Content uploaded by William D Andrews
Author content
All content in this area was uploaded by William D Andrews on May 03, 2018
Content may be subject to copyright.
Differential Gene Expression in Migrating Cortical
Interneurons During Mouse Forebrain Development
Clare Faux,
1
Sonja Rakic,
1
William Andrews,
1
Yuchio Yanagawa,
2
Kunihiko Obata,
3
and John G. Parnavelas
1
*
1
Department of Cell and Developmental Biology, University College London, London WC1E 6BT, United Kingdom
2
Department of Genetics and Behavioural Neuroscience, Gunma University Graduate School of Medicine, Maebashi 371-8511, Japan
3
Neuronal Circuit Mechanisms Research Group, RIKEN Brain Science Institute, Wako 351-0198 Japan
ABSTRACT
␥-Aminobutyric acid (GABA)ergic interneurons play a vital
role in modulating the activity of the cerebral cortex, and
disruptions to their function have been linked to neurolog-
ical disorders such as schizophrenia and epilepsy. These
cells originate in the ganglionic eminences (GE) of the ven-
tral telencephalon and undergo tangential migration to en-
ter the cortex. Currently, little is known about the signaling
mechanisms that regulate interneuron migration. We
therefore performed a microarray analysis comparing the
changes in gene expression between the GABAergic inter-
neurons that are actively migrating into the cortex with
those in the GE. We were able to isolate pure populations
of GABAergic cells by fluorescence-activated cell sorting of
cortex and GE from embryonic brains of glutamate decar-
boxylase 67 (GAD67)-green fluorescent protein (GFP)
transgenic mice. Our microarray analysis identified a num-
ber of novel genes that were upregulated in migrating cor-
tical interneurons at both E13.5 and E15.5. Many of these
genes have previously been shown to play a role in cell
migration of both neuronal and non-neuronal cell types. In
addition, several of the genes identified are involved in the
regulation of migratory processes, such as neurite out-
growth, cell adhesion, and remodeling of the actin cy-
toskeleton and microtubule network. Moreover, quantita-
tive polymerase chain reaction and in situ hybridization
analyses confirmed that the expression of some of these
genes is restricted to cortical interneurons. These data
therefore provide a framework for future studies aimed at
elucidating the complexities of interneuron migration and,
in turn, may reveal important genes that are related to the
development of specific neurological disorders. J. Comp.
Neurol. 518:1232–1248, 2010.
©2009 Wiley-Liss, Inc.
INDEXING TERMS: microarray; GAD67-GFP; fluorescence-activated cell sorting (FACS); neurite outgrowth
Interneurons, comprising approximately 20% of the total
cortical neuron population in the adult, regulate the activity of
excitatory projection neurons by utilizing the inhibitory neu-
rotransmitter ␥-aminobutyric acid (GABA). Clinical and exper-
imental evidence indicates that alterations to the number,
distribution, and function of the cortical interneuron popula-
tion can contribute to various neurological disorders, includ-
ing epilepsy and schizophrenia (Benes and Berretta, 2001;
Cossart et al., 2005). During development, these cells arise in
the ganglionic eminence (GE) in the ventral telencephalon,
and migrate tangentially into the cortex along well-defined
streams (Corbin et al., 2001; Marin and Rubenstein, 2003;
Metin et al., 2006; Nakajima, 2007). At the start of cortico-
genesis, they enter the neocortex at the level of the preplate
layer (PPL) and intermediate zone (IZ). With the formation of
the cortical plate (CP), interneurons are found migrating in the
marginal zone (MZ), subplate (SP), and subventricular zone
(SVZ), whereas at slightly later stages of development they
display complex intracortical movement as they move into
the CP in search of their correct layer (Nadarajah et al., 2002;
Ang et al., 2003; Pla et al., 2006; Tanaka et al., 2006).
The mode of migration used by interneurons is similar to
that of other migrating cells, whereby they initially extend
a leading process in the direction of migration, which is
followed by nuclear translocation and the retraction of the
trailing process (Marin et al., 2006; Metin et al., 2006).
However, unlike other neuronal subtypes, their movement
is highly dynamic, often showing branching and changes in
orientation of the leading process, migration in all direc-
tions within the streams, and the use of different cellular
Additional Supporting Information may be found in the online version
of this article.
Grant sponsor: the Wellcome Trust; Grant number: 074549 (to J.G.P);
Grant sponsor: MEXT, Grant-in-Aid for Science, Japan (to Y.Y).
*CORRESPONDENCE TO: John G. Parnavelas, Department of Cell and
Developmental Biology, University College London, Gower Street, Lon-
don WC1E 6BT, UK. E-mail: j.parnavelas@ucl.ac.uk
Received 27 May 2009; Revised 17 July 2009; Accepted 29 October 2009
DOI 10.1002/cne.22271
Published online November 20, 2009 in Wiley InterScience (www.interscience.
wiley.com).
©2009 Wiley-Liss, Inc.
RESEARCH ARTICLE
1232 The Journal of Comparative Neurology
円
Research in Systems Neuroscience 518:1232–1248 (2010)
substrates through direct contact with multiple cell types
(Nadarajah et al., 2002; Polleux et al., 2002; Metin et al.,
2006; Tanaka et al., 2006, 2009; Rakic et al., 2009; Martini
et al., 2009).
To date, various signaling systems, as well as guidance
molecules and their receptors have been shown to influ-
ence interneuron migration. These include the Slit/Robo
(Andrews et al., 2006, 2008), Neuregulin/ErbB4 (Flames
et al., 2004), and Semaphorin/Neuropilin (Marin et al.,
2001) signaling pathways. Furthermore, the growth fac-
tors brain-derived neurophic factor (BDNF) and NT4 stim-
ulate tangential interneuron migration via the TrkB recep-
tor (Polleux et al., 2002), whereas signaling via the
chemokine receptor CXCR4 influences the movement of
the cells into the CP (Li et al., 2008; Lopez-Bendito et al.,
2008). In addition, transcription factors, such as Lhx6 and
Arx, are required for their migration from the GE into the
cortex (Alifragis et al., 2004; Friocourt et al., 2008). Nev-
ertheless, given the multifaceted modes of interneuron
movement and their complex migratory routes, it is highly
likely that other signaling mechanisms are also employed.
Here, we sought to identify novel genes involved in the
process of migration by comparing the gene expression
profiles of interneurons that are actively migrating into the
cortex with cells of the GE. We were able to isolate popu-
lations of cortical interneurons by taking advantage of the
glutamate decarboxylase 67 (GAD67)-green fluorescent
protein (GFP) transgenic mouse line (Tamamaki et al.,
2003). We performed fluorescence-activated cell sorting
(FACS) to purify cells from the two forebrain regions, cor-
tex and GE, at two developmental ages, E13.5 and E15.5,
when the majority of interneurons are undergoing tangen-
tial migration into the cortex. Subsequent microarray anal-
ysis revealed a large number of genes that are differentially
expressed between the two cell populations, including cell
surface proteins, ion transport molecules, and regulators
of intracellular signaling pathways. In particular, our stud-
ies have focused on genes that are upregulated in migrat-
ing cortical interneurons. To explore the potential role of
some of these genes more closely, we have examined their
expression patterns in the developing forebrain by in situ
hybridization. Our results support a role for a number of
new candidate molecules in the process of migration and
incorporation of interneurons into the cortical mantle.
MATERIALS AND METHODS
Embryonic dissection and fluorescence-
activated cell sorting
All experimental procedures were performed in accor-
dance with the UK Animals (Scientific Procedures) Act
1986 and institutional guidelines. GAD67-GFP (⌬neo)
mice (Tamamaki et al., 2003) were maintained in a C57/
BL6J background. The day the vaginal plug was found was
considered as embryonic day (E) 0.5. Timed pregnant
dams were sacrificed at E13.5, E15.5 (for FACS sorting
and in situ hybridization), and E18.5 (for in situ hybridiza-
tion). Embryonic brains were dissected in cold artificial
cerebral spinal fluid. The forebrain was isolated and the
meninges, olfactory bulb, and septum were removed. The
cortex and GE were separated and the (presumptive) hip-
pocampus was removed from the cortex. Cortex and GE
cells were dissociated by incubation in 0.05% trypsin with
100 g/ml DNase I in neurobasal medium (Invitrogen,
Paisley, UK) at 37°C for 15 minutes. Trypsinization was
quenched by addition of neurobasal medium containing
10% heat-inactivated fetal bovine serum (FBS; Invitrogen)
at 37°C for 5 minutes. Cells were washed 3 times in neu-
robasal medium (without FBS) to remove serum before
FACS, and resuspended in neurobasal medium without
phenol red (Invitrogen) containing L-glutamine (Invitrogen)
and B-27 supplement (1:50; Invitrogen).
Dissociated cells from 8 –10 embryos were pooled for
each FACS. Multiple sorts (E13.5, n ⫽3; E15.5, n ⫽2)
were performed on separate days to obtain RNA for indi-
vidual microarray chips. FACS was performed by the Wolf-
son Scientific Support Services (UCL, London, UK) by us-
ing a MoFlo Sorter (Dako, Copenhagen, Denmark). A non-
green embryo was used as a control for fluorescence. Cells
were excited by using a 488-nm Argon laser and detected
by using a 530/40 (FL1) bandpass filter. A cell purity of
95–98.5% was obtained for each sort.
RNA isolation, microarray hybridization, and
analysis
Total RNA from GFP-positive FACS-purified cells iso-
lated from the cortex and GE was extracted immediately
after collection by using the Qiagen RNeasy Plus kit (Qia-
gen, Chatsworth, CA). RNA was sent to the Institute of
Child Health Microarray Facility (UCL Genomics, http://
www.genomics.ucl.ac.uk/platforms/affymetrix.htm) for
cDNA production, hybridization, and scanning. The quality
of the RNA was assessed by using an Agilent bioanalyzer
nanochip (Agilent, Palo Alto, CA). All RNA had 18S and 28S
ribosomal RNA bands. RNA (100 ng per chip) was con-
verted to single-strand, sense strand cDNA by using the
Affymetrix Sense target labeling protocol and the Mouse
Gene 1.0_ST Array kit (Affymetrix High Wycombe, UK).
