Article

Differential expression of new splice variants of the neurotensin receptor 1 gene in human prostate cancer cell lines

Laboratorio de Genética, Instituto Universitario de Enfermedades Tropicales de Canarias, Universidad de La Laguna, Avda. Astrofísico Francisco Sánchez s/n, 38206 La Laguna, Canarias, Spain.
Peptides (Impact Factor: 2.62). 12/2009; 31(2):242-7. DOI: 10.1016/j.peptides.2009.12.007
Source: PubMed

ABSTRACT

Neurotensin is a neuroendocrine peptide acting as a trophic factor in a variety of cells in vivo but it can also function as an autocrine growth factor in human prostate cancer cells in vitro. In addition, the high-affinity G protein-coupled NT receptor (NTS1) is overexpressed in prostate cancer cell lines. Increasing evidence argues for a direct correlation between specific alternative splice variants and cancer. We detected four splice variants of the NTS1 receptor in human prostate cancer cell lines. These isoforms include one or more exons skipping as well as an alternative 5' splice donor site and are expressed in the late-stage androgen independent prostate cancer cell lines PC3 and DU145, but not in the early-stage androgen-sensitive LNCaP or in normal prostate tissue, which only express the normal transcript. This result shows new splice variants of NTS1 for the first time. The differential expression observed among prostate cancer cell lines and normal prostate tissue opens the interesting possibility of a new role of NT/NTS1 pathway in prostate cancer.

Full-text

Available from: Ricardo Reyes
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Page 1
Author's personal copy
Differential expression of new splice variants of the neurotensin receptor
1 gene in human prostate cancer cell lines
Teresa A. Almeida
a,
*
, Yurena Rodriguez
b
, Mariano Herna
´
ndez
a
, Ricardo Reyes
b
, Aixa R. Bello
b
a
Laboratorio de Gene
´
tica, Instituto Universitario de Enfermedades Tropicales de Canarias, Universidad de La Laguna, Avda. Astrofı
´
sico Francisco Sa
´
nchez s/n,
38206 La Laguna, Canarias, Spain
b
Departamento de Microbiologı
´
a y Biologı
´
a Celular, Facultad de Biologı
´
a, Universidad de La Laguna, and ICIC (Instituto Canario de Investigacio
´
n del Ca
´
ncer),
Avda. Astrofı
´
sico Francisco Sa
´
nchez s/n, 38206 La Laguna, Canarias, Spain
1. Introduction
Neurotensin (NT) is a tridecapeptide that fulfils a dual function
of neurotransmitter or neuromodulator in the nervous system and
of paracrine or endocrine modulator in the periphery [22]. NT was
equally reported in functions linked specifically to neoplastic
progression, including proliferation of prostate cancer cells [5]. Its
effects are mainly mediated by the high-affinity NT receptor NTS1
and its mRNA is present in both the central nervous system and
peripheral tissues [22]. NTS1 mRNA is highly overexpressed by a
variety of primary human cancers as compared to normal tissues
[7,14]. In addition, human cancer cell lines, including those from
lung, pancreas, colon and prostate, express high levels of NTS1 and
exhibit growth responses to sub-nanomolar concentrations of NT
[4,16]. NTS1 therefore represents a possible target for the
treatment of some types of cancer and the characterization of
truncated receptor forms may provide new insights into the
physiological function of the NT pathway.
Western blot analysis using an antibody against NTS1 detected
two major bands (50 kDa and 33 kDa) in the human prostate
cancer cell line PC3 [3] . Although the authors suggested that the
smaller band represented breakdown products of the normal
protein, a truncated form of the unglycosylated receptor cannot be
discarded [2]. However, no alternative splice mRNAs have been
described for NTS1.
Inthisstudywedemonstratethathumanprostatecancercelllines
PC3 and DU145 express multiple NTS1 mRNA isoforms as a result of
alternative splicing. These new variants include one or more exons
skipping as well as an alternative 5
0
splice donor site located in the
third intron. Interestingly, the androgen-dependent cell line LNCaP
and healthy prostate tissue express only the normal transcript.
