:b =
0.95) for each clade (Table 8). With a known diversity
of 361 modern species (Table 1) and an estimated basal
split at 157 Myr ago (Figure 9), the Lophiiformes exhibit
an average net diversification rate of 0.0368 event per
lineage per million years under d:b = 0 and 0.0181 event
per lineage per million years under d:b = 0.95. As
expected from differences in the current diversity and
similar stem node ages, the Ceratioidei exhibits remark-
ably higher net diversification rates of 0.0434 event per
lineage per million years under d:b = 0 and 0.0188 event
per lineage per million years under d:b =0.95(Table8)
than those of the rest of the four suborders (0.0231-
0.0334 under d:b = 0; 0.0045-0.0115 under d:b = 0.95).
With the acquisition of novel features, such as male
dwarfism, bioluminescent lures, and unique reproductive
modes, it appears that a ceratioid invasion of a largely
Table 7 Comparisons of divergence time estimates between the present study and previous studies
Node This study (Figure 9) Azuma et al. [40]
a
Setiamarga et al. [84]
Sarcopterygii vs. Actinopterygii 421 (403-439) 429 (417-449) 428 (419-442)
Teleostei vs. Neopterygii 360 (340-376) 365 (348-378) 364 (346-378)
Euteleostei vs. Otocephala 285 (265-305) 288 (268-307) 315 (270-363)
Cyprinus vs. Danio 148 (121-176) 147 (120-174) 153 (125-183)
Acanthopterygii vs. Paracanthopterygii 206 (190-224) 207 (190-224) 209 (191-225)
Percomorpha vs. Berycomorpha 196 (182-212) 198 (183-215) 200 (185-217)
Oryzias vs. Tetraodontiformes 174 (161-187) 176 (163-191) 180 (166-195)
Oryzias vs. Cichlidae 143 (134-153) 152 (141-165) 150 (139-161)
Gasterosteus vs. Tetraodontidae 169 (156-183) 170 (156-185) 173 (159-189)
Takifugu vs. Tetraodon 81 (68-96) 78 (65-93) 78 (63-93)
a
Estimated with biogeography-based time constraints on cichlid divergence
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 23 of 27

unexploited bathypelagic zone allowed for explosive
diversification in a relatively brief period.
Conclusions
The mitogenomic analyses demonstrated previously
unappreciated phylogenetic relationships among the
lophiiform suborders and deep-sea ceratioid familes.
Although the latter relationships cannot be reconciled
with the earlier hypotheses based on morphology, we
found that simple exclusion of the reductive or simpli-
fied characters can alleviate some of the conflict. Recon-
struction of the male reproductive modes of the
Figure 10 Divergence times of the 39 species of the Lophiiformes. Divergence times were estimated from the partitioned Bayesian analysis
using a multidistribute program package [63]. A total of nine nodes (filled circles) were used for fixed time constraints.
Table 8 Per-clade net diversification rates
(events per lineage per Myr) for the five suborders
of the Lophiiformes
Suborder Number of
species
Divergence time
(Myr ago)
r
0
r
0.95
Lophioidei 25 134.7 0.0239 0.0059
Ogcocephalidae 54 129.2 0.0309 0.0100
Antennarioidei 66 125.6 0.0334 0.0115
Chaunacoidei 15 117.2 0.0231 0.0045
Ceratioidei 161 117.2 0.0434 0.0188
The rates were calculated using a Magallón and Sanderson’s method-of-
moment estimator [64] assuming two extreme extinction rates (ε) of 0 and
0.95
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 24 of 27

ceratioids on the resultant phylogeny revealed complex
evolutionary patterns of the sexual parasitism in males.
