Failure to Detect the Novel Retrovirus XMRV in Chronic Fatigue Syndrome

Article (PDF Available)inPLoS ONE 5(1):e8519 · January 2010with41 Reads
DOI: 10.1371/journal.pone.0008519 · Source: PubMed
Abstract
In October 2009 it was reported that 68 of 101 patients with chronic fatigue syndrome (CFS) in the US were infected with a novel gamma retrovirus, xenotropic murine leukaemia virus-related virus (XMRV), a virus previously linked to prostate cancer. This finding, if confirmed, would have a profound effect on the understanding and treatment of an incapacitating disease affecting millions worldwide. We have investigated CFS sufferers in the UK to determine if they are carriers of XMRV. Patients in our CFS cohort had undergone medical screening to exclude detectable organic illness and met the CDC criteria for CFS. DNA extracted from blood samples of 186 CFS patients were screened for XMRV provirus and for the closely related murine leukaemia virus by nested PCR using specific oligonucleotide primers. To control for the integrity of the DNA, the cellular beta-globin gene was amplified. Negative controls (water) and a positive control (XMRV infectious molecular clone DNA) were included. While the beta-globin gene was amplified in all 186 samples, neither XMRV nor MLV sequences were detected. XMRV or MLV sequences were not amplified from DNA originating from CFS patients in the UK. Although we found no evidence that XMRV is associated with CFS in the UK, this may be a result of population differences between North America and Europe regarding the general prevalence of XMRV infection, and might also explain the fact that two US groups found XMRV in prostate cancer tissue, while two European studies did not.
Failure to Detect the Novel Retrovirus XMRV in Chronic
Fatigue Syndrome
Otto Erlwein
1
, Steve Kaye
1
, Myra O. McClure
1
*, Jonathan Weber
1
, Gillian Wills
1
, David Collier
2
, Simon
Wessely
3
, Anthony Cleare
3
1 Jefferiss Research Trust Laboratories, Section of Infectious Diseases, Wright-Fleming Institute, Faculty of Medicine, Imperial College London, St Mary’s Campus, Norfolk
Place, London, United Kingdom, 2 Social Genetic and Developmental Psychiatry Centre, Institute of Psychiatry (King’s College London) De Crespigny Park, Denmark Hill,
London, United Kingdom, 3 Department of Psychological Medicine, Institute of Psychiatry, King’s College London, Camberwell, London, United Kingdom
Abstract
Background:
In October 2009 it was reported that 68 of 101 patients with chronic fatigue syndrome (CFS) in the US were infected
with a novel gamma retrovirus, xenotropic murine leukaemia virus-related virus (XMRV), a virus previously linked to prostate
cancer. This finding, if confirmed, would have a profound effect on the understanding and treatment of an incapacitating disease
affecting millions worldwide. We have investigated CFS sufferers in the UK to determine if they are carriers of XMRV.
Methodology:
Patients in our CFS cohort had undergone medical screening to exclude detectable organic illness and met
the CDC criteria for CFS. DNA extracted from blood samples of 186 CFS patients were screened for XMRV provirus and for
the closely related murine leukaemia virus by nested PCR using specific oligonucleotide primers. To control for the integrity
of the DNA, the cellular beta-globin gene was amplified. Negative controls (water) and a positive control (XMRV infectious
molecular clone DNA) were included. While the beta-globin gene was amplified in all 186 samples, neither XMRV nor MLV
sequences were detected.
Conclusion:
XMRV or MLV sequences were not amplified from DNA originating from CFS patients in the UK. Although we
found no evidence that XMRV is associated with CFS in the UK, this may be a result of population differences between North
America and Europe regarding the general prevalence of XMRV infection, and might also explain the fact that two US
groups found XMRV in prostate cancer tissue, while two European studies did not.