After fragmenting and end labeling, the cDNA were hybrid-
ized to Mouse Gene Gene-1_0-st-v1 Array’s (Affymetrix) at
45°C for 16 hours according to the manufacturer’s in-
structions. The arrays were then washed and stained on
the Fluidics station 450 (Affymetrix) by using the hybrid-
ization, wash, and stain kits and scanned on the GeneChip
Scanner 3000.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1233
Analysis of microarray data was performed at the
Bloomsbury Centre for Bioinformatics, Department of
Computer Science (UCL). Raw data were summarized and
normalized by using the RMA algorithm (Irizarry et al.,
2003) implemented in the Affymetrix Expression Console
software. LIMMA (Linear Models for Microarray Analysis)
(Smyth, 2004) was used to identify differentially expressed
genes. LIMMA applies a modified t-test to each probe set,
which uses an empirical Bayes approach for estimating
sample variances. The moderated t-statistic calculated by
LIMMA is more robust than the ordinary t-statistic with
small sample sizes. The Pvalues were corrected for multi-
ple testing by using the Benjamini-Hochberg correction,
and a corrected Pvalue threshold of 0.01, together with a
fold cut-off of greater than 2, was used to select differen-
tially expressed genes.
Quantitative PCR validation
For validation of the differentially expressed genes,
quantitative PCR (qPCR) was performed on 10 genes. Em-
bryonic dissection, FACS, and RNA extraction were per-
formed as previously described, and RNA was treated by
using DNase I (Amplification grade; Invitrogen) to remove
any remaining trace amounts of DNA. cDNA was gener-
ated with 20 ng of RNA by using the Qiagen Whole Tran-
scriptome Amplification Kit as described in the manufac-
turer’s protocol. Primers for qPCR were designed by
SigmaGenosys (Sigma-Aldrich, Poole, UK) and are as fol-
lows:
Gapdh (forward ATGACATCAAGAAGGTGGTG; reverse
CATACCAGGAAATGAGCTTG)
Hprt (forward GTTGGATACAGGCCAGACTTTGTTG; re-
verse GAGGGTAGGCTGGCCTATAGGCT)
Cacng2 (forward CAGCAAGAAGAACGAGGAAG; reverse
AAGCAGGATCACACTCAGG)
CHL1 (forward CCACTCTCCGTTCAACAG; reverse
GGCTTATCGTCCTTAGTCC)
Cxcr4 (forward TCATCTACACTGTCAACCTCTAC; reverse
GGTGGCGTGGACAATAGC)
Dact1 (forward TCTGAGGAATGGAAGTGTG; reverse
GTCTGTCTTTGAGTCTTTGG)
Gria4 (forward AGGGAGAGGAGCAAAGAAG; reverse CT-
GGTGTTATGAAGAAAGATAGC)
Lhx6 (forward GCCGCATCCATTACGACACC; reverse TG-
GCTGGCTTGGGCTGAC)
Maf (forward CGTCCTGGAGTCGGAGAAGAAC; reverse
TTCGGGAGAGGAAGGGTTGTCG)
RPTP
␦
(forward CCGCTGTCGCTGCTCCTC; reverse
TCTCTGGTTGCTGACTTTCTTTCC)
RPTP
(forward TGACCAAACCGACCTCTG; reverse
GCGTTACTCTTGCTGGATAC)
RPTP
(forward CGGGTCCTTGCTCATCCATGC; reverse
CGGGTGACCATGAGGGCTGTG).
The qPCR reaction was performed by using Sybr Green
reagent (Sigma, Poole, UK) on a Chromo4 PTC-200 Real-
Time PCR Detector system (Bio-Rad, Hercules, CA). PCR
conditions were 94°C for 2 minutes, followed by 40 three-
step cycles of 94°C for 15 seconds, 60°C for 30 seconds,
and 72°C for 30 seconds. Gapdh and Hprt were used for
endogenous reference gene controls. Each primer set am-
plified a single PCR product of predicted size as deter-
mined by melt-curve analysis following PCR and by aga-
rose gel electrophoresis, and had approximately equal
amplification efficiencies when validated by using a serial
dilution of representative cDNA. Each qPCR was per-
formed in triplicate, and relative quantification was deter-
mined according to the delta-delta c(t) method (Livak and
Schmittgen, 2001).
In situ hybridization
In situ hybridization was performed as described previ-
ously (Pringle et al., 1996), except that digoxigenin (DIG)-
labeled probes were used. Briefly, embryonic brains were
dissected in phosphate-buffered saline (PBS; pH 7.4) and
fixed in 4% paraformaldehyde in PBS at 4°C for 4 hours
(E13.5 and E15.5) to overnight (E18.5), followed by cryo-
protection in 30% diethyl pyrocarbonate (DEPC)-treated
sucrose in PBS at 4°C overnight. Brains were frozen in
Tissue-Tek OCT (Sakura Finetek Europe, Zoeterwoude, The
Netherlands) and sectioned by using a cryostat (20 m;
Bright Instruments, Huntingdon, UK). Sections were dried
for 2 hours at room temperature before overnight incuba-
tion at 65°C in hybridization buffer (1X DEPC-treated
’Salts’ [200 mM NaCl, 5 mM EDTA, 10 mM Tris pH 7.5, 5
mM NaH
2
PO
4
䡠2H
2
O,5mMNa
2
HPO
4
); 50% deionized
formamide (Ambion, Austin, TX); 0.1 mg/ml RNAse-free
yeast tRNA (Invitrogen); 1X Denhardt’s (RNase/DNase
free; Invitrogen); 10% dextran sulfate (Sigma-Aldrich,
Poole, UK)] containing 100 –500 ng/ml DIG-labeled RNA
probes.
Probes were generated by linearization of plasmids with
appropriate enzyme and reverse transcription polymerase
to obtain antisense probes. The Lhx6 probe was previously
described (Grigoriou et al., 1998; Lavdas et al., 1999) and
corresponds to 1342 bp between the BamHI and EcoRI
restriction sites within the 3⬘UTR region, matching bp
1263–2604 of isoform 1; bp 1159-2500 of isoform 2, bp
1274 –2615 of isoform 3, and bp 1170–2511 of isoform 4.
A number of probes were obtained from the I.M.A.G.E.
Consortium (LLNL) cDNA Clones (Lennon et al., 1996)
(Geneservice, Cambridge, UK), as follows:
Astn1 (bp 5475–7157, I.M.A.G.E. Consortium clone ID:
6812101)
Dgkg (modified to bp 1–2155, I.M.A.G.E. Consortium
clone ID: 4221290)
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1234 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
Mgat5B (bp 2779 – 4277, I.M.A.G.E. Consortium clone
ID: 6813534)
RPTP
(modified to bp 471–1732, I.M.A.G.E. Consor-
tium clone ID: 30618457)
RPTP
(bp 3945– 6449, I.M.A.G.E. Consortium clone ID:
30620151).
Other probes were the gift of the following:
Dact1 (bp 62–1523, Dr. C. Andoniadou, Institute of
Child Health, UCL)
CHL1 (bp 415–2465, Professor P. Maness, University of
North Carolina, Chapel Hill, NC)
RPTP
␦
(bp 3241– 4770, Stoker laboratory, Institute of
Child Health, UCL)
TRPC4 (bp 169 – 818, Professor O. von Bohlen und Hal-
bach Laboratory, University of Heidelberg, Germany)
Wnt7A (bp 30 –3176, Professor P. Salinas, UCL).
Following hybridization, sections were washed three
times in wash solution (50% formamide, 1X SSC, 0.1%
Tween-20) at 65°C and 2 times at room temperature in 1X
MABT (20 mM maleic acid, 30 mM NaCl, 0.1% Tween-20)
before incubating in blocking solution (2% blocking reagent
[Roche Applied Science, Burgess Hill, UK], 10% normal
goat serum [Vector, Burlingame, CA] in MABT) followed by
overnight incubation in alkaline phosphatase-conjugated
anti-DIG antibody (1:1,500; Roche Applied Sciences). Ni-
tro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl
phosphate (NBT/BCIP) diluted 1:1,000 in MABT with 5%
polyvinyl alcohol (PVA) was used for the colormetric detec-
tion for 8 –20 hours at 37°C. Fast red (Roche Applied Sci-
ences) was used for fluorescent color detection of probe
by incubation in 100 mM Tris, pH 8.0, 400 mM NaCl con-
taining Fast Red for approximately 2 hours at 37°C. Fluo-
rescent in situ hybridization was followed by immunohis-
tochemical detection of GFP as described below. Sections
were mounted by using Glycergel Mounting Medium
(Dako).
Immunohistochemistry
Embryonic brains and cryosections were prepared as
previously described. Sections were blocked for 1 hour in
PBS containing 5% normal goat serum (Vector) and subse-
quently incubated with anti-calbindin antibody overnight at
room temperature or, following fluorescence in situ hybrid-
ization, using anti-GFP antibody (Table 1). Sections were
washed 3 times in PBS and incubated for 2 hours with
Alexa-Fluor-568 anti-rabbit IgG (1:200; Invitrogen) for flu-
orescent detection of calbindin labeling or Alexa-Fluor-488
anti-rabbit IgG (1:200; Invitrogen) for GFP detection. Sec-
tions were mounted in CitiFluor solution (Agar, Essex, UK)
containing 50% glycerol PBS.
The calbindin D-28 (CB) antiserum recognized a single
band of 28 kDa on Western blots of rat brain (manufactur-
er’s datasheet), and stained a pattern of cellular morphol-
ogy and distribution in the mouse developing cerebral cor-
tex that is identical with previous reports (Ang et al., 2003;
Andrews et al., 2006, Rakic et al., 2009). The GFP anti-
serum recognized the expected (27 kDa) band on western
blot of GFP-positive transgenic mouse brain (manufactur-
er’s datasheet). GFP immunohistochemistry, carried out
on wildtype mouse forebrain sections, showed no staining
except for weak autofluorescence in the choroid plexus.