A relaxed molecular-clock Bayesian analysis of the
divergence times suggests that all of the subordinal
diversifications have occurred during a relatively short
time period between 100 and 130 Myr ago (early to mid
Cretaceous). Comparisons of per-clade net diversifica-
tion rates among the five lophiiform suborders suggest
that the acquisition of novel features, such as male
dwarfism, bioluminescent lures, and unique reproductive
modes allowed the deep-sea ceratioids to diversify
rapidly in a largely unexploited, food-poor bathypelagic
zone (200-2000 m depth) relative to the other lophii-
forms occurring in shallow coastal areas along continen-
tal shelves.
Acknowledgements
This study would not have been possible without donation of the study
materials, for which we would like to thank A. Bentley, J.H. Caruso, H. Endo,
A. Graham, K.E. Hartel, M. McGrouther, T.T. Sutton, E.O. Wiley, and M.
Yamaguchi. We also thank J.G. Inoue for his kind advice in divergence time
estimation, Y. Yamanoue for providing the pre-aligned sequences used in
Yamanoue et al. [27], and C.P. Kenaley and D.E. Stevenson for helpful
discussions. We thank the following for allowing us to reproduce their
photographs: J.H. Caruso, P. David, D.B. Grobecker, C.P. Kenaley, R. Kuiter, D.
Shale, and E. A. Widder. This study was supported in part by Grants-in-Aid
from the Ministry of Education, Culture, Sports, Science and Technology,
Japan (12NP0201, 15380131, 17207007, and 19207007); and by the U.S.
National Science Foundation Grant DEB-0314637, T.W. Pietsch, principal
investigator.
Author details
1
Natural History Museum and Institute, Chiba, 955-2 Aoba-cho, Chuo-ku,
Chiba 260-8682, Japan.
2
School of Aquatic and Fishery Sciences, College of
Ocean and Fishery Sciences, University of Washington, Campus Box 355020,
Seattle, WA 98195-5020, USA.
3
National Marine Fisheries Service, Alaska
Fisheries Science Center, 7600 Sand Point Way NE, Seattle, WA 98115, USA.
4
Collection Center, National Museum of Nature and Science, 3-23-1
Hyakunincho, Shinjuku-ku, Tokyo 169-0073, Japan.
5
Department of
Organismic and Evolutionary Biology, Museum of Comparative Zoology,
Harvard University, 26 Oxford Street, Cambridge, MA 02138, USA.
6
Institute of
Marine Biology, National Taiwan Ocean University, 2 Peining Road, Keelung
202, Taiwan.
7
Laboratory of Marine Biodiversity, Graduate School of Fisheries
Sciences, Hokkaido University, 3-1-1 Minato-cho, Hakodate, Hokkaido 041-
8611, Japan.
8
Ocean Research Institute, The University of Tokyo, 1-15-1
Minamidai, Nakano-ku, Tokyo 164-8689, Japan.
Authors’contributions
MM, TWP and MN designed this study. MM, TWP, TPS, HCH, MS and MY
mainly collected the specimens. MM and TPS carried out the molecular work
and analyzed the data. MM drafted the original manuscript and TWP, JWO,
RJA, AMS, HCH, MS, and MY contributed to its improvement. All authors
read and approved the final manuscript.
Received: 30 August 2009
Accepted: 23 February 2010 Published: 23 February 2010
References
1. Pietsch TW: Lophiiformes: development and relationships. Ontogeny and
systematics of fishes Lawrence, Kansas: American Society of Ichthyologists
and HerpetologistsMoser HG, Richards WJ, Cohen DE, Fahay MP, Kendall
MPJ, Richardson SL 1984, 320-325, vol. Special Publication 1.
2. Pietsch TW: Oceanic anglerfishes: extraordinary diversity in the deep sea.
Berkeley, California: University of California Press 2009.
3. Pietsch TW, Grobecker DB: Frogfishes of the world: systematics,
zoogeography, and behavioral ecology. Stanford, California: Stanford
University Press 1987.
4. Pietsch TW: Dimorphism, parasitism, and sex revisited: modes of
reproduction among deep-sea ceratioid anglerfishes (Teleostei:
Lophiiformes). Ichthyological Research 2005, 52:207-236.