Citation: Erlwein O, Kaye S, McClure MO, Weber J, Wills G, et al. (2010) Failure to Detect the Novel Retrovirus XMRV in Chronic Fatigue Syndrome. PLoS ONE 5(1):
e8519. doi:10.1371/journal.pone.0008519
Editor: Douglas F. Nixon, University of California San Francisco, United States of America
Received December 1, 2009; Accepted December 4, 2009; Published January 6, 2010
Copyright: ß 2010 Erlwein et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: AC, DC and SW are partially funded by the South London and Maudsley NHS Foundation Trust/Institute of Psychiatry National Institute of Health
Biomedical Resaerch Centre. The team from Imperial College is grateful for support from the NIHR Biomedical Research Centre Funding Scheme. The funders had
no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: m.mcclure@imperial.ac.uk
Introduction
A recent study by Lombardi et al. [1] describing a gamma-
retrovirus infection in 68 of 101 chronic fatigue syndrome (CFS)
patients was notable not only for its claim of a new viral aetiology of
a hitherto controversial disease, but also for the fact that proviral
DNA could be amplified from the peripheral blood mononuclear
cells (PBMC) of 3.75% (8/218) of the healthy controls. This follows
an earlier claim that 1.7% (5/300) of healthy Japanese blood donors
carried antibodies to the same virus [2]. The virus in question is a
recently discovered retrovirus, Xenotropic Murine Leukaemia
Virus (MLV)-Related Virus (XMRV).
In the original identification of XMRV in prostate cancer
stromal cells, Urisman et al. [3] confirmed by sequence analysis
that XMRV is not a laboratory contaminant, as is often the case
with claims of new retroviral associations with disease. It shares
.90% sequence identity in gag and env (two of the three viral
structural genes) with other xenotropic MLVs.
An association between XMRV and prostate cancer was
strengthened with th e demonstration of XMRV protein expres-
sion in malignant epithelial ce lls [4]. However, these results have
not been duplicated in studies conducted in Europe [5–7]. Both
prostate cancer and CFS have been linked to an Arg to Gln
mutation at codon 462 (R462Q) in the RNaseL gene, an
interferon-induced ribonuclease [8]. On activation, RNaseL
destroys single stranded cellular and viral RNA, thereby
preventing viral replication, blocking protein synthesis, triggering
cellular apoptosis and providing an innate anti-viral response.
The two US studies are of interest, not only because this would be
a further example of a virus association with cancer, but because
they represent the first demonstration of a gamma-retrovirus able
to infect human cells, over-riding the intrinsic immune
mecha nisms that were believed to protect humans from MLV
infection.
The XMRV sequences derived from prostate cancer tissue are
identical to those from CFS patients, but differ from xenotropic
MLV sequences, endorsing a genuine cross-species transmission.
However, the claim that XMRV is preferentially found in prostate
tumours from patients homozygous for the R462Q variant [3] is
not borne out by the second prostate cancer study to find XMRV
in patients [4], nor was the genetic variant detected in CFS
patients carrying XMRV [5].
PLoS ONE | www.plosone.org 1 January 2010 | Volume 5 | Issue 1 | e8519
The finding of Lombardi et al. of a 67% XMRV infection rate
among CFS patients, if confirmed, would have a serious impact on
understanding the pathogenesis of this complex and debilitating
disease and its treatment. Therefore, it was important to determine
if CFS sufferers in the UK were carriers of XMRV. We have
screened DNA extracts from the blood of CFS sufferers by PCRs
targeted at an XMRV-specific sequence and at a sequence
conserved amongst most murine retroviruses (MRV).
Methods
Patients
All patients gave written informed consent for the use of their
DNA to test aetiological theories of CFS, and the study was
approved by the South London and Maudsley NHS Trust Ethics
Committee. The study recruited 186 patients (62% female, age
range 19–70, mean 39.6611.3years) from consecutive referrals to
the CFS clinic at King’s College Hospital, London. All patients
had undergone medical screening to exclude detectable organic
illness, including a minimum of physical examination, urinalysis,
full blood count, urea and electrolytes, thyroid function tests, liver
function tests, 9 a.m. cortisol and ESR. Patients were interviewed
using a semi-structured interview for CFS [9] to determine
whether they met international consensus criteria for CFS. All
subjects met the CDC criteria [10]; patients with the Fukuda-
specified exclusionary psychiatric disorders, or somatisation
disorder (as per DSM-IV), were not included. The patient set
studied is a well-characterised and representative sample of CFS
patients who have been described previously: all were routine
clinic attendees, referred within the UK National Health Service,
who had taken part in prior studies of neuroendocrine functioning
[11] and/or of cognitive behaviour therapy [12]. As is typical of
the patients seen in this tertiary care centre, they were markedly
unwell. Few were working, and 19% were members of patient
support groups for CFS/ME [12–14]. The levels of fatigue in this
sample were high (mean Chalder Fatigue Scale, 26.365.4) [15], as
were levels of disability (mean Work and Social Adjustment Scale,
total score 28.267.2) [16]. The mean GHQ-12 score [17] was
19.768.1. Patients had been unwell for a median of 4.0 y (range
1–28 y). Of note was that 45% said their illness definitely related
to a viral illness and 45% said it might relate to a viral illness.
