Mass mortality associated with a frog virus 3-like Ranavirus infection in farmed tadpoles Rana catesbeiana from Brazil

Abstract

Ranaviruses (Iridoviridae) are increasingly associated with mortality events in amphibians, fish, and reptiles. They have been recently associated with mass mortality events in Brazilian farmed tadpoles of the American bullfrog Rana catesbeiana Shaw, 1802. The objectives of the present study were to further characterize the virus isolated from sick R. catesbeiana tadpoles and confirm the etiology in these outbreaks. Sick tadpoles were collected in 3 farms located in Goiás State, Brazil, from 2003 to 2005 and processed for virus isolation and characterization, microbiology, histopathology, and parasitology. The phylogenetic relationships of Rana catesbeiana ranavirus (RCV-BR) with other genus members was investigated by PCR with primers specific for the major capsid protein gene (MCP) and the RNA polymerase DNA-dependent gene (Pol II). Sequence analysis and multiple alignments for MCP products showed >99% amino acid identity with other ranaviruses, while Pol II products showed 100% identity. Further diagnostics of the pathology including histology and transmission electron microscopy confirmed the viral etiology of these mass deaths. As far as we know, this is the first report of a ranaviral infection affecting aquatic organisms in Brazil. Additionally, our results suggest that American bullfrogs may have served as a vector of transmission of this virus, which highlights the potential threat of amphibian translocation in the world distribution of pathogens.

Full text

Mass mortality associated with a frog virus 3-like Ranavirus
infection in farmed tadpoles Rana catesbeiana from Brazil
Rolando Mazzoni
1,*
, Albenones José de Mesquita
2
, Luiz Fernando F. Fleury
3
, Wilia Marta
Elsner Diederichsen de Brito
4
, Iolanda A. Nunes
2
, Jacques Robert
5
, Heidi Morales
5
,
Alexandre Siqueira Guedes Coelho
6
, Denise Leão Barthasson
4
, Leonardo Galli
1
, and Marcia
H. B. Catroxo
7
1
Instituto de Investigaciones Pesqueras, Facultad de Veterinaria, Universidad de la República,
Tomás Basañez 1160, Montevideo 11300, Uruguay
2
Centro de Pesquisa em Alimentos, Escola de Veterinária, Universidade Federal de Goiás, Campus
Samambaia (Campus II), Caixa postal 131, CEP 74001-970, Goiânia-GO, Brazil
3
Departmento de Patologia e Imaginologia, Faculdade de Medicina, Universidade Federal de
Goiás, l
a
Avenida s/n, Setor Universitário 74605-050, Goiânia-GO, Brazil
4
Laboratório de Virologia Animal, Setor Microbiologia, Instituto de Patologia Tropical e Saude
Pública, Universidade Federal de Goiás, Rua 235 s/n, Setor Universitário 74605-050, Goiânia-GO,
Brazil
5
Department of Microbiology and Immunology, University of Rochester Medical Center, 601
Elmwood Avenue, Rochester, New York 14642, USA
6
Escola de Agronomia e Enqenharia de Alimentos, Universidade Federal de Goiás, Campus
Samambaia, CEP 74001–970, Goiânia-Go, Brazil
7
Laboratório de Microscopia Eletrônica, Centro de Pesquisa e Desenvolvimento de Sanidade
Animal, Instituto Biológico, Av. Cons. Rodrigues Alves 1252, CEP 04014-002. São Paulo-SP, Brazil
Abstract
Ranviruses (Iridoviridae) are increasingly associated with mortality events in amphibians, fish, and
reptiles. They have been recently associated with mass mortality events in Brazilian farmed tadpoles
of the American bullfrog Rana catesbeiana Shaw. 1802. The objectives of the present study were to
further characterize the virus isolated from sick R. catesbeiana tadpoles and confirm the etiology in
these outbreaks. Sick tadpoles were collected in 3 farms located in Goiás State, Brazil, from 2003 to
2005 and processed for virus isolation and characterization, microbiology, histopathology, and
parasitology. The phylogenetic relationships of Rana catesbeiana ranavirus (RCV-BR) with other
genus members was investigated by PCR with primers specific for the major capsid protein gene
(MCP) and the RNA polymerase DNA-dependent gene (Pol II). Sequence analysis and multiple
alignments for MCP products showed >99% amino acid identity with other ranaviruses, while Pol
II products showed 100% identity. Further diagnostics of the pathology including histology and
transmission electron microscopy confirmed the viral etiology of these mass deaths. As for as we
know, this is the first report of a ranaviral infection affecting aquatic organisms in Brazil.
Additionally, our results suggest that American bullfrogs may have served as a vector of transmission
of this virus, which highlights the potential threat of amphibian translocation in the world distribution
of pathogens.
*
rolo@pes.fvet.edu.uy.
NIH Public Access
Author Manuscript
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
Published in final edited form as:
Dis Aquat Organ. 2009 November 9; 86(3): 181–191.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Keywords
Iridovirus; FV3; Ranavirus; Rana catesbeiana
INTRODUCTION
Brazilian frog farming is a flourishing industry that mainly focuses on producing the American
bullfrog Rana catesbiana Shaw, 1802. Ranaculture has been recently plagued by mass
mortality events. These acute outbreaks were identified as a severe condition in tadpoles at
early developmental stages and resulted in significant economic loses (Galli et al. 2006,
Mazzoni 2006). The clinical signs of disease were apparently non-specific and common to
several disorders. Nutritional, toxic, or management causes, associated or not with various
genera and species of bacteria, have been suspected as possible etiologies (Hipólito & Bach
2002). However, viruses of the family Iridoviridae, genus Ranavirus have been increasingly
signaled as possible etiological agents in both wild and cultured aquatic organisms (Williams
et al. 2005).