5. Gregory WK: Fish skulls: A study of the evolution of natural mechanisms.
Transactions of American Philosophical Society 1933, 23:75-481.
6. Regan CT: The classification of the teleostean fishes of the order
Pediculati. Annals and Magazine of Natural History, Series 1912, 8:277-289.
7. Rosen DE, Patterson C: The structure and relationships of the
paracanthopterygian fishes. Bulletin of the American Museum of Natural
History 1969, 141:359-474.
8. Greenwood PH, Rosen DE, Weitzman SH, Myers GS: Phyletic studies of
teleostean fishes, with a provisional classification of living forms. Bulletin
of the American Museum of Natural History 1966, 131:339-456.
9. Hennig W: Phylogenetic systematics. Urbana, IL: University of Illinois Press
1966.
10. Patterson C, Rosen DE: The Paracanthopterygii revisited: order and
disorder. Papers on the systematics of gadiform fishes Los Angeles, California:
Natural History Museum of Los Angeles CountyCohen DM 1989, 32:5-36.
11. Helfman GS, Collette BB, Facey DE: The diversity of fishes. Massachusetts:
Blackwell Publishing 1997.
12. Helfman GS, Collette BB, Facey DE, Bowen BW: The diversity of fishes:
biology, evolution and ecology. West Sussex, UK: John Wiley & Sons, 2
2009.
13. Nakabo T: Fishes of Japan with pictorial keys to the species. Tokyo: Tokai
University Press, 2 2000.
14. Nelson JS: Fishes of the world. Hoboken, New Jersey: John Wiley & Sons, 4
2006.
15. Nelson JS: Fishes of the World. New York: John Wiley & Sons, 3 1994.
16. Rosen DE: An essay on euteleostean classification. American Museum
Novitates 1985, 2827:1-57.
17. Chen WJ, Bonillo C, Lecointre G: Repeatability of clades as a criterion of
reliability: a case study for molecular phylogeny of Acanthomorpha
(Teleostei) with larger number of taxa. Molecular Phylogenetics and
Evolution 2003, 26:262-288.
18. Dettai A, Bailly N, Vignes-Lebbe R, Lecointre G: Metacanthomorpha: essay
on a phylogeny-oriented database for morphology–the acanthomorph
(Teleostei) example. Systematic Biology 2004, 53:822-834.
19. Dettai A, Lecointre G: Further support for the clades obtained by multiple
molecular phylogenies in the acanthomorph bush. Comptes Rendus
Biologies 2005, 328:674-689.
20. Holcroft NI: A molecular test of alternative hypotheses of
tetraodontiform (Acanthomorpha: Tetraodontiformes) sister group
relationships using data from the RAG1 gene. Molecular Phylogenetics and
Evolution 2004, 32:749-760.
21. Holcroft NI: A molecular analysis of the interrelationships of
tetraodontiform fishes (Acanthomorpha: Tetraodontiformes). Molecular
Phylogenetics and Evolution 2005, 34:525-544.
22. Li B, Dettaï A, Cruaud C, Couloux A, Desoutter-Meniger M, Lecointre G:
RNF213, a new nuclear marker for acanthomorph phylogeny. Molecular
Phylogenetics and Evolution 2009, 50:345-363.
23. Li C, Lu G, Orti G: Optimal data partitioning and a test case for ray-finned
fishes (Actinopterygii) based on ten nuclear loci. Systematic Biology 2008,
57:519-539.
24. Miya M, Holcroft NI, Satoh TP, Yamaguchi M, Nishida M, Wiley EO:
Mitochondrial genome and a nuclear gene indicate a novel
phylogenetic position of deep-sea tube-eye fish (Stylephoridae).
Ichthyological Research 2007, 54:323-332.
