Exploring the mechanism by which UCHL3 alleviates diabetic foot ulcers: FOXM1/NLRP3 inflammasome-mediated angiogenesis and endothelial cell pyroptosis

Abstract

Background
This study investigated the role of ubiquitin C-terminal hydrolase L3 (UCHL3) in regulating endothelial cell (EC) pyroptosis and angiogenesis in diabetic foot ulcers (DFUs), with a focus on FOXM1 and NLRP3 inflammasomes.

Methods
Differentially expressed genes in DFUs were identified using the GSE134431 dataset and cross-referenced with vascular formation-related factors from GeneCard and deubiquitinases from the UbiNet 2.0 database. A rat DFU model was used to evaluate wound healing, with or without UCHL3 overexpression and FOXM1 knockdown. Histological analysis and immunohistochemistry were employed to assess tissue morphology and the expression of CD31, eNOS, UCHL3, and FOXM1. In vitro, high glucose-induced human umbilical vein ECs (HUVECs) were transfected with UCHL3 overexpression and FOXM1 knockdown constructs. Cell viability, migration, and angiogenesis were assessed.

Results
UCHL3 expression was significantly reduced in DFU tissues. UCHL3 overexpression promoted wound healing in a rat model, while FOXM1 knockdown impaired wound healing and vascular formation. In HUVECs, UCHL3 overexpression enhanced cell viability, migration, and angiogenesis, accompanied by reduced NLRP3 and N-GSDMD levels. FOXM1 knockdown reversed these effects, but treatment with the NLRP3 inhibitor, MCC950, alleviated this damage.

Conclusion
UCHL3 enhances FOXM1 deubiquitination, inhibits NLRP3 inflammasome activation, and reduces EC pyroptosis, thereby contributing to DFU healing. UCHL3 and FOXM1 are potential therapeutic targets for DFU.