Ranaviruses belong to the family Iridoviridae, which comprises 4 other genera:
Lymphocystisvirus, Chloriridovirus, Iridovirus, and Megalocytivirus. Viral size ranges from
120 to 300 nm in diameter with icosahedrical symmetry (Webby & Kalmarkoff 1998). The
genome is composed of a unique DNA double-stranded linear molecule with variable size
ranging from 102 to 212 kbp depending on the species. The virus particle is formed by 3
structures: the external protein capsid, a polypeptide-lipid intermediate membrane, and a
central nucleus containing a DNA-protein complex. The DNA is both circularly permuted and
terminally redundant (Goorha & Murti 1982), leading to a genome map that is circular while
the actual molecule is still linear (Houts el al. 1974) with >20% of its cytosine CpG sequences
methylated (Willis & Granoff 1980). All iridovirus family members express the major capsid
protein (MCP) of about 50 kDa, whose molecular properties have been extensively used for
viral characterization and identification (Webby & Kalmarkoff 1998, Chinchar et al. 2005,
Williams et al. 2005). Complete ranavirus MCP sequences are available from frog virus 3
(FV3) (Mao el al. 1996, Tan et al. 2004), tiger frog virus (He et al. 2002), Bohle iridovirus
(Marsh el al. 2002), epizootic hematopoietic necrosis virus (Marsh et al. 2002), Ambystoma
tigrinum virus (Jancovich et al. 2003), and Rana grylio virus (RGV 9506, RGV 9507, and RGV
9508; Zhang et al. 2006). Complete genome sequences from several members of the genus are
also available, including FV3, the type species of the family (Tan et al 2004). Diseases produced
by ranaviruses have been increasingly reported to affect 3 different taxonomic classes of cold-
blooded vertebrates: teleost fish, amphibians, and reptiles. They are considered to be emerging
pathogens that produce economic damage to commercially raised species and cause population
declines in the wild (Williams et al. 2005, Fox et al. 2006). Ranaviruses were reported to be
associated with mass mortality episodes affecting Rana grylio tadpoles (Zhang et al. 2001),
R. tigrina rugulosa tadpoles (Weng et al. 2002), and R. catesbeiana tadpoles in the USA
showing abdominal swelling (Majji et al. 2006).
Ranaviruses were suspected as etiological agents in mass mortalities affecting farmed tadpoles
Rana catesbeiana in Brazil (Galli et al. 2006). Galli el al. (2006) reported high sequence identity
with FV3 and other Ranavirus genus members for MCP and the immediately early protein
(IE-ICP18) gene products, raising the question about the source and origin of the Brazilian
virus isolate, given that bullfrog populations, signaled as endemic FV3 carriers (Wolf et al.
1968), were imported from North America in 1970 (Mathias & Scoll 2004), so a pathogen
translocation through the bullfrog trade is possible. However, ranaviruses have been identified
in almost all continents and previous reports in South America showed their presence in local
species (Zupanovic et al. 1998, Fox et al. 2006).
Mazzoni et al. Page 2
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

The MCP gene has been used extensively to assess the phylogeny and taxonomy of iridoviruses.
Based on the MCP sequence, Mao et al. (1997) have shown that iridoviruses isolated from the
same geographic region were identical or highly similar; meanwhile those from different
regions were genetically more distant. Similar results were reported when 30 iridoviruses from
different geographic sites were analyzed (Hyatt et al. 2000). Examination of the entire MCP
sequence allowed the differentiation of Australian, European, and American ranavirus isolates
(Marsh el al. 2002) A phylogeographic study of ranaviruses from salamander Ambystoma
tigrinum in the USA was based a the comparison of 514 MCP nucleotides located at the 5′ end
(Jancovich et al. 2005). Do et al. (2005) analyzed 13 iridoviruses isolated from fish in Korea
using the complete MCP sequences and showed that the viruses belong to the some species,
which is consistent with the introduction of a single infectious agent. The DNA polymerase of
many large DNA viruses has been also used to evaluate virus relationships (Hanson et al.
2006).
The goals of the present study were to isolate the virus from sick Rana catesbeiana tadpoles
and determine whether the virus had an etiological role in mass mortality episodes. To study
the phylogenetic relationships with FV3 and other Ranavirus members, we analyzed the
complete MCP coding region as well as partial sequences from the RNA polymerase DNA-
dependent polymerase II (Pol II).
MATERIALS AND METHODS
Tadpole samples
Five hundred sick tadpoles in Gosner Stage 25 (Gosner 1960) were collected from 3 farms
located in Goiás State, Brazil (Fig. 1) from 2003 to 2005, one-third being used for virus
isolation, one-third for PCR, and the rest being necropsied and used for bacteriology,
parasitology, and histopathology (Table 1). Continuous gravitational flow of surface water was
maintained in all ponds where tadpoles received 45% crude protein powder feed from different
sources. Samples were taken from tanks when acute mass mortality events were reported within
the first 24 h of onset. Records of anamnestic and epizootiological data were collected as well
as clinical evaluations of sick tadpoles. Dead animals were not sampled to avoid post-mortem
changes that might result in the wrong microbiological or histopathological conclusions.
Samples for virus isolation
Tadpoles were preserved in 95% ethanol when fixed at the farm or frozen at −20°C when
processed at the laboratory. For virus isolation, frozen tadpoles were macerated with the
addition of sterile amphibian phosphate-buffered saline (APBS, 6.6 g 1
−1
NaCl, 1.15 g 1
−1
Na
2
HPO
4
, and 0.2 g 1
−1
KH
2
PO
4
; pH 7.5). The suspension was collected and distributed in 2
ml sterile tubes, freeze-thawed 3 times at −80°C, and followed by centrifugation at 1000 × g
for 10 min at 4°C. The supernatant containing virus was filtered with 0.45 μm Millipore filters,
and 1.0 ml aliquots were stored at −80°C until used or immediately inoculated in 80% confluent
Xenopus sp. kidney A6 cells (Rafferty 1969) in 25 cm
2
bottles. After a 45 min incubation, 5
ml culture medium was added (Dulbecco’s modified Eagle medium [DMEM; Gibco] with
addition of penicillin-streptomycin and amphotericin). Control bottles were inoculated wilh
1.0 ml APBS. Cells were incubated at 25 to 27°C in a dark chamber and examined twice daily
during 1 wk to verify the cytopathic effect.