Overall, we conclude that this sample is typical of CFS patients
seen in specialist clinical services in the UK. We also know from
collaborative studies that our patients resemble those seen in other
specialist CFS services in the United States and Australia [18].
PCR detection of XMRV and MLV sequences. DNA was
extracted from EDTA whole blood using a standard phenol-based
organic deproteinisation procedure [19]. DNA concentrations
were determined by absorbance at 260 nm (A
260
). Each sample
was amplified in three nested PCRs using primers targeted to an
XMRV-specific sequence, to a sequence conserved amongst most
MLV and, as a control for sample addition and PCR-inhibition, to
a human beta-globin (hBG) sequence (Table 1). Each first-round
reaction was performed in a 25
ml volume containing 0.5 units
TaqGold (Applied BioSystems, Warrington, UK), 1 x TaqGold
reaction buffer (Applied BioSystems), 1.5 mM Mg
2+
, 200 mM
each dNTP, 2.5 pmol each primer to which 5
ml DNA extract or
control was added. Reaction conditions were one cycle of 94uC, 8
minutes, 35 cycles of 94uC 30 seconds, 55uC 30 seconds, 72uC30
seconds and one cycle 0f 72uC, 7 minutes. Second round reaction
mixes were identical to the first round and the sample was a 1
ml
transfer from the first round reactions. Second round reaction
conditions were as for the first round over 30 cycles. PCR
amplicons were visualised on a 1% agarose gel stained with
ethidium bromide. Each PCR run consisted of test samples, six
negative (water) and two positive controls. The positive control
was a dilution of a plasmid with a full-length XMRV (isolate
VP62) insert, generously gifted by Dr R. Silverman. To validate
the sensitivity of the PCR, an end-point dilution of the plasmid was
performed. To determine specificity of the PCR, a sample of
human DNA from the LNCaP prostate cancer cell line (American
Type Culture Collection, code CRL-1740) was amplified with the
XMRV and MLV primer sets. To ensure integrity of the DNA
extracts, three randomly selected samples were titrated to end-
point using the hBG PCR to determine if the PCR copy number
equated with the A
260
. To determine if the DNA extracts exhibited
low level non-specific inhibition of PCR, 10 samples were
subjected to 30 cycles of the first round hBG PCR (reaction mix
and conditions as above) followed by 40 cycles of a nested real-
time SYBR-green PCR using the SYBR-green Fast PCR kit
(Roche, Lewes UK) according to the manufacturer’s instructions.
Results
Nested PCR Validation
Based on A
260
of the purified plasmid, both primer sets
(XMRV, MLV) were able to amplify a single target copy added to
the reaction. Amplification of 600 ng of LNCaP cellular DNA
added to XMRV and MLV PCRs yielded no non-specific bands
when viewed on an ethidium bromide-stained agarose gel.
Quantification of DNA samples from three randomly selected
test samples by end-point dilution PCR with the hBG primer set
showed concurrence of the PCR-determined copy number with
A
260
, thus indicating integrity of the DNA preparations. Nested
real-time amplification of 10 samples showed no evidence of non-
specific inhibition as determined by the slope of the amplification
curves and the height of the signal plateau.
PCR Analysis of Test Samples
Input DNA ranged from 10 to 600 ng (1.6610
3
to 1.1610
5
cell
equivalents) as determined by A
260
of which 149 samples had an
input of .100 ng and 106 samples .200 ng. None of the 186 test
samples analysed yielded a specific PCR product with either the
XMRV or MLV primer sets and no non-specific PCR products were
observed. A specific hBG product was amplified from all 186 test
samples. The positive control was amplified in each run by the
Table 1. Oligonucleotide Primers.