2. Materials and methods
2.1. RNA extraction and RT-PCR
PC3 and DU145 cell lines were kindly provided by Dr. M. Llanos
Valero (Centro Regional de Investigaciones Biome
´
dicas, Universi-
dad de Castilla-La Mancha, Spain). LNCaP cell line was kindly
supplied by Dr. R. Pe
´
rez Machı
´
n (Instituto Canario de investigacio
´
n
del Cancer, Spain). These cell lines were grown in RPMI-1640
medium supplemented with 10% heat-inactivated Fetal
Bovine Serum,
L
-glutamine and 1% (v/v) Penicillin/Streptomycin
Peptides 31 (2010) 242–247
ARTICLE INFO
Article history:
Received 15 September 2009
Received in revised form 4 December 2009
Accepted 4 December 2009
Available online 14 December 2009
Keywords:
Neurotensin
Neurotensin receptor 1
RT-PCR
Alternative splicing
Cancer
ABSTRACT
Neurotensin is a neuroendocrine peptide acting as a trophic factor in a variety of cells in vivo but it can
also function as an autocrine growth factor in human prostate cancer cells in vitro. In addition, the high-
affinity G protein-coupled NT receptor (NTS1) is overe xpressed in prostate cancer cell lines. Increasing
evidence argues for a direct correlation between specific alternative splice variants and cancer. We
detected four splice variants of the NTS1 receptor in human prostate cancer cell lines. These isoforms
include one or more exons skipping as well as an alternative 5
0
splice donor site and are expressed in the
late-stage androgen independent prostate cancer cell lines PC3 and DU145, but not in the early-stage
androgen-sensitive LNCaP or in normal prost ate tissue, which only express the normal transcript. This
result shows new splice variant s of NTS1 for the first time. The differential expression observed among
prostate cancer cell lines and normal prostate tissue opens the interesting possibility of a new role of NT/
NTS1 pathway in prostate cancer.
ß 2009 Elsevier Inc. All rights reserved.
* Corresponding author at: Laboratorio de Gene
´
tica, Instituto Universitario de
Enfermedades Tropicales y Salud Pu
´
blica de Canarias, Universidad de La Laguna,
Campus Anchieta, Avda. Astrofı
´
sico Francisco Sa
´
nchez s/n, 38206 La Laguna,
Canarias, Spain. Tel.: +34 922 316502x6116; fax: +34 922 318490.
E-mail address: tacosalm@ull.es (T.A. Almeida).
Contents lists available at ScienceDirect
Peptides
journal homepage: www.elsevier.com/locate/peptides
0196-9781/$ see front matter ß 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.peptides.2009.12.007
Page 2
Author's personal copy
antibiotics at 37 8Cin5%CO
2
. Total RNA was automatically
extracted using the Maxwell 16 LEV total RNA purification kit with
the Maxwell
1
16 Instrument (Promega, Madison, USA), which
specifically extracts RNA from cytoplasm of cultured eukaryotic
cells. First strand cDNA was synthesized from 2
m
g of RNA using
Moloney murine leukemia virus reverse transcriptase (M-MLV),
RNase H Minus, Point Mutant (Promega, Madison, USA) and
random hexamers according to manufacturer’s instructions
(Promega, Madison, USA). cDNA from normal prostate was kindly
supplied by Dr. N. Papadopoulos (Sidney Kimmel Comprehensive
Cancer Center, USA), and was synthesized from Poly(A) RNA of
normal prostate tissue (Clontech, Palo Alto, USA). The resulting
cDNA samples were amplified by PCR using the ‘‘splice targeted
primer approach’’ [24]. For that purpose, primers were designed to
overlap each unique exon junction. The specificity of the primers
was tested using a BLAST analysis against the genomic NCBI
database. The sequences of the primers used are shown in Table 1.
PCR mixes contained 0.2
m
M primers, 0.2
m
l Phire Hot Start DNA
polymerase (Finnzymes, Espoo, Finland), 1.5 mM MgCl
2
, 200
m
;
dNTPs and cDNA in a final volume of 20
m
l. PCR reactions included
an initial 98 8C denaturation step for 30 s, and then 35–40 cycles of
the following cycling conditions: 10 s at 98 8C, 10 s at optimum T
m
and 15 s at 72 8C. Optimum T
m
was 62 8C for NTS1
b
and NTS1
d
, and
60 8C for the rest of the amplicons. The beta isoform of the protein
phosphatase 1 housekeeping gene, PPP1CB, served as control of RT-
PCR reactions with 25 rounds of amplification. To test if genomic
DNA was also present in RNA samples, RT samples were amplified
with intron-specific primers of the angiotensin-converting enzyme
gene (ACE).
2.2. Cloning and sequencing
The PCR products that showed a single band of the expected size
were purified using GenElute
TM
PCR clean-up Kit (Sigma–Aldrich,
Steinheim, Germany) and sequenced. PCR products with additional
bands were also purified and then cloned into pGEM-T vector
system (Promega, Madison, USA) following manufacturer’s rec-
ommendation. White recombinant colonies were PCR screened
using vector SP6/T7 flanking primers and PCR products of positive
clones were purified as explained above and sequenced.
DNA sequencing was performed in our University facilities using
the DYEnamic ET Dye Terminator Cycle Sequencing Kit (GeHealth-
care Bio-Sciences AB, Uppsala, Sweden). The sequencing reactions
were run in a MegaBACE 1000 DNA Analysis System (GeHealthcare
Bio-Sciences AB, Uppsala, Sweden). Electropherograms were
visualized with the software Chromas (Technelysium Pty Ltd.).
