Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India

Abstract

Type 1 diabetes (T1D) is a multifactorial autoimmune disorder where interaction and integration of immune response genes along with environmental factors play a role in autoimmune destruction of the insulin producing Pancreatic Beta cells.
We have studied four single nucleotide polymorphisms (FokI site in Exon 2, BsmI and ApaI sites in Intron 8 and TaqI site in exon 9) in the vitamin D receptor (VDR) gene using PCR-RFLP and HLA-DRB1 alleles using PCR and hybridization with sequence specific oligonucleotide probes and studied their interaction using LD based statistics for non-linked loci followed by sequence analysis of the vitamin D response element (VDRE) present in the promoter region of HLA-DRB1 0301. Haplotypes, constructed using SHEsis program for four single nucleotide polymorphisms in the VDR gene, were studied for their interaction with HLA-DRB1 alleles in 233 T1D patients and 191 healthy controls from North India. A significant increase of haplotypes FBAt and fBAT (p<0.02, OR = 1.44 and p<0.002, OR = 3.23 respectively) was observed in the patients. Both the haplotypes FBAt and fBAT were significantly increased in male patients with age at onset less than 18 years; however, fBAT was significantly increased in female patients irrespective of their age at onset. LD based statistics showed significant interaction between the high producer F and T alleles with HLA-DRB1 0301. F and T alleles of VDR have been shown to contribute to VDR mRNA independently. The promoter sequence analysis of HLA-DRB1 0301 showed presence of VDRE involved in higher expression of HLA-DRB1 030, which was confirmed by flow cytometry and real time PCR analysis.
These data suggest that the interaction between VDR and HLA alleles is mediated by VDRE present in the promoter region of HLA-DRB1 0301 allele, which may be detrimental for the manifestation of T1D in the absence of 1,25-(OH)(2)D(3) in early childhood due to poor expression of DRB1 0301 in the thymus resulting in autoimmunity.

Full text

Interaction of Vitamin D Receptor with HLA DRB1*0301
in Type 1 Diabetes Patients from North India
Neetu Israni
1
, Ravinder Goswami
2
, Avinash Kumar
1
, Rajni Rani
1
*
1Molecular Immunogenetics Group, National Institute of Immunology, New Delhi, India, 2Endocrinology and Metabolism Department, All India Institute of Medical
Sciences, New Delhi, India
Abstract
Background:
Type 1 diabetes (T1D) is a multifactorial autoimmune disorder where interaction and integration of immune
response genes along with environmental factors play a role in autoimmune destruction of the insulin producing Pancreatic
Beta cells.
Methodology/Principal Findings:
We have studied four single nucleotide polymorphisms (FokI site in Exon 2, BsmI and ApaI
sites in Intron 8 and TaqI site in exon 9) in the vitamin D receptor (VDR) gene using PCR-RFLP and HLA-DRB1 alleles using PCR
and hybridization with sequence specific oligonucleotide probes and studied their interaction using LD based statistics for
non-linked loci followed by sequence analysis of the vitamin D response element (VDRE) present in the promoter region of
HLA-DRB1*0301. Haplotypes, constructed using SHEsis program for four single nucleotide polymorphisms in the VDR gene,
were studied for their interaction with HLA-DRB1 alleles in 233 T1D patients and 191 healthy controls from North India. A
significant increase of haplotypes FBAt and fBAT (p,0.02, OR = 1.44 and p,0.002, OR = 3.23 respectively) was observed in
the patients. Both the haplotypes FBAt and fBAT were significantly increased in male patients with age at onset less than 18
years; however, fBAT was significantly increased in female patients irrespective of their age at onset. LD based statistics
showed significant interaction between the high producer Fand Talleles with HLA-DRB1*0301.Fand Talleles of VDR have
been shown to contribute to VDR mRNA independently. The promoter sequence analysis of HLA-DRB1*0301 showed
presence of VDRE involved in higher expression of HLA-DRB1*030, which was confirmed by flow cytometry and real time
PCR analysis.
Conclusions/Significance:
These data suggest that the interaction between VDR and HLA alleles is mediated by VDRE
present in the promoter region of HLA-DRB1*0301 allele, which may be detrimental for the manifestation of T1D in the
absence of 1,25-(OH)
2
D
3
in early childhood due to poor expression of DRB1*0301 in the thymus resulting in autoimmunity.
Citation: Israni N, Goswami R, Kumar A, Rani R (2009) Interaction of Vitamin D Receptor with HLA DRB1*0301 in Type 1 Diabetes Patients from North India. PLoS
ONE 4(12): e8023. doi:10.1371/journal.pone.0008023
Editor: Amanda Ewart Toland, Ohio State University Medical Center, United States of America
Received May 28, 2009; Accepted October 27, 2009; Published December 2, 2009
Copyright: ß2009 Israni et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The project was funded in part by a grant from Department of Science and Technology (DST), Department of Biotechnology (DBT), Ministry of Science
and Technology, Government of India and partly by Core funds of National Institute of Immunology, New Delhi, India. The funders had no role in study design,
data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: rajni@nii.res.in
Introduction
Type 1 diabetes (T1D) is a multifactorial, autoimmune disorder
where the insulin producing pancreatic beta cells are destroyed by
one’s own immune system. The disorder occurs with an incidence
of 10.5/100,000/year in India [1]. T1D develops as a result of
complex interaction of many genetic and environmental factors
leading to autoimmune destruction of the insulin producing
Pancreatic Beta cells. While 20 genomic intervals have been
implicated for the manifestation of the disease, role of an intricate
network of the products of these genes cannot be ruled out. We
have shown earlier that simultaneous presence of DRB1*0301
along with homozygous INS-VNTR class-I was significantly
increased (p,10
28
) in T1D patients, giving a relative risk of
70.81 [2]. Simultaneous presence of high secretor genotypes of
TNF-a-308 (GA +AA) along with high secretor genotypes of IL-6,
IL-10 and TGF-b1were also significantly increased in T1D
patients. Low secretor genotype of TNF- a-308 GG along with low
secretor genotypes of IFN-c, high secretor genotypes of IL-6, and
TGF- b1were protective. This effect of TNF-ahigh secretor
genotype was independent of predisposing HLA-DRB1*0301 [3].
To further understand the intricate network of genes regulating
the immune responses, we have studied the interaction of vitamin D
receptor (VDR) polymorphic alleles with predisposing HLA alleles in
T1D patients using Linkage Disequilibrium (LD) based statistics
between two unlinked loci.
Vitamin D Receptor (VDR) is a ligand dependent transcription
factor that belongs to the super family of the Nuclear Hormone
Receptors [4]. The ligand for VDR is Vitamin D3 i.e., 1,25-
(OH)
2
D
3
which mediates its biological actions through VDR.
Binding of 1,25-(OH)
2
D
3
induces conformational changes in VDR
which promotes its hetero-dimerization with Retinoid X Receptor
(RXR), followed by translocation of this complex into the nucleus.
The RXR-VDR heterodimer binds to the vitamin D
3
responsive
elements (VDRE) in promoter regions of 1,25-(OH)
2
D
3
responsive
genes[5], which in turn results in the regulatory function of 1,25-
PLoS ONE | www.plosone.org 1 December 2009 | Volume 4 | Issue 12 | e8023