Target Sequence Location
XMRV Forward outer 59CATTCTGTATCAGTTAACCTAC 39 411–432
1
Reverse outer 59 ATGATCTCGAGAACACTTAAAG 39 606–588
1
Forward inner 59 GACTTTTTGGAGTGGCTTTGT 39 441–461
1
Reverse inner 59 ACAGAAGAACAACAAAACAAA TC 39 566–544
1
MLV Forward outer 59 GGATCAAGCCCCACATACAG 39 2796–2847
1
Reverse outer 59 CATCAAACAGGGTGGGACTG 39 3179–3160
1
Forward inner 59 AGAAGTCAACAAGCGGG TGG 39 2926–2945
1
Reverse inner 59 GGTGGAGTCTCAGGCAGAAA 39 3062–3043
1
hBG Forward outer 59 TGGTGGTCTACCCTTGGACC 39 148–162
2
Reverse outer 59 GAGGTTGTCCAGGTGAGCCA 39 296–277
2
Forward inner 59 GAGGTTCTTTGAGTCCTTTGG 39 170–190
2
Reverse inner 59 CATCACTAAAGGCACCGAGCA 39 273–253
2
Locations in GenBank accessions
1
EF185282,
2
NM000518.4.
doi:10.1371/journal.pone.0008519.t001
XMRV and CFS
PLoS ONE | www.plosone.org 2 January 2010 | Volume 5 | Issue 1 | e8519
XMRV and MLV primer sets. A stained gel of the XMRV and MLV
PCR products is shown in figure 1 and a representative sample of our
results with CFS DNA and MLV primers is shown in figure 2.
Discussion
Unlike the study of Lombardi et al., we have failed to detect
XMRV or closely related MRV proviral DNA sequences in any
sample from CFS cases. There have been numerous claims for an
infective aetiology to CFS over the years, not least because, as in this
sample, many patients report that their symptoms were triggered by
an infective episode. Prospective epidemiological studies have
confirmed that certain infective agents, for example Epstein Barr
virus, are unequivocally associated with subsequent CFS [20], even
if the mechanisms are unclear and almost certainly multi factorial.
Nearly two decades ago, sequences from another retrovirus, the
human T-lymphotropic virus type ll, were amplified from the
PBMCs of 10/12 (83%) adult and 13/18 paediatric CFS patients,
but not from healthy control subjects [21]. However, subsequent
studies carried out on small numbers (20–30) of CFS patients, failed
to confirm evidence for HTLV (type 1 or 11) [22–25] or other
retroviruses, including the closely-related simian T lymphotropic
virus type l, the prototype foamy virus, simian retrovirus, bovine and
feline leukaemia viruses [26] and HIV-1 [23].
The Lombardi paper is the first to study a significantly larger
number of people than that in any previous study and to detect a
virus only recently discovered. Our study resembles that of
Lombardi et al. in certain respects. Both studies use the widely
accepted 1994 clinical case definition of CFS
10
. Lombardi et al.
reported that their cases ‘‘presented with severe disability’’ and we
provide quantifiable evidence confirming high levels of disability in
our subjects. Our subjects were also typical of those seen in
secondary and tertiary care in other centres.
Our own study also differs from that of Lombardi in other
respects. Firstly, the PCR operator was blinded to the provenance
of the DNA samples. In fact, with the exception of the PCR
controls, all 186 DNA test samples originated from CFS patients.
Care was taken to grow the XMRV plasmid in a laboratory in
which no MLV had been cultured and no MLV vectors used and
the PCR was carried out in a CPA-accredited Molecular
Diagnostics Unit which processes only human tissue. Multiple
(six) water (negative) controls were included in every run to detect
low level contamination and a PCR to amplify a sequence that is
conserved in most murine leukaemia viruses was included in order
to expose any circulating MLV contamination and to detect any
variant of XMRV that might be circulating in the UK CFS
population.
Based on our molecular data, we do not share the conviction
that XMRV may be a contributory factor in the pathogenesis of
CFS, at least in the U.K.
Acknowledgments
The assistance of Sarah Bull in data collection and processing is gratefully
acknowledged.
Author Contributions
Conceived and designed the experiments: SK MM. Performed the
experiments: OWE SK. Analyzed the data: SK MM. Contributed
reagents/materials/analysis tools: SK GW DC SW AC. Wrote the paper:
SK MM. Facilitated the study by setting up the collaboration: JW.
Responsible for providing samples and associated data from a well
characterised and valuable cohort of subjects: SW.