2.3. Absolute quantification
To quantify the relative abundance of each transcript in PC3 we
used a standard curve constructed by amplifying known amounts
of target DNA [20]. These DNA standards consisted of five different
amplicons produced individually by RT-PCR with specific primers
corresponding to native and four new splice variants of NTS1.
These PCR products were further purified using PCR Clean-Up
System (Promega, Madison, USA) and quantified by optical
measurement at OD
260 nm
. To generate a standard curve, serial
dilutions from 10 million to 10 copies of each amplicon were done
in TE buffer. A Biorad MyiQ Real Time PCR detection system
apparatus (Biorad, Foster City, CA) was used to perform the
quantitative expression study. Each sample was analyzed in
triplicate in a total reaction volume of 20
m
l consisting of different
dilutions of DNA standards, or 10-fold dilution of PC3 cDNA, 10
m
l
of 2 SensiMixPlus SYBR & Fluorescein kit (Bioline Ltd., London,
UK) and 0.2
m
M of each primer. The cycling conditions were 95 8C
for 10 min followed by 45 cycles of 95 8C for 15 s, 60 8C for 30 s and
72 8C for 30 s. For each experiment, a non-template reaction was
included as negative control. The specificity of the PCR reactions
was confirmed by melting curves analysis of the products as well
as by size verification of the amplicon in a conventional agarose
gel.
Quantification of NTS1 transcripts was performed using Biorad
MyiQ software 3.0 based on ‘Second Derivative Maximum Method’
[20]. In this method, a second derivative maximum within the
exponential phase of the amplification curve is linearly related to a
starting concentration of template cDNA molecules.
3. Results
All cDNA samples were negative for ACE amplification,
indicating that nuclear contamination was absent (data not
shown).
cDNA amplification using a forward primer spanning exons 1–2
(1–2F) and a reverse primer in exon 4 (4R) showed a band of 396 bp
corresponding to the expected size in all samples. However, in PC3
and DU145 an additional higher band was visualized in the agarose
gel (Fig. 1A). Sequencing analysis showed that the lower band
corresponds unequivocally with exons 1–4 of the previously
described NTS1. This transcript encodes a protein of 418 amino
acids (aa). The sequencing of the higher band revealed the insertion
of the initial 37 bp of intron 3 between exons 3 and 4 (Fig. 2).
Comparison with the genomic sequence revealed a new splice
donor site (GT) located 37 bp downstream from the end of exon 3
leading to extension of this exon (Fig. 2). This insertion created a
premature stop codon just after exon 3 predicting a truncated
protein of 336 aa (Fig. 3). To detect each transcript we designed two
new reverse primers with a 5
0
sequence from exon 4 and a 3
0
sequence from intron 3 (4–Int3R) and exon 3 (4–3R), respectively.
As expected, amplification of each transcript was detected in PC3
and DU145 (Fig. 1B and C). The new variant was named NTS1
a
.
PCR using forward primer spanning exons 1–3 (1–3F) and two
reverse primers, 4–3R and 4–Int3R showed that PC3 contains both
the intron-containing and intron-less alternative transcripts
(Fig. 1D and E). Sequencing established that exon 1 was followed,
out of reading frame, by exon 3 while exon 2 was skipped. This
transcript named NTS1
b
would encode a truncated protein of 280
aa (Fig. 3). However, a larger 363 aa protein results from the
transcript that splices exon 1 to exon 3, containing the initial 37 bp
from intron 3 (NTS1
d
) leading to 42 new aa corresponding to exon
3 and 37 bp of intron 3 (Fig. 3). Interestingly, after inclusion of the
partial intron 3 sequence, the normal reading frame of the protein
is restored so that the C-terminal end encoded by exon 4 and
containing 82 aa is the same as the wild-type protein.
PCR using forward primer spanning exons 1–4 (1–4F) and a
reverse primer in exon 4 (4R), amplified a fragment of the expected
size (299 bp) in PC3 and DU145 (Fig. 1). Sequencing confirmed that
exon 1 was followed by exon 4 while exons 2 and 3 were skipped
Table 1
Sequence of forward (F) and reverse (R) primers used to amplify the NTS1 mRNA
isoforms. Primers sequences of the housekeeping gene PPP1CB are also included.