PCR
DNA was obtained using the saline extraction method (Miller et al 1988). Briefly, whole
tadpoles were homogenized in a pestle and mortar in sterile conditions, and 50 mg samples
were diluted in 500 μl lysis buffer (50 mM Tris-HCl, pH 8.0; 50 mM EDTA, pH 8.0; 1 % SDS,
50 mM NaCl) and 50 μl lysozyme (10 mg ml
−1
), then finger-vortexed and left overnight al 55°
Mazzoni et al. Page 3
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

C. Tubes were centrifuged (Eppendort Microcentrifuge 5415 D) at 12000 × g for 15 min, and
400 μl supernatant was mixed with 240 μl 5 M NaCl, finger-vortexed for 15 s, and centrifuged
for 30 min at 12000 × g. The supernatant (450 μl) was transferred to a new tube, to which 400
μl 100% ethanol at −20°C was added, and mixed by gently inverting the tubes for 30 s. Tubes
were left for at least 2 h at −20°C or at 4°C overnight for DNA precipitation. For pelleting,
tubes were centrifuged at 12000 × g for 30 min, washed twice with 70% ethanol, centrifuged
at 5000 × g for 5 min, and dried at room temperature. DNA was resuspended in 100 μl TE
buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA) at 55°C in a dry air chamber for 2 h.
IE-ICP 18 was used as the screening tool for primary detection. Positive samples were then
PCR-amplified using primers specific for MCP and Pol II genes (Table 2). Optimal melting
temperature for these primers was determined by a thermal-gradient PCR, testing from 50 to
65°C. For each reaction, the mixture used was 2.5 μl 10× PCR buffer (20 mM Tris-HCl. pH
8.4; 50 mM KCl). 200 μM dNTP, 2.5 mM MgCl
2
, 2.5 μM of each primer. 1 U of Taq DNA
polymerase, 5 μl of DNA template (100 ng μl
−1
), and distilled water to complete 50 μl.
Amplification conditions were adapted for each set of primers according to the melting
temperature and length of the amplified fragment. Briefly, an initial cycle at 90°C for 1 min
was followed by 40 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, and a final
extension step at 72°C for 5 min. For complete MCP primers, the extension time was 90 s, and
for Pol II 30 s. Amplification products were run in 1 % agarose gel, immersed in TAE buffer
(40 mM Tris-acetate, 1 mM EDTA) stained with 0.5 μg ml
−1
ethidium bromide and visualized
with UV transilluminator.
Sequencing and sequence analysis
The PCR fragments were sequenced using the Big Dye
®
Terminator (v. 3.1) kit in an ABI-3100
fragment analyzer (Applied Biosystems) following the manufacturer’s instructions. MCP
sequences were analyzed from both ends, combined with 4 internal primers to overlap partial
fragments and obtain the whole sequence (forward primers 5′-CAC CAG CGA TCT CAT
CAA CC-3′ and 5′-CGC AGT CAA GGC CTT GAT CT-3′ [Hyatt et al. 2000], and reverse
primers 5′-GTC TCT GGA GAA GAA GAA-3′ [MCP5; Mao et al. 1996] and 5′-GTA ATT
GGA GCC GAC GGA AGG-3′ [designed by the authors for the present analysis]). Pol II
products were sequenced using specific primers shown in Table 2. All sequences were analyzed
at least 6 times from both ends.
The DNA and the deduced amino acid sequences were compared with sequences in the
GenBank/EMBL databases using the basic local alignment search tool (BLAST;
www.ncbi.nlm.nih.gov/BLAST/). Sequences were aligned using CLUSTAL W (Thompson et
al. 1994), and the phylogenetic relationships among species were determined using the
neighbor-joining method (Saitou & Nei 1987) and parsimony, and maximum likelihood using
MEGA4 (Tamura et al. 2007), Paup* 4.0b10 (Swofford 2002), and ModelTest (Posada &
Crandall 1998) software. The tree was rooted using the lymphocystis disease virus as the
external group and its reliability was inferred using the Felsenstein (1985) bootstrap method
with 10 000 replicates.
Bacteriology
Tadpoles were collected, immediately euthanized with an overdose of tricaine methane
sulphonate (MS222, Finquel
®
, Argent Chemical Laboratories) and immersed for 30 s in 0.2%
peracetic acid solution to reduce external contamination. The liver, kidneys, and ascitic exudate
were obtained aseptically using sterilized surgical instruments. Samples were inoculated and
incubated in 4 different broths: brain heart infusion, triplicase soy broth, glucose azide, and
selenite cystine (DIFCO Labs), prepared according to the manufacturer’s indications. All
samples were incubated at 30°C for 24 to 72 h.
Mazzoni et al. Page 4
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Histopathology
Whole tadpoles were preserved in 10% buffered formaline (vol/vol) and processed according
to routine techniques. Paraffin-embedded blocks were sectioned in 4 to 5 μm sections and
stained with hematoxylin and eosin (H&E) for primary validation. In a second stage, selected
samples were stained using MacCallum-Goodpasture for bacterial detection. Fite for
mycobacteria, and PAS for fungus (Luna 1968).
Transmission electron microscopy (TEM)
Material for TEM was selected from lesions identified on histopathology slides. Once the lesion
was precisely located in the paraffin-embedded block, a 1 mm
3
tissue sample was extracted
for analysis. The retrieved tissue was deparaffined and fixed in 2.5% glutaraldehyde with the
addition of phosphate buffer (0.1 M, pH 7.0) and later processed for resin inclusion and positive
staining with uranyl acetate and lead citrate. Samples were observed in a Philips EM 208 TEM.