References
1. Lombardi V, Ruscetti FW, Gupta JD, Pfost MA, Hagen KS, et al. (2009)
Detection of an infectious retrovirus, XMRV, in blood cells of patients with
chronic fatigue syndrome. Science 326: 585–589.
2. Furuta RA, Miyazawa T, Sugiyama T, Kimura T, Hirayama F, et al. (2009)
The Prevalence of Xenotropic Murine Leukemia Virus-related Virus in Healthy
Blood Donors in Japan. Cold Spring Harbor Retrovirus Symposium.
3. Urisman A, Molinaro RJ, Fischer N Plummer SJ, Casey G, et al. (2006)
Identification of a novel gammaretrovirus in prostate tumors of patients
homozygous for R462Q RNaseL variant. PLoS Pathog 2: 211–225.
4. Schlaberg R, Choe DJ, Brown KR, Thaker HM, Singh IR (2009) XMRV is
present in malignant prostatic epithelium and is associated with prostate cancer,
especially high-grade tumours. Proc Natl Acad Sci U S A 106: 16351–6.
5. Hohn O, Krause H, Barbarotto P, Niederstadt L, Beimforde N, et al. (2009)
Lack of evidence for xenotropic murine leukemia virus-related virus (XMRV) in
German prostate cancer patients. Retrovirology 6: 92.
6. D’Arcy FR, Foley A, Perry L, Marignol L, Lawler M, et al. (2008) No evidence
of XMRV in Irish prostate cancer patients with the R462Q mutations.
European Urology 7 Suppl: 271.
7. Fischer N, Hellwinkel O, Schulz C, Chun FK, Huland H, et al. (2008)
Prevalence of human gamma retrovirus XMRV in sporadic prostate cancer.
J Clin Virol 43: 277–283.
8. Silverman RH (2007) A scientific journey through the 2-5A/RNaseL system.
Cytokine Growth Factor Rev 18: 381–388.
9. Sharpe M, Chalder T, Palmer I, Wessely S (1997) Chronic fatigue syndrome. A
practical guide to assessment and management. General Hospital Psychiatry 19:
185–99.
10. Fukuda K, Straus S, Hickie I, Sharpe MC, Dobbins JG, et al. (1994) The
chronic fatigue syndrome: a comprehensive approach to its definition and study.
Annals of Internal Medicine 121: 953–959.
11. Roberts AD, Charler M, Papadopoulos AS, Wessely S, Chalder T, et al. (2009)
Does hypocortisolism predict a p oor response to cognitive behavioural therapy
in chronic fatigue syndrome? Psychological Medicine. In press.
12. Quarmby L, Rimes KA, Deale A, Wessely S, Chalder T (2007) Cognitive-
behaviour therapy for chronic fatigue syndrome: comparison of outcomes within
and outside the confines of a randomised controlled trial. Behaviour Research &
Therapy 45: 1085–94.
Figure 1. PCR products of the XMRV VP62 clone. Primers are
generic to MLV (lanes 1 and 2) or specific to XMRV (lanes 4 and 5). The
sizes of the respective fragments are shown. Lane 3–200 bp molecular
size ladder.
doi:10.1371/journal.pone.0008519.g001
Figure 2. Nested PCR from the DNA of 8 CFS patients. Products
of generic MLV primers (including XMRV) are shown. Lanes 1–8, CFS
patient DNA (2
nd
round); lanes 9 and 10, XMRV 2
nd
round and 1
st
round
positive controls; lanes 11 and 12, DNA of uninfected cell line LNCaP;
lanes 13–18, water controls.
doi:10.1371/journal.pone.0008519.g002
XMRV and CFS
PLoS ONE | www.plosone.org 3 January 2010 | Volume 5 | Issue 1 | e8519
13. Euba R, Chalder T, Deale A, Wessely S (1996) A comparison of the
characteristics of chronic fatigue syndrome in primary and tertiary care. British
Journal of Psychiatry 168: 121–6.
14. Deale A, Chalder T, Marks I, Wessely S (1997) A randomised controlled trial of
cognitive behaviour versus relaxation therapy for chronic fatigue syndrome.
American Journal of Psychiatry 154: 408–14.
15. Chalder T, Berelowitz G, Pawlikowska T, Watts L, Wessely S, et al. (1993)
Development of a fatigue scale. Journal of Psychosomatic Research 37: 147–153.