Full text

RESEARCH Open Access
© The Author(s) 2025. Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0
International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you
give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modied the
licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or
other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or
exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit h t t p : / / c r e a t i
v e c o m m o n s . o r g / l i c e n s e s / b y - n c - n d / 4 . 0 /.
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
https://doi.org/10.1186/s13018-025-05914-w Journal of Orthopaedic
Surgery and Research
*Correspondence:
Guanghua Guo
gggg2024@126.com
1Medical Center of Burn Plastic and Wound Repair, The First Aliated
Hospital, Jiangxi Medical College, Nanchang University, Nanchang,
Jiangxi Province 330006, China
Abstract
Background This study investigated the role of ubiquitin C-terminal hydrolase L3 (UCHL3) in regulating
endothelial cell (EC) pyroptosis and angiogenesis in diabetic foot ulcers (DFUs), with a focus on FOXM1 and NLRP3
inammasomes.
Methods Dierentially expressed genes in DFUs were identied using the GSE134431 dataset and cross-referenced
with vascular formation-related factors from GeneCard and deubiquitinases from the UbiNet 2.0 database. A rat
DFU model was used to evaluate wound healing, with or without UCHL3 overexpression and FOXM1 knockdown.
Histological analysis and immunohistochemistry were employed to assess tissue morphology and the expression of
CD31, eNOS, UCHL3, and FOXM1. In vitro, high glucose-induced human umbilical vein ECs (HUVECs) were transfected
with UCHL3 overexpression and FOXM1 knockdown constructs. Cell viability, migration, and angiogenesis were
assessed.
Results UCHL3 expression was signicantly reduced in DFU tissues. UCHL3 overexpression promoted wound
healing in a rat model, while FOXM1 knockdown impaired wound healing and vascular formation. In HUVECs, UCHL3
overexpression enhanced cell viability, migration, and angiogenesis, accompanied by reduced NLRP3 and N-GSDMD
levels. FOXM1 knockdown reversed these eects, but treatment with the NLRP3 inhibitor, MCC950, alleviated this
damage.
Conclusion UCHL3 enhances FOXM1 deubiquitination, inhibits NLRP3 inammasome activation, and reduces EC
pyroptosis, thereby contributing to DFU healing. UCHL3 and FOXM1 are potential therapeutic targets for DFU.
Keywords Diabetic foot ulcers, UCHL3, FOXM1, NLRP3 inammasome, Endothelial cells
Exploring the mechanism by which UCHL3
alleviates diabetic foot ulcers: FOXM1/NLRP3
inammasome-mediated angiogenesis
and endothelial cell pyroptosis
XinchengLiao1, ZhengyingJiang1, ZhonghuaFu1 and GuanghuaGuo1*
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 2 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Introduction
Diabetic foot ulcers (DFUs) signicantly increase sus-
ceptibility to infection, elevating both the risk of ampu-
tation and post-amputation mortality rates [1, 2]. e
diagnosis is mainly based on clinical manifestations, and
requires comprehensive evaluation of infection signs,
ulcer depth, and tissue necrosis degree [3]. e wound
healing process in patients with diabetes is notably slow,
and in severe cases, healing may stagnate entirely, lead-
ing to substantial psychological and physical burdens, as
well as posing serious health threats [4]. In individuals
with diabetes, endothelial dysfunction and compromised
microcirculation severely hinder angiogenesis during
wound healing [5]. Although existing treatments such
as surgical intervention can promote ulcer healing, the
treatment outcomes of DFU are still unsatisfactory [6, 7].
erefore, the identication of new therapeutic targets
and intervention strategies is critical for advancing DFU
management.
e pathogenesis of DFUs primarily stems from
chronic inammation and inadequate angiogenesis [8].
Angiogenesis is regulated by various molecular factors
and signaling pathways, with endothelial cell (EC) func-
tions playing a pivotal role in this process [9]. However,
high glucose (HG) levels render ECs highly susceptible to
damage, diminishing their capacity for blood vessel for-
mation [10]. Insucient angiogenesis in wounds exacer-
bates tissue inammation and impedes or halts wound
healing [11]. us, mitigating HG-induced endothelial
damage and enhancing angiogenic potential are critical
for improving wound healing in DFU.
As a post-translational modication, ubiquitination/
deubiquitination critically regulates protein stability
and function, and is involved in the pathophysiology of
many diseases [12]. Deubiquitinases (DUBs) counter-
balance ubiquitination by removing ubiquitin moieties
from target proteins, thereby modulating their func-
tion and stability [13]. Ubiquitin C-terminal hydrolase
(UCH) L3 (UCHL3), a member of the UCH family of