(OH)
2
D
3
. In the absence of classical responsive elements, 1,25-
(OH)
2
D
3
may control the expression of some genes like cytokine
genes by targeting inducible transcription factors like NFAT in IL-
2 in a sequence specific manner [6]. 1,25-(OH)
2
D
3
has been
shown to have an important immuno-modulatory role since it
represses transcription of IL-2 [7,8], IFN-c[9], GM-CSF [10] and
IL-12 [11] and up regulates the production of Th2 cytokines IL-4
and TGF-b1 [12], thereby inhibiting the overall Th1 responses. It
has been shown to enhance the development of TH2 cells via a
direct effect on naive CD-4 cells [5]. Besides, 1,25-(OH)
2
D
3
has
also been shown to modulate the expression of HLA class-II alleles
on monocytes and human bone cells [13,14]
In NOD mice, administration of 1,25-(OH)
2
D
3
before the onset
of Insulitis, has been effectively shown to prevent the disease
progression. However, this treatment was found to be ineffective
when Insulitis had already been established. Treatment of adult
NOD mice with 1,25-(OH)
2
D
3
analog has also been shown to be
effective [15–18]. Similarly, in humans, vitamin D supplementa-
tion in early childhood has been shown to reduce the incidence of
T1D [19,20]. Since 1,25-(OH)
2
D
3
is a VDR ligand, we have
studied the VDR gene polymorphisms and their interaction with
the most predisposing MHC alleles to investigate their role, if any,
in the pathophysiology of T1D. The VDR single nucleotide
polymorphisms (SNPs) studied include the T.C SNP in exon2
initiation codon detected with FokI restriction enzyme [21], the
A.G SNP detected with BsmI [22] and G.T SNP detected with
ApaI [23] located in Intron 8, and a silent C.T SNP [24] detected
with TaqI, located in Exon 9. We studied the interaction between
VDR alleles and predisposing HLA alleles using LD based statistics
[25] and subsequently sequenced the promoter region of the
predisposing MHC allele to detect the VDRE sequence which has
been shown to modulate the expression of the HLA alleles [26],
suggesting the functional implications of the statistically significant
interaction.
Results
VDR FokI, BsmI, ApaI and TaqI Genotypes and Haplotypes
in T1D Patients
Table 1 shows the frequencies of FokI, BsmI, ApaI and TaqI
genotypes (figure 1A–D) in the T1D patient group as compared to
the control group. FokI,BsmI and TaqI sites were found to be in
Hardy Weinberg equilibrium both in patients as well as controls
and ApaI site was in Hardy Weinberg disequilibrium in both
patients and controls. While there were no significant differences
in the genotypes of ApaI and TaqI in patients and controls. FokI ‘ff’
was significantly increased in the patient group as compared to
controls (p,0.047) and BsmI ‘bb’ was significantly decreased in the
patient group (p,0.04). However, these differences did not remain
significant after Boneferroni’s correction.
Haplotype analysis was carried out for the four restriction sites
studied in the VDR gene in patients and controls using SHEsis
program (http://202.120.7.14/analysis/myAnalysis.php) [27].
Additionally, Famhap (http://famhap.meb.uni-bonn.de) was used
to confirm the frequencies of the haplotypes. Since both Famhap
and SHEsis were giving similar results, we carried out the rest of
the analysis using SHEsis only. Table 2 shows the haplotype
frequencies of VDR in T1D patients and controls. The software
was instructed to drop frequencies less than 0.03 in the analysis.
The analysis showed that FokI site was in a very weak linkage
disequilibium (LD) with BsmI, ApaI and TaqI with D’ values of
0.004, 0.01 and 0.04 respectively. BsmI, however, was in strong LD
with ApaI and TaqI with D’ values of 0.91 and 0.93 and ApaI was
also in strong LD with TaqI with a D’ value of 0.97. Significant
differences in terms of haplotypes was observed between patients
and controls with a global chi-square of 20.9 for 6 degrees of
freedom with a p value of 0.002. Individually, haplotype FBAt and
fBAT were significantly increased in T1D patients (p,0.02 and
,0.001 respectively) and fBAt was significantly reduced in them as
compared to controls (p,0.036).
Association of VDR FokI-BsmI-ApaI-TaqI Haplotypes with
Age at Onset
To study if the VDR haplotypes are associated with age at
onset, we divided the patients into two groups adult onset i.e.,
above 18 and young onset as below or equal to 18 years (Table 3
shows data on 223 samples in whom the exact age at onset was
known). The analysis showed that haplotypes fBAT anf FBAt to be
significantly increased in patients who developed diabetes before
18 years of age (p,0.0002 and 0.0077 respectively) and haplotype
FbaT seemed to be protective from younger onset of T1D
(p,0.037). However, adult onset was not significantly associated
with any VDR haplotypes in T1D patients.
Association of VDR FokI-BsmI-ApaI-TaqI Haplotypes with
Gender and Age at Onset of T1D Patients
To study if this association of VDR haplotypes had any gender
bias, comparisons were done between female/male patients and
female/male controls and also with all controls (female +males).
Table 4 shows the gender-wise analysis of VDR haplotype using
SHEsis software. While fBAT was significantly increased in female
patients as compared to controls (both female controls and all
controls), FBAt was significantly increased in males as compared to
controls (both male controls and all controls). FbaT was
significantly reduced in female patients when compared to female
controls and fBAt was significantly reduced in male patients as
compared to controls. A comparison of female patients with male
patients did not reveal any significant differences. Since the
patients with younger age at onset were showing significant
differences, we analysed the data with respect to age at onset in the
two genders (data not shown). The haplotypes FBAt and fBAT
were significantly increased in male patients below the age at onset
of 18 years as compared to controls (p,0.0024 and p,0.0017
respectively) and FBAT was significantly reduced (p,0.0038) in
the male patients below the age at onset of 18 years as compared
to controls. No significant differences were observed in the VDR
haplotypes of male patients with age at onset above 18 years when
compared to controls. However, in the females, the haplotype
fBAT was significantly increased in patients irrespective of their
age at onset whether early or adult onset and haplotype FbaT was
significantly reduced in female patients with less than 18years age
at onset.
Gene to Gene Interaction of VDR Haplotypes with
Predisposing HLA Alleles
Based on the SHEsis and Famhap analysis, haplotypes were
constructed manually for each sample. The haplotype with the
highest frequency as calculated by SHEsis was constructed from
thegenotypeofeachsampleandthesecondhaplotypewas
constructed by subtraction of the first haplotype. Simultaneous
presence of different haplotypes with the predisposing HLA
alleles DRB1*0301, DRB1*0401, DRB1*0402 and DRB1*0405
(listed as DR3 for the sake of simplicity in Table 5 which
includes all these alleles) in patients was studied. Interestingly,
haplotypes FBAT, FbaT, whose frequencies were not signifi-
cantly different in patients and controls, showed a significant
increase in patients when present along with the predisposing
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 2 December 2009 | Volume 4 | Issue 12 | e8023

Table 1. Comparison of genotype frequencies of VDR SNPs at Fok1, Bsm1, Apa and Taq1 sites in T1D patients with controls.
SNP T1D Controls T1D vs Controls
Number N = 236 % Number N = 197 % Comparison p value Odds Ratio 95% CI Global p value
FF 142 60.2 116 58.9 FF vs Ff 0.483 1.17 0.774–1.79 0.122
Ff 79 33.5 76 38.6 Ff vs. ff 0.03
*#
0.346 0.109–1.086
ff 15 6.4 5 2.5 FF vs ff 0.06
#
0.41 0.126–1.246
HWE p = 0.38@ HWE p = 0.07 FF vs. Ff+ff 0.862 1.05 0.704–1.58
ff vs. FF+Ff 0.047*
#
2.6 0.87–8.36
N = 236 N = 197
BB 79 33.5 56 28.4 BB vs Bb 0.735 1.105 0.698–1.75 0.134
Bb 120 50.9 94 47.7 Bb vs bb 0.059 0.638 0.4–1.017
bb 37 15.7 47 23.9 BB vs bb 0.05
*
1.792 0.996–3.23
HWE p = 0.59 HWE p = 0.95 BB vs. Bb+bb 0.305 1.3 0.82–1.95
bb vs. BB+Bb 0.04
*
0.59 0.36–0.99
N = 236 N = 197
AA 85 36.01 60 30.5 AA vs.Aa 0.52 1.17 0.757–1.82 0.09
Aa 133 56.4 110 55.8 Aa vs. aa 0.09 1.81 0.907–3.64
aa 18 7.6 27 13.7 AA vs. aa 0.04
*
2.125 1.02–4.45
HWE p = 0.0005 HWE p= 0.04 AA vs Aa+aa 0.263 1.285 0.84–1.96
aa vs AA+Aa. 0.056 0.52 0.264–1.02
N = 236 N = 197
TT 91 38.6 80 40.6 TT vs Tt 0.93 0.995 0.651–1.523 0.38
Tt 112 47.5 98 49.75 Tt vs. tt 0.246 0.658 0.335–1.285
tt 33 14.0 19 9.6 TT vs. tt 0.253 0.655 0.329–1.299
HWE p = 0.9 HWE p = 0.16 TT vs. Tt+tt 0.737 0.918 0.612–1.38
tt vs. TT+Tt 0.217 1.523 0.805–2.895
*
Corrected p (pc) value is not significant.
#Calculated using Fisher’s exact test.
@HWE p value calculated using SHEsis program.
doi:10.1371/journal.pone.0008023.t001
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 3 December 2009 | Volume 4 | Issue 12 | e8023

DRB1 alleleswhilethesamehaplotypeswereprotectivewhen
associated with non-predisposing alleles of DRB1.Similar
results were obtained with other haplotypes like FBAt, fBAT
and fbaT in association with the predisposing HLA-DRB1 alleles,
as shown in table 5.
These results prompted us to study the interaction between two
unlinked loci i.e., VDR and the predisposing HLA-DRB1 alleles
since it was crucial to study the difference in LD patterns of these
two unlinked loci between patients and controls. For this kind of
analysis we used LD based statistics as described by Zhao et al (22).
The analysis has been shown in Table 6. Two most frequent
haplotypes of VDR, FbaT and FBAT and a relatively less frequent
haplotype in patients fbaT do not show any significant difference
between patients and controls when studied by themselves.
However, when studied in association with the predisposing
HLA-DRB1*0301, *0401, *0402 and *0405 collectively (listed as
DR3 in tables 5–7) in T1D patients, these VDR haplotypes show
significant linkage disequilibrium. Since all these haplotypes had
consistently Tallele at TaqI site and either of the two alleles at FokI,
BsmI and ApaI sites, in order to decipher which alleles were
actually involved, we studied the LD pattern between the
predisposing HLA-DR3 with each of these alleles at the four
SNP sites separately.
Table 7 shows the LD pattern of the FokI, BsmI, ApaI and TaqI
alleles with predisposing HLA-DRB1*0301, *0401, *0402 and
*0405 (listed as DR3 in tables 5–7) in T1D patients. Fand Talleles
in the exons 2 and 9 for FokI and TaqI restriction sites respectively
show significant interactions (p,0.0002 and 0.0003 respectively).
However, for BsmI and ApaI sites both the alleles were significantly
associated with predisposing HLA alleles suggesting their null
effect.
Sequence Analysis of HLA DRB1*0301 Promoter Region
Since 85.9% of the patients had DRB1*0301, to study if the
interaction of VDR with predisposing HLA alleles was mediated by
VDRE present in the promoter region of the allele, we amplified
the promoter region of 3 T1D subjects and 3 healthy controls
homozygous for HLA-DRB1*0301. Sequencing of the amplified
promoter region was done to determine the VDRE variants in the
North Indian population. Sequences were aligned using Clus-
talW2, and the presence of a VDRE was confirmed in-silico using
JASPAR_CORE version 3.0 database using default conditions
[28]. Figure 2 shows the HLA- DRB1*0301 promoter sequences
showing the localization of vitamin D response element (VDRE) in
the promoter region of HLA-DRB1*0301 from the 6 subjects.
Important regulatory elements like S-box, X-box, Y-box,
Figure 1. The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products
with enzymes
FokI, BsmI, ApaI
, and
TaqI
.A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers
59AGCTGGCCCTGGCACTGACTCTTGCTCT 39and 59ATGGAAACACCTTGCTTCTTCTCCCTC 39with 68uC as annealing temperature and digestion by fok1
at 37uC for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band
or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8
was studied by amplifying an 825 bp fragment using primers 59CAACCAAGACTACAAGTACCGCGTCAGTGA 39and 59AACCAGCGGGAAGAGGT-
CAAGGG 39with 65uC as annealing temperature and digestion by Bsm1 at 65uC for one hour. Presence of restriction site is denoted as ‘b’ and
absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG)
650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 59
CAGAGCATGGACAGGGAGCAAG 39and 59GCAACTCCTCATGGCTGAGGTCTCA 39with 65uC as annealing temperature and digestion by Apa1 at 37uC
for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa
(TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was
studied by amplifying an 740 bp fragment using primers 59CAGAGCATGGACAGGGAGCAAG 39and 59GCAACTCCTCATGGCTGAGGTCTCA 39with 65uC
as annealing temperature and digestion by Taq1 at 65uC for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is
denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp,
245 bp and 205 bp bands. M is 100 bp ladder.
doi:10.1371/journal.pone.0008023.g001
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 4 December 2009 | Volume 4 | Issue 12 | e8023