Primer name 5
0
region 3
0
region Sequence
1–2F Exon 1 Exon 2 AGGTCGTCATACAG
GTCAAC
1–3F Exon 1 Exon 3 AGGTCGTCATACAG
GTGCAG
1–4F Exon 1 Exon 4 AGGTCGTCATACAG
GTTCCT
4–3R Exon 4 Exon 3 GGTAGAAGTCATAGAGGAAC
GGAGT
4–Int3R Exon 4 Intron 3 TGGTAGAAGTCATAGAGGAAC
TTGTC
4R Exon 4 Exon 4 GGTTGTACAGGATGGGGTTG
4-AR Exon 4 Exon 4 CAGGCTCCTCCTGGACAC
PPP1CB-F AACCATGAGTGTGCTAGCATCA
PPP1CB-R CACCAGCATTATCAAACTCGCC
ECA-1F CTGGAGACCACTCCCATCCTTTCT
ECA-1R GATGTGGCCATCACATTCGTCAGAT
T.A. Almeida et al. / Peptides 31 (2010) 242–247
243
Page 3
Author's personal copy
(NTS1
g
). The splicing of exon 1 to exon 4 changed the reading
frame of the transcript, creating a premature stop codon after the
addition of 2 aa from exon 4 (Fig. 3). This alternative transcript
would encode a short 241 aa protein.
Absolute quantification of each mRNA transcript shows that
PC3 cell line preferentially expresses full-length NTS1 mRNA
(Table 2), and the relative abundance of the alternatively spliced
NTS1 mRNAs is NTS1
a
> NTS1
b
> NTS1
d
> NTS1
g
.
4. Discussion
We detected for the first time four different forms of the NTS1
receptor mRNA in human prostate cancer cell lines. NTS1 receptor
shares a general topology with others GPCR, which consist of an
extracellular N terminus followed by seven transmembrane
domains (TM) connected via extracellular (E1, E2, E3) and
cytoplasmic (I1, I2, I3) loops and a cytoplasmic C terminus
(Fig. 3). Human and rat NTS1 (rNTS1) [22] share 84% homology and
a previous study using rNTS1 site directed mutagenesis identified
six residues located in TM4, TM6 and E3 that interact with NT
peptide [9]. Five of these conserved amino acids are also present in
human NTS1 (Fig. 3). Regarding receptor functionality, previous
studies showed that the third intracellular loop of the NTS1
receptor was required for coupling to G
q/11
[25], while the C-
terminal portion of the receptor was involved in coupling to G
i/o
and G
s
[10,18]. Finally, the residues involved in NT-induced
receptor uncoupling and internalization through the formation of
stable receptor-
b
-arrestin complexes are located at the C-terminal
end (Fig. 3) and are involved in the regulation of receptor
desensitization, sequestration, and resensitization [6,11].
The translation of the NTS1
a
mRNA predicts a 336 aa protein
which conserves the 1–6 TM domains, I1–3 and E1–2 loops, but the
C terminus is now extracellularly located and contains only 10
amino acids that correspond to the E3 loop of the long isoform
(Fig. 3). Recently, Seck et al. [15] have conducted functional studies
with different isoforms of another GPCR, the calcitonin receptor.
They have shown that a truncated receptor form lacking the
cytoplasmic tail plus the seventh TM is expressed, although with
Fig. 1. Detection of NTS1 transcripts in prostate cancer cell lines and normal tissue. Top panel shows the expression of the PPICB used as housekeeping gene in all samples
analyzed. (A–F) The position of the different primers, the expected size of each amplicon and the PCR products observed in the agarose gel. Boxes represent exons and the
striped box indicates intron 3 sequence. Lines 1–5 on the top of each gel represent PCR products of PC3, DU145, LNCaP, normal prostate and PCR negative control, respectively.
M, 100 bp DNA ladder molecular size standard.
T.A. Almeida et al. / Peptides 31 (2010) 242–247
244
Page 4
Author's personal copy
lower intensity, on the cell surface with an extracellular C-terminal
domain. Therefore, it is possible that NTS1
a
may anchor in the
plasma membrane and it may also bind NT, since four conserved
amino acids involved in agonist binding are also present in this
form (Fig. 3). In addition, it conserves the I3 loop suggesting that
activation of the PLC pathway is feasible. However, the absence of
the C-terminal end point to a reduced affinity for
b
-arrestin and
impaired receptor internalization. In fact, Hermans et al. [8] have
Fig. 3. Schematic representation of NTS1 at gene and protein level and amino acid sequence alignments of wild-type and the four predicted isoforms. (A) NTS1 gene is divided
into four exons (I–IV) interrupted by three introns (indicated by dashed lines). Transmembrane segments (1–7) are shown by solid grey boxes and E and I denote extracellular
and intracellular domains, respectively. (B) Serpentine representation of the NTS1 receptor. (C) Sequence alignment of the full-length NTS1 and the four alternative splice
variants. Yellow shading represents invariant residues with respect to wild-type protein. Black boxes above sequence alignments represent transmembrane segments of the
native protein. Asterisk indicates amino acids involved in NT binding and underlying residues are important for receptor internalization according to rNTS1. The different
domains of the full-length receptor were obtained from Vincent et al. [22]. (For interpretation of the references to color in this figure caption, the reader is referred to the web
version of the article.)