Digital image capture
Photographs of in situ hybridization samples labeled by
using NBT/BCIP and anti-calbindin immunofluorescent
samples were taken by using a Leica DM microscope and
Leica DC 500 digital camera. Double-labeled samples
were photographed by using a Leica TCS SPE confocal
laser scanning microscope, and a single optical plane was
used for detection of double-labeled cells. All images were
processed by using Photoshop CS2 software (Adobe, San
Jose, CA), adjusting only brightness and contrast.
RESULTS
Isolation of GABAergic cells by fluorescence-
activated cell sorting
Examination of the forebrain of GAD67-GFP mice during
corticogenesis showed cells undergoing tangential migra-
tion in the cortex (Fig. 1A–E) as previously described
(Corbin et al., 2001; Marin and Rubenstein, 2003; Metin et
al., 2006). At E13.5, GFP-positive cells were observed pri-
marily in the PPL and IZ (Fig. 1A,C), whereas at E15.5
prominent streams of cells were observed in the MZ, SP,
and SVZ (Fig. 1B,D). At this stage (E15.5), some cells had
begun to migrate radially to enter the developing CP. By
TABLE 1.
Primary Antibodies Used in Immunohistochemistry
Antigen Immunogen
Immunoconverted
species
Antibody
clone
Manufacturer, cat. no.,
dilution
Calbindin D-28 (CB) Purified rat calbindin
D-28
Rabbit Polyclonal Swant (Bellinzona, Switzerland),
CB-38a, 1:2,000
Green fluorescent
protein (GFP)
Recombinant full-length
jellyfish protein
Rabbit Polyclonal Abcam (Cambridge, UK),
ab290, 1:6,000
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1235
Figure 1
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1236 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
E18.5, the three streams of migrating neurons were still
evident, but a much larger proportion of cells had entered
the CP (Fig. 1E). A similar pattern of migration was also
observed in sections stained with two established markers
of developing interneurons, calbindin (Fig. 1F–H) (Ander-
son et al., 1997; Ang et al., 2003) and Lhx6 (Fig. 1I–K)
(Alifragis et al., 2004).
FACS was used to isolate GAD67-GFP-positive cells
from dissected cortex and GE at E13.5 and E15.5 (Fig.
1C,D, dotted line). In the cortex at E13.5, approximately 2%
of the cells were GFP positive, whereas at E15.5 this num-
ber had increased to approximately 7.5% (data not shown).
In the GE, approximately 30% of the cells collected were
GFP positive at both E13.5 and E15.5.
Microarray analysis and validation
In order to identify novel genes involved in cortical inter-
neuron migration, we performed a microarray analysis on
purified GAD67-GFP cells, comparing the gene expression
in cortical interneurons with that of cells isolated from the
GE. Genes were considered to be differentially expressed if
a greater than twofold change in expression was found,
together with a corrected Pvalue threshold of 0.01. The
number of genes upregulated in the cortical interneurons
at E13.5 was 129 and at E15.5 it was 189, whereas in the
GE, 276 and 388 genes were upregulated at E13.5 and
E15.5, respectively. To examine the overall changes in ex-
pression more closely, genes were classified into six cate-
gories according to their molecular function (Fig. 2). A
comparison of the proportion of genes in each category
showed no substantial changes between the two develop-
mental ages. We therefore decided to combine data sets
and examine only those genes that were differentially ex-
pressed at both E13.5 and E15.5. In cortical interneurons,
88 genes were upregulated at both ages, whereas in GE purified cells 176 genes were upregulated at both E13.5
and E15.5.
As an initial validation of our microarray data, we exam-
ined changes in expression of genes known to play a role in
interneuron migration, such as Cxcr4, ErbB4, and Lhx6
(Alifragis et al., 2004; Flames et al., 2004; Li et al., 2008;
Lopez-Bendito et al., 2008). Each of these genes was ex-
pressed at higher levels in the cortical interneuron popu-
lation compared with the GE (Supplementary Tables 1 and
3). In contrast, but as expected, genes such as Nkx2.1,
which is responsible for MGE development (Sussel et al.,
1999) and Isl1 and Er81, which are involved in striatal and
olfactory bulb neuron differentiation, respectively (Sten-
man et al., 2003), were found to be highly enriched in the
GE purified cells (Supplementary Table 3). Interestingly, no
significant changes were observed in the expression of
mature interneuron subtype markers such as calbindin,
calretinin, and somatostatin (data not shown).
Figure 1. Tangential migration of interneurons into the cortex. A,B:
Schematic diagrams depicting the streams of migrating interneurons
at E13.5 (A) and E15.5–E18.5 (B). Red lines show the laminar posi-
tion of each migrating interneuron stream at these ages. C–K: Coro-
nal sections of embryonic forebrain at E13.5 (C,F,I), E15.5 (D,G,J),
and E18.5 (E,H,K). C–E: Sections from GAD67-GFP transgenic mice.
Dotted lines in C and D indicate the regions of cortex and GE dis-
sected and dissociated at E13.5 and E15.5 for fluorescent activated
cell sorting (FACS). F–H: Immunohistochemical localization of inter-
neuron marker calbindin at the three ages examined, showing abun-
dant expression in the GE and in the streams of migrating cortical
interneurons. I–J: In situ hybridization on similar sections using Lhx6
antisense probes. Note the similar expression pattern of calbindin
and Lhx6 to GAD67. Cx, cortex; LGE, lateral ganglionic eminence;
MGE, medial GE; PPL, preplate layer; MZ, marginal zone; CP, cortical
plate; SP, subplate; IZ, intermediate zone; SVZ, subventricular zone;
VZ, ventricular zone. Scale bar ⫽500 m in C–K.
Figure 2. Comparison of gene expression changes observed at
E13.5 and E15.5. Genes were classified into the categories listed
according to their molecular function. A: Genes upregulated in the
cortical interneuron population. B: Genes upregulated in the GABAer-
gic ganglionic eminence (GE) cell population. No substantial differ-
ences were observed between the two ages in either the dorsal or
ventral forebrain.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1237
Our studies have focused on identifying genes that are
involved in the migration of interneurons into the cortex.
As the GE also contains subpopulations of GABAergic cells
that are destined for the olfactory bulb and striatum, we
decided to concentrate on genes with higher expression in
the cortical interneuron population. These genes are listed
in Supplementary Tables 1– 6. qPCR on a set of 10 of these
genes was subsequently used to validate the observed
changes in expression further (Table 2, Supplementary Fig.
1). At the two ages examined, all but one of these genes
(RPTP) was shown to have fold changes in the same di-
rection as the microarray. Interestingly, the fold changes
observed by qPCR for a number of these genes were higher
than that found by the array. qPCR was also performed on
cortical GAD67-GFP-negative cells to determine whether
any of these 10 genes were differentially regulated in the
interneuron compared with non-interneuron populations
in the cortex (Table 3, Supplementary Fig. 1). Interestingly,
a number of these genes were not expressed in GFP-
negative cells, including Lhx6, Gria4, Maf, RPTP, and
RPTP. In addition, the expression of the other genes ex-
amined was found to be higher in the GFP-positive inter-
neurons. Therefore, our microarray analysis, together with
the qPCR, has identified a number of genes with upregu-
lated expression levels in migrating cortical interneurons.
Identification of cell migration genes and
genes that modulate neurite outgrowth in
cortical interneurons
Many of the genes found to be upregulated in the corti-
cal interneurons have previously been shown to play a role
in cell migration, either directly or indirectly, by regulating
specific events that are essential for this process, such as
neurite outgrowth and branching. We performed in situ
hybridization for a selection of these genes to examine
their potential role in cortical interneuron migration fur-
ther.
Cell migration genes
Close Homolog of L1 (CHL1), a member of the L1 family
of cell adhesion molecules, is an important regulator of
radial migration and lamination in the developing brain
(Demyanenko et al., 2004). At E13.5, the pattern of CHL1
expression closely resembled that of tangentially migrat-
ing interneurons (Fig. 3A), with high expression in the PPL
as well as in a recognizable stream of cells in the IZ. To
confirm that these cells were migrating interneurons, we
performed double-labeling experiments using GAD67-
GFP-positive brains to label both CHL1- and GFP-
expressing cells (Supplementary Fig. 2A,B). The majority of
the GFP-positive interneurons in the MZ and IZ streams
were also CHL1 positive. In contrast, at this stage, only a
few scattered cells in the GE were found to express CHL1.
By E15.5, the expression of CHL1 had increased dramati-
cally in the CP, whereas lower levels were observed in the
IZ and SVZ of the cortex and in the differentiated area of
the ventral forebrain (Fig. 3B). The expression of CHL1 in
the IZ and SVZ was reduced by E18.5, whereas it remained
strong in the MZ, SP, and the CP, especially in its lower
two-thirds (Fig. 3C). Double labeling confirmed the expres-
sion of CHL1 in almost all interneurons in the CP and MZ at
both E15.5 and E18.5 (Supplementary Fig. 2D–I). How-
ever, CHL1 is also expressed in the non-interneuron cell
population. No expression of CHL1 was observed in the VZ
at any of the developmental ages examined.
TABLE 2.
qPCR Comparing Gene Expression in Cortical Interneurons
With GE Cells (GAD67-GFP-Positive Cells)
1
Gene
E13.5 E15.5
Microarray qPCR Microarray qPCR
Cacng2 ⫹⫹⫹⫹
Chl1 ⫹ ⫹⫹⫹ ⫹ ⫹⫹⫹
Cxcr4 ⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹⫹
Dact1 ⫹ ⫹⫹⫹ ⫹ ⫹⫹⫹
Gria4 ⫹ ⫹⫹⫹ ⫹ ⫹⫹
Lhx6 ⫹⫹⫹⫹⫹
Maf ⫹⫹ ⫹⫹⫹ ⫹ ⫹
PTPR
␦
⫹ ⫹⫹⫹ NC NC
PTPR
⫹—⫹NC
PTPR
⫹⫹ ⫹⫹⫹ ⫹ ⫹⫹⫹
1
⫹, 2-5-fold higher in cortical GAD67-GFP positive; ⫹⫹, 5-15-fold higher
in cortical GAD67-GFP positive; ⫹⫹⫹, greater than 15-fold higher in
cortical GAD67-GFP positive; -, 2-5-fold higher in GE GAD67-GFP positive;
NC, no change; qPCR, quantitative polymerase chain reaction.