16. Mundt JC, Marks IM, Shear K, Griest JH (2002) The work and social
adjustment scale: a simple measure of impairment in functioning. British Journal
of Psychiatry 180: 461–464.
17. Goldberg DP, Blackwell B (1970) Psychiatric illness in general practice. A
detailed study using a new method of case identification. British Medical Journal
1: 439–443.
18. Wilson AHI, Hadzi-Pavlovic D, Wakefield D, Parker G, et al. (2001) What is
chronic fatigue syndrome? Heterogeneity within an international multicentre
study. Australian and New Zealand Journal of Psychiatry 35: 520–527.
19. Freeman B, Smith N, Curtis C, Huckett L, Mill J, et al. (2003) DNA from buccal
swabs recruited by mail: evaluation of storage effects on long-term stability and
suitability for multiplex polymerase chain reaction genotyping. Behav Genet 33:
67–72.
20. White P, Thomas J, Kangro HO, Bruce-Jones WD, Amess J, et al. (2001)
Predictions and associations of fatigue syndromes and mood disorders that occur
after infectious mononucleosis. Lancet 358: 1946–1954.
21. De Freitas E, Hilliard B, Cheney PR, Bell DS, Kiggundu E, et al. (1991)
Retroviral sequences related to human T-lymphotropic virus type II in patients
with chronic fatigue immune dysfunction syndrome. Proc Natl Acad Sci USA
88: 2922–2926.
22. Gow J, Simpson K, Schliephake A, Behan WM, Morrison LJ, et al. (1992)
Search for retrovirus in the chronic fatigue syndrome. J Clin pathol 45:
1058–1061.
23. Honda M, Kitamura K, Nakasone T, Fukushima Y, Matsuda S, et al. (1993)
Japanese patients with chronic fatigue syndrome are negative for known
retrovirus infections. Microbiol. Immunol 37: 779–784.
24. Folks TM, Heneine W, Khan A, Woods T, Chapman L, et al. (1993)
Investigation of retroviral involvement in chronic fatigue syndrome. Ciba Found
Symp 173: 160–166.
25. Khan AS, Heneine WM, Chapman LE, Gary HE Jr, Woods TC, et al. (1993)
Assessment of retrovirus sequence and other possible risk factors for the chronic
fatigue syndrome in adults. Annals of Internal Med 118: 241–245.
26. Heneine W, Woods TC, Sinha SD, Khan AS, Chapman LE, et al. (1994) Lack
of evidence for infection with known human and animal retroviruses in patients
with chronic fatigue syndrome. Clin Infect Dis suppl 1: s121–125.
XMRV and CFS
PLoS ONE | www.plosone.org 4 January 2010 | Volume 5 | Issue 1 | e8519
    • "Beim CFS und der Neurasthenie handelt es sich um 2 Störungen, die durch verschiedene somatische Symptome, aber v. a. durch eine Erschöpfung gekennzeichnet sind [4, 39], die zu erheblichen Einbussen der sozialen Funktionsfähigkeit führen kann [18, 62]. Die Überlappung dieser Störungen untereinander und zu affektiven Störungen ist groß [1, 25, 111] , und die genauen Entstehungsmechanismen oder Ursachen werden nach wie vor unklar und kontrovers diskutiert [12, 24, 35]. Ein spezifischer Test existiert auch hier nicht [24, 25, 104]. "
    [Show abstract] [Hide abstract] ABSTRACT: In der Schweiz gibt es 11 verschiedene, historisch gewachsene Sozialversicherungen, deren grundsätzliche Ausgestaltung im Allgemeinen Teil des Sozialversicherungsgesetzes (ATSG) dargelegt ist. Die soziale Sicherung für behinderte Menschen und solche mit chronischen Erkrankungen wird u. a. von der Invalidenversicherung gewährleistet, die durch das Bundesgesetz über die Invalidenversicherung - aktuell in der 6. Revision - geregelt wird. Da sich die Rechtsprechung bezüglich der Invalidenversicherung in den letzten 10 Jahren erheblich gewandelt hat - was sich insbesondere auf die Leistungszusprache bei psychischen Störungen auswirkt - soll der vorliegende Beitrag einen Überblick über die für den medizinischen Experten relevanten juristischen Aspekte geben. Es ist hervorzuheben, dass die Rechtsprechung Prinzipien zur Einordung von Folgen spezifischer Krankheitsentitäten normativ festgelegt und diese im letzten Jahrzehnt weiterausgebaut hat. Die vom Rechtsanwender vorgenommene Prüfung der „willentlichen Überwindbarkeit“ stellt dabei auf einen Kriterienkatalog ab, der aus medizinischer Sicht nicht ausreichend belegt ist. In der juristischen Literatur der Schweiz wird diese gegenwärtige (Rechts-)Praxis kontrovers diskutiert, und Anpassungen werden erwogen. Abstract There are 11 different historically established social security insurances in Switzerland. Social security for disabled and chronically ill people is mostly covered by the disability insurance. The disability insurance is governed by a federal law which has been revised six times, the last amendments having been introduced in 2012. The disability insurance legislation has changed much in the past 10 years and this has had a particularly great impact on the benefits awarded for psychiatric disorders. This article outlines several important facets of the disability insurance legislation relevant to psychiatric work capacity evaluations. Of particular interest are the special legal rules applied to specific illness groups, which have been expanded during the last decade. The concept of “voluntary surmountability” has arguably had the most impact and is based on a catalogue of criteria with an insufficient scientific foundation. The impact and possible changes of the current jurisdiction is currently being discussed in the Swiss juristic literature and amendments are under consideration.