DUBs, has substrates, including Forkhead box protein
M1 (FOXM1), Lactate dehydrogenase A (LDHA), and
TNF receptor-associated factor 2 (TRAF2), which it
deubiquitinates to modulate their activity [14]. Notably,
decreased FOXM1 expression in DFU models has been
associated with impaired wound healing [15], suggest-
ing that UCHL3 may inuence DFU progression through
deubiquitination of FOXM1.
High-glucose environments exacerbate tissue inam-
mation and suppress angiogenesis in DFUs [1]. Stud-
ies have indicated that FOXM1 upregulation attenuates
inammation while promoting endothelial regeneration
and vascular repair [16]. Furthermore, NACHT, LRR
and PYD domains-containing protein 3 (NLRP3) inam-
masome activation induces Gasdermin-D (GSDMD)
cleavage, releasing N-GSDMD, which triggers pyroptosis,
a form of programmed cell death marked by inamma-
tion [17]. Excessive cellular pyroptosis and inammation
are major impediments to wound healing in DFUs [18].
erefore, FOXM1 may enhance DFU wound healing by
suppressing NLRP3 inammasome activation.
In this study, we hypothesized that UCHL3 binds to
FOXM1 to promote its deubiquitination and potentially
improve DFU outcomes. To date, there has been limited
research on the role of UCHL3 in DFUs. We addressed
this gap by investigating how UCHL3 modulates EC
pyroptosis-mediated angiogenesis in DFUs via FOXM1
deubiquitination. Our ndings underscore the critical
role of UCHL3 in DFU management via the regulation of
FOXM1.
Methods
Bioinformatics analysis
Gene expression data from DFUs and skin samples were
obtained from the GSE134431 dataset ( h t t p s : / / w w w . n c
b i . n l m . n i h . g o v / g e o /). Genes with signicant dierential
expression in DFUs were screened, with the following
criteria: P < 0.01 and |logFoldChange| ≥ 1. e Gene-
Card database (https://www.genecards.org/) was used to
retrieve a list of angiogenesis-related genes. Using the
UbiNet 2.0 database ( h t t p : / / u b i b r o w s e r . b i o - i t . c n / u b i b r
o w s e r _ v 3 / h o m e / i n d e x), we obtained factors related to
ubiquitinases (DUBs).
Rat culture and modeling
Adult male SD rats (6 weeks old, weighing 200–220g)
were purchased from Beijing Huafukang Biotechnology
Co., Ltd. and housed in a pathogen-free animal room
(temperature: 22–25°C, humidity: 60–65%) with a 12h
light/dark cycle. e rats were allowed to adapt for 1
week before the experiment. e 36 rats were divided
into six groups: Control, DFU, oe-NC, oe-UCHL3 (over-
expressing UCHL3), oe-UCHL3 + sh-NC (overexpressing
UCHL3), and oe-UCHL3 + sh-FOXM1 (overexpressing
UCHL3 and FOXM1 knockdown). Type 1 diabetes mel-
litus was induced in all rats, except those in the control
group, via a single intraperitoneal injection of strepto-
zotocin (STZ; 100 mg/kg; S0130, Sigma-Aldrich, USA),
freshly dissolved in 0.01 M sodium citrate buer (pH
4.3). Rats were fasted for 12h prior to injection. Control
rats received an equal volume of sodium citrate buer
without STZ. After 72h, fasting blood glucose was mea-
sured from tail vein blood. Rats with glucose levels ≥ 16.7
mmol/L were considered diabetic. To maintain a stable
diabetic state and prevent severe hyperglycemia-related
complications (e.g., ketoacidosis, weight loss, death),
insulin (6–18 U/day; 92209ES10, Yeasen, China) was
administered only to diabetic rats, not to control animals.
Dosage was individually adjusted based on daily blood
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 3 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
glucose levels, with a target range of 16.7–33.3 mmol/L.
Four weeks later, rats were anesthetized using 1.5% iso-
urane (R510-22-10, Shenzhen Reward Life Science &
Technology Company Limited, China), and a full-thick-
ness, round skin wound was created on the back of the
hind foot using a 5mm disposable skin biopsy puncture
device (273690, Kruse, Langeskov, Denmark) and West-
cott scissors to establish a DFU model. Adenoviruses
for overexpression (oe-NC, oe-UCHL3) and knockdown
(sh-FOXM1 1#, 2#, and 3#) were purchased from Vec-
torBuilder and injected subcutaneously (1 × 1011 PFU)
around the wound at 0 h post-modeling. On day 14,
the rats were euthanized via intravenous injection of an
excessive amount of pentobarbital sodium (200mg/kg,
P3761, Sigma-Aldrich). e wound tissue was quickly
removed for subsequent testing [1, 19]. Blood samples
were collected via rapid heart puncture after euthanasia
for further experiments. is study was approved by the
Animal Ethics Committee of Hunan Evidence-Based Bio-
technology Co. Ltd. (ABTZ24002).
Evaluation of the wound healing rate of rats
On days 0, 7, and 14, the wound area was recorded using
a camera and analyzed using ImageJ software (National
Institutes of Health, USA). Wound healing rate was cal-
culated as follows:
W ound healing r ate =