TABLE 3.
qPCR Comparing Gene Expression in Cortical Interneurons
(GAD67-GFP-Positive) With Non-Interneurons
(GAD67-GFP-Negative)
1
Gene E13.5 E15.5
Cortex GFP
positive vs. GFP
negative
Cortex GFP
positive vs. GFP
negative
Cacng2 ⫹⫹⫹ ⫹⫹⫹
Chl1 ⫹⫹⫹ ⫹⫹
Cxcr4 ⫹⫹ ⫹⫹⫹
Dact1 ⫹⫹⫹ ⫹⫹⫹
Gria4 NP GFP-ve ⫹⫹⫹
Lhx6 NP GFP-ve NP GFP-ve
Maf NP GFP-ve ⫹⫹⫹
RPTP
␦
NC ⫹⫹
RPTP
NP GFP-ve NP GFP-ve
RPTP
NP GFP-ve NP GFP-ve
1
⫹, 2-5-fold higher in cortical GAD67-GFP positive; ⫹⫹, 5-15-fold higher
in cortical GAD67-GFP positive; ⫹⫹⫹, greater than 15-fold higher in
cortical GAD67-GFP positive; NC, no change; NP, not present; qPCR,
quantitative polymerase chain reaction; GAD67, glutamate decarboxyl-
ase 67; GFP, green fluorescent protein.
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1238 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
The cell surface glycoprotein Astrotactin (Astn1) has
been shown to regulate neuronal migration along glia fi-
bers (Adams et al., 2002). Similar to CHL1, Astn1 was also
highly expressed in the PPL at E13.5 (Fig. 3D), where it
co-localized with GFP expressed by the GAD67-positive
cells (Supplementary Fig. 3A–C). At this stage, its expres-
sion was lower, although relatively ubiquitous, in the rest of
the developing forebrain. At E15.5, strong expression of
Astn1 was seen in the CP as well as in the SVZ of the cortex
and GE (Fig. 3E). The expression of Astn1 was maintained
in the CP at E18.5 (Fig. 3F), and appeared upregulated in
the VZ of the cortex, but reduced in the SVZ at this age. We
again confirmed the expression of Astn1 in the interneu-
rons in the CP at both E15.5 and E18.5 by double labeling
(Supplementary Fig. 3D–I). Like Chl1, Astn1 is also ex-
pressed by the non-interneurons in the CP region and in
the VZ (data not shown).
The glycosyltransferase Mgat5b has also been shown to
regulate cell migration in vitro (Abbott et al., 2006; Lee et
al., 2006). Although it too appeared to be ubiquitously
expressed throughout forebrain development, a higher
level of expression was observed in the IZ at E13.5 and in
the SVZ at E15.5 and E18.5 (Fig. 3G–I). Double labeling
with GAD67-GFP-positive cells confirmed that the inter-
neurons in these regions expressed Mgat5B (Supplemen-
tary Fig. 4), although it is also expressed by some of the
non-interneuron population. At E18.5, Mgat5B expression
is also increased in the CP. Although each of these genes is
expressed throughout the developing cortex, their upregu-
lated expression in sites of interneuron migration may in-
dicate their importance in this process.
Neurite outgrowth genes
Neurite outgrowth is fundamental for the initiation of
neuronal migration. Our microarray results identified vari-
ous genes that are involved in modulating neurite out-
growth. Among these are three members of the receptor
protein tyrosine phosphatase (RPTP) family, RPTP,
RPTP, and RPTP␦. In situ hybridization revealed that
these genes have distinct expression patterns during fore-
brain development (Fig. 4). At E13.5, the expression of
RPTPwas predominantly ventral; however, some RPTP-
positive cells were present in the PPL and were also seen
migrating around the corticostriatal notch into the cortex
in the IZ (Fig. 4A). By E15.5, the expression of RPTPhad
increased in both GE and cortex, and was very similar to
that of migrating cortical interneurons, with expression
restricted in the three main streams of cells, namely, the
MZ, SP, and SVZ (Fig. 4B). qPCR analysis of GAD67-GFP-
negative cells from the cortex at E13.5 and E15.5 showed
that RPTPwas not expressed by these cells at this stage
(Table 3, Supplementary Fig. 1). By E18.5, the expression
of RPTPhad increased in the CP, where it appeared in
non-interneurons. The expression of RPTPwas main-
tained in the SP and SVZ at this age (Fig. 4C).
Similar to RPTP, RPTPwas found at low levels in the
E13.5 forebrain (Fig. 4D). Its expression was mainly ob-
served in developing blood vessels in both the GE and
cortex. However, a number of cells in the PPL also ex-
pressed RPTP, in addition to some that appeared to be
migrating from the GE. By E15.5, the expression of RPTP
had increased and was seen in a number of cells in the GE,
as well as in cells in the MZ and in a subpopulation scat-
tered throughout other cortical layers (Fig. 4E). Once
again, qPCR of GAD67-GFP-negative cells at E13.5 and
E15.5 showed that RPTPwas not expressed by these
cells (Table 3). The expression of RPTPwas maintained in
the MZ at E18.5 (Fig. 4F) and was present in a subset of
neurons in the lower CP. At this stage, very high levels were
also observed in the basal ganglia.
In contrast to the previous RPTP’s, a higher level of
RPTP␦expression was found from E13.5 onward (Fig. 4G–
I). At E13.5, RPTP␦expression appeared in the PPL of the
cortex and in a specific population of cells in the GE; how-
ever, its expression was strongest in the emerging CP. This
prominent expression in the CP remained at E15.5 (Fig.
4H), with lower levels found in the IZ and SVZ and in the GE.
RPTP␦expression was maintained at high levels in the
upper layers of the CP at E18.5 (Fig. 4I), whereas its ex-
pression was reduced in other zones of the developing
cortex and in the GE. The expression patterns of these
genes, particularly early in development, combined with
our microarray results, suggest a role for these proteins in
interneuron development.
The regulation of calcium concentration within cells is
also an important modulator of neurite outgrowth (Zheng
and Poo, 2007). Three different calcium channels were
upregulated in the cortical interneuron population (Supple-
mentary Table 2). We examined the expression of one of
these channels, TRPC4 (Fig. 4J–L). It was high in the sep-
tum at both E13.5 and E15.5, but extremely low in the
developing cortex, where it appeared to be expressed in a
subpopulation of cells in the VZ and SVZ (Fig. 4J,K). A small
number of cells in the SP also expressed TRPC4 at these
stages (Fig. 4K). At E18.5, the expression of TRPC4 was
upregulated in the upper layers of the developing CP (Fig.
4L).
Genes that regulate major signaling pathways
In addition to genes that directly affect cell migration or
neurite outgrowth, our microarray analysis has also iden-
tified various genes that modulate major cellular signaling
pathways, which in turn can influence cell movement. We
examined the expression of three of these genes: Dgk␥
(diacylglycerol kinase ␥), which phosphorylates diacylglyc-
erol (DAG) to regulate signaling through protein kinase C
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1239
Figure 3
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1240 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
(PKC) and the Rho/Rac signaling pathways (Sakane et al.,
2007); and Dact1 and Wnt7A, which both act via the Wnt
signaling pathway (Brott and Sokol, 2005; Ciani and Sali-
nas, 2005).
Dgk␥is expressed at low levels in the forebrain at E13.5
(Fig. 5A); however, a number of positive cells were found in
the PPL. In addition, a small subset of cells in the IZ, which
appeared to represent cells migrating from the GE into the
cortex, also expressed Dgk␥. The expression of Dgk␥in
cells that resemble those of the migrating interneuron pop-
ulation had increased by E15.5, with a prominent stream
seen in the MZ, SP, and SVZ (Fig. 5B). The expression of
this gene was maintained in the MZ until at least E18.5,
when it was also found in a subpopulation of cells in the CP
(Fig. 5C). Interestingly, Dgk␥did not appear to be ex-
pressed in the GE during the developmental stages exam-
ined.
Similarly, the expression pattern of Dact1, an intracellu-
lar regulator of Wnt signaling, was highly correlated with
that of the tangentially migrating interneurons (Fig. 5D–F).
At E13.5, its expression was found in the GE, as well as in
cells in the PPL and IZ. qPCR analysis showed that it was
not expressed by the GFP-negative cells at this stage (Ta-
ble 3). By E15.5, a more robust expression of Dact1 was
seen in the MZ, SP, and SVZ (Fig. 5E), as well as continued
expression in the GE. At E18.5, the expression of Dact1
was high in a subpopulation of cells in the CP, as well as in
the MZ and SVZ (Fig. 5F). We did not observe any expres-
sion of Dact1 in the VZ, particularly during the early stages
of development. In contrast, Wnt7A, a secreted protein
that activates Wnt signaling, was highly expressed in the
VZ at both E13.5 and E15.5 (Fig. 5G,H). A high level of
expression was also observed in the GE. Interestingly,
Wnt7A was also expressed in the PPL at E13.5, and by
E15.5 was highly expressed in the lower CP/SP region. By
E18.5, the expression of Wnt7A had decreased, although it
was still present in the VZ and in the region of the lower CP
and SP (Fig. 5I), indicating that it continues to activate Wnt
signaling in the cortex throughout forebrain development.
Taken together, our studies have identified a number of
genes that are enriched in developing interneurons and are
potentially important for their migration into the cortex.