CCAAY-box, TATA-box and VDRE are highlighted in the
figure. Interestingly, the alignment showed exactly the same
sequence of VDRE in the promoter region of HLA-DRB1*0301
which has been shown to influence the expression of HLA allele
DRB1*1501 recently by Ramagopalan et al [26] suggesting the
bases for interaction of VDR with HLA-DRB1*0301.
Altered Expression of HLA-DRB1*0301 by 1,25-(OH)
2
D
3
(Calcitriol)
Flow cytometry. HLA-DRB1*0301 homozygous B-
lymphoblastoid cell lines (B-LCL) VAVY (International
Histocompatibility Workshop cell line Number IHW09023) and
DUCAF (International Histocompatibility Workshop cell line
Number IHW09019) were treated with 100 nM of calcitriol
(Sigma) for 24 hours and stained with anti-HLA DR-PE antibody
(BD Biosciences) to study the expression of HLA-DR on B-LCL
cells treated with or without calcitriol and acquired on BD-LSR
flowcytometer. The data was analysed using WinMDI 2.9
software. The results showed 1.2-1.3 fold higher expression of
HLA-DR in the B-LCLs treated with calcitriol as compared to the
vehicle controls in three independent experiments (Figure 3). Two
tailed Paired T test shows the difference to be significant with
p,0.001 suggesting enhanced expression of HLA-DR in B-LCLs
treated with calcitriol as compared to untreated ones.
Real Time PCR
RNA was extracted from the B-LCLs VAVY and DUCAF after
24 hour treatment with calcitriol and vehicle control, reverse
transcribed and real time PCR was performed for HLA-DR to
study its expression. The data shows an average of 1.7960.28
(mean6S.D. of three independent experiments) fold increase in
the HLA-DRB1 transcripts from B-LCL treated with calcitriol as
compared to the vehicle control. We also confirmed these results
using peripheral blood mononuclear cells (PBMCs) derived from a
normal healthy control homozygous for HLA-DRB1*0301 and
observed a 1.77 fold increase in expression of HLA-DR when
treated with calcitriol as compared to untreated PBMCs.
Discussion
In this study we show that the Fand the Talleles of FokI and
TaqI site of VDR interact with predisposing HLA DRB1*0301
through VDRE present in the promoter region of the DRB1*0301
allele. VDR-1,25-(OH)
2
D
3
complex has been shown to play a
significant role in interfering with the signaling of transcription
factors (like NFAT, NF-kB and AP-1) involved in the regulation of
immunomodulatory genes [6,29–33] as well as expression of HLA
class-II alleles on monocytes and human bone cells [13,14].
Polymorphisms in the VDR gene have been shown to influence
VDR mRNA and protein levels [34], which in turn may influence
Table 2. Haplotype Analysis for Fok1, Apa1, Bsm1 and Taq1 loci using SHEsis software[27]. (http://202.120.7.14/analysis/
myAnalysis.php).
T1D 2N = 472 Controls 2N = 394 T1D Vs Controls
Haplotype (Nucleotides) Haplotype Frequency Haplotype Frequency x2 Pearson’s p value Odds Ratio 95% C.I.
FBAt (CATC) 0.303 0.233 5.340 0.0208 1.436 1.056–1.953
FBAT (CATT) 0.142 0.146 0.032 0.8582 0.966 0.659–1.416
FbaT (CGGT) 0.262 0.317 3.311 0.0688 0.759 0.563–1.022
FbAT (CGTT) 0.045 0.065 1.611 0.2042 0.683 0.378–1.234
fBAt (TATC) 0.063 0.099 4.402 0.0359 0.586 0.354–0.970
fBAT (TATT) 0.065 0.021 9.564 0.0019 3.227 1.478–7.049
fbaT(TGGT) 0.079 0.074 0.066 0.7976 1.068 0.645–1.768
*
Haplotype Frequencies less than 0.03 have not been shown in the analysis.
95% C.I. = 95% confidence interval. Global Chi
2
= 20.9 with Pearson’s p value = 0.002.
Linkage disequilibrium test using SHEsis (D’).
D’: Fok1-Bsm1 = 0.004. Fok1-Apa1 = 0.010, Fok1-Taq1 = 0.04, Bsm1-Apa1 = 0.91, Bsm1-Taq1 = 0.93, Apa1-Taq1 = 0.97.
doi:10.1371/journal.pone.0008023.t002
Table 3. Association of VDR haplotypes with age at onset in
T1D patients.
VDR
Haplotype
FBAt FBAT fBAT FbaT fBAt
Nucleotides
CATC CATT TATT CGGT TATC
Age at Onset
Patients#18 years
HF* 2N = 268 0.33 0.11 0.08 0.25 0.06
Patients.18 years
HF 2N = 178 0.27 0.19 0.04 0.27 0.06
Controls
HF 2N = 394 0.23 0.15 0.02 0.32 0.1
Patients age at onset#18 years. Vs. Controls
p value 0.0077 0.17 0.0002 0.0367 0.082
Odds Ratio 1.6 0.718 4.16 0.69 0.59
95% CI 1.13–2.27 0.45–1.15 1.84–9.4 0.483–0.99 0.33–1.08
Patients age at onset .18 years. Vs. Controls
p value 0.274 0.21 0.112 0.273 0.169
Odds Ratio 1.26 1.35 2.2 0.8 0.62
95% CI 0.84–1.89 0.84–2.17 0.81–5.93 0.54–1.19 0.31–1.23
Adult onset was considered above 18 years of age and child onset as 18 years
or below 18 years. The two groups were compared with controls using SHEsis
software.
Linkage Disequilibrium tests for patients below 18 years of age (SHEsis).
D’: Fok1-Bsm1 = 0.048, Fok1-Apa1 = 0.005, Fok1-Taq1 = 0.054, Bsm1-Apa1 = 0.914,
Bsm1-Taq 1 = 0.949, Apa1-Taq1 = 0.955.
Linkage Disequilibrium tests for patients above 18 years of age (SHEsis).
D’: Fok1-Bsm1 = 0.004, Fok1-Apa1 = 0.009, Fok1-Taq1 = 0.104, Bsm1-Apa1 = 0.886,
Bsm1-Taq 1 = 0.93, Apa1-Taq1 = 0.946.
doi:10.1371/journal.pone.0008023.t003
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 5 December 2009 | Volume 4 | Issue 12 | e8023

the immunomodulatory function of VDR. We have studied four
single nucleotide polymorphisms (FokI, BsmI, ApaI and TaqI sites)
in the VDR region in T1D and compared them to normal healthy
controls. The SNP detected by FokI digestion is the only
polymorphisms at the translation start site where a ‘T’to‘C’
substitution alters the VDR protein in such a way that there are
either two ATG start sites separated by six nucleotides or only one
start codon if the ‘T’ is substituted by ‘C’. The former gives rise to a
restriction site for FokI and is designated as ‘f’ allele which encodes
a 427 amino acid protein, while the latter is designated as ‘F’ allele
encoding a 424 amino acid protein. [35–37]. The shorter ‘F’ allele
has been reported to have emerged later after the divergence of
hominids from Apes [38] and a higher percentage of the allele
suggests an evolutionary advantage [39]. Recently, ‘F’ allele has
also been shown to affect the immune system with a more active
immune system for short ‘F’-VDR suggesting its role in the
immune-mediated diseases [40]. The gene to gene interaction
analysis shows allele Fand predisposing MHC alleles to have
significant interaction suggesting the integrated roles of the MHC
alleles in antigen presentation and VDR-F allele in enhanced
autoimmune responses since shorter F-VDR has been shown to
result in higher NF-kappaB- and NFAT-driven transcription as
well as higher IL-12p40 promoter-driven transcription [40].
In the present study, we observed homozygous ‘bb’tobe
significantly reduced in the patients in contrast to a report by
McDermott et al [41] in Southern Indian families where ‘b’ allele
was shown to be excessively transmitted to the affected offsprings.
This difference could be due to different ethnicity of south and
north Indian populations since the B/b polymorphism does not
have any functional significance. Individual VDR polymorphisms
have been studied in different populations with conflicting reports.
Some reports find a positive association of VDR polymorphism
with T1D [41–46], while there are a considerable number of
reports where no association of VDR polymorphism with T1D was
Table 4. Comparisons of frequencies of VDR haplotypes in male and female patients with male and female controls, all controls
and between male and female patients using SHEsis software.
VDR Haplotype
FBAt FBAT fBAT FbaT fBAt
Nucleotides
CATC CATT TATT CGGT TATC
Female (HF)*
Patients 2N = 210
0.267 0.173 0.084 0.252 0.067
Male (HF)
Patients 2N = 262
0.333 0.119 0.048 0.268 0.056
Female (HF)
Controls 2N = 162
0.225 0.166 0.012 0.348 0.114
Male (HF)
Controls 2N = 232
0.231 0.128 0.030 0.314 0.096
All (HF)
Controls 2N = 394
0.233 0.146 0.021 0.317 0.099
Female Patients vs. Controls
p value 0.41 0.42 0.0003 0.074 0.17
Odds Ratio 1.18 1.21 4.21 0.71 0.64
95% C.I. 0.8–1.74 0.76–1.9 1.81–9.8 0.48–1.03 0.34–1.21
Female Patients vs. Female Controls
p value 0.42 0.95 0.0025 0.0298 0.095
Odds Ratio 1.22 1.02 7.25 0.61 0.54
95% C.I 0.75 –1.98 0.59–1.77 1.64–32.1 0.39–0.95 0.26–1.12
Male Patients vs. Controls
p value 0.004 0.33 0.051 0.185 0.052
Odds Ratio 1.67 0.33 0.051 0.185 0.052
95% C.I 1.18–2.37 0.49–1.27 0.97–5.8 0.56–1.12 0.29–1.01
Male Patients vs. Male Controls
p value 0.01 0.75 0.29 0.27 0.09
Odds Ratio 1.69 0.75 0.29 0.27 0.09
95% C.I. 1.13–2.54 0.54–1.57 0.64–4.27 0.54 –1.19 0.28–1.11
Female Patients vs. Male Patients
p value 0.089 0.113 0.13 0.61 0.67
Odds Ratio 0.71 1.5 1.77 0.61 0.67
95% C.I. 0.47–1.06 0.9–2.56 0.84 –3.75 0.59–1.36 0.55– 2.52
HF = Haplotype frequency.
Linkage Disequilibrium tests for Female patients using SHEsis software.
D’: Fok1-Bsm1 = 0.066, Fok1-Apa1 = 0.042, Fok1-Taq1 = 0.048, Bsm1-Apa1 = 0.9, Bsm1-Taq 1 = 0.966, Apa1-Taq1 = 0.946.
Linkage Disequilibrium tests for Male patients using SHEsis software.
D’: Fok1-Bsm1 = 0.015, Fok1-Apa1 = 0.03, Fok1-Taq1 = 0.014, Bsm1-Apa1 = 0.898, Bsm1-Taq 1 = 0.923, Apa1-Taq1 = 0.957.
doi:10.1371/journal.pone.0008023.t004
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 6 December 2009 | Volume 4 | Issue 12 | e8023