25. Miya M, Satoh TP, Nishida M: The phylogenetic position of toadfishes
(order Batrachoidiformes) in the higher ray-finned fish as inferred from
partitioned Bayesian analysis of 102 whole mitochondrial genome
sequences. Biological Journal of the Linnean Society 2005, 85:289-306.
26. Miya M, Takeshima H, Endo H, Ishiguro NB, Inoue JG, Mukai T, Satoh TP,
Yamaguchi M, Kawaguchi A, Mabuchi K, Shirai SM, Nishida M: Major
patterns of higher teleostean phylogenies: a new perspective based on
100 complete mitochondrial DNA sequences. Molecular Phylogenetics and
Evolution 2003, 26:121-138.
27. Yamanoue Y, Miya M, Matsuura K, Yagishita N, Mabuchi K, Sakai H, Katoh M,
Nishida M: Phylogenetic position of tetraodontiform fishes within the
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 25 of 27

higher teleosts: Bayesian inferences based on 44 whole mitochondrial
genome sequences. Molecular Phylogenetics and Evolution 2007, 45:89-101.
28. Pietsch TW: The osteology and relationships of the anglerfish genus
Tetrabrachium, with comments on lophiiform classification. Fishery
Bulletin 1981, 79:387-419.
29. Shedlock AM, Pietsch TW, Haygood MG, Bentzen P, Hasegawa M: Molecular
systematics and life history evolution of anglerfishes (Teleostei:
Lophiiformes): Evidence from mitochondrial DNA. Steenstrupia 2004,
28:129-144.
30. Caruso JH: The systematics and distribution of the lophiid anglerfishes:
III. Intergeneric relationships. Copeia 1985, 1985:870-875.
31. Endo H, Shinohara G: A new batfish, Coelophrys bradburyae
(Lophiiformes: Ogcocephalidae) from Japan, with comments on the
evolutionary relationships of the genus. Ichthyological Research 1999,
46:359-365.
32. Bertelsen E: Ceratioidei: Development and relationships. Ontogeny and
systematics of fishes Lawrence, Kansas: American Society of Ichthyologists
and HerpetologistsMoser HG, Richards WJ, Cohen DE, Fahay MP, Kendall
MPJ, Richardson SL 1984, 325-334, vol. Special Publication 1.
33. Pietsch TW, Orr JW: Phylogenetic relationships of deep-sea anglerfishes
of the suborder Ceratioidei (Teleostei: Lophiiformes) based on
morphology. Copeia 2007, 2007:1-34.
34. Carnevale G, Pietsch TW: Filling the gap: a fossil frogfish, genus
Antennarius (Teleostei, Lophiiformes, Antennariidae), from the Miocene
of Algeria. Journal of Zoology 2006, 270:448-457.
35. Carnevale G, Pietsch TW: The deep-sea anglerfish genus Acentrophryne
(Teleostei, Ceratioidei, Linophrynidae) in the Miocene of California.
Journal of Vertebrate Paleontology 2009, 29:372-378.
36. Carnevale G, Pietsch TW: An Eocene frogfish from Monte Bolca, Italy: The
earliest known skeletal record for the family. Palaeontology 2009, 52:745-752.
37. Carnevale G, Pietsch TW: Eocene handfishes from Monte Bolca, with
description of a new genus and species, and a phylogeny of the family
Brachionichthyidae (Teleostei: Lophiiformes). Zoological Journal of the
Linnean Society 2009.
38. Carnevale G, Pietsch TW, Takeuchi GT, Huddleston RW: Fossil ceratioid
anglerfishes (Teleostei: Lophiiformes) from the Miocene of the Los
Angeles Basin, California. Journal of Paleontology 2008, 82:996-1008.
39. Yang Z: Computational molecular evolution. New York: Oxford University
Press, USA 2006.
40. Azuma Y, Kumazawa Y, Miya M, Mabuchi K, Nishida M: Mitogenomic
evaluation of the historical biogeography of cichlids toward reliable
dating of teleostean divergences. BMC Evolutionary Biology 2008, 8:215.
41. Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics 2006,
22:2688-2690.
42. Cheng S, Higuchi R, Stoneking M: Complete mitochondrial genome
amplification. Nature Genetics 1994, 7:350-351.
43. Inoue JG, Miya M, Tsukamoto K, Nishida M: Complete mitochondrial DNA
sequence of the Japanese sardine Sardinops melanostictus.Fisheries
Science 2000, 66:924-932.
44. Inoue JG, Miya M, Tsukamoto K, Nishida M: Complete mitochondrial DNA
sequence of the Japanese anchovy Engraulis japonicus.Fisheries Science
2001, 67:828-835.
45. Ishiguro N, Miya M, Nishida M: Complete mitochondrial DNA sequence of
ayu Plecoglossus altivelis.Fisheries Science 2001, 67:474-481.
46. Kawaguchi A, Miya M, Nishida M: Complete mitochondrial DNA sequence
of Aulopus japonicus (Teleostei: Aulopiformes), a basal Eurypterygii:
longer DNA sequences and higher-level relationships. Ichthyological
Research 2001, 48:213-223.
47. Miya M, Nishida M: Organization of the mitochondrial genome of a
deep-sea fish, Gonostoma gracile (Teleostei: Stomiiformes): first example
of transfer RNA gene rearrangements in bony fishes. Marine
Biotechnology 1999, 1:416-426.
48. Löytynoja A, Milinkovitch MC: A hidden Markov model for progressive
multiple alignment. Bioinformatics 2003, 19:1505-1513.
49. Katoh K, Toh H: Recent developments in the MAFFT multiple sequence
alignment program. Briefings in Bioinformatics 2008, 9:286-298.
50. Maddison DR, Maddison WP: MacClade Version 4. Sunderland,
Massachusetts: Sinauer Associates 2003.
51. Phillips MJ, Penny D: The root of the mammalian tree inferred from
whole mitochondrial genomes. Molecular Phylogenetics and Evolution 2003,
28:171-185.
52. Saitoh K, Sado T, Mayden RL, Hanzawa N, Nakamura K, Nishida M, Miya M:
Mitogenomic evolution and interrelationships of the Cypriniformes
(Actinopterygii: Ostariophysi): the first evidence toward resolution of
higher-level relationships of the world’s largest freshwater fish clade
based on 59 whole mitogenome sequences. Journal of Molecular
Evolution 2006, 63:826-841.
53. Miya M, Nishida M: Use of mitogenomic information in teleostean
molecular phylogenetics: a tree-based exploration under the maximum-
parsimony optimality criterion. Molecular Phylogenetics and Evolution 2000,
17:437-455.
54. Shimodaira H: An approximately unbiased test of phylogenetic tree
selection. Systematic Biology 2002, 51:492-508.
55. Shimodaira H, Hasegawa M: CONSEL: for assessing the confidence of
phylogenetic tree selection. Bioinformatics 2001, 17:1246-1247.
56. Maddison WP, Maddison DR: Mesquite: a modular system for
evolutionary analysis. Version 2.71. 2009http://mesquiteproject.org.
57. Pagel M: The maximum likelihood approach to reconstructing ancestral
character states of discrete characters on phylogenies. Systematic Biology
1999, 48:612-622.
58. Schluter D, Price T, Mooers AO, Ludwig D: Likelihood of ancestor states in
adaptive radiation. Evolution 1997, 51:1699-1711.
59. Lewis PO: A likelihood approach to estimating phylogeny from discrete
morphological character data. Systematic Biology 2001, 50:913-925.
60. Benton MJ, Ayala FJ: Dating the tree of life. Science 2003, 300:1698-1700.
61. Linder HP, Hardy CR, Rutschmann F: Taxon sampling effects in molecular
clock dating: an example from the African Restionaceae. Molecular
Phylogenetics and Evolution 2005, 35:569-582.