DISCUSSION
The migratory pathways of cortical interneurons have
been well documented in recent years. These cells follow
complex routes, initially migrating tangentially from the
ventral forebrain in well-defined streams, before moving
radially to populate the CP. To date, only a few signaling
pathways and guidance molecules have been found that
directly control their migration. In the present study, we
have identified a number of novel genes that are poten-
tially involved in the migration of interneurons into the
cortex. Among these are various genes that are known to
play a role in neuronal migration, both in the cortex and in
other areas of the developing brain. In addition, our analy-
sis has found many genes that are involved in different
migratory processes, such as neurite outgrowth and guid-
ance, cell adhesion, and the regulation of the actin cy-
toskeleton and microtubule network.
In a similar microarray analysis, Marsh et al. (2008) used
expression of the transcription factors Dlx5/6 to mark
interneurons. These Dlx genes are expressed in a similar
pattern to the GABAergic cells (Zerucha et al., 2000; Stuh-
mer et al., 2002b; Batista-Brito et al., 2008), and ectopic
expression of Dlx5 has been shown to induce the expres-
sion of GAD67 (Stuhmer et al., 2002a). As expected, we
found a number of genes in common with this study, in-
cluding neurotransmitter receptors, ion channels, and syn-
aptic proteins. However, some differences were also ob-
served, and in particular our studies identified additional
genes encoding cell surface proteins (e.g., RPTP, RPTP␦,
Large) and intracellular signaling molecules (e.g., Mgat5b,
Fgd3, Dusp1). These differences may be due to the differ-
ent markers used for interneurons, especially as not all
Dlx5/6-positive cells are GABAergic and vice versa (Stuh-
mer et al., 2002b; Batista-Brito et al., 2008). Alternatively,
the use of different microarray chips may highlight differ-
ent genes. Marsh et al. (2008) also included in their anal-
ysis a third cell population, the cortical Dlx5/6-negative
cells (non-interneurons). In another study, Batista-Brito et
al. (2008) used the Dlx5/6-GFP transgenic mouse line to
compare gene expression of cortical interneurons with
non-interneurons, focusing on genes enriched in the Dlx5/
6-positive cells. These studies, in combination with the
results presented here, provide a strong basis for identify-
ing new targets of cortical interneuron development.
It is important to note that GABAergic interneurons pro-
duced in the GE are not only destined for the cortex. Sub-
populations of these interneurons also migrate to the ol-
factory bulb and developing striatum (Sussel et al., 1999;
Figure 3. Expression of genes involved in cell migration in the devel-
oping forebrain as seen by in situ hybridization. A–C: Expression of
CHL1. At E13.5 (A) note the pattern of expression in the preplate
layer (arrowheads in A) and in a stream of cells in the intermediate
zone (arrow in A) is similar to the migrating interneurons. At E15.5 (B)
and E18.5 (C) CHL1 is upregulated in the cortical plate with lower
levels of expression in the subventricular zone (arrow in B,C). D–F:
Expression of Astn1 is found throughout the developing forebrain,
but is higher in the preplate layer at E13.5 (arrowheads in D), whereas
at E15.5 (E) and E18.5 (F) Astn1 is upregulated in the cortical plate
and subventricular zone (arrow in E) and ventricular zone (open arrow
in E,F). G–I: Mgat5b is also expressed throughout the developing
forebrain, but is higher in the intermediate zone at E13.5 (arrow in G)
and subventricular zone at E15.5 and E18.5 (arrow in H,I). Scale
bar ⫽500 m in A–I.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1241
Marin et al., 2000; Wichterle et al., 2001; Marin and Ruben-
stein, 2003; Stenman et al., 2003). In addition, a large
proportion of the projection neurons present in the stria-
tum are GABAergic (Sarter and Bruno, 2002). By focusing
our studies on genes that are upregulated in the cortical
interneuron population, we sought to differentiate be-
tween genes that may be important for cortical interneu-
ron migration and genes required for the differentiation
and migration of other GABAergic cell types. Indeed, our
analysis showed that specific genes such as Isl1 and Er81,
which are involved in striatal projection neuron and olfac-
tory bulb interneuron differentiation, respectively (Sten-
man et al., 2003), are enriched in the GE GABAergic pop-
ulation.
However, given the common signaling pathways used by
many migrating neurons (Marin et al., 2006), we cannot
exclude the possibility that the cortical migration genes
identified are not also involved in migration of other
GABAergic cells. Of particular interest in our study was the
finding that there were no differences in the expression of
mature cortical interneuron subtype markers, including
calbindin, calretinin, and somatostatin. These results sug-
gest that specific interneuron subtypes are determined
either prior to their migration into the cortex (Batista-Brito
et al., 2008) or after they have settled in the CP. They also
support our hypothesis that, when compared with cells in
the GE, many of the genes upregulated in the cortical in-
terneuron population are involved in cell migration rather
than subtype differentiation.
Cell migration genes
It is becoming increasingly apparent that different types
of neurons use common molecular signals to control their
migration (Marin and Rubenstein, 2003; Marin et al.,
2006). Our microarray analysis has identified various mi-
gration genes required for the movement of other types of
neurons. Among them, three cell surface proteins, CHL1,
Astn1, and Large have been shown to be involved in the
radial migration of cells in the cortex and cerebellum
(Zheng et al., 1996; Adams et al., 2002; Holzfeind et al.,
2002; Demyanenko et al., 2004; Qu et al., 2006; Jak-
ovcevski et al., 2009). Our in situ hybridization experi-
ments, together with previous studies, have demonstrated
that Astn1 and CHL1 are highly expressed in the develop-
ing cortex (Zheng et al., 1996; Wright et al., 2007). Inter-
estingly, our qPCR analysis showed that CHL1 expression
is higher in cortical interneurons compared with non-
interneurons. Moreover, Batista-Brito et al. (2008) found
that both CHL1 and Astn1 are enriched in cortical inter-
neurons. It is likely, therefore, that these genes also regu-
late interneuron migration, either during their early tangen-
tial stage or as they move radially into the cortex. The
glycosyltransferase Mgat5B may also be involved in neu-
ron migration. Mgat5B expression is restricted to the brain
(Inamori et al., 2003) and, during development, is highly
expressed in the SVZ (Fig. 3). Mgat5B has been shown to
modulate the integrin-mediated migration of PC12 and
SY5Y neuronal cell lines (Abbott et al., 2006; Lee et al.,
2006), and may therefore prove a good candidate for fur-
ther investigation of neuronal migration in the forebrain.
In addition to different neuronal types using similar mi-
gratory mechanisms, it has been suggested that the migra-
tion signals used by non-neuronal cells may also be used
by neurons (Marin et al., 2006). With this in mind, we have
identified certain genes from our microarray analysis that
have been implicated in the migration of other cell types.
The dual specific phosphatase Dusp1 regulates phophory-
lation of mitogen-activated protein kinases (MAPKs) and
plays a critical role in endothelial cell migration following
vascular endothelial growth factor (VEGF) stimulation (Kin-
ney et al., 2008). Fgd3, a guanine nucleotide exchange
factor that activates CDC42, inhibits the migration of the
HeLa cancer cell line (Hayakawa et al., 2008), and the cell
adhesion molecule protocadherin 8 (Pcdh8) has been
shown to coordinate convergent extension cell move-
ments in Xenopus embryos (Unterseher et al., 2004). A
closer examination of these genes during forebrain devel-
opment may provide further evidence in support of the
notion that common migratory mechanisms are used by
different cell types.
Neurite outgrowth-promoting genes
Neurite outgrowth is a fundamental step in neuronal
migration. This process is directed by multiple signaling
systems, ranging from the expression of receptor proteins
and cell adhesion molecules that detect extracellular guid-
ance cues, to the activation of intracellular signaling path-
ways that control the formation of the actin cytoskeleton
allowing neurite extension or retraction. Here, we identi-
fied a number of genes with upregulated expression in
cortical interneurons that affect the outgrowth of neurites,
indicating they may also be important for their migration.
One group of genes identified in our study that modulate
neurite outgrowth belong to the RPTP family (Stoker,
2001; Ensslen-Craig and Brady-Kalnay, 2004). These re-
ceptor proteins catalyze the dephosphorylation of tyrosine
residues; however, their extracellular domain is similar to
that of the cell adhesion molecules, indicating that they
also play a role in adhesion. Two of the three RPTPs found
to be upregulated in migrating cortical interneurons,
RPTPand RPTP, are expressed primarily by these cells.
Indeed, our qPCR analysis indicated that during early fore-
brain development (up to E15.5), these genes are not ex-
pressed in the non-interneuron population. Little is known
about the cellular function of RPTP, but RPTPhas been
shown to regulate the outgrowth of neurites and the lami-
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1242 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
Figure 4. In situ hybridization expression of genes that regulate neurite outgrowth. Higher magnification of boxed regions are shown beside each low-
magnification panel. A–C: Expression of RPTP.A,Aⴕ:At E13.5, RPTPis expressed in some cells in the PPL and IZ. Dotted line in A⬘represents the boundary
between cortex and GE . B,Bⴕ:At E15.5, RPTPis expressed in interneuron streams (MZ, SP, and SVZ streams). C,Cⴕ:At E18.5 it is in SP and SVZ cells, and is
increased in the CP. D–F: Expression of RPTPis seen in blood vessels during forebrain development (arrowheads in D⬘,E⬘), but it is also observed in other
scattered cells (arrows) within the interneuron streams, namely, in the PPL at E13.5 (D⬘), and in the MZ, SP, and SVZ at E15.5 (E⬘).At E18.5, RPTPis in scattered
cells in the MZ and the lower CP (F⬘). G–I: Expression of RPTP␦is highest in the developing CP at each age examined. Note, however, the expression in IZ cells
at E13.5 (G⬘) and the higher level of expression in SVZ cells at E15.5 (H⬘).J–L: Rostral forebrain sections showing high level of expression of TRPC4 in the septum,
but low levels in the developing cortex. Note the TRPC4 expression in a subpopulation of cells in the SVZ and VZ at E15.5 (K⬘) and in the upper CP layers at E18.5
(L⬘). GE, ganglionic eminence; PPL, preplate layer; MZ, marginal zone; CP, cortical plate; SP, subplate; IZ, intermediate zone; SVZ, subventricular zone; VZ,
ventricular zone. Scale bar ⫽500 m in A–L; 100 minA⬘–L⬘.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1243
Figure 5
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1244 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
nation of neurons in the retina (Burden-Gulley et al., 2002;
Ensslen et al., 2003), suggesting that it may play a similar
role for cortical interneurons. Interestingly, RPTPis also
expressed on developing blood vessels (Koop et al., 2003).