Table 5. Simultaneous presence of different VDR haplotypes along with predisposing HLA-DRB1*0301, *0401, *0402 and *0405
alleles.
VDR
Haplotype T1D (N = 233) Controls (N = 191) T1D vs CONTROLs
-
HLA-DR3
+/2No. % No. % p Value OR 95% CL
FBat-DR3-ve#0 0.00 1 0.52 0.45 0.27 0.007–3.0
FBaT-DR3+ve 3 1.29 0 0.00 0.16 5.9 0.7–58.8
FBaT-DR3-ve 1 0.43 3 1.57 0.241 0.34 0.07–1.5
FBAt-DR3+ve 107 45.92 20 10.47 ,10
26*
7.2 4.15–12.8
FBAt-DR3-ve 27 11.58 60 31.41 ,10
26*
0.29 0.16–0.49
FBAT-DR3+ve 48 20.60 7 3.66 ,10
26
6.8 2.9–16.9
FBAT-DR3-ve 4 1.72 34 17.80 ,10
28*
0.07 0.03–0.2
FbaT-DR3+ve 103 44.21 24 12.57 ,10
26*
5.5 3.25–9.39
FbaT-DR3-ve 16 6.87 105 54.97 ,10
26*
0.05 0.03–0.09
FbAt-DR3+ve 1 0.43 0 0.00 0.5 2.5 0.23–848.2
FbAt-DR3-ve 0 0.00 1 0.52 0.45 0.27 0.007–3.0
FbAT-DR3+ve 14 6.01 3 1.57 0.02
**
3.7 1.5–9.6
FbAT-DR3-ve 3 1.29 18 9.42 0.0003
*
0.12 0.04–0.46
fBaT-DR3+ve 3 1.29 1 0.52 0.4 1.9 0.45–14.5
fBaT-DR3-ve 0 0.00 1 0.52 0.45 0.27 0.007–3.0
fBAt-DR3+ve 14 6.01 9 4.71 0.7 1.3 0.5–3.3
fBAt-DR3-ve 1 0.43 29 15.18 ,10
28*
0.03 0.01–0.1
fBAT-DR3+ve 34 14.59 7 3.66 0.0003
*
4.5 1.8–11.4
fBAT-DR3-ve 7 3.00 13 6.81 0.11 0.42 0.15–1.2
fbaT-DR3+ve 29 12.45 0 0 ,10
28*
55.2 8.2–173.4
fbaT-DR3-ve 8 3.43 9 4.71 0.67 0.72 0.25–2.1
fbAt-DR3+ve 3 1.29 0 0.00 0.16 6 0.7–58.8
fbAt-DR3-ve 1 0.43 1 0.52 0.7 0.81 0.13–5.1
fbAT-DR3+ve 7 3.00 2 1.05 0.15 2.6 0.9–8.2
fbAT-DR3-ve 1 0.43 8 4.19 0.009
*
0.13 0.04–0.5
No. shows the number of individual positive for the indicated VDR haplotype and DR3 allele.
#DR3+ve includes all the Predisposing Alleles i.e. DRB1*0301,*0401,*0402 and *0405.
*
Corrected P(pc) value is significant.
**
Corrected P(pc) value is not significant.
doi:10.1371/journal.pone.0008023.t005
Table 6. LD based statistics to study the linkage disequilibrium between two unlinked loci (VDR haplotypes and predisposing
HLA-DRB1*0301, *0401, *0402 and *0405 alleles shown collectively as DR3 in the table 6).
VDR haplotype-DR3
#
T1D (N = 233) d
A
Controls (N = 191) d
N
V
A
V
N
T1 p value
FBAT-DR3 0.035 0.0056 0.00004 0.000035 11.52 0.0006
FBAt-DR3 0.042 0.03 0.0001 0.000075 0.82 0.365
FbaT-DR3 0.0576 0.0233 0.000081 0.000069 7.84 0.005
fBAT-DR3 0.0222 0.01 0.0000323 0.00003 2.39 0.122
fBAt-DR3 0.01 0.013 0.000016 0.000043 0.15 0.698
fbaT-DR3 0.0146 20.0028 0.000032 0.00000085 9.195 0.002
#
DR3+ve includes all the Predisposing Alleles i.e. DRB1*0301,*0401,*0402 and *0405.
d
A
,d
N
,V
A
,V
N
and T1 calculated as shown in statistical methods.
Frequencies of DR3 = 0.6, FBAT =0.12,FBAT-DR3 = 0.10 7, FBAt =0.33, FBAt-DR3 = 0.24, FbaT = 0.264, FbaT-DR3 = 0.216, fBAT = 0.088, fBAT-DR3 = 0.075, fBAt = 0.034, fBAt-
DR3 = 0.03, fbaT = 0.079, fbaT-DR3 = 0.062 in patients and DR3 = 0.107, FBAT = 0.118, FBAT-DR3 = 0.0183, FBAt = 0.233, FBAt-DR3 = 0.055, FbaT = 0.369, FbaT-DR3 = 0.063,
fBAT = 0.052, fBAT-DR3 = 0.01 57, fBAt = 0.099, fBAt-DR3 = 0.0236, fbaT = 0.026 and fbaT-DR3 = 0 in controls. Frequencies of the VDR haplotypes are marginally different
from Table 2 as these have been calculated from the reconstructed haplotypes based on SHEsis program to study interaction with predisposing HLA alleles, whereas
Table 2 shows the frequencies as calculated by SHEsis analysis.
doi:10.1371/journal.pone.0008023.t006
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 7 December 2009 | Volume 4 | Issue 12 | e8023