Parasitology
Wet mounts of skin were observed under an optical microscope for the parasite survey.
RESULTS
Epizootiology and clinical signs
The disease occurred throughout the year in all farms in the present survey, although the
incidence and prevalence were higher during the rainy season (October to April). Clinical signs
were observed in tadpoles in Gosner Stage 25 (Gosner 1960) ranging from 15 to 28 d old. Mass
mortalities affected the whole tank population within the first 24 h. In a short period, all tanks
harboring tadpoles within the same age range were affected, with an overall mortality between
95 and 100%. Newly hatched tadpoles did not show any sign of disease, and those in pre-
metamorphic stages were not affected.
Typically, diseased tadpoles stopped feeding and were lethargic. They lost their swimming
ability and remained at the bottom of the tank with erratic movements Abdominal distention
was a frequent finding, but some affected tadpoles evidenced pale color and cachexia (Fig. 2).
Skin lesions like ulcers or petechiae were not observed.
Cell culture, PCR, and sequence analysis
Xenopus sp. A6 cells inoculated with virus suspension obtained from sick tadpoles showed
signs of cytopathic effects after 48 h incubation. A6 cells damaged by the virus first rounded
up, and later contracted and elongated, some showing a star shape, and their cytoplasm became
very granular with signs of apoptosis. Then cells detached from the layer (Fig. 3).
PCR on DNA extracted from sick tadpoles was positive for MCP and Pol II. The MCP gene
primers yielded a specific fragment of about 1500 bp. Primers targeting the Pol II gene yielded
a product of about 380 bp (Fig. 4).
To clarify the taxonomic position of our isolate, we cloned and sequenced the MCP and partial
Pol II PCR fragments. Multiple alignments of MCP-deduced amino acid sequences showed
the phylogenetic relationships of RCV-BR with FV3 and other ranaviruses (Fig. 5). High
identities were obtained with published MCP sequences from anurans (Table 3). Multiple
sequence alignments of the Pol II-deduced amino acid sequences showed 100% identity with
FV3 (GenBank Accession No. AY548484), 98 % with tiger frog virus (GenBank Accession
No. AF389451), and 96% with Regina ranavirus (GenBank Accession No. AF368230) and
Ambystoma tigrinum stebbensi virus (GenBank Accession No. AY150217). Based on the
Mazzoni et al. Page 5
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

alignments of MCP nucleotides, the neighbor-joining tree (Fig. 6) showed that selected
ranaviruses and RCV-BR form a tight cluster of closely related viruses. Moreover, RCV-BR
and FV3 are located in a single clade with high bootstrap values supporting this division. The
same results were obtained for Pol II (data not shown).
The RCV-BR MCP sequence was deposited to GenBank under Accession No. DQ897669.
Necropsy and histopathology
Autopsy of tadpoles with abdominal distension revealed abundant fluids filling the body cavity,
with a pale-colored liver associated with congestive and slightly hemorrhagic organs.
Cachectic tadpoles showed poor body conditions, including an absence of a fat body and pale
coloration of the liver with congestive kidneys.
Histological analysis of infected tadpoles showed various degrees of tissue damage and cell
necrosis over broad areas of tissue disruption. Lesions were prominent in the kidneys, liver,
and spleen. The kidneys were the most affected organs, with large necrotic areas evidencing
pyknosis and karyorrhexis associated with diffuse inflammatory infiltrate, mostly composed
of mononuclear lymphocytes and eosinophils (Fig. 7a). The liver also showed necrosis with
pyknosis and karyorrhexis, areas of steatosis, vacuolized hepatocytes, and mononuclear
infiltrate (Fig. 7b). The spleen repeated the same pattern of necrosis and inflammatory infiltrate.
Neither bacteria nor fungi were observed using specific histological detection techniques.
TEM
Tissue samples of sick tadpoles obtained from formalin-fixed blocks and reprocessed for TEM
analysis showed cell lyses, deformed nucleii with marginalized chromatin, absence of nuclear
membrane, cytoplasm with empty or altered organelles, and mitochondria without crystals.
Aggregates of iridovirus-like icosahedric particles in diverse assembly degrees were detected
in kidney samples, confirming viral presence in areas of tissue damage (Fig. 8).
Bacteriology and parasitology
Bacteriological analyses were negative for both tissue samples and ascitic exudates. Skin and
gills samples showed several parasite species, of which Trichodina spp. and Oodinium spp.
were the most common.
DISCUSSION
In the present study, we have identified a virus from the Ranavirus genus as the cause of mass
mortality episodes in young Rana catesbeiana tadpoles in 3 Brazilian farms. Clinical and
laboratory observations, including molecular characterization and TEM results, confirmed the
viral etiology of these mass deaths. Histological examination of the tissue lesions indicated
that bullfrog tadpoles died from viral injuries located mainly in the kidney, liver, and spleen.
Bacteria were not associated with the disease, as tissue cultures and MacCallum-Goodpasture-
stained histological slides were negative. Skin parasites were considered just an opportunistic
invasion and not associated with clinical signs and lesions. Toxic causes, always suspected in
acute syndromes, were discarded as each farm used different water sources and feed brands.
The fact that different ponds were not affected simultaneously and that younger tadpoles
remained healthy further ruled out this possibility.
The present evidence for a Ranavirus infection is consistent with the description of ‘abdominal
distension disease’ in China, affecting farmed Rana grylio and R. tigrina rugulosa (Zhang et
al. 2001, Weng et al. 2002).
Mazzoni et al. Page 6
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Brazilian Ranavirus does not seem to be a great threat to Rana catesbeiana as farmed
populations are well established, and disease outbreaks, despite their economic impact, were
solved after biosecurity and good management practices were implemented. Environmental
conditions within commercial frog farms should be the most important trigger for these
outbreaks contributing to increased susceptibility to viral infections. This disease seems to be
a typical epidemiological example of host–environment–pathogen interaction, where disease
outbreaks and pathogen virulence enhancement are associated with environmental and
management stressors. Similar considerations were quoted in reference to RGV pathogenesis
in R. grylio with lethal syndrome (Zhang et al. 2001) and adult R. catesbeiana infections (Majji
et al. 2006, Miller el al. 2007).