Recent studies have indicated common pathways in the
development of neurons and blood vessels (Carmeliet and
Tessier-Lavigne, 2005). Furthermore, RPTPhas been
shown to bind homophilically to mediate cell interactions
(Brady-Kalnay et al., 1993), leading to the possibility that it
may mediate an interaction between blood vessels and
cortical interneurons during development. Further studies
of the molecular and cellular functions of RPTPin the
forebrain are required to elucidate this hypothesis.
Among the intracellular signaling molecules that regu-
late neurite outgrowth and, in turn, cell migration, are
many non-receptor kinases and phosphatases (Marin et
al., 2006; Zheng and Poo, 2007). The intracellular kinase
Dgk␥identified by our microarray presented a particularly
interesting pattern of expression in the forebrain in that it
appears to be specific to cortical interneurons. It is also
expressed highly in GABAergic cells in the cerebellum
(Goto et al., 1994). Dgk␥interacts with the Rho-GTPase
Rac1, suppressing its function and altering the actin cy-
toskeleton (Tsushima et al., 2004). However, Dgk␥also
phosphorylates the protein kinase C isoform PKC␥
(Yamaguchi et al., 2006), which regulates a vast number of
cellular processes (Larsson, 2006). The elucidation of the
specific molecular mechanisms used by Dgk␥in cortical
interneurons will prove an important part of further studies
aimed at examining its role in migration.
In addition to the specific phosphatase and kinase
genes discussed above, we found that the gene Dact1 also
exhibited a pattern of expression that closely resembled
that of the developing interneuron population. Dact1 is an
intracellular regulator of Wnt signaling (Cheyette et al.,
2002; Zhang et al., 2006), a highly complicated pathway,
involving multiple secreted ligands, numerous receptors,
and various downstream signals (Ciani and Salinas, 2005).
Several members of this pathway are expressed in the
developing forebrain (Lako et al., 1998; Kim et al., 2001;
Zhao and Pleasure, 2005; Tissir and Goffinet, 2006). Wnt
signaling also regulates a diverse range of cellular pro-
cesses during nervous system development, including pro-
liferation, tissue patterning, apoptosis, cell polarity, and
axon guidance (Ciani and Salinas, 2005; Ille and Sommer,
2005). The precise downstream regulation of Wnt signal-
ing is, therefore, essential for directing the specific pro-
cess undertaken by the cell. The higher expression of
Dact1 in migrating cortical interneurons observed here, in
agreement with the work of Marsh et al. (2008), indicates
that it may play a principal role in regulating Wnt signaling
during interneuron migration and development.
In contrast to our results, recent work by Fisher et al.
(2006) showed expression of Dact1 also in the cortical VZ.
Verification of our in situ probe sequence has confirmed
that it is specific for Dact1 and not the other Dact family
members (Dact2 and 3). However, this does not rule out
the possibility that different isoforms of Dact1 exist, which
may also regulate different Wnt signals. Although further
studies are required to examine possible Dact1 isoforms, it
seems highly likely that Dact1 generally plays an important
role in forebrain development.
Regulation of the levels of calcium ions present in a cell
also strongly influences neurite outgrowth and directional
neuron migration (Zheng and Poo, 2007). According to our
microarray data, three calcium channels may be contrib-
uting to alterations in calcium levels in migrating interneu-
rons, Cacng2, Cacnb4, and TRPC4. We examined the ex-
pression of TRPC4, which has been shown to alter axonal
regeneration of dorsal root ganglia neurons (Wu et al.,
2008), indicating that it may play a role in neurite out-
growth. Our in situ hybridization observations confirmed
previous results (Zechel et al., 2007; Wu et al., 2008)
showing that TRPC4 is expressed at very low levels in the
cortex, but at very high levels in the septum. Although the
septum contains GABAergic cells, it was removed from the
cortical tissue for our microarray and is, therefore, unlikely
to have contributed to the observed upregulation in ex-
pression. This expression of TRPC4 in the cortex suggests
that it may also be important for the development of a
specific subset of cortical neurons.
Our studies have revealed a number of novel genes that
show an expression pattern resembling that of migrating
cortical interneurons, including RPTP, RPTP, Dgk␥, and
Dact1. However, the expression of these genes does not
overlap completely with that of GAD67 or Lhx6. In fact, it
appears that fewer cells in the cortex express RPTP,
RPTP, and Dgk␥, suggesting that these genes may be
expressed by specific subpopulations of interneurons. It
Figure 5. Expression of genes that regulate major signaling path-
ways. A–C: Expression of Dgk␥. Higher power magnifications of
boxed region in the cortex are shown in A⬘–C⬘. Note the expression of
Dgk␥in the interneuron streams: in cells of the PPL and IZ at E13.5
(A,A⬘), in the MZ, SP, and SVZ at E15.5 (B,B⬘), and in the MZ and in
scattered cells in the CP at E18.5 (C,C⬘). D–F: Dact1 expression is
also observed in the interneuron streams in the developing cortex. At
E13.5 (D) expression is high in the PPL (arrowheads) and in the IZ
stream (arrow), at E15.5 (E) Dact1 is found in the MZ (arrowheads),
SP (asterisk), and SVZ (arrow) and at E18.5 in the MZ (arrowheads)
and scattered cells in the CP (open arrowheads). Note also the ex-
pression in the GE. G–I: Expression of Wnt7A is highest in the VZ
during development, but it is also expressed in the PPL at E13.5 (G,
arrowheads) and in the lower CP and SP at E15.5 (H) and E18.5 (I).
PPL, preplate layer; MZ, marginal zone; CP, cortical plate; SP, sub-
plate; IZ, intermediate zone; SVZ, subventricular zone; VZ, ventricular
zone. Scale bar ⫽500 m in A–I; 200 minA⬘–C⬘.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1245
will be important to investigate this possibility further by
co-labeling the cells expressing these genes with markers
of interneuron subpopulations, such as calbindin, calreti-
nin, somatostatin, and paravalbumin. The specificity of
these genes may, therefore, provide additional markers for
the different interneuronal subtypes.
Neurological disorders
Disturbances in cortical interneuron function have been
associated with a number of neurological disorders, in-
cluding epilepsy and schizophrenia. Increasing evidence
suggests that disruption to interneuron function may be
partially due to their improper differentiation and mis-
guided migration during development (Benes and Berretta,
2001; Lewis and Levitt, 2002; Cossart et al., 2005). It was,
therefore, interesting to find that some of the genes show-
ing increased expression in migrating interneurons are as-
sociated with various neurological conditions. Mutations in
the CHL1 and synapsin 2 (Syn2) genes have been directly
linked to schizophrenia (Sakurai et al., 2002; Saviouk et al.,
2007), and a weak link to schizophrenia has also been
shown for Pcdh8 (Bray et al., 2002). Ion channel function
has been associated with epilepsy (Meisler et al., 2001),
and we have found that a number of ion channels are
upregulated in migrating interneurons, including three that
play a direct role in epileptic seizures in mice and humans,
namely, Cacng2, Cacnb4, and the sodium channel Scn1a
(Letts et al., 1998; Escayg et al., 2000; Kearney et al.,
2006). Mutations in the Scn1a gene have also been re-
ported in familial autism (Weiss et al., 2003). As suggested
by Marsh et al. (2008) and Batista-Brito et al. (2008), the
association of these gene mutations with neurological dis-
orders may not be solely due to disrupted interneuron
function in the adult, but may also be caused by subtle
changes occurring during interneuron development.
ACKNOWLEDGMENTS
We thank Patricia Maness (CHL1), Cynthia Andoniadou
(Dact1), Andrew Stoker and Viktoria Tchetchelnitski
(RPTP␦), Sabrina Zechel and Oliver von Bohlen und Hal-
bach (TRPC4), and Patricia Salinas (Wnt7A,) for providing
in situ probes, and Cynthia Andoniadou, Valentina Massa,
Kaylene Young, and Mary Rahman for helpful discussion
and advice throughout.
LITERATURE CITED
Abbott KL, Troupe K, Lee I, Pierce M. 2006. Integrin-dependent
neuroblastoma cell adhesion and migration on laminin is reg-
ulated by expression levels of two enzymes in the
O-mannosyl-linked glycosylation pathway, PomGnT1 and
GnT-Vb. Exp Cell Res 312:2837–2850.
Adams NC, Tomoda T, Cooper M, Dietz G, Hatten ME. 2002. Mice
that lack astrotactin have slowed neuronal migration. Devel-
opment 129:965–972.
Alifragis P, Liapi A, Parnavelas JG. 2004. Lhx6 regulates the mi-
gration of cortical interneurons from the ventral telencepha-
lon but does not specify their GABA phenotype. J Neurosci
24:5643–5648.
Anderson SA, Eisenstat DD, Shi L, Rubenstein JL. 1997. Interneu-
ron migration from basal forebrain to neocortex: dependence
on Dlx genes. Science 278:474 –476.
Andrews W, Liapi A, Plachez C, Camurri L, Zhang J, Mori S, Mu-
rakami F, Parnavelas JG, Sundaresan V, Richards LJ. 2006.
Robo1 regulates the development of major axon tracts and
interneuron migration in the forebrain. Development 133:
2243–2252.
Andrews W, Barber M, Hernadez-Miranda LR, Xian J, Rakic S,
Sundaresan V, Rabbitts TH, Pannell R, Rabbitts P, Thompson
H, Erskine L, Murakami F, Parnavelas JG. 2008. The role of
Slit-Robo signaling in the generation, migration and morpho-
logical differentiation of cortical interneurons. Dev Biol 313:
648 – 658.