(initial wound area
−daily wound area)
initial wound area



×100%.
Hematoxylin and eosin staining
Rat wound tissue was xed in a 4% paraformaldehyde
solution (158127, Sigma-Aldrich) for 24h. After xation,
the tissue was dehydrated, made transparent, waxed, and
embedded in paran. e tissue sections were immersed
in xylene (534056P4707, Sigma-Aldrich) for 5 min to
remove paran. Ethanol (E7023, Sigma-Aldrich) was
used for hydration, and the sections were then immersed
in hematoxylin staining solution (HHS16, Sigma-Aldrich)
for 5min. After dierentiation in 1% hydrochloric acid
alcohol, the sections were immersed in 0.2% aqueous
ammonia for 1min, returning to blue. e sections were
then stained with eosin staining solution (HT110132,
Sigma-Aldrich) for 1min, dehydrated in ethanol, cleared
in xylene, and sealed with neutral gum sealing agent
(HX93203, ermo Fisher Scientic, Waltham, MA,
USA). Observations were made using a Nikon Eclipse
E200 microscope (Nikon Corporation, Tokyo, Japan).
Cell culture and modeling
Human umbilical vein ECs (HUVECs; C2519A, Lonza,
Basel, Switzerland) were purchased and inoculated into
EGM-2 medium (CC-3162, Lonza) containing 10% FBS
under moist conditions at 37°C and 5% CO₂. HUVECs
were cultured in EGM-2 medium at 50–70% conuence
and transfected with 2µg of either oe-NC (empty vec-
tor control) or oe-UCHL3 plasmid using Lipofectamine
3000 (ermo Fisher) for 24h, followed by 48h culture
in fresh medium. Finally, UCHL3 and FOXM1 expression
in HUVECs was veried by Western blotting (WB). In
normal DMEM (5 mM glucose, D6046, Sigma-Aldrich),
25 mM glucose was added to prepare a high-glucose
medium (30 mM). e cells were incubated with normal
DMEM and high-glucose DMEM for 24 h, followed by
subsequent measurements [20, 21].
Cell Counting Kit-8
Cell viability was determined using a Cell Counting Kit-8
(CCK-8) assay kit (C0037; Beyotime, Shanghai, China).
Cells (3 × 10³/well) were inoculated onto a 96-well plate.
After washing the cells with PBS, they were cultured
at 37°C for 2h in 10 µL CCK-8 and 90 µL serum-free
medium, with 95% air and 5% CO2. e OD was mea-
sured at 450 nm using a microplate reader (BioTek
Instruments Inc., Winooski, Vermont, USA) to evaluate
cell viability.
RT-qPCR
Total RNA was extracted using TRIzol reagent (R1030,
Prilai, Beijing, China). e extracted RNA was quan-
tied using an HD-UV90 spectrophotometer (Shan-
dong Hold Electronic Technology Co., Weifang, China)
according to the manufacturer’s instructions. Two
micrograms of RNA underwent reverse transcription
using the Vazyme DLR102 SynScript® III One-Step RT
Kit (DLR102, Vazyme Biotech Co., Ltd., Nanjing, China)
to create cDNA. A thermal cycler (Applied Biosystems,
California, USA) was used to conduct the RT-qPCR. e
relative expression level was calculated using the 2–ΔΔCt
method [22]. GAPDH was used as the internal control.
e primer sequences are shown in Table1.
Western blotting
e cells were added to radioimmunoprecipitation assay
solution (89900, ermo Fisher Scientic) and lysed on
ice for 30min with shaking every 5min. Centrifugation
was performed at 12,000rpm for 10min at 4°C to col-
lect the supernatant. e protein concentration of each
Table 1 The primer sequences for RT-qPCR
Gene Primer sequences (5ʹ-3ʹ)
UCHL3 Forward CAAACAATCAGCAATGCCTGTGG
Reverse GGCTCATTGACACAGATTCCTCC
GAPDH Forward GTCTCCTCTGACTTCAACAGCG
Reverse ACCACCCTGTTGCTGTAGCCAA
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 4 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
sample was measured using a BCA protein detection kit
(23227; ermo Fisher Scientic). After SDS-PAGE gel
electrophoresis, the protein was transferred to a PVDF
membrane (88518, ermo Fisher Scientic), and the
membrane was sealed with 5% skimmed milk powder
for 1 h following electroporation. Anti-TSP-1 antibody
(1:2000, HY-P83750, MedChemExpress, New Jersey,
USA), Anti-UCHL3 antibody (1:1000, A0280, Abclonal,
Düsseldorf, Germany), Anti-UCHL3 antibody (1:10,000,
ab126621, Abcam, Cambridge, Massachusetts, USA),
anti-FOXM1 antibody (1:1000, ab180710, Abcam),
anti-NLRP3 antibody (1:1000, 30109-1-AP, Santa Cruz
Biotechnology, Inc., Shanghai, China), anti-cleaved
N-terminal GSDMD antibody (1:1000, ab215203), UB
(1:60,000, 80992-1-RR, Proteintech Group, Wuhan,
China), and anti-GAPDH antibody (1:5000, 4A9L6,
ermo Fisher Scientic) were added to the membranes
and incubated overnight at 4 °C. Rat anti-rabbit IgG
horseradish peroxidase (HRP) antibody was diluted in
5% skim milk (1:20,000, 31464, ermo Fisher Scientic)
and incubated at room temperature for 1h. Finally, the
protein bands were developed using an ECL luminescent
reagent (32106, ermo Fisher Scientic) and analyzed
for optical density using ImageJ image analysis software.
Immunohistochemistry
Rat wound tissue slices were placed in sodium citrate buf-
fer (C9999; Sigma-Aldrich) for antigen repair. Sections
were incubated with a blocking solution containing 5%
bovine serum albumin (A9647, Sigma-Aldrich) at room
temperature for 30–60min. e sections were then incu-
bated overnight at 4°C with anti-CD31 antibody (1:4000,