    Full-text · Article · May 2015
    • "However, no virus has been consistently found among the CFS population with all original studies failing to be reproduced due to either experimental design flaws, one-off incidents, or isolated sample populations [51]. The most recent virus to be linked and consequently refuted by follow-up and replication studies was the XMRV retrovirus [52]. Consensus suggests that viral pathogens play a nonspecific role in stressing the body before and after the onset of the disorder, either triggering it or taking advantage of a lowered immune system. "
    [Show abstract] [Hide abstract] ABSTRACT: Chronic fatigue syndrome (CFS) is a poorly understood condition that presents as long-term physical and mental fatigue with associated symptoms of pain and sensitivity across a broad range of systems in the body. The poor understanding of the disorder comes from the varying clinical diagnostic definitions as well as the broad array of body systems from which its symptoms present. Studies on metabolism and CFS suggest irregularities in energy metabolism, amino acid metabolism, nucleotide metabolism, nitrogen metabolism, hormone metabolism, and oxidative stress metabolism. The overwhelming body of evidence suggests an oxidative environment with the minimal utilization of mitochondria for efficient energy production. This is coupled with a reduced excretion of amino acids and nitrogen in general. Metabolomics is a developing field that studies metabolism within a living system under varying conditions of stimuli. Through its development, there has been the optimisation of techniques to do large-scale hypothesis-generating untargeted studies as well as hypothesis-testing targeted studies. These techniques are introduced and show an important future direction for research into complex illnesses such as CFS.
    Article · Oct 2014
    • "However use of the term in this context may result in misleading assignation of the syndrome directly and solely to an infectious agent. This has been seen previously during the XMRV expedition464748495051. Alternatively the identification of this illness as due to immune dysfunction following infection or other initiating event represents a paradigm in closer fit with observable clinical signs and laboratory findings. "
    [Show abstract] [Hide abstract] ABSTRACT: Background Several diagnostic definitions are available for Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME) that varies significantly in their symptom criteria. This pilot study was conducted to determine whether simple biological and clinical measures differed between CFS/ME patients meeting the 1994 Centres for Disease Control and Prevention (CDC) criteria, the International Consensus Criteria (ICC), as well as healthy controls. Methods A total of 45 CFS/ME patients and 30 healthy controls from the South East Queensland region of Australia provided a blood sample, reported on their current symptoms, as well as aspects of their physical and social health using the Short-Form Health Survey (SF-36), and the World Health Organisation Disability Adjustment Schedule 2.0 (WHO DAS 2.0). Differences were examined using independent sample t-testing. Results Patients fulfilling the ICC definition reported significantly lower scores (p < 0.05) for physical functioning, physical role, bodily pain, and social functioning than those that only fulfilled the 1994 CDC definition. ICC patients reported significantly greater (p < 0.05) disability across all domains of the WHO DAS 2.0. Conclusions These preliminary findings suggest that the ICC identifies a distinct subgroup found within patients complying with the 1994 CDC definition, with more severe impairment to their physical and social functioning.
    Full-text · Article · Apr 2014
Show more