observed [47–49]. In a meta-analysis Guo et al [50] did not see
any evidence of significant association between VDR polymor-
phism and T1D in either case-control or family transmission. Yet
another meta-analysis [51] concluded that Fand the Balleles at
FokI and BsmI site showed an increased relative risk for T1D as
regional winter UVR levels increased, however, the association of
TaqI T allele with T1D decreased with winter suggesting that the
environmental UVR conditions may influence the association
between VDR genotype and T1D risk. Hence, the contradictory
reports in the literature with respect to VDR associations in T1D
could be due to ethnic differences in the frequencies of different
SNPs in different populations, the environmental UVR and the
pleiotropic behaviour of VDR.
It is important that all the SNPs of the gene constituting a
haplotype be studied as representative of the allele or the so-called
‘‘pseudo-allele’’ as such rather than individual SNPs since it is
possible that the 59and 39polymorphisms may be functionally
linked to each other either through their independent influences
on VDR activity or by physical interaction [52]. SHEsis and
Famhap analysis showed BsmI site was in strong LD with ApaI site
and TaqI site with D’ values of 0.91 and 0.93 and ApaI site was also
in strong LD with TaqI site with a D’ value of 0.97, however, the
FokI site was in a very weak linkage disequilibium (LD) with BsmI,
ApaI and TaqI sites with D’ values of 0.004, 0.01 and 0.04
respectively. The haplotypes, with FokI alleles, however, could still
be constructed because 60.2% of the patients had FF genotype and
6.4% had ff genotype. SHEsis analysis in the present study showed
haplotype ‘FBAt’ and ‘fBAT’ to be significantly increased in
patients as compared to controls. Both these haplotypes were
increased in patients with less than 18 years as age at onset.
However, there was no significant difference in patients with adult
age at onset as compared to controls. We also observed a gender-
wise distribution of these haplotypes. While ‘fBAT’ was signifi-
cantly increased in female patients as compared to all controls and
female controls, ‘FBAt’ was significantly increased in male patients
as compared to all controls and male controls. To study the
distribution of these haplotypes in the two genders with the age at
onset, we divided the males and females into two groups each i.e.,
with adult onset (above 18 years) and younger onset (#18 years).
Interestingly, both ‘FBAt’ and ‘fBAT’ were significantly increased
in male patients with younger age at onset and not in the male
patients with adult onset of T1D. However, ‘fBAT’ was
significantly increased in female patients in both adult onset as
well as younger onset of the disease. These data suggest that
different haplotypes with ‘F’or‘T’ allele may be involved in
differential effects on the immune systems in males and females
patients since both FokI and TaqI sites have been implicated in
transcription of VDR [34].
We have shown earlier that HLA-DRB1*0301, *0401 and
*0405 are predisposing for T1D [2]. Association of MHC class-
II alleles with an autoimmune disease could be due to its
antigen presenting function and VDR may have a role in
regulation of autoimmune responses through VDR 21,25
(OH)
2
D3 complex. Hence, we sought to study whether
interaction of two independently assorting genes i.e. predis-
posing HLA alleles and VDR alleles have a role to play in the
precipitation of the disease. T1D is a complex, multi-factorial
disease where individual factors may not show any significant
difference, however, when studied in association with other
predisposing factors, integration of different factors may be
implicated. To study the interaction of two genes which are not
linked i.e., VDR (on chromosome 12q 13–14) and predisposing
HLA alleles (on chromosome 6p21.3), we used ‘‘LD based
statistics’’ as described by Zhao et al [25]. We tested the
interaction by comparing the difference in the LD levels
between VDR haplotypes and HLA-DR3 (HLA-DRB1*0301,
*0401, *0402 and *0405 collectively) between cases and
controls. Since there is a possibility of background LD between
the two unlinked loci in the population, we used more robust
case-control formula as Zhao et al [25] suggest that case-only
formula may lead to type 1 error. Moreover, Zhao et al [25]
argue that LD based statistics has much higher power in
detecting interaction than does the logistic regression. The
analysis revealed FBAT-DR3,FbaT-DR3 and fbaT-DR3 to show
significant interactions in the patients as compared to controls.
It is obvious from these data that ‘T’ allele is common in all the
haplotypes which showed interaction with pre-disposing HLA
alleles, while haplotypes with both ‘F’and‘f’ alleles were
associated with HLA-DR3 allele, so to dissect out which of these
alleles were actually interacting with DR-3 allele, we applied
LD based statistic to individual Fok, BsmI, ApaI and Taq 1
alleles (Table 7) and the data suggested that ‘F’ allele at FokI
Table 7. LD based statistics to study the linkage disequilibrium between two unlinked loci (VDR alleles F/f, B/b, A/a and T/t and
predisposing HLA-DRB1*0301, *0401, *0402 and *0405 alleles shown collectively as DR3 in the table).
VDR allele-DR3
#
T1D (N = 233) d
A
Controls (N = 191) d
N
V
A
V
N
T1 p value
F-DR3 0.063 0.022 0.00011 0.000016 13.3 0.0002
f-DR3 0.042 0.0245 0.000078 0.000069 2.08 0.149
B-DR3 0.071 0.03 0.00012 0.000058 9.497 0.002
b-DR3 0.07 0.0136 0.00011 0.000062 17.84 0.00002
A-DR3 0.075 0.031 0.00012 0.000046 11.66 0.0006
a-DR3 0.058 0.021 0.0001 0.00006 8.65 0.003
T-DR3 0.0696 0.024 0.00012 0.000039 13.07 0.0003
t-DR3 0.049 0.029 0.00011 0.000073 2.29 0.13
#
DR3+ve includes all the Predisposing Alleles i.e. DRB1*0301,*0401,*0402 and *0405.
d
A
,d
N
,V
A
,V
N
and T1 calculated as shown in statistical methods.
Frequencies of DR3 = 0.6, F=0.76,F-DR3 = 0.519 f= 0.23, f-DR3 = 0.18, B=0.59, B-DR3 = 0.425, b= 0.41, b-DR3 = 0.315, A= 0.642, A-DR3 = 0.46, a= 0.358, a-DR3 = 0.273,
T= 0.624, T-DR3 = 0.444, t= 0.376, t-DR3 = 0.275 in patients and DR3 = 0.107, F= 0.78, F-DR3 = 0.105, f= 0.21, f-DR3 = 0.047, B= 0.52, B-DR 3 = 0.086, b= 0.48, b-DR3 = 0.065,
A= 0.59, A-DR3 = 0.094, a= 0.411, a-DR 3 = 0.065, T= 0.66 T-DR3 = 0.0942, t= 0.34, t-DR3 = 0.065 in controls. Frequencies of the VDR alleles are marginally different from
Table 1 depending on which samples were typed for all the four loci and HLA-DRB1 in both patients and controls.
doi:10.1371/journal.pone.0008023.t007
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 8 December 2009 | Volume 4 | Issue 12 | e8023

site and ‘T’ allele at the TaqI site show significant interaction
with the predisposing HLA-DR3. However, both ‘B’and‘b’
alleles and ‘A’and‘a’ alleles at BsmI and ApaI sites respectively
showed interaction suggesting their null effect.
An association of VDR genotypes with VDR mRNA and VDR
protein has been demonstrated [21,34,53] in peripheral blood
mononuclear cells providing functional relevance to the VDR
polymorphisms. FokI and TaqI genotypes were observed to be
independent determinants of insulin secretion and VDR mRNA
and protein levels [34]. Gross et al [53] showed an increased
transcription rate of the VDR gene in cells with ‘FF’ genotype. ‘F’
allele which encodes the shorter protein has been shown to be
transcriptionally 1.5 to 2.5 fold more active than ‘f’ allele and has
also been shown to associate more avidly with Transcription factor
II B (TF IIB) [39]. Interestingly, Jurutka et al [39] show that
vitamin-D3 mediated transcription requires specific physical
interaction of VDR with TF IIB which involves both C and N
terminal domains in the receptor. Moreover, while FokI site is
situated in the N-terminal end of the VDR molecule, the ligand
binding domain is situated in its C-terminal [41], which explains
why FokI and TaqI sites may be playing detrimental roles in the
manifestation of T1D in the presence of predisposing MHC alleles.
FokI and TaqI genotypes have been shown to contribute to VDR
mRNA and protein levels independently[54]. While the promoter
Figure 2. Promoter region of HLA- DRB1 was sequenced from 3 subjects suffering from type 1 diabetes and 3 normal healthy
individuals homozygous for DRB1*0301. The sequence showing important regulatory elements like S-box, X-box, Y-box, CCAAY-box, TATA-box
and VDRE are highlighted. Stars (*) in the last row show homology and dots (.) show nucleotide substitution in one or more samples at that particular
site and dashes(-) represent gaps inserted to maximize the homology. The ID and A numbers represent the T1D and control samples sequenced
respectively. The sequences have been aligned with reference sequence gi|545423|gb|S69987.1| HLA-DRB1 (DRB1*0301) {promoter} [human,
lymphoblastoid cell line AVL, Genomic, 416 nt] [64].
doi:10.1371/journal.pone.0008023.g002
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 9 December 2009 | Volume 4 | Issue 12 | e8023

has been shown to regulate production of mRNA, the 39UTR is
involved in stability/degradation of mRNA, and their interaction
or combined effects may regulate the net availability of the mRNA
for translation into the VDR protein [54]. Hence, Fallele of FokI
and Tallele of TaqI along with predisposing MHC alleles play an
integrated role in the autoimmune responses in T1D.
Functionally, VDR-FF individuals have been shown to produce
more IL-12p40 and IL-12p35 and even the IL-12 protein is higher
in these individuals as compared to those with ff genotype [40]. On
the other hand, the VDR ligand 1,25 (OH)
2
D
3
has been shown to
inhibit lymphocyte proliferation and production of IFN-gamma, IL-
2 and IL-12 [54]. Hence, in the present scenario, while predisposing
MHC alleles may be involved in auto-antigen presentation, the
VDR haplotypes with ‘F’and‘T’ alleles may have a role in
increased amount of VDR protein resulting in increased IL-12
production which in turn may lead to other downstream pro-
inflammatory immune responses against auto-antigens in T1D. And
administration of 1,25-(OH)
2
D
3
in type 1 diabetes may be able to
inhibit these pro-inflammatory immune responses by binding to
VDR which induces conformational changes in VDR, promoting
its heterodimerization with Retinoid X Receptor (RXR), followed
by translocation of this complex into the nucleus which in turn binds
to the vitamin D
3
responsive elements (VDRE) or the DNA binding
domains in promoter regions of 1,25-(OH)
2
D
3
responsive genes [4],
thereby down regulating transcription of the pro-inflammatory
cytokines like IL-2, IFN-cand IL-12 [7–9,11], thus delaying the
pathogenesis of type 1 diabetes.
Additionally, presence of VDRE in the promoter region of the
predisposing HLA-DRB1*0301 may also have a significant role in
manifestation of the disease since a direct interaction between HLA-
DRB1 and vitamin D has been demonstrated recently [26]. VDRE
is shown to have subtle sequence differences and different HLA
alleles may have different VDRE sequences in their promoter
regions influencing the expression of HLA alleles [26]. Gene
expression of vitamin D regulated genes has been shown to be
influenced by these subtle sequence differences within the classical
VDRE [6]. Hence, we sequenced the promoter region of normal
and affected individuals homozygous for HLA-DRB1*0301 and
discovered that VDRE sequence observed in DRB1*0301 promot-
ers from North Indians is homologous to the VDRE sequence
which had been shown to up-regulate the expression of HLA
DRB1*1501 allele in Multiple Sclerosis [26]. Ramagopalan et al
[26] showed that the VDRE corresponding to the Multiple Sclerosis
(MS) associated DRB1*1501 haplotype bound to recombinant
VDR/RXR with high specificity in vitro in contrast to relatively
lower affinity for the VDRE variants observed in the non-MS
associated HLA-DRB1 haplotypes which were not responsive to
vitamin D3 [26]. 85.9% of the patients in the present study had
HLA-DRB1*0301 with 27.7% being homozygous and the rest
heterozygous with DRB1*04 or any other alleles (data not shown).
These data suggested that the interaction of VDR with DRB1*0301
is through the VDRE present in the promoter region of the HLA
allele. Interestingly, both Multiple Sclerosis and T1D have HLA as
the main susceptibility locus and vitamin D a strong environmental
element since supplementation of 1,25-(OH)
2
D
3
analog in NOD
mice before the onset of Insulitis, has been effectively shown to
prevent the disease progression. However, this treatment was
ineffective when Insulitis had already been established [15–18].
Similarly, in humans, vitamin D supplementation in early childhood
has been shown to reduce the incidence of T1D [19]. To study
whether the interaction of VDR with the HLA DRB1*0301 is
through VDRE present in the promoter region of the HLA-
DRB1*0301, we stimulated the International Histocomopatibility
Workshop’s DRB1*0301 homozygous B-lymphoblastoid cell line
VAVY (B-LCL IHW09023) and DUCAF (B-LCL IHW09019) with
100 nM of calcitriol and checked for the expression of DR using
flow cytometry and real time PCR. The B-LCLs showed 1.2–1.3
fold enhanced expression on flow cytometry, probably because of
constitutively high levels of HLA- DR expression on the cell lines
tested. However, this enhanced difference was statistically signifi-
cant on two tailed paired T test (p,0.001). Ramagopalan et al [26]
have also shown 1.3 fold increase in expression of HLA-DRB1 in
DRB1*15 homozygous cell line PGF on addition of calcitriol and
they too found it to be statistically significant. Interestingly,
however, real time PCR showed 1.860.28 fold increase in the
HLA-DR transcripts. Thus, the enhanced expression of HLA-DR
on the B-LCLs stimulated with calcitriol as compared to the
unstimulated one confirms that indeed the interaction of VDR with
HLA-DRB1*0301 is occurring through the VDRE present in the
promoter region of the gene. Based on the earlier studies and the
present data one can speculate that in the absence of required
amount of Vitamin D in early life in the predisposed individuals
with HLA-DRB1*0301, the expression of the allele may be impaired
in the thymus [26] resulting in escape from thymic deletion of
autoreactive T cells leading to T1D manifestations. We have shown
earlier that simultaneous presence of DRB1*0301 along with
homozygous INS-VNTR class-I was significantly increased
(p,10
28
) in T1D patients, giving a relative risk of 70.81 [2]. INS-
Figure 3. Flow cytometric analysis of HLA-DR expression. B-LCLs
VAVY and DUCAF cells were treated with 100 nM calcitriol or equal
volume of alcohol as vehicle control. Both VAVY and DUCAF cells show
a significant increase in surface HLA-DR expression as determined by
the geometric mean flurescence intensity of staining with HLA-DR-PE
antibody. A. The figure shows mean6S.E.M. of three independent
experiments. Two tailed Paired T test shows the difference to be
significant with p,0.001 i.e., enhanced expression of HLA-DR in B-LCLs
treated with calcitriol as compared to untreated ones. B: Line graph
showing the extent of enhanced HLA-DR expression in three
independent expeiments.
doi:10.1371/journal.pone.0008023.g003
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 10 December 2009 | Volume 4 | Issue 12 | e8023