Ranviruses have been recognized as emerging pathogens, producing high mortalities in fish,
reptiles, and amphibians; a minimally pathogenic virus in one species can cause serious
diseases in others (Daszak et al. 1999. Chinchar 2002, Chinchar et al. 2005, Williams et al.
2005, Majji et al. 2006, Miller et al. 2007).
The high susceptibility of larval stages to ranaviruses has been established in Xenopus sp.
(Gantress et al. 2003, Robert et al. 2005, Williams et al. 2005). This is consistent with the
present results, as older tadpoles were not affected. However, others have reported that late-
stage tadpoles and new metamorphs of other anuran species (e.g. Rana sylvatica and R.
pipiens) appear to be more susceptible to Ranavirus infections (Green et al. 2002, Greer et al.
2005). This is not a contradiction, considering it may be an interplay between differential
susceptibility of age classes, coupled with cycles of viral virulence and attenuation underlying
this phenomenon, as well as the effect of Ranavirus infections often varying within host species
(Daszak et al. 2003, Williams et al. 2005).
Wolf et al. (1968) isolated tadpole edema virus (TEV) from grossly edematous Rana
catesbeiana and experimentally infected several amphibian species. Infected metamorphosing
bullfrogs showed lethargy and edema prior to death. A generalized eosinophilia with marked
infiltration in kidney tissues associated with necrosis and pyknotic nuclei was observed (Wolf
et al. 1968). The similar increase in eosinophils found in the present study suggests that
Ranavirus infection is associated with a pathophysiological host response involving an
accumulation of eosinophils in infected tissues, at least in American bullfrogs. In mammals,
eosinophils are pleiotropic multifunctional leukocytes involved in initiation and propagation
of diverse inflammatory responses, as well as modulators of innate and adaptive immunity
(Rothenberg & Hogan 2006). In addition to secreting various cytokines, they may participate
in virus-induced immune responses by processing and presenting complex viral proteins and/
or intact viral particles (Handzel et al. 1998). Whether eosinophils play a similar role in
amphibian innate and adaptive immunity and how critical they are in amphibian anti-
Ranavirus host response remains to be determined.
Sequence alignments of Pol II and MCP from RCV-BR showed 100 and 99.7% identity
respectively with published FV3 sequences as well as high identities with other Ranavirus
genus members. To determine the relationships among these viruses, we generated a neighbor-
Joining tree (Saitou & Nei 1987) using the MCP sequence information in Fig. 5. The tree in
Fig. 6 shows that all selected ranaviruses and RCV-BR form a tight cluster of closely related
viruses. Moreover, RCV-BR and FV3 are located in a single clade, with high bootstrap values
supporting this division. These results suggest that RCV-BR and FV3 are close relatives or
perhaps strains of the same virus.
The highly conserved MCP is diverse enough to be used to distinguish among closely related
isolates (Tidona et al. 1998). Do et al. (2005) analyzed 13 isolates of flounder (Paralichthys
olivaceus) iridoviruses (FLIVs); MCP-deduced amino acid sequences of the 13 FLIVs showed
Mazzoni et al. Page 7
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

97 to 100% amino acid sequence identity to each other, suggesting that all 13 isolates have a
single origin. Jancovich et al. (2005) concluded that 18 geographically widespread
Ranavirus isolates in the USA corresponded to a single introduction, after determining genetic
divergences of <1 % for MCP sequences.
Studies performed with Iridoviridae showed that viruses isolated from the same geographic
region were genetically similar, whereas those from different areas were distinct (Mao et al.
1997, Hyatt et al. 2000, Marsh et al. 2002). FV3-like viruses were reported outside North
America in Rana temporaria from the UK (Hyatt et al. 2000) and R. grylio viruses isolated in
China (Zhang et al. 2001), as a consequence of amphibian translocations. TEV isolated from
R. catesbeiana in North America was signaled as being endemic to this species (Wolf et al.
1968) and could be a strain of FV3 (Essani & Granoff 1989). The present results along with
IE-ICP 18 identity reported by Galli et al. (2006) suggest that American bullfrogs may have
carried the virus to Brazil, illustrating the key role of amphibian translocation in the world
distribution of pathogens and particularly FV3. The minimum genetic differences between
RCV-BR and FV3, located in 2 geographically distant places, could be explained by DNA
viruses characteristically expressing mechanisms of co-divergence between host and virus,
determined by vicariance, in association to persistent infections by sexual or vertical
transmission (Holmes 2004).
Nevertheless, ranaviruses with high identities to FV3 within partial MCP sequences have been
also found in Venezuela (Zupanovic et al. 1998) and Argentina (Fox et al. 2006), suggesting
the possibility of on autochthonous species.
In agreement with Goldberg et al. (2003), it is necessary to continue studies on protein profiles
using amplified fragment length polymorphism (AFLP) and to obtain the complete RCV-BR
genome sequence to determine, with accuracy, similarities among these closely related viruses.
In conclusion, viruses of family Iridoviridae, genus Ranavirus are pathogenic to young Rana
catesbeiana tadpoles, and likely the cause of mass mortality commonly observed on Brazilian
frog farms. As for as we know, this is the first report of Ranavirus affecting aquatic organisms
in Brazil. Given that ranaviruses are now ‘notifiable’ diseases according to the World
Organization for Animal Health (OIE), this is of high relevance for frog farming and
aquaculture industry and export in the USA. Although the Brazilian Ranavirus may become
pathogenic for bullfrogs only under stressing conditions, it can be potentially virulent for other
South American amphibians, fish, or reptiles. We believe that Ranavirus-like disease
exemplifies the problems likely to arise with the intensive culturing of new species. More
systematic animal husbandry including defined disease-control strategies will be required for
long-term economically successful aquaculture industries. Further basic and applied research
will be needed to answer questions raised in the present study, such as viral origin and the
hazards associated with disease translocation and amphibian trade.