Fig. 2. DNA chromatogram showing 37 bp of intron 3 that are included in the mature mRNA in the isoforms NTS1
a
and NTS1
d
. Analysis of the genomic sequence revealed an
alternative splice donor site (GT) located in intron 3.
T.A. Almeida et al. / Peptides 31 (2010) 242–247
245
Page 5
Author's personal copy
shown that a truncated form of rNTS1 with a deletion of 52 amino
acids from the COOH-terminal end did not affect the ability of the
receptor to achieve phospholipids hydrolysis, but receptor
internalization was dramatically reduced. Recently it has been
shown that NTS1 is able to dimerize in detergent solution in a
concentration-dependent manner [23]. Interestingly, an alterna-
tive splice variant of the calcitonin receptor that lacks the seventh
transmembrane helical bundle causes a dominant-negative effect
on the surface expression of the full-length isoform [15]. Therefore,
even if this receptor isoform is unable to exert a functional
response in the cell, the expression of this truncated variant may
affect the surface expression of the full-length isoform.
NTS1
b
isoform would encode a truncated protein of 280 aa
which presents TM1–4, E1–2 and I1–2 encoded by exon 1 equal to
the long isoform (Fig. 3). However,41 aminoacidsencoded by exon3
and the initial 35 nucleotides of exon 4 are specific to this variant. A
similar isoform has been detected in rat and mouse NTS2, which
share about 60% homology with NTS1. In both, the alternative splice
variant (vNTS2) lacks an internal 181 bp sequence. This deletion
leads to a shift of the reading frame which changes the C-terminal
amino acid sequence leading to a truncated protein of 282 and 281
amino acids, respectively [1,12,19]. Hydrophobicity analysis indi-
cated that rat vNTS2 is a 5-transmembrane domain receptor with an
intracellular C-terminal tail [12]. COS-7 cells transfected with rat
vNTS2 demonstrate that this variant (1) binds to NT although with
considerably lower affinity, (2) presents functional coupling to the
MAPK signaling pathway, (3) associates both with itself and with the
full-length 7-TM receptor to form homo- and heterodimer species
[12]. The sequence identity between vNTS2 and NTS1
b
is around
60% so it is possible that this truncated isoform may exert some of
the effects observed for rat vNTS2.
NTS1
d
would encode a truncated protein of 363 aa and
conserves TM1–4, I1–2 and E1 compared to the full-length isoform
(Fig. 3). However, the E2 loop presents additional amino acids
which are encoded by exon 3 and the 37 nucleotides of intron 3.
Interestingly, the recovery of the open reading frame after intron
inclusion leads to a TM5 equivalent to TM7 of the wild-type form
and an identical carboxyl terminus to that of NTS1 (Fig. 3).
Hydrophobicity analysis using different transmembrane topology
prediction methods available through the Expasy Proteomics
Server [26] did not identify new TM domains. Although we do not
yet know if this isoform can insert in the plasma membrane and
bind to neurotensin, the C-terminal end is identical to native
protein, and hence it may exert all the functions attributable to this
domain, such as coupling to G
i/o
and G
s
and receptor internaliza-
tion. In fact, deletion of most of the I3 residues of rNTS1 and
expression of the deleted receptor in CHO cells resulted in a total
loss of PLC activation by NT without affecting the ability of the
peptide to stimulate cAMP production [25].
Finally, the 241 aa protein resulting from the splicing of exon 1
to exon 4 is devoid of the last three transmembrane domains and
presents an extracellular C-terminal end that corresponds to the E2
loop of the long form plus two new amino acids (Fig. 3). The
absence of important structural and functional domains in this
truncated receptor suggests that its ability to insert in the plasma
membrane, bind to NT and activate G protein-coupled pathways
may be impaired.
Androgen deprivation of LNCaP cells in culture gives rise to
synthesis and secretion of neurotensin, in turn inducing increased
cell proliferation and invasion [17]. The presence of truncated
receptor isoforms in PC3 and DU145, two cell lines representing an
advanced stage of the disease, points to new NT signaling in
prostate cancer. Although the NTS1 isoforms described here have
been detected in prostate cancer cell lines, we are already aware of
the presence of these new mRNA isoforms in primary tumors of
myometrium, but not in matched normal myometrium (unpub-
lished results).
The increasing evidence of peptide receptor overexpression as
well as tumor specific peptide receptor has stimulated the
development of specific target, since small radiolabeled peptides
can bind to these receptors and deliver radioactivity to the tumor
cells for cancer diagnosis and/or targeted radiotherapy [13].