VNTR class-I has also been shown to be associated with lower
expression of Insulin in thymii of fetuses as compared to Class-III
alleles [55,56] which may be responsible for poor thymic education
for insulin resulting in autoimmunity against pancreatic beta cells.
The present study provides additional evidence based on the
statistically significant interaction between the predisposing HLA
allele and high producer alleles of VDR which may be detrimental
for the manifestation of T1D in the absence of 1,25-(OH)
2
D
3
in
early childhood and/or in-utero and this interaction is mediated by
VDRE present in the promoter region of DRB1*0301.
Materials and Methods
Genomic DNA was extracted using a standard protocol from
10 ml of blood from T1D patients and healthy controls from the
same ethnic background after obtaining informed written consent
and Institutional Human Ethics Committee’s approval from both
All India Institute of Medical Sciences (AIIMS) and National
Institute of Immunology (NII).
236 T1D subjects and 197 normal healthy controls based in
Delhi, originally from three states of North India, Uttar Pradesh,
Haryana and Punjab, were studied for VDR polymorphisms. The
patients studied in the current study were recruited from ‘Type 1
Diabetes Clinic’ at All India Institute of Medical Sciences, New
Delhi, India, in a consecutive manner from 2004–2008. Most of
these patients were part of our earlier studies [3,57] and were
recruited based on their availability in follow up in the clinic and
informed consent and were representative of a general population of
T1D patients in North India. All the patients were carefully assessed
(by RG) and categorized as type 1, type 2 and fibrocalculous
pancreatopathy according to the recent classification of the
American Diabetes Association expert committee [58]. All of the
subjects included in the study required insulin for glycemic control.
Insulin requiring patients with fibrocalculous pancreatopathy and
subjects with diabetes in whom glycemic control was achieved with
diet and oral anti-diabetic drug were excluded from the study as
described earlier [3]. The T1D group consisted of 105 females with
the mean age at onset 14.7467.57 and 131 males with a mean age
of onset 16.8967.25. The control group consisted of 81 females and
116 males with a mean age of 30.1610.2.
Normal healthy controls from the same ethnic background with
no history (of self or family) of any autoimmune or infectious
diseases were included in the study. They represent the same source
population because the controls too, like the patients, belonged to
three states of North India, Uttar Pradesh, Haryana and Punjab.
The controls were the students, scholars and employees of NII and
AIIMS who belonged to these three states. They were not selected
in particular but were random individuals who gave informed
consent to draw blood and did not have any history of infectious or
autoimmune diseases. Controls were not clinically tested; however,
they were asked if they had any infectious, autoimmune or any other
disease. Only healthy individuals with no disease, symptoms of a
disease or family history of any autoimmune or infectious disease,
were included in the study. The response rate was about 85%.
There was no statistically significant difference between the
numbers of Males and Females in the patient and the control
group. Higher age group of controls were, however, preferred to
rule out their possibility of developing T1D at a later date after the
collection of their blood samples as normal healthy controls. Since
the control samples have been collected over a period of 5–6 years,
all the controls who had the predisposing DRB1*0301 allele and
were below the age of 30 years at the time of blood collection have
been followed up till the date of analysis to make sure that they did
not develop diabetes.
Genotypic Analysis of VDR Polymorphisms
The genotypes for the four SNPs were determined by PCR
amplification and restriction digestion of the PCR products with
enzymes FokI, BsmI, ApaI, and TaqI as described earlier [23,59]
Briefly, 500 ng of DNA was amplified in 5 ml of 10X Thermo Pol
reaction buffer supplemented with 2 mM MgSO
4
(New England
Biolabs), 5 pm of each primers, 0.25 mM of dNTPs, and 1.25 U of
Taq DNA Polymerase (New England Biolabs), under standard
conditions for 35 cycles in Perkin Elmer 2700 thermocycler. 1%
agarose gel was run to confirm the amplification. To determine the
presence of restriction site within an amplified product, a 5 ml
aliquot of respective PCR product was digested with the respective
restriction endonucleases. Figures 1A–D show the sizes of the
restriction fragments obtained after digestion with the respective
enzymes, the primers, their annealing temperatures for the PCRs
and the temperatures at which restriction digestion was carried
out. The interpretation of restriction fragments were done as
shown in figures 1A–D.
HLA-DRB1 Polymorphism
Alleles of HLA-DRB1 locus were determined for 233 T1D
patients and 191 controls. For 100 patient samples and 94 controls
samples, the second exon of the DRB1 gene was PCR amplified
using standard conditions and hybridized with sequence specific
oligonucleotide probes (SSOP) as described earlier [2,60,61]. The
PCR products were run on 1% agarose gel to check for
amplification. The amplified PCR products were dot blotted on
Zeta probe membranes (Biorad), UV cross-linked (Syngene, USA)
and hybridized with
32
P- labeled probes for DRB1- generic, DR2,
DR4 and DR52- associated alleles.
For the remaining 133 patients and 97 control samples a Labtype
SSO kit from One Lambda, (Canoga Park, CA, USA) was used
according to the manufacturer’s instructions as described earlier [2].
Briefly, 40 ng of DNA was amplified in master mix, primers and
2mlofTaq DNA polymerase in Perkin Elmer 2700 thermal cycler.
The amplified product was run on 1% agarose gel to confirm
amplification. 5 ml of amplified product was hybridized with
appropriate amount of multiplex beads conjugated with oligonu-
cleotide probes, in hybridization buffer at 60uC for 15 minutes
followed by washing and incubation with 50 ml 1X SAPE solution
(Steptavidin Phycoerythin) at 60uC for 5 minutes. Fluorescence of
the labeled beads was acquired on Luminex 2.2 flow cytometer
(Luminex corporation, Austin, TX). Acquired data was analysed
using Labtype software provided by One Lambda for analysis of
HLA alleles. Some of these samples that were typed using PCR-
SSOP earlier were re-typed using Luminex method to study the
concordance using Luminex multiplex beads conjugated with
oligonucleotide probes, since this was a new method being adopted
in the lab to avoid using radioactivity. With 98% concordance
between the two methods, Luminex method was used for the rest of
the samples. A few samples were typed a second time using
Luminex, for HLA-DR alleles, just to confirm the reproducibility.
HLA-DRB1 Promoter Sequencing
Sequencing of the DRB1 promoter region was done to determine
the VDRE variants in the North Indian population. The HLA-
DRB1 promoter region was amplified from 3 T1D subject samples
and 3 control samples homozygous for HLA-DRB1*0301 using the
primers described earlier, 59-TTTCAGAAGAGGACCTT-39and
59- CTTACGTCGGGTGTCCC-39[62]. Briefly, 100 ng of DNA
was amplified in 2.5 mL of 10X standard Taq Buffer, supplemented
with 3 mM MgCl
2
(New England Biolabs), 2 pmoles of each primer,
0.25 mM dNTPs, and 1.25U of Taq DNA polymerase (New
England Biolabs), under standard conditions at 54uC annealing, for
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 11 December 2009 | Volume 4 | Issue 12 | e8023