Acknowledgments
This work was performed with the financial support of Programa de Desarrollo Tecnológico-Dirección Nacional de
Ciencia y Tecnología (Ministerio de Educación y Cultura, Uruguay) and Coordenação de Aperfeiçoamento de Pessoal
de Nível Superior (Ministerio da Educação, Brazil), J.R. and H.M. were supported by NIH grant AI-2R24,
AI059830-06. We thank S. Q. P. de Mesquita, U. N. Rauecker, and M. Hipólito for their excellent technical assistance.
Fig. 1 was prepared by F. Mazzoni.
LITERATURE CITED
Chinchar VG. Ranaviruses (family Iridoviridae); emerging cold-blooded killers. Arch Virol
2002;147:447–470. [PubMed: 11958449]
Mazzoni et al. Page 8
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Chinchar, VG.; Essbauer, S.; He, JG.; Hyatt, AD.; Miyazaki, T.; Seligy, V.; Williams, T. Iridoviridae.
In: Fauquet, CM.; Mayo, MA.; Manilott, J.; Desselberger, U.; Ball, LA., editors. Virus taxonomy: 8th
report of the International Committee on the Taxonomy of Viruses. Elsevier; London: 2005. p.
163-175.
Daszak P, Berger L, Cunningham AA, Hyatt AD, Green DE, Speare R. Emerging infectious diseases and
amphibian population declines. Emerg Infect Dis 1999;5:735–748. [PubMed: 10603206]
Daszak P, Cunningham AA, Hyatt AD. Infectious diseases and amphibian population declines. Divers
Distrib 2003;9:141–150.
Do J, Cha S, Kim J, An E, et al. Phylogenetic analysis of the major capsid protein gene of iridovirus
isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Org 2005;64:193–200.
[PubMed: 15997817]
Essani K, Granoff A. Amphibian and piscine iridoviruses proposal for nomenclature and taxonomy based
on molecular and biological properties. Intervirology 1989;30:187–193. [PubMed: 2550386]
Felsenstein J. Phylogenies and the comparative method. Am Nat 1985;125:1–15.
Fox SF, Greer AL, Torres-Cervantes R, Collins JP. First case of ranavirus-associated morbidity and
mortality in natural populations of the South American frog Atelognathus patagonicus. Dis Aquat Org
2006;72:87–92. [PubMed: 17067077]
Galli L, Pereira A, Marquez A, Mazzoni R. Ranavirus detection by PCR in cultured ladpoles (Rana
catesbeiana Shaw 1802) from South America. Aquaculture 2006;257:78–82.
Gantress J, Maniero G, Cohen N, Robert J. Development and characterization of a model system to study
amphibian immune responses to iridoviruses. Virology 2003;311:254–262. [PubMed: 12842616]
Goldberg T, Coleman D, Gram E, Inendino K, Philipp D. Strain variation in an emerging iridovirus of
warm-water fishes. J Virol 2003;77:8812–8818. [PubMed: 12885900]
Goorha R, Murti KG. The genome of frog virus 3, an animal DNA virus, is circularly permuted and
terminally redundant. Proc Natl Acad Sri USA 1982;79:248–252.
Gosner K. A simplified table for Staging anuran embryos and larva with notes on identification.
Herpetologica 1960;16:183–190.
Green DE, Converse KA, Schrader AK. Epizootiology of sixty-four amphibian morbidity and mortality
events in the USA, 1996–2001. Ann NY Acad Sci 2002;969:323–339. [PubMed: 12381613]
Greer AL, Berrill M, Wilson PJ. Five amphibian mortality events associated with ranavirus infection in
south central Ontario, Canada. Dis Aquat Org 2005;67:9–14. [PubMed: 16385802]
Handzel ZT, Busse WW, Sedgwick JB, Vrtis R, Lee WM, Kelly EAB, Gern JE. Eosinophils bind
rhinovirus and activate virus-specific T cells. J Immunol 1998;160:1279–1284. [PubMed: 9570544]
Hanson LA, Rudis MR, Vasquez-Lee M, Montgomery RD. A broadly applicable method to characterize
large DNA viruses and adenoviruses based on the DNA polymerase gene. Virol J 2006;3:28.
[PubMed: 16608526]
He JG, Lu L, Deny M, He HH, et al. Sequence analysis of the complete genome of an iridovirus isolated
from the tiger frog. Virology 2002;292:185–197. [PubMed: 11878922]
Hipólito M, Bach EE. Patologias em rã-touro (Rana catesbeiana, Shaw, 1802). Primeira revisão da
bibliografia brasileira. Arq Inst Biol (Sao Paulo) 2002;69:113–120.
Holmes EC. The phylogeography of human viruses. Mol Ecol 2004;13:745–756. [PubMed: 15012753]
Houts GE, Gravell M, Granoff A. Electron microscopic observations on early events of frog virus 3
replication. Virology 1974;58:589–594. [PubMed: 4362435]
Hyatt AD, Gould AR, Zupanovic Z, Cunningham AA, et al. Comparative studies of piscine and amphibian
iridoviruses. Arch Virol 2000;145:301–331. [PubMed: 10752555]
Jancovich JK, Mao J, Chinchar VG, Wyatt C, et al. Genomic sequence of a ranavirus (family
Iridoviridae) associated with salamander mortalities in North America. Virology 2003;316:90–103.
[PubMed: 14599794]
Jancovich JK, Davidson EW, Parameswaran N, Mao J, et al. Evidence for emergence of an amphibian
iridoviral disease because of human-enhanced spread. Mol Ecol 2005;14:213–224. [PubMed:
15643965]
Luna, LG. Manual of histology staining methods of the Armed Forces Institute of Pathology. 3. McGraw-
Hill; New York: 1968.