Alternatively, the presence of cancer-related alternative splicing of
transmembrane proteins offers great potential for the selective
therapeutic targeting of tumors [21].
In conclusion, in this study we describe for the first time in the
prostate cancer cell lines PC3 and DU145, four new alternative splice
variants of NTS1 receptor. If these mRNA are finally translated in
theircorresponding protein,these cancercell lines would co-express
native as well as truncated forms of NTS1 receptor.
Acknowledgements
The authors are very grateful to Dr. Luz Candenas for the
revision of the manuscript and helpful comments and to Guido
Jones for a careful review of the text. This investigation was
supported in part by the Instituto Canario de Investigacio
´
n del
Cancer (ICIC).
References
[1] Botto JM, Sarret P, Vincent JP, Mazella J. Identification and expression of a
variant isoform of the levocabastine-sensitive neurotensin receptor in the
mouse central nervous system. FEBS Lett 1997;400:211–4.
[2] Boudin H, Grauz-Guyon A, Faure MP, Forgez P, Lhiaubet AM, Dennis M, et al.
Immunological recognition of different forms of the neurotensin receptor in
transfected cells and rat brain. Biochem J 1995;305:277–83.
[3] Carraway RE, Gui X, Cochrane DE. Ca2+ channel blockers enhance neurotensin
(NT) binding and inhibit NT-induced inositol phosphate formation in prostate
cancer PC3 cells. J Pharmacol Exp Ther 2003;307:640–50.
[4] Carraway RE, Hassan S. Neurotensin receptor binding and neurotensin-in-
duced growth signaling in prostate cancer PC3 cells are sensitive to metabolic
stress. Regul Pept 2007;7:140–53.
[5] Carraway RE, Plona AM. Involvement of neurotensin in cancer growth: evi-
dence, mechanisms and development of diagnostic tools. Peptides 2006;27:
2445–60.
[6] Chabry J, Botto JM, Nouel D, Beaudet A, Vincent JP, Mazella J. Thr-422 and Tyr-
424 residues in the carboxyl terminus are critical for the internalization of the
rat neurotensin receptor. J Biol Chem 1995;270:2439–42.
[7] Elek J, Pinzon W, Park KH, Narayanan R. Relevant genomics of neurotensin
receptor in cancer. Anticancer Res 2000;20:53–8.
[8] Hermans E, Octave JN, Maloteaux JM. Interaction of the COOH-terminal
domain of the neurotensin receptor with a G protein does not control the
phospholipase C activation but is involved in the agonist-induced internaliza-
tion. Mol Pharmacol 1996;49:365–72.
[9] Kitabgi P. Functional domains of the subtype 1 neurotensin receptor (NTS1).
Peptides 2006;27:2461–8.
[10] Najimi M, Gailly P, Maloteaux JM, Hermans E. Distinct regions of C-terminus of
the high affinity neurotensin receptor mediate the functional coupling with
pertussis toxin sensitive and insensitive G-proteins. FEBS Lett 2002;512:
329–33.
[11] Oakley RH, Laporte SA, Holt JA, Barak LS, Caron MG. Molecular determinants
underlying the formation of stable intracellular G protein-coupled receptor-
beta-arrestin complexes after receptor endocytosis. J Biol Chem 2001;276:
19452–60.
[12] Perron A, Sarret P, Gendron L, Stroh T, Beaudet A. Identification and functional
characterization of a 5-transmembrane domain variant isoform of the NTS2
neurotensin receptor in rat central nervous system. J Biol Chem 2005;280:
10219–27.
Table 2
Quantification of NTS1 mRNA full-length and alternative splice variants expressed
in PC3 cell line.
Standard curve r
2
Linear range Copy/RNA (molecules)
NTS1 native 0.998 10
7
–10
2
49.7 10
3
NTS1
a
0.998 10
7
–10
2
2.8 10
3
NTS1
b
0.999 10
7
–10
2
1.1 10
3
NTS1
d
0.999 10
7
–10
1
6.0 10
2
NTS1
g
0.997 10
7
–10
2
3.1 10
2
r
2
represents the correlation coefficient of the standard curve. Copy/RNA, number of
mRNA copies in 1
m
g of total RNA.
T.A. Almeida et al. / Peptides 31 (2010) 242–247
246
Page 6
Author's personal copy
[13] Reubi JC, Ma
¨
cke HR, Krenning EP. Candidates for peptide receptor radiothera-
py today and in the future. J Nucl Med 2005;46(Suppl. 1):67S–75S.
[14] Reubi JC, Waser B, Schaer JC, Laissue JA. Neurotensin receptors in human
neoplasms: high incidence in Ewing’s sarcomas. Int J Cancer 1999;82:
213–8.