35 cycles in Eppendorf Mastercycler Gradient. Sequencing (using
Sanger’s di-deoxy chain termination method) of the PCR products
was performed using primers internal to the amplification primers
which were designed usingNCBI primer blast. The sequencesof the
internal primers used are: 59-ATACAGCATCTCTGACCAGC-
39,59-TCAGCACCATCAGTGTCA-39. Sequences were aligned
using ClustalW2, and the presence of a VDRE was confirmed in-
silico using JASPAR_CORE version 3.0 database using default
conditions [28].
Expression Analysis Using Flow Cytometry and Real Time
PCR
HLA-DRB1-*0301 homozygous B-lymphoblastoid cell line (B-
LCL IHW09023) VAVY and DUCAF (B-LCL IHW09019) were
cultured in RPMI 1640 with L-glutamine, supplemented with
15% fetal bovine serum and 100 nM sodium pyruvate at 37uCin
humidified 5% CO
2
. Cells were incubated with Calcitriol (Sigma)
at a final concentration of 100 nM for 24 hours from a 10 mM
stock in ethanol. Control cells were treated with the same volume
of absolute ethanol alone.
Flow Cytometry
Flow cytometry was performed using anti-human HLA-DR
antibody conjugated with PE (BD biosciences). 7610
5
Cells were
stained with anti-HLA-DR antibody as per manufacturer’s recom-
mendations. Briefly, the cells were washed with Dulbecco’s Phosphate
buffered saline (DPBS) twice and resuspended in 100 ml of staining
buffer containing 0.5% BSA in DPBS. To this 10 mlofanti-DR
antibody-PE was added and incubated on ice for 30 minutes. The
cells were washed with 0.5% BSA in DPBS, fixed in 2%
paraformaldehyde for 10 minutes on ice and acquired on a BD-
LSR flow cytometer. Data analysis was performed on Win-MDI 2.9
software.
Real-Time Analysis
Total RNA was isolated from cells using Trizol (Invitrogen)
method. The RNA was purified using Qiagen RNeasy Mini
column purification kit, and reverse transcribed using Superscript
III First Strand Kit (Invitrogen). Real Time PCR analysis was
performed on the ABI 7000 cycler (95uC 10 min Activation, 40
cycles: 95uC 15 secs Denaturation, 60uC 1 min Anneling/
Extension), using Maxima SYBR Green qPCR Master Mix
(Fermentas) with the following primers:
18s r RNA: Forward 59CGAAAGCATTTGCCAAGAAT 39
Reverse 59AGTCGGCATCGTTTATGGTC 39
HLA-DRB1: Forward 59TTAAGCTGCCACAAGAAACG 39
Reverse 59TGTTCTCCAGCATGGTGTGT 39
Expression level changes were calculated as fold-change in the
level of transcript between treated and untreated samples and
normalized to 18s rRNA levels. DCt values were obtained by
subtracting the average Ct values of triplicate SYBR green assays
for 18s rRNA from that of the corresponding HLA-DR. Fold
change was calculated by using 2
2DDCt
, where DDCt represents
DCt of treated - DCt of untreated control.
Statistical Analysis
Chi-Square test or Fisher’s exact test (whenever the numbers
were five or less), were used to determine the significance of
differences between the patient and control groups. p values were
corrected using Boneferroni’s correction by multiplying the p
values with the number of alleles tested for the locus. Odds ratios
were calculated using Woolf’s method, with Haldane’s modifica-
tion wherever the numbers were five or less as described earlier
[63]. Further, the Haplotype analysis was done using the SHEsis
software freely available at (http://202.120.7.14/analysis/myA-
nalysis.php). [27] Hardy-Weinberg equilibrium was also calculated
for both patients and controls using SHEsis software [27].
Additionally, Famhap (http://famhap.meb.uni-bonn.de) was used
to confirm the frequencies of the haplotypes. Since both Famhap
and SHEsis were giving similar results, we carried out the rest of
the analysis using SHEsis only.
Interaction of two unlinked loci was tested using ‘‘LD based
statistics’’ [25] using the following formulae
T1 ~dA{dN
ðÞ
2
VAzVN
Where d
A
is the measure of LD between two unlinked loci a and
b in cases and is calculated as
dA~Pab PaXP
b
Pab ~No:of observed haplotypes
2N
Where P
ab
is the observed ‘haplotype’ frequency of alleles a and
b at two unlinked loci (in this case HLA-DR3 and the VDR
haplotype/allele) and P
a
is the gene frequency of the concerned
allele at one locus and P
b
is the gene frequency of the unlinked
allele on the other locus. Here the word ‘haplotype’ does not
necessarily mean that they are on the same chromosome as
conventionally thought, rather simultaneously present alleles of
two unlinked loci which may be associated with each other.
Similarly d
N
is the measure of LD between two unlinked loci a
and b in controls.
V
A
and V
N
are the estimators of variance in patients and
controls respectively and are calculated as:
VA~Pa1{Pa
ðÞPb1{Pb
ðÞz1{2Pa
ðÞ1{2Pb
ðÞdA{d2A
2NA
for patients and
VN~Pa1{Pa
ðÞPb1{Pb
ðÞz1{2Pa
ðÞ1{2Pb
ðÞdA{d2A
2NG
forcontrols
N
A
and N
G
are the number of samples tested in patients and
control groups respectively.
The test Statistic T1 is asymptotically distributed as a central
x
2
(1)
distribution under the null hypotheses of no interaction
between the two unlinked loci [25].
Acknowledgments
We are thankful to Yong Yong Shi for providing the SHEsis program
(http://202.120.7.14/analysis/myAnalysis.php) for haplotype analysis
Authors are thankful to the Fred Hutchinson Cancer Research Center
IHWG Cell and Gene Bank for providing HLA-DRB1*0301 homozygous
lymphoblastoid Cell lines for studies showing effect of vitamin D on HLA-
DR expression.
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 12 December 2009 | Volume 4 | Issue 12 | e8023