Mazzoni et al. Page 9
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Majji S, LaPatra S, Long SM, Sample R, Bryan L, Sinning A, Chinchar VG. Rana catesbeiana virus Z,
(RCV-Z): a novel pathogenic ranavirus. Dis Aquat Org 2006;73:1–11. [PubMed: 17240747]
Mao J, Tham TN, Gentry GA, Aubertin A, Chinchar VG. Cloning, sequence analysis, and expression of
the major capsid protein of the iridovirus frog virus 3. Virology 1996;216:431–436. [PubMed:
8607274]
Mao J, Hedrick RP, Chinchar VG. Molecular characterization, sequence analysis, and taxonomic position
of newly isolated fish iridoviruses. Virology 1997;229:212–220. [PubMed: 9123863]
Marsh IB, Whittington BJ, O’Rourke B, Hyatt AD, Chisholm O. Rapid differentiation of Australian,
European, and American ranaviruses based on variation in major capsid protein gene sequence. Mol
Cell Probes 2002;16:137–151. [PubMed: 12030764]
Mathias, M.; Scott, P. Série Agronegócios. SEBRAE/RJ; Rio de Janeiro: 2004. Potencial produtivo de
criação de rãs no Estado do Rio de Janeiro.
Mazzoni, R. PhD thesis. Universidade Federal de Goiás; Goiânia: 2006. Infecções por Ranavirus e cocos
Gram-positivos em girinos e rãs de criação (Rana catesbeiana Shaw, 1802) do estado de Goiás.
Miller SA, Dykes DA, Polesky HF. A simple salting out procedure for extracting DNA from human
nucleated cells. Nucleic Acids Res 1988;16:1215. [PubMed: 3344216]
Miller DL, Rajeev S, Gray MJ, Baldwin CA. Frog virus 3 infection, cultured American bullfrogs. Emerg
Infect Dis 2007;13:342–343. [PubMed: 17479910]
Posada D, Crandall KA. ModelTest: testing the model of DNA substitution. Bioinformatics 1998;14:817–
818. [PubMed: 9918953]
Rafferty, KA. Mass culture of amphibian cells, methods and observations concerning stability of cell
type. In: Mizell, M., editor. Biology of amphibian tumors. Springer Verlag; New York: 1969. p.
52-81.
Robert J, Morales H, Buck W, Cohen A, Marr S, Gantress J. Adaptive immunity and histopathology in
frog virus 3-infected Xenopus. Virology 2005;332:667–675. [PubMed: 15680432]
Rothenberg ME, Hogan SP. The eosinophil. Annu Rev Immunol 2006;24:147–174. [PubMed: 16551246]
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol
Biol Evol 1987;4:406–425. [PubMed: 3447015]
Swofford, DL. Phylogenetic analysis using parsimony (* and other methods). Sinauer Associates;
Sunderland, MA: 2002. PAUP*.
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA)
software version 4.0. Mol Biol Evol 2007;24:1596–1599. [PubMed: 17488738]
Tan WGH, Barkman TJ, Chinchar VG, Essani K. Comparative genomic analyses of frog virus 3, type
species of the genus Ranavirus (family Iridoviridae). Virology 2004;323:70–84. [PubMed:
15165820]
Thompson JD, Higgins DG, Gibson TJ. CLUSTALW: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res 1994;22:4673–4680. [PubMed: 7984417]
Tidona CA, Schnitzler P, Kehm R, Darai G. Is the major capsid protein of iridoviruses a suitable target
for the study of viral evolution? Virus Genes 1998;16:59–66. [PubMed: 9562891]
Webby R, Kalmarkoff J. Sequence comparison of the major capsid protein gene from 18 diverse
iridoviruses. Arch Virol 1998;143:1949–1966. [PubMed: 9856083]
Weng SP, He JG, Wang XH, Lu L, Deng M, Chan SM. Outbreaks of an iridovirus disease in cultured
tiger frog, Rana tigrina rugulosa, in southern China. J Fish Dis 2002;25:423–427.
Williams T, Barbosa-Solomieu V, Chinchar VG. A decade of advances in iridovirus research. Adv Virus
Res 2005;65:173–248. [PubMed: 16387197]
Willis DB, Granoff A. Frog virus 3 DNA is heavily methylated at CpG sequences. Virology
1980;107:250–257. [PubMed: 6255678]
Wolf K, Bullock G, Dunbar C, Quimby M. Tadpole edema virus: a viscerotropic pathogen for anuran
amphibians. J Infect Dis 1968;118:253–262. [PubMed: 5674065]
Zhang QY, Xiao F, Li ZQ, Gui JF, Mao JH, Chinchar VG. Characterization of an iridovirus from the
cultured pig frog Rana grylio with lethal syndrome. Dis Aquat Org 2001;48:27–36. [PubMed:
11843137]
Mazzoni et al. Page 10
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Zhang QY, Zhe Z, Xiao F, Li ZQ, Gui JF. Molecular Characterization of three Rana grylio virus (RGV)
isolates and Paralichthys olivaceus lymphocystis disease virus (LCDV-C) in iridoviruses.
Aquaculture 2006;251:1–10.
Zupanovic Z, Musso C, López G, Loureiro CL, Hyatt AD, Hengstberger S, Robinson AJ. Isolation and
characterization of iridoviruses from the giant toad Bufo marinus in Venezuela. Dis Aquat Org
1998;33:1–9. [PubMed: 9653454]
Mazzoni et al. Page 11
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 1.
Location of frog farms sampled in Goiás State. Brazil: 1: Fujioka; 2: Laranjeiras; 3; Dos Reis
Mazzoni et al. Page 12
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 2.
External gross lesions in Rana calesbeiana tadpoles with Ranavirus infection. In the center is
a normal tadpole, flanked by 2 ascitic tadpoles with ‘heart-shaped body’ (left) and 2 emaciated
tadpoles showing ‘arrow-shaped body’ (right). Scale bar = 2 cm
Mazzoni et al. Page 13
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 3.