Ang ES Jr, Haydar TF, Gluncic V, Rakic P. 2003. Four-dimensional
migratory coordinates of GABAergic interneurons in the de-
veloping mouse cortex. J Neurosci 23:5805–5815.
Batista-Brito R, Machold R, Klein C, Fishell G. 2008. Gene expres-
sion in cortical interneuron precursors is prescient of their
mature function. Cereb Cortex 18:2306 –2317.
Benes FM, Berretta S. 2001. GABAergic interneurons: implica-
tions for understanding schizophrenia and bipolar disorder.
Neuropsychopharmacology 25:1–27.
Brady-Kalnay SM, Flint AJ, Tonks NK. 1993. Homophilic binding of
PTP mu, a receptor-type protein tyrosine phosphatase, can
mediate cell-cell aggregation. J Cell Biol 122:961–972.
Bray NJ, Kirov G, Owen RJ, Jacobsen NJ, Georgieva L, Williams HJ,
Norton N, Spurlock G, Jones S, Zammit S, O’Donovan MC,
Owen MJ. 2002. Screening the human protocadherin 8
(PCDH8) gene in schizophrenia. Genes Brain Behav 1:187–
191.
Brott BK, Sokol SY. 2005. Frodo proteins: modulators of Wnt
signaling in vertebrate development. Differentiation 73:323–
329.
Burden-Gulley SM, Ensslen SE, Brady-Kalnay SM. 2002. Protein
tyrosine phosphatase-mu differentially regulates neurite out-
growth of nasal and temporal neurons in the retina. J Neurosci
22:3615–3627.
Carmeliet P, Tessier-Lavigne M. 2005. Common mechanisms of
nerve and blood vessel wiring. Nature 436:193–200.
Cheyette BN, Waxman JS, Miller JR, Takemaru K, Sheldahl LC,
Khlebtsova N, Fox EP, Earnest T, Moon RT. 2002. Dapper, a
Dishevelled-associated antagonist of beta-catenin and JNK
signaling, is required for notochord formation. Dev Cell
2:449 – 461.
Ciani L, Salinas PC. 2005. WNTs in the vertebrate nervous sys-
tem: from patterning to neuronal connectivity. Nat Rev Neu-
rosci 6:351–362.
Corbin JG, Nery S, Fishell G. 2001. Telencephalic cells take a
tangent: non-radial migration in the mammalian forebrain. Nat
Neurosci 4(Suppl):1177–1182.
Cossart R, Bernard C, Ben-Ari Y. 2005. Multiple facets of GABAer-
gic neurons and synapses: multiple fates of GABA signalling in
epilepsies. Trends Neurosci 28:108 –115.
Demyanenko GP, Schachner M, Anton E, Schmid R, Feng G,
Sanes J, Maness PF. 2004. Close homolog of L1 modulates
area-specific neuronal positioning and dendrite orientation in
the cerebral cortex. Neuron 44:423– 437.
Ensslen SE, Rosdahl JA, Brady-Kalnay SM. 2003. The receptor
protein tyrosine phosphatase mu, PTPmu, regulates histogen-
esis of the chick retina. Dev Biol 264:106 –118.
Ensslen-Craig SE, Brady-Kalnay SM. 2004. Receptor protein ty-
rosine phosphatases regulate neural development and axon
guidance. Dev Biol 275:12–22.
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1246 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
Escayg A, De WM, Lee DD, Bichet D, Wolf P, Mayer T, Johnston J,
Baloh R, Sander T, Meisler MH. 2000. Coding and noncoding
variation of the human calcium-channel beta4-subunit gene
CACNB4 in patients with idiopathic generalized epilepsy and
episodic ataxia. Am J Hum Genet 66:1531–1539.
Fisher DA, Kivimae S, Hoshino J, Suriben R, Martin PM, Baxter N,
Cheyette BN. 2006. Three Dact gene family members are
expressed during embryonic development and in the adult
brains of mice. Dev Dyn 235:2620 –2630.
Flames N, Long JE, Garratt AN, Fischer TM, Gassmann M, Birch-
meier C, Lai C, Rubenstein JL, Marin O. 2004. Short- and
long-range attraction of cortical GABAergic interneurons by
neuregulin-1. Neuron 44:251–261.
Friocourt G, Kanatani S, Tabata H, Yozu M, Takahashi T, Antypa
M, Raguenes O, Chelly J, Ferec C, Nakajima K, Parnavelas JG.
2008. Cell-autonomous roles of ARX in cell proliferation and
neuronal migration during corticogenesis. J Neurosci 28:
5794 –5805.
Goto K, Funayama M, Kondo H. 1994. Cloning and expression of
a cytoskeleton-associated diacylglycerol kinase that is domi-
nantly expressed in cerebellum. Proc Natl Acad SciUSA
91:13042–13046.
Grigoriou M, Tucker AS, Sharpe PT, Pachnis V. (1998) Expression
and regulation of Lhx6 and Lhx7, a novel subfamily of LIM
homeodomain encoding genes, suggests a role in mammalian
head development. Development 125:2063–2074
Hayakawa M, Matsushima M, Hagiwara H, Oshima T, Fujino T,
Ando K, Kikugawa K, Tanaka H, Miyazawa K, Kitagawa M.
2008. Novel insights into FGD3, a putative GEF for Cdc42,
that undergoes SCF(FWD1/beta-TrCP)-mediated proteaso-
mal degradation analogous to that of its homologue FGD1 but
regulates cell morphology and motility differently from FGD1.
Genes Cells 13:329 –342.
Holzfeind PJ, Grewal PK, Reitsamer HA, Kechvar J, Lassmann H,
Hoeger H, Hewitt JE, Bittner RE. 2002. Skeletal, cardiac and
tongue muscle pathology, defective retinal transmission, and
neuronal migration defects in the Large(myd) mouse defines a
natural model for glycosylation-deficient muscle-eye-brain
disorders. Hum Mol Genet 11:2673–2687.
Ille F, Sommer L. 2005. Wnt signaling: multiple functions in neural
development. Cell Mol Life Sci 62:1100 –1108.
Inamori K, Endo T, Ide Y, Fujii S, Gu J, Honke K, Taniguchi N. 2003.
Molecular cloning and characterization of human GnT-IX, a
novel beta1,6-N-acetylglucosaminyltransferase that is specif-
ically expressed in the brain. J Biol Chem 278:43102– 43109.
Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ,
Scherf U, Speed TP. 2003. Exploration, normalization, and
summaries of high density oligonucleotide array probe level
data. Biostatistics 4:249 –264.
Jakovcevski I, Siering J, Hargus G, Karl N, Hoelters L, Djogo N, Yin
S, Zecevic N, Schachner M, Irintchev A. 2009. Close homo-
logue of adhesion molecule L1 promotes survival of Purkinje
and granule cells and granule cell migration during murine
cerebellar development. J Comp Neurol 513:496 –510.
Kearney JA, Wiste AK, Stephani U, Trudeau MM, Siegel A, Ram-
achandranNair R, Elterman RD, Muhle H, Reinsdorf J, Shields
WD, Meisler MH, Escayg A. 2006. Recurrent de novo muta-
tions of SCN1A in severe myoclonic epilepsy of infancy. Pedi-
atr Neurol 34:116 –120.
Kim AS, Lowenstein DH, Pleasure SJ. 2001. Wnt receptors and
Wnt inhibitors are expressed in gradients in the developing
telencephalon. Mech Dev 103:167–172.
Kinney CM, Chandrasekharan UM, Mavrakis L, DiCorleto PE.
2008. VEGF and thrombin induce MKP-1 through distinct sig-
naling pathways: role for MKP-1 in endothelial cell migration.
Am J Physiol Cell Physiol 294:C241–C250.
Koop EA, Lopes SM, Feiken E, Bluyssen HA, van d, V, Voest EE,
Mummery CL, Moolenaar WH, Gebbink MF. 2003. Receptor
protein tyrosine phosphatase mu expression as a marker for
endothelial cell heterogeneity; analysis of RPTPmu gene ex-
pression using LacZ knock-in mice. Int J Dev Biol 47:345–354.
Lako M, Lindsay S, Bullen P, Wilson DI, Robson SC, Strachan T.
1998. A novel mammalian wnt gene, WNT8B, shows brain-
restricted expression in early development, with sharply de-
limited expression boundaries in the developing forebrain.
Hum Mol Genet 7:813– 822.
Larsson C. 2006. Protein kinase C and the regulation of the actin
cytoskeleton. Cell Signal 18:276 –284.
Lavdas AA, Grigoriou M, Pachnis V, Parnavelas JG. 1999. The
medial ganglionic eminence gives rise to a population of early
neurons in the developing cerebral cortex. J Neurosci 19:
7881–7888.
Lee I, Guo HB, Kamar M, Abbott K, Troupe K, Lee JK, Varez-Manilla
G, Pierce M. 2006. N-acetylglucosaminyltranferase VB ex-
pression enhances beta1 integrin-dependent PC12 neurite
outgrowth on laminin and collagen. J Neurochem 97:947–
956.
Lennon G, Auffray C, Polymeropoulos M, Soares MB. 1996. The
I.M.A.G.E. Consortium: an integrated molecular analysis of
genomes and their expression. Genomics 33:151–152.
Letts VA, Felix R, Biddlecome GH, Arikkath J, Mahaffey CL, Valen-
zuela A, Bartlett FS, Mori Y, Campbell KP, Frankel WN. 1998.
The mouse stargazer gene encodes a neuronal Ca2⫹-channel
gamma subunit. Nat Genet 19:340 –347.
Lewis DA, Levitt P. 2002. Schizophrenia as a disorder of neuro-
development. Annu Rev Neurosci 25:409 –432.
Li G, Adesnik H, Li J, Long J, Nicoll RA, Rubenstein JL, Pleasure SJ.
2008. Regional distribution of cortical interneurons and de-
velopment of inhibitory tone are regulated by Cxcl12/Cxcr4
signaling. J Neurosci 28:1085–1098.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expres-
sion data using real-time quantitative PCR and the 2(-Delta
Delta C(T)) method. Methods 25:402– 408.