Author Contributions
Conceived and designed the experiments: RR. Performed the experiments:
NI AAK. Analyzed the data: NI AAK RR. Contributed reagents/
materials/analysis tools: RG AAK RR. Wrote the paper: NI RR.
Diagnosed the patients: RG. Provided the clinical data, ages at onset of
the disease and blood samples for the study: RG.
References
1. Ramachandran A, Snehalatha C, Krishnaswamy CV (1996) Incidence of IDDM
in children in urban population in southern India. Madras IDDM Registry
Group Madras, South India. Diabetes Res Clin Pract 34: 79–82.
2. Rani R, Sood A, Goswami R (2004) Molecular basis of predisposition to develop
type 1 diabetes mellitus in North Indians. Tissue Antigens 64: 145–155.
3. Kumar R, Goswami R, Agarwal S, Israni N, Singh SK, et al. (2007) Association
and interaction of the TNF-alpha gene with other pro- and anti-inflammatory
cytokine genes and HLA genes in patients with type 1 diabetes from North
India. Tissue Antigens 69: 557–567.
4. Evans RM (1988) The steroid and thyroid hormone receptor superfamily.
Science 240: 889–895.
5. Boonstra A, Barrat FJ, Crain C, Heath VL, Savelkoul HF, et al. (2001)
1alpha,25-Dihydroxyvitamin d3 has a direct effect on naive CD4(+) T cells to
enhance the development of Th2 cells. J Immunol 167: 4974–4980.
6. Takeuchi A, Reddy GS, Kobayashi T, Okano T, Park J, et al. (1998) Nuclear
factor of activated T cells (NFAT) as a molecular target for 1alpha,25-
dihydroxyvitamin D3-mediated effects. J Immunol 160: 209–218.
7. Bhalla AK, Amento EP, Serog B, Glimcher LH (1984) 1,25-Dihydroxyvitam in
D3 inhibits antigen-induced T cell activation. J Immunol 133: 1748–1754.
8. Alroy I, Towers TL, Freedman LP (1995) Transcriptional repression of the
interleukin-2 gene by vitamin D3: direct inhibition of NFATp/AP-1 complex
formation by a nuclear hormone receptor. Mol Cell Biol 15: 5789–5799.
9. Cippitelli M, Santoni A (1998) Vitamin D3: a transcriptional modulator of the
interferon-gamma gene. Eur J Immunol 28: 3017–3030.
10. Lemire JM (1992) Immunomodulatory role of 1,25-dihydroxyvitamin D3. J Cell
Biochem 49: 26–31.
11. D’Ambrosio D, Cippitelli M, Cocciolo MG, Mazzeo D, Di Lucia P, et al. (1998)
Inhibition of IL-12 production by 1,25-dihydroxyvitamin D3. Involvement of
NF-kappaB downregulation in transcriptional repression of the p40 gene. J Clin
Invest 101: 252–262.
12. Cantorna MT, Woodward WD, Hayes CE, DeLuca HF (1998) 1,25-
dihydroxyvitamin D3 is a positive regulator for the two anti-encephalitogenic
cytokines TGF-beta 1 and IL-4. J Immunol 160: 5314–5319.
13. Rigby WF, Waugh M, Graziano RF (1990) Regulation of human monoc yte
HLA-DR and CD4 antigen expression, and antigen presentation by 1,25-
dihydroxyvitamin D3. Blood 76: 189–197.
14. Skjodt H, Hughes DE, Dobson PR, Russell RG (1990) Constitutive and
inducible expression of HLA class II determinants by human osteoblast-like cells
in vitro. J Clin Invest 85: 1421–1426.
15. Mathieu C, Laureys J, Sobis H, Vandeputte M, Waer M, et al. (1992) 1,25-
Dihydroxyvitamin D3 prevents insulitis in NOD mice. Diabetes 41: 1491–1495.
16. Mathieu C, Waer M, Laureys J, Rutgeerts O, Bouillon R (1994) Prevention of
autoimmune diabetes in NOD mice by 1,25 dihydroxyvitamin D3. Diabetologia
37: 552–558.
17. Gysemans CA, Cardozo AK, Callewaert H, Giulietti A, Hulshagen L, et al.
(2005) 1,25-Dihydroxyvitamin D3 modulates expression of chemokines and
cytokines in pancreatic islets: implications for prevention of diabetes in nonobese
diabetic mice. Endocrinology 146: 1956–1964.
18. Zella JB, McCary LC, DeLuca HF (2003) Oral administration of 1,25-
dihydroxyvitamin D3 completely protects NOD mice from insulin-dependent
diabetes mellitus. Arch Biochem Biophys 417: 77–80.
19. Hypponen E, Laara E, Reunanen A, Jarvelin MR, Virtanen SM (2001) Intake of
vitamin D and risk of type 1 diabetes: a birth-cohort study.Lancet 358: 1500–1503.
20. Jones G, Strugnell SA, DeLuca HF (1998) Current understandi ng of the
molecular actions of vitamin D. Physiol Rev 78: 1193–1231.
21. Gross C, Eccleshall TR, Malloy PJ, Villa ML, Marcus R, et al. (1996) The
presence of a polymorphism at the translation initiation site of the vitamin D
receptor gene is associated with low bone mineral density in postmenopausal
Mexican-American women. J Bone Miner Res 11: 1850–1855.
22. Morrison NA, Yeoman R, Kelly PJ, Eisman JA (1992) Contribution of trans-
acting factor alleles to normal physiological variability: vitamin D receptor gene
polymorphism and circulating osteocalcin. Proc Natl Acad Sci U S A 89:
6665–6669.
23. Faraco JH, Morrison NA, Baker A, Shine J, Frossard PM (1989) ApaI dimorphism
at the human vitamin D receptor gene locus. Nucleic Acids Res 17: 2150.
24. Durrin LK, Haile RW, Ingles SA, Coetzee GA (1999) Vitamin D receptor 39-
untranslated region polymorphisms: lack of effect on mRNA stability. Biochim
Biophys Acta 1453: 311–320.
25. Zhao J, Jin L, Xiong M (2006) Test for interaction between two unlinked loci.
Am J Hum Genet 79: 831–845.
26. Ramagopalan SV, Maugeri NJ, Handunnetthi L, Lincoln MR, Orton SM, et al.
(2009) Expression of the multiple sclerosis-associated MHC class II Allele HLA-
DRB1*1501 is regulated by vitamin D. PLoS Genet 5: e1000369.
27. Shi YY, He L (2005) SHEsis, a powerful software platform for analyses of linkage
disequilibrium, haplotype construction, and genetic association at polymorphism
loci. Cell Res 15: 97–98.
28. Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B (2004)
JASPAR: an open-access database for eukaryotic transcription factor binding
profiles 10.1093/nar/gkh012. Nucl Acids Res 32: D91–94.
29. Komine M, Watabe Y, Shimaoka S, Sato F, Kake K, et al. (1999) The action of
a novel vitamin D3 analogue, OCT, on immunomodulatory function of
keratinocytes and lymphocytes. Arch Dermatol Res 291: 500–506.
30. Towers TL, Staeva TP, Freedman LP (1999) A two-hit mechanism for vitamin
D3-mediated transcriptional repression of the granulocyte-macrophage colony-
stimulating factor gene: vitamin D receptor competes for DNA binding with
NFAT1 and stabilizes c-Jun. Mol Cell Biol 19: 4191–4199.
31. Yu XP, Bellido T, Manolagas SC (1995) Down-regulation of NF-kappa B
protein levels in activated human lymphocytes by 1,25-dihydroxyvitamin D3.
Proc Natl Acad Sci U S A 92: 10990–10994.
32. Park YC, Rimbach G, Saliou C, Valacchi G, Packer L (2000) Activity of
monomeric, dimeric, and trimeric flavonoids on NO production, TNF-alpha
secretion, and NF-kappaB-dependent gene expression in RAW 264.7 macro-
phages. FEBS Lett 465: 93–97.
33. Rooney JW, Sun YL, Glimcher LH, Hoey T (1995) Novel NFAT sites that
mediate activation of the interleukin-2 promoter in response to T-cell receptor
stimulation. Mol Cell Biol 15: 6299–6310.
34. Ogunkolade BW, Boucher BJ, Prahl JM, Bustin SA, Burrin JM, et al. (2002)
Vitamin D receptor (VDR) mRNA and VDR protein levels in relation to
vitamin D status, insulin secretory capacity, and VDR genotype in Bangladeshi
Asians. Diabetes 51: 2294–2300.
35. Nejentsev S, Godfrey L, Snook H, Rance H, Nutland S, et al. (2004)
Comparative high-resolution analysis of linkage disequilibrium and tag single
nucleotide polymorphisms between populations in the vitamin D receptor gene.
Hum Mol Genet 13: 1633–1639.
36. Arai H, Miyamoto K, Taketani Y, Yamamoto H, Iemori Y, et al. (1997) A
vitamin D receptor gene polymorphism in the translation initiation codon: effect
on protein activity and relation to bone mineral density in Japanese women.
J Bone Miner Res 12: 915–921.
37. Zmuda JM, Cauley JA, Ferrell RE (2000) Molecular epidemiology of vitamin D
receptor gene variants. Epidemiol Rev 22: 203–217.
38. Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, et al.
(1998) The nuclear vitamin D receptor: biological and molecular regulatory
properties revealed. J Bone Miner Res 13: 325–349.
39. Jurutka PW, Remus LS, Whitfield GK, Thompso n PD, Hsieh JC, et al. (2000)
The polymorphic N terminus in human vitamin D receptor isoforms influences
transcriptional activity by modulating interaction with transcription factor IIB.
Mol Endocrinol 14: 401–420.
40. van Etten E, Verlinden L, Giulietti A, Ramos-Lopez E, Branisteanu DD, et al.
(2007) The vitamin D receptor gene FokI polymorphism: functional impact on
the immune system. Eur J Immunol 37: 395–405.
41. McDermott MF, Ramachandran A, Ogunkolade BW, Aganna E, Curtis D,
et al. (1997) Allelic variation in the vitamin D receptor influences susceptibi lity
to IDDM in Indian Asians. Diabetologia 40: 971–975.
42. Chang TJ, Lei HH, Yeh JI, Chiu KC, Lee KC, et al. (2000) Vitamin D receptor
gene polymorphisms influence susceptibility to type 1 diabetes mellitus in the
Taiwanese population. Clin Endocrinol (Oxf) 52: 575–580.
43. Skrabic V, Zemunik T, Situm M, Terzic J (2003) Vitamin D receptor
polymorphism and susceptibility to type 1 diabetes in the Dalmatian population.
Diabetes Res Clin Pract 59: 31–35.
44. Motohashi Y, Yamada S, Yanagawa T, Maruyama T, Suzuk i R, et al. (2003)
Vitamin D receptor gene polymorphism affects onset pattern of type 1 diabetes.
J Clin Endocrinol Metab 88: 3137–3140.
45. Guja C, Marshall S, Welsh K, Merriman M, Smith A, et al. (2002) The study of
CTLA-4 and vitamin D receptor polymorphisms in the Romanian type 1
diabetes population. J Cell Mol Med 6: 75–81.
46. Pani MA, Knapp M, Donner H, Braun J, Baur MP, et al. (2000) Vitamin D
receptor allele combinations influence genetic susceptibility to type 1 diabetes in
Germans. Diabetes 49: 504–507.
47. Angel B, Santos JL, Carrasco E, Albala C, Perez-Bravo F (2004) Vitamin D
receptor polymorphism and susceptibility to type 1 diabetes in Chilean subjects:
a case-parent study. Eur J Epidemiol 19: 1085–1087.
48. Turpeinen H, Hermann R, Vaara S, Laine AP, Simell O, et al. (2003) Vitamin
D receptor polymorphisms: no association with type 1 diabetes in the Finnish
population. Eur J Endocrinol 149: 591–596.
49. Bianco MG, Minicucci L, Calevo MG, Lorini R (2004) Vitamin D receptor
polymorphisms: are they really associated with type 1 diabetes? Eur J Endocrinol
151: 641–642.
50. Guo SW, Magnuson VL, Schiller JJ, Wang X, Wu Y, et al. (2006) Meta-analysis
of vitamin D receptor polymorphisms and type 1 diabetes: a HuGE review of
genetic association studies. Am J Epidemiol 164: 711–724.
51. Ponsonby AL, Pezic A, Ellis J, Morley R, Cameron F, et al. (2008) Variation in
associations between allelic variants of the vitamin D receptor gene and onset of
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 13 December 2009 | Volume 4 | Issue 12 | e8023

type 1 diabetes mellitus by ambient winter ultraviolet radiation levels: a meta-
regression analysis. Am J Epidemiol 168: 358–365.
52. Guy M, Lowe LC, Bretherton-Watt D, Mansi JL, Peckitt C, et al. (2004)
Vitamin D receptor gene polymorphisms and breast cancer risk. Clin Cancer
Res 10: 5472–5481.
53. Gross C, Krishnan AV, Malloy PJ, Eccleshall TR, Zhao XY, et al. (1998) The
vitamin D receptor gene start codon polymorphism: a functional analysis of FokI
variants. J Bone Miner Res 13: 1691–1699.
54. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP (2004)
Genetics and biology of vitamin D receptor polymorphisms. Gene 338:
143–156.
55. Pugliese A, Zeller M, Fernandez A Jr, Zalcberg LJ, Bartlett RJ, et al. (1997) The
insulin gene is transcribed in the human thymus and transcription levels
correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus
for type 1 diabetes. Nat Genet 15: 293–297.
56. Vafiadis P, Bennett ST, Todd JA, Nadeau J, Grabs R, et al. (1997) Insulin
expression in human thymus is modulated by INS VNTR alleles at the IDDM2
locus. Nat Genet 15: 289–292.
57. Goswami R, Marwaha RK, Goswami D, Gupta N, Ray D, et al. (2006)
Prevalence of thyroid autoimmunity in sporadic idiopathic hypoparathyroidism
in comparison to type 1 diabetes and premature ovarian failure. J Clin
Endocrinol Metab 91: 4256–4259.
58. Report of the expert committee on the diagnosis and classification of diabetes
mellitus. Diabetes Care 26 Suppl 1: S5–20.
59. Hustmyer FG, DeLuca HF, Peacock M (1993) ApaI, BsmI, EcoRV and TaqI
polymorphisms at the human vitamin D receptor gene locus in Caucasians,
blacks and Asians. Hum Mol Genet 2: 487.
60. Fernandez-Vina MA, Gao XJ, Moraes ME, Moraes JR, Salatiel I, et al. (1991)
Alleles at four HLA class II loci determined by oligonucleotide hybridization and
their associations in five ethnic groups. Immunogenetics 34: 299–312.
61. Rani R, Mukherjee R, Stastny P (1998) Diversity of HLA-DR2 in North
Indians: the changed scenario after the discovery of DRB1*1506. Tissue
Antigens 52: 147–152.
62. Louis P, Eliaou JF, Kerlan-Candon S, Pinet V, Vincent R, et al. (1993)
Polymorphism in the regulatory region of HLA-DRB genes correlating with
haplotype evolution. Immunogenetics 38: 21–26.
63. Rani R, Fernandez-Vina MA, Stastny P (1998) Associations between HLA class
II alleles in a North Indian population. Tissue Antigens 52: 37–43.
64. Emery P, Mach B, Reith W (1993) The different level of expression of HLA-
DRB1 and -DRB3 genes is controlled by conserved isotypic differences in
promoter sequence. Hum Immunol 38: 137–147.
VDR and MHC Alleles in TID
PLoS ONE | www.plosone.org 14 December 2009 | Volume 4 | Issue 12 | e8023