[15] Seck T, Pellegrini M, Florea AM, Grignoux V, Baron R, Mierke DF, et al. The delta
e13 isoform of the calcitonin receptor forms a six-transmembrane domain
receptor with dominant-negative effects on receptor surface expression and
signaling. Mol Endocrinol 2005;19:2132–44.
[16] Seethalakshmi L, Mitra SP, Dobner PR, Menon M, Carraway RE. Neurotensin
receptor expression in prostate cancer cell line and growth effect of NT at
physiological concentrations. Prostate 1997;31:183–92.
[17] Sehgal I, Powers S, Huntley B, Powis G, Pittelkow M, Maihle NJ. Neurotensin is
an autocrine trophic factor stimulated by androgen withdrawal in human
prostate cancer. Proc Natl Acad Sci USA 1994;91:4673–7.
[18] Skrzydelski D, Lhiaubet AM, Lebeau A, Forgez P, Yamada M, Hermans E,
et al. Differential involvement of intracellular domains of the rat
NTS1 neurotensin receptor in coupling to G proteins: a molecular basis
for a gonist-directed trafficking of receptor stimulus. Mol Pharmacol
2003;64:421–9.
[19] Sun YJ, Maeno H, Aoki S, Wada K. Mouse neurotensin receptor 2 gene (Ntsr2):
genomic organization, transcriptional regulation and genetic mapping on
chromosome 12. Brain Res Mol Brain Res 2001;95:167–71.
[20] TichopadA,Pfaf MW,Didier A. Tissue-specificexpressionpatternofbovineprion
gene: quantification using real-time RT-PCR. Mol Cell Probes 2003;17:5–10.
[21] Venables JP. Aberrant and alternative splicing in cancer. Cancer Res
2004;64:7647–54.
[22] Vincent JP, Mazella J, Kitabgi P. Neurotensin and neurotensin receptors. Trends
Pharmacol Sci 1999;20:302–9.
[23] White JF, Grodnitzky J, Louis JM, Trinh LB, Shiloach J, Gutierrez J, et al.
Dimerization of the class A G protein-coupled neurotensin receptor NTS1
alters G protein interaction. Proc Natl Acad Sci USA 2007;104:12199–204.
[24] Williams DM, Koduri S, Li Z, Hankins WD, Poola I. Primer design strategies for
the targeted amplification of alternatively spliced molecules. Anal Biochem
1999;271:194–7.
[25] Yamada M, Yamada M, Watson MA, Richelson E. Deletion mutation in the
putative third intracellular loop of the rat neurotensin receptor abolishes
polyphosphoinositide hydrolysis but not cyclic AMP formation in CHO-K1
cells. Mol Pharmacol 1994;46:470–6.
[26] http://www.expasy.org.
T.A. Almeida et al. / Peptides 31 (2010) 242–247
247
Page 7
  • Source
    • "Similarly, relative strong inductions in the in vivo setting were observed for NTSR1 in LNCaP and PC-3 cells (Fig. 3E andTable III). The NTSR1 receptor is over-expressed in numerous types of solid tumors and NTSR1 receptor binding to neurotensin (NT) has been reported to increase proliferation of several types of cancer cells, including prostate cancer cells [19,34]. Further, NT functions via autocrine, paracrine, and endocrine actions in prostate cancer tissues [35,36] . "
    [Show abstract] [Hide abstract] ABSTRACT: Membrane receptors are frequent targets of cancer therapeutic and imaging agents. However, promising in vitro results often do not translate to in vivo clinical applications. To better understand this obstacle, we measured the expression differences in receptor signatures among several human prostate cancer cell lines and xenografts as a function of tumorigenicity. Messenger RNA and protein expression levels for integrin α(ν) β(3), neurotensin receptor 1 (NTSR1), prostate specific membrane antigen (PSMA), and prostate stem cell antigen (PSCA) were measured in LNCaP, C4-2, and PC-3 human prostate cancer cell lines and in murine xenografts using quantitative reverse transcriptase polymerase chain reaction, flow cytometry, and immunohistochemistry. Stable expression patterns were observed for integrin α(ν) and PSMA in all cells and corresponding xenografts. Integrin β(3) mRNA expression was greatly reduced in C4-2 xenografts and greatly elevated in PC-3 xenografts compared with the corresponding cultured cells. NTSR1 mRNA expression was greatly elevated in LNCaP and PC-3 xenografts. PSCA mRNA expression was elevated in C4-2 xenografts when compared with C4-2 cells cultured in vitro. Furthermore, at the protein level, PSCA was re-expressed in all xenografts compared with cells in culture. The regulation of mRNA and protein expression of the cell-surface target proteins α(ν) β(3), NTSR1, PSMA, and PSCA, in prostate cancer cells with different tumorigenic potential, was influenced by factors of the microenvironment, differing between cell cultures and murine xenotransplants. Integrin α(ν) β(3), NTRS1 and PSCA mRNA expression increased with tumorigenic potential, but mRNA expression levels for these proteins do not translate directly to equivalent expression levels of membrane bound protein.