Lopez-Bendito G, Sanchez-Alcaniz JA, Pla R, Borrell V, Pico E,
Valdeolmillos M, Marin O. 2008. Chemokine signaling con-
trols intracortical migration and final distribution of GABAer-
gic interneurons. J Neurosci 28:1613–1624.
Marin O, Rubenstein JL. 2003. Cell migration in the forebrain.
Annu Rev Neurosci 26:441– 483.
Marin O, Anderson SA, Rubenstein JL. 2000. Origin and molecular
specification of striatal interneurons. J Neurosci 20:6063–
6076.
Marin O, Yaron A, Bagri A, Tessier-Lavigne M, Rubenstein JL.
2001. Sorting of striatal and cortical interneurons regulated
by semaphorin-neuropilin interactions. Science 293:872–
875.
Marin O, Valdeolmillos M, Moya F. 2006. Neurons in motion:
same principles for different shapes? Trends Neurosci 29:
655– 661.
Marsh ED, Minarcik J, Campbell K, Brooks-Kayal AR, Golden JA.
2008. FACS-array gene expression analysis during early de-
velopment of mouse telencephalic interneurons. Dev Neuro-
biol 68:434 – 445.
Martini FJ, Valiente M, Lopez BG, Szabo G, Moya F, Valdeolmillos
M, Marin O. 2009. Biased selection of leading process
branches mediates chemotaxis during tangential neuronal mi-
gration. Development 136:41–50.
Meisler MH, Kearney J, Ottman R, Escayg A. 2001. Identification
of epilepsy genes in human and mouse. Annu Rev Genet 35:
567–588.
Metin C, Baudoin JP, Rakic S, Parnavelas JG. 2006. Cell and mo-
lecular mechanisms involved in the migration of cortical inter-
neurons. Eur J Neurosci 23:894 –900.
Nadarajah B, Alifragis P, Wong RO, Parnavelas JG. 2002.
Ventricle-directed migration in the developing cerebral cor-
tex. Nat Neurosci 5:218 –224.
------------------------------------------------------------------------------------------------------------------------- Gene expression in migrating cortical interneurons
The Journal of Comparative Neurology
円
Research in Systems Neuroscience 1247
Nakajima K. 2007. Control of tangential/non-radial migration of
neurons in the developing cerebral cortex. Neurochem Int
51:121–131.
Pla R, Borrell V, Flames N, Marin O. 2006. Layer acquisition by
cortical GABAergic interneurons is independent of Reelin sig-
naling. J Neurosci 26:6924 –6934.
Polleux F, Whitford KL, Dijkhuizen PA, Vitalis T, Ghosh A. 2002.
Control of cortical interneuron migration by neurotrophins
and PI3-kinase signaling. Development 129:3147–3160.
Pringle NP, Yu WP, Guthrie S, Roelink H, Lumsden A, Peterson AC,
Richardson WD. 1996. Determination of neuroepithelial cell
fate: induction of the oligodendrocyte lineage by ventral mid-
line cells and sonic hedgehog. Dev Biol 177:30 –42.
Qu Q, Crandall JE, Luo T, McCaffery PJ, Smith FI. 2006. Defects in
tangential neuronal migration of pontine nuclei neurons in the
Largemyd mouse are associated with stalled migration in the
ventrolateral hindbrain. Eur J Neurosci 23:2877–2886.
Rakic S, Yanagawa Y, Obata K, Faux C, Parnavelas JG, Nikolic M.
2009. Cortical interneurons require p35/Cdk5 for their mi-
gration and laminar organization. Cereb Cortex 19:1857–
1869.
Sakane F, Imai S, Kai M, Yasuda S, Kanoh H. 2007. Diacylglycerol
kinases: why so many of them? Biochim Biophys Acta 1771:
793– 806.
Sakurai K, Migita O, Toru M, Arinami T. 2002. An association
between a missense polymorphism in the close homologue of
L1 (CHL1, CALL) gene and schizophrenia. Mol Psychiatry
7:412– 415.
Sarter M, Bruno JP. 2002. The neglected constituent of the basal
forebrain corticopetal projection system: GABAergic projec-
tions. Eur J Neurosci 15:1867–1873.
Saviouk V, Moreau MP, Tereshchenko IV, Brzustowicz LM. 2007.
Association of synapsin 2 with schizophrenia in families of
Northern European ancestry. Schizophr Res 96:100 –111.
Smyth GK. 2004. Linear models and empirical bayes methods for
assessing differential expression in microarray experiments.
Stat Appl Genet Mol Biol 3:Article3.
Stenman J, Toresson H, Campbell K. 2003. Identification of two
distinct progenitor populations in the lateral ganglionic emi-
nence: implications for striatal and olfactory bulb neurogen-
esis. J Neurosci 23:167–174.
Stoker AW. 2001. Receptor tyrosine phosphatases in axon
growth and guidance. Curr Opin Neurobiol 11:95–102.
Stuhmer T, Anderson SA, Ekker M, Rubenstein JL. 2002a. Ectopic
expression of the Dlx genes induces glutamic acid decarbox-
ylase and Dlx expression. Development 129:245–252.
Stuhmer T, Puelles L, Ekker M, Rubenstein JL. 2002b. Expression
from a Dlx gene enhancer marks adult mouse cortical
GABAergic neurons. Cereb Cortex 12:75– 85.
Sussel L, Marin O, Kimura S, Rubenstein JL. 1999. Loss of Nkx2.1
homeobox gene function results in a ventral to dorsal molec-
ular respecification within the basal telencephalon: evidence
for a transformation of the pallidum into the striatum. Devel-
opment 126:3359 –3370.
Tamamaki N, Yanagawa Y, Tomioka R, Miyazaki J, Obata K,
Kaneko T. 2003. Green fluorescent protein expression and
colocalization with calretinin, parvalbumin, and somatostatin
in the GAD67-GFP knock-in mouse. J Comp Neurol 467:60 –
79.
Tanaka DH, Maekawa K, Yanagawa Y, Obata K, Murakami F.
2006. Multidirectional and multizonal tangential migration of
GABAergic interneurons in the developing cerebral cortex.
Development 133:2167–2176.
Tanaka DH, Yanagida M, Zhu Y, Mikami S, Nagasawa T, Miyazaki
J, Yanagawa Y, Obata K, Murakami F. 2009. Random walk
behavior of migrating cortical interneurons in the marginal
zone: time-lapse analysis in flat-mount cortex. J Neurosci 29:
1300 –1311.
Tissir F, Goffinet AM. 2006. Expression of planar cell polarity
genes during development of the mouse CNS. Eur J Neurosci
23:597– 607.
Tsushima S, Kai M, Yamada K, Imai S, Houkin K, Kanoh H, Sakane
F. 2004. Diacylglycerol kinase gamma serves as an upstream
suppressor of Rac1 and lamellipodium formation. J Biol Chem
279:28603–28613.
Unterseher F, Hefele JA, Giehl K, De Robertis EM, Wedlich D,
Schambony A. 2004. Paraxial protocadherin coordinates cell
polarity during convergent extension via Rho A and JNK.
EMBO J 23:3259 –3269.
Weiss LA, Escayg A, Kearney JA, Trudeau M, MacDonald BT, Mori
M, Reichert J, Buxbaum JD, Meisler MH. 2003. Sodium chan-
nels SCN1A, SCN2A and SCN3A in familial autism. Mol Psy-
chiatry 8:186 –194.
Wichterle H, Turnbull DH, Nery S, Fishell G, Varez-Buylla A. 2001.
In utero fate mapping reveals distinct migratory pathways and
fates of neurons born in the mammalian basal forebrain. De-
velopment 128:3759 –3771.
Wright AG, Demyanenko GP, Powell A, Schachner M, Enriquez-
Barreto L, Tran TS, Polleux F, Maness PF. 2007. Close ho-
molog of L1 and neuropilin 1 mediate guidance of thalamo-
cortical axons at the ventral telencephalon. J Neurosci 27:
13667–13679.
Wu D, Huang W, Richardson PM, Priestley JV, Liu M. 2008. TRPC4
in rat dorsal root ganglion neurons is increased after nerve
injury and is necessary for neurite outgrowth. J Biol Chem
283:416 – 426.
Yamaguchi Y, Shirai Y, Matsubara T, Sanse K, Kuriyama M, Oshiro
N, Yoshino K, Yonezawa K, Ono Y, Saito N. 2006. Phosphory-
lation and up-regulation of diacylglycerol kinase gamma via its
interaction with protein kinase C gamma. J Biol Chem 281:
31627–31637.
Zechel S, Werner S, von Bohlen Und HO. 2007. Distribution of
TRPC4 in developing and adult murine brain. Cell Tissue Res
328:651– 656.
Zerucha T, Stuhmer T, Hatch G, Park BK, Long Q, Yu G, Gambaro-
tta A, Schultz JR, Rubenstein JL, Ekker M. 2000. A highly con-
served enhancer in the Dlx5/Dlx6 intergenic region is the site
of cross-regulatory interactions between Dlx genes in the em-
bryonic forebrain. J Neurosci 20:709 –721.
Zhang L, Gao X, Wen J, Ning Y, Chen YG. 2006. Dapper 1 antag-
onizes Wnt signaling by promoting dishevelled degradation.
J Biol Chem 281:8607– 8612.
Zhao C, Pleasure SJ. 2005. Frizzled9 protein is regionally ex-
pressed in the developing medial cortical wall and the cells
derived from this region. Brain Res Dev Brain Res 157:93–97.
Zheng C, Heintz N, Hatten ME. 1996. CNS gene encoding astro-
tactin, which supports neuronal migration along glial fibers.
Science 272:417– 419.
Zheng JQ, Poo MM. 2007. Calcium signaling in neuronal motility.
Annu Rev Cell Dev Biol 23:375– 404.
Faux et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
1248 The Journal of Comparative Neurology
円
Research in Systems Neuroscience