Xenopus sp. kidney A6 cells inoculated with viral suspension obtained from sick Rana
catesbeiana tadpoles. (A) Mock-infected A6 cells; scale bar = 20 μm. (B) A6 cells with
cytopathic effect 48 h after inoculation at 25 to 27°C; star-shaped and elongated cells are
evidence of viral infection; scale bar = 10 μm
Mazzoni et al. Page 14
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 4.
(A) Amplification products of the MCP gene from the 3 Brazilian Rana catesbeiana viral
isolates (RCV-BR) (Lanes 1, 2, and 3) and frog virus 3 (Lane 4). Lane 5 is the negative control,
and Lane M is the molecular marker (1 kb Plus DNA ladder; Invitrogen), where ‘a’ indicates
1500 bp and ‘b’ 1000 bp. (B) Amplification products of Pol II gene from the 3 RCV-BR isolates
(Lanes 1, 2, and 3). Lane 4 is the negative control, and Lane M is the molecular marker (100
kb DNA ladder; Invitrogen), where ‘c’ indicates 500 bp. Purified virus genomic DNA was
used as a template in PCR reactions described in ‘Materials and methods’. PCR products were
separated on a 1 % agarose gel and visualized by staining with 0.5 μg ml
1
ethidium bromide
Mazzoni et al. Page 15
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Mazzoni et al. Page 16
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 5.
Multiple alignment of deduced amino acid sequence of MCP from the Brazilian Rana
catesbeiana viral isolate (GenBank Accession No. DQ897669) along with other members of
the genus Ranavirus: frog virus (FV3; GenBank Accession No. AY548484); Rana grylio virus
(RGV 9806. 9807. 9808; Zhang et al. 2006); Bohle iridovirus (BIV; GenBank Accession No.
AY 187046); tiger frog virus (TFV; GenBank Accession Nos. AY033630 and AF389451);
epizootic haematopoietic necrosis virus (EHNV; GenBank Accession No. AY187045); and
Ambystoma tigrinum virus (ATV; GenBank Accession No. AY50217). Amino acid residues
differing from the Brazilian sequence are shaded
Mazzoni et al. Page 17
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 6.
Phylogenetic analysis of MCP sequences. Neighbor-joining tree constructed using multiple
alignment (and algorithms) presented in MEGA4 (Tamura et al. 2007). Degree of confidence
for each branch point was determined by bootstrap analysis (10000 repetitions). For virus
abbreviations, see Fig. 5. Lymphocystis disease virus (LCDV) used as external group from the
genus Lymphocystisvirus
Mazzoni et al. Page 18
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 7.
Rana catesbeiana tadpole. (A) Kidney showing lesions produced by Ranavirus. Complete loss
of normal architecture. Cell necrosis with pyknosis and karyorrhexis (arrowheads),
mononuclear lymphocyte infiltrate (white arrow), and eosinophilic infiltration (black arrows).
H&E stain. Scale bar = 100 μm, (B) Liver with lesions produced by Ranavirus. Diffuse necrosis
with pyknosis and karyorrhexis, areas of steatosis, vacuolized hepotocytes with loss of
trabecular structure, and mononuclear infiltrate. Arrowheads indicate normal hepatocytes.
H&E stain. Scale bar = 50 μm
Mazzoni et al. Page 19
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Fig. 8.
Transmission electron micrograph from kidney of affected Rana catesbeiana tadpole with
signs of ascites. Samples were obtained from paraffin-embedded blocks after precisely locating
lesions on histology slides. Complete (white arrow) and incomplete (black arrow) iridovirus-
like particles. Viral particles seem to emerge from a finely granular, slightly electron-dense
mass (arrowhead). Scale bar = 360 nm
Mazzoni et al. Page 20
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Mazzoni et al. Page 21
Table 1
Source of tadpoles, location information, and number of tadpoles analyzed from each farm. See Fig. 1 for farm
locations
Farm name
Location
Sampled tadpoles (n)
County GPS coordinates
Fujioka Hidrolândia 17° 02′ 17.03″S
49° 12′ 46.94″ W
250
Laranjeiras Gameleira 16° 20′ 28.75″S
48° 44′ 19.63″ W
200
Dos Reis Gameleira 16° 24′ 15.24″ S
48° 46′ 03.70″ W
50
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Mazzoni et al. Page 22
Table 2
Primers used for PCR analysis: MCPcomp (MCP gene complete coding region); Pol II (RNA polymerase DNA
dependent-Pol II); IE-ICP 18 (immediate early protein-ICP 18)
Target gene
Primer sequence (5′–3′)
Amplicon size (bp)
Forward Reverse
IE-ICP 18
ATGATCCAAGCCTACCTGTGC
a
AAATGTCCTAATCTATACACC
a 479
MCP ATGTCTTCTGTAACTGGTTCA
AAAGACCCGTTTTGCAGCAAAC
b 1483
Pol II TCACCGCCGCAGACATCTTTAG GTAACCGTTCTTTTCGCAGTGG 377
a
Galli et al. (2006);
b
Hyatt et al. (2000)
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Mazzoni et al. Page 23
Table 3
Identities obtained when the MCP nucleotide sequence from the Brazilian Rana catesbeiana viral isolate
(GenBank Accession No. DQ897669) was aligned with published MCP sequences from anurans. ‘Source’ is
GenBank Accession No. or literature reference
Virus % identity Source
FV3 99.7 AY548484
RGV 9506 99 Zhang et al. (2006)
RGV 9507 99 Zhang et al. (2006)
Bohle iridovirus 98 AY187046
Rana tigrina ranavirus 98 AY033630
98 AP389451
RGV 9508 97 Zhang et al. (2006)
Epizootic hematopoietic necrosis virus 96 AY187045
Ambystoma tigrinum virus 95 AY150217
Dis Aquat Organ. Author manuscript; available in PMC 2010 July 9.