    Full-text · Article · Apr 2012 · The Prostate
  • Source
    • "Experiments using a specific antagonist or knockdown of the NTSR1 using short interfering RNA suggest that NTSR1 mediates the effects of neurotensin on cancer cells, although NTSR3/sortilin, which is often coexpressed in cancer cells, may modulate NTSR1 signalling [14,16]. Splice variants of the NTSR1 were recently detected in prostate cancer cell lines, however, no functional studies of these have been conducted [17]. Recent data have suggested that the NTSR1 receptor gene may be a downstream target of the extracellular signal-regulated kinase (ERK) and Tcf/β-catenin pathways [18,19], and increased expression of NTSR1 during progression of colon tumorigenesis has been reported [20,21]. "
    [Show abstract] [Hide abstract] ABSTRACT: Neurotensin has been found to promote colon carcinogenesis in rats and mice, and proliferation of human colon carcinoma cell lines, but the mechanisms involved are not clear. We have examined signalling pathways activated by neurotensin in colorectal and pancreatic carcinoma cells. Colon carcinoma cell lines HCT116 and HT29 and pancreatic adenocarcinoma cell line Panc-1 were cultured and stimulated with neurotensin or epidermal growth factor (EGF). DNA synthesis was determined by incorporation of radiolabelled thymidine into DNA. Levels and phosphorylation of proteins in signalling pathways were assessed by Western blotting. Neurotensin stimulated the phosphorylation of both extracellular signal-regulated kinase (ERK) and Akt in all three cell lines, but apparently did so through different pathways. In Panc-1 cells, neurotensin-induced phosphorylation of ERK, but not Akt, was dependent on protein kinase C (PKC), whereas an inhibitor of the β-isoform of phosphoinositide 3-kinase (PI3K), TGX221, abolished neurotensin-induced Akt phosphorylation in these cells, and there was no evidence of EGF receptor (EGFR) transactivation. In HT29 cells, in contrast, the EGFR tyrosine kinase inhibitor gefitinib blocked neurotensin-stimulated phosphorylation of both ERK and Akt, indicating transactivation of EGFR, independently of PKC. In HCT116 cells, neurotensin induced both a PKC-dependent phosphorylation of ERK and a metalloproteinase-mediated transactivation of EGFR that was associated with a gefitinib-sensitive phosphorylation of the downstream adaptor protein Shc. The activation of Akt was also inhibited by gefitinib, but only partly, suggesting a mechanism in addition to EGFR transactivation. Inhibition of PKC blocked neurotensin-induced DNA synthesis in HCT116 cells. While acting predominantly through PKC in Panc-1 cells and via EGFR transactivation in HT29 cells, neurotensin used both these pathways in HCT116 cells. In these cells, neurotensin-induced activation of ERK and stimulation of DNA synthesis was PKC-dependent, whereas activation of the PI3K/Akt pathway was mediated by stimulation of metalloproteinases and subsequent transactivation of the EGFR. Thus, the data show that the signalling mechanisms mediating the effects of neurotensin involve multiple pathways and are cell-dependent.
    Full-text · Article · Oct 2011 · BMC Cancer
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Leiomyomas or fibroids are the most frequently diagnosed tumors of the female genital tract, and their growth seems to be steroid-hormone dependent by a yet undetermined cellular and molecular mechanism. Sexual hormones induce the secretion of growth factor peptides and the expression of their receptors, stimulating cell proliferation. One of these factors is neurotensin, and increasing evidence suggests that it can promote growth of different cancer cells. Since there are no data on neurotensin expression in normal and tumoral uterine tissue, we have analyzed the expression of NTS and NTSR1 receptor using immunohistochemistry for protein detection, in situ hybridization to detect cells expressing NTS mRNA, and RT-PCR to detect NTSR1 transcript as well as any of the alternative splice variants recently described for this receptor. We found that NTS and NTSR1 are expressed in connective cells of normal myometrium. In leiomyomas, immunoreactivity for NTS and NTSR1 receptor is colocalized in the smooth muscle cells that are also transcribing NTS. Women receiving high doses of steroids for in vitro fertilization showed tumor growth and increased immunoreactivity for neurotensin and NTSR1 receptor. Interestingly, alternative splice variants of NTSR1 receptor were detected only in tumoral tissue. These findings suggest a role of steroid hormones inducing neurotensin expression in leiomyoma smooth muscle cells. In these cells, NTS could act autocrinally through NTSR1 receptor, promoting their proliferation.
    Full-text · Article · Oct 2010 · Biology of Reproduction
Show more

Similar Publications