62. Yoder AD, Yang Z: Divergence dates for Malagasy lemurs estimated from
multiple gene loci: geological and evolutionary context. Molecular
Ecology 2004, 13:757-773.
63. Thorne JL, Kishino H: Divergence time and evolutionary rate estimation
with multilocus data. Systematic Biology 2002, 51:689-702.
64. Magallónn S, Sanderson MJ: Absolute diversification rates in angiosperm
clades. Evolution 2001, 55:1762-1780.
65. Holcroft NI, Wiley EO: Acanthuroid relationships revisited: a new nuclear
gene-based analysis that incorporates tetraodontiform representatives.
Ichthyological Research 2008, 55:274-283.
66. Ballard JW, Whitlock MC: The incomplete natural history of mitochondria.
Molecular Ecology 2004, 13:729-744.
67. Ballard JWO, Chernoff B, James AC: Divergence of mitochondrial DNA is
not corroborated by nuclear DNA, morphology, or behavior in
Drosophila simulans.Evolution 2002, 56:527-545.
68. Cameron SL, Miller KB, D’Haese CA, Whiting MF, Barker SC: Mitochondrial
genome data alone are not enough to unambiguously resolve the
relationships of Entognatha, Insecta and Crustacea sensu lato
(Arthropoda). Cladistics 2004, 20:534-557.
69. Leache AD, McGuire JA: Phylogenetic relationships of horned lizards
(Phrynosoma) based on nuclear and mitochondrial data: Evidence for a
misleading mitochondrial gene tree. Molecular Phylogenetics and Evolution
2006, 39:628-644.
70. Springer MS, DeBry RW, Douady C, Amrine HM, Madsen O, de Jong WW,
Stanhope MJ: Mitochondrial versus nuclear gene sequences in deep-
level mammalian phylogeny reconstruction. Molecular Biology and
Evolution 2001, 18:132-143.
71. Boore JL: Animal mitochondrial genomes. Nucleic Acids Research 1999,
27:1767-1780.
72. Mindell DP, Sorenson MD, Dimcheff DE: Multiple independent origins of
mitochondrial gene order in birds. Proceedings of the National Academy of
Sciences 1998, 95:10693-10697.
73. Inoue JG, Miya M, Tsukamoto K, Nishida M: Complete mitochondrial DNA
sequence of Conger myriaster (Teleostei: Anguilliformes): novel gene order
for vertebrate mitochondrial genomes and the phylogenetic implications
for anguilliform families. Journal of Molecular Evolution 2001, 52:311-320.
74. Satoh TP, Miya M, Endo H, Nishida M: Round and pointed-head grenadier
fishes (Actinopterygii: Gadiformes) represent a single sister group:
evidence from the complete mitochondrial genome sequences.
Molecular Phylogenetics and Evolution 2006, 40:129-138.
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 26 of 27

75. Kawahara R, Miya M, Mabuchi K, Lavoue S, Inoue JG, Satoh TP,
Kawaguchi A, Nishida M: Interrelationships of the 11 gasterosteiform
families (sticklebacks, pipefishes, and their relatives): A new perspective
based on whole mitogenome sequences from 75 higher teleosts.
Molecular Phylogenetics and Evolution 2007, 46:224-236.
76. Yagishita N, Miya M, Yamanoue Y, Shirai SM, Nakayama K, Suzuki N,
Satoh TP, Mabuchi K, Nishida M, Nakabo T: Mitogenomic evaluation of the
unique facial nerve pattern as a phylogenetic marker within the
percifom fishes (Teleostei: Percomorpha). Molecular Phylogenetics and
Evolution 2009, 53:258-266.
77. Waters JM, Saruwatari T, Kobayashi T, Oohara I, McDowall RM, Wallis GP:
Phylogenetic placement of retropinnid fishes: data set incongruence can
be reduced by using asymmetric character state transformation costs.
Systematic Biology 2002, 51:432-449.
78. Caruso JH: The systematics and distribution of the lophiid anglerfishes: I.
A revision of the genus Lophiodes with the description of two new
species. Copeia 1981, 1981:522-549.
79. Bradbury MG: The genera of batfishes (family Ogcocephalidae). Copeia
1967, 1967:399-422.
80. Bertelsen E, Struhsaker PJ: The ceratioid fishes of the genus
Thaumatichthys: Osteology, relationships, distribution, and biology.
Galathea Report 1977, 14:7-40.
81. Hedges SB, Sibley CG: Molecule versus morphology in avian evolution:
The case of the “pelecaniform”birds. Proceedings of the National Academy
of Sciences 1994, 91:9861-9865.
82. Bertelsen E: The ceratioid fishes: ontogeny, taxonomy, distribution and
biology. Dana Report 1951, 39:1-276.
83. Tyler JC, Sorbini L: New superfamily and three new families of
tetraodontiform fishes from the Upper Cretaceous: the earliest and most
morphologically primitive plectognaths. Smithsonian Contributions to
Paleontology 1996, 82:1-59.
84. Setiamarga DHE, Miya M, Yamanoue Y, Azuma Y, Inoue JG, Ishiguro NB,
Mabuchi K, Nishida M: Divergence time of the two regional medaka
populations in Japan as a new time scale for comparative genomics of
vertebrates. Biology Letters 2009, 5:812-816.
85. Smith AG, Smith DG, Funnell BM: Atlas of Mesozoic and Cenozoic
coastlines. Cambridge: Cambridge University Press 1994.
86. Storey BC: The role of mantle plumes in continental breakup: case
histories from Gondwanaland. Nature 1995, 377:301-308.
87. Minegishi Y, Aoyama J, Inoue JG, Miya M, Nishida M, Tsukamoto K:
Molecular phylogeny and evolution of the freshwater eels genus
Anguilla based on the whole mitochondrial genome sequences.
Molecular Phylogenetics and Evolution 2005, 34:134-146.
88. Janvier P: Early vertebrates. Oxford: Oxford University Press 1996.
89. Zhu M, Yu X, Wang W, Zhao W, Jia L: A primitive fish provides key
characters bearing on deep osteichthyan phylogeny. Nature 2006,
441:77-80.
90. Hurley IA, Mueller RL, Dunn KA, Schmidt EJ, Friedman M, Ho RK, Prince VE,
Yang Z, Thomas MG, Coates MI: A new time-scale for ray-finned fish
evolution. Proceedings of the Royal Society B 2007, 274:489-498.
91. Patterson C: Osteichthyes: Teleostei. The Fossil Record 2 London: Chapman
& HallBenton MJ 1993, 621-656.
92. Wilson MVH, Brinkman DB, Neuman AG: Cretaceous Esocoidei (Teleostei):
early radiation of the pikes in North American fresh waters. Journal of
Paleontology 1992, 66:839-846.
93. Benton MJ, Donoghue PC: Paleontological evidence to date the tree of
life. Molecular Biology and Evolution 2007, 24:26-53.
94. Masters JC, de Wit MJ, Asher RJ: Reconciling the origins of Africa, India
and Madagascar with vertebrate dispersal scenarios. Folia Primatologica
2006, 77:399-418.
95. Blot J: La faune ichthyologique des gisements du Monte Bolca (Province
de Vérone, Italie). Bulletin Muséum national d’Histoire naturelle Paris (4)
1980, 2:339-396.
doi:10.1186/1471-2148-10-58
Cite this article as: Miya et al.: Evolutionary history of anglerfishes
(Teleostei: Lophiiformes): a mitogenomic perspective. BMC Evolutionary
Biology 2010 10:58.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Miya et al.BMC Evolutionary Biology 2010, 10:58
http://www.biomedcentral.com/1471-2148/10/58
Page 27 of 27