11265-1-AP, Proteintech Group), anti-eNOS antibody
(1:500, 27120-1-AP, Proteintech Group), FOXM1 anti-
body (10µg/mL, AA 209–460, Antibodies Online, Penn-
sylvania, USA), and UCHL3 antibody (1:50, MA5-44997,
ermo Fisher Scientic). e sections were incubated
with HRP secondary antibody (1:1000, 31470, ermo
Fisher Scientic) at room temperature for 30min. e
sections were then incubated with DAB colorimetric
reagent (SK-4100; Vector Laboratories, Burlingame, CA,
USA), counterstained with hematoxylin, dehydrated,
and sealed with neutral gum. Protein expression levels
were quantitatively analyzed using ImageJ image analysis
software by observing and capturing the staining results
under a microscope.
Immunoprecipitation
e cells were collected and lysed using a lysis buf-
fer containing protease inhibitors and placed on ice for
30min. e cell debris was removed by high-speed cen-
trifugation, and the supernatant was collected. UCHL3
antibody (PA5-81106, ermo Fisher Scientic) and IgG
antibody (SAB5600195, Sigma-Aldrich) were added, and
the mixture was incubated overnight at 4°C. Protein A/G
beads (88802, ermo Fisher Scientic) were added and
incubated for 2h to allow the antibody-antigen complex
to bind to the beads. e beads were washed three times
and centrifuged to remove the supernatant. Sample buf-
fer was added, and the samples were boiled for 5min for
Western blot analysis.
Deubiquitination analysis
HUVECs were cultured to a conuence of 70–80%,
after which Lipofectamine™ 3000 transfection reagent
(L30000008, ermo Fisher Scientic) and sh-NC or
sh-UCHL3 plasmids were added to the culture dish and
incubated for 6h. e medium was then replaced, and
the cells were treated with 10 µM proteasome inhibitor
MG132. After 48 h of transfection, the cells were col-
lected and immunoprecipitated with FOXM1 antibody
(PA5-27631, ermo Fisher Scientic). Ub and FOXM1
expression were detected by WB.
Cycloheximide (CHX) detection
First, a suitable cell line was selected for routine culture,
and the cells were divided into control and experimental
groups. In the experimental group, UCHL3 was knocked
down. Fifty micrograms per milliliter of CHX (C7698,
Sigma Aldrich) was added to the experimental and con-
trol group cells, and the cells were collected at dierent
time points (0, 0.5, 1, 2h). WB was performed to analyze
the eect of UCHL3 on FOXM1 protein stability.
Scratch test
ECs were cultured in culture dishes until they formed a
dense monolayer. A sterile pipette tip (200 µL) was then
used to scratch a single layer of cells, simulating a wound,
and creating a “blank” area in the cell layer. Subsequently,
the crossed cells were removed and replaced with serum-
free EGM-2 medium (CC-3162; Lonza, Basel, Switzer-
land) to ensure that no oating cells reattached to the
scratched area. e culture dish was returned to the
incubator, and the scratched area was observed and pho-
tographed at 0 and 24h using a microscope to observe
and record cell migration. e width changes of the
scratch areas at dierent time points were measured and
compared using ImageJ image analysis software to evalu-
ate the speed of cell migration.
Tube formation experiment
Matrigel (356231, Corning, New York, USA) was added
to a 96-well plate, and the plate was incubated in a 37°C
incubator for 30min to solidify the matrix gel. e pre-
pared ECs were evenly inoculated onto the solidied
matrix gels. Subsequently, the 96-well plate was placed
in an incubator and incubated for 6h at 37 °C and 5%
CO₂ conditions. Images were captured after 6 h using
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 5 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
an inverted microscope (Nikon, Tokyo, Japan). ImageJ
image analysis software was used to analyze the captured
images and measure and quantify the total length of the
tubular structure to evaluate the angiogenic ability of the
ECs.
Statistical analysis
Statistical analysis was performed using Prism 9 soft-
ware (GraphPad, USA), and the data were expressed as
mean ± SD. Dierences between the two groups were
analyzed using a t-test. For three or more sets of data,
one-way or two-way ANOVA was used, and Tukey’s test
was applied for post-hoc testing. Statistical signicance
was set at P < 0.05, indicating a statistically signicant
dierence.
Results
UCHL3 is lowly expressed in DFU
To identify dierentially expressed genes in DFUs, we
compared DFU samples with diabetic skin samples from
the GSE134431 dataset, using thresholds of P < 0.01
and|logFC| ≥ 1 (Fig. 1A). An intersection analysis was
conducted with angiogenesis-related factors from Gen-
eCard and DUB factors from the UbiNet 2.0 database,
resulting in three overlapping factors: UCHL3, PSMD14,
and TNFAIP3 (Fig. 1B). UCHL3 showed the small-
est p-value in the dataset. To investigate the function of
UCHL3 in DFU, we developed a rat model. We found
that blood glucose levels signicantly increased after
modeling (DFU pathological rat model, Fig.1C). Evalua-
tion of the wound healing rate demonstrated a signicant
reduction in healing after modeling (Fig.1D). Hematoxy-
lin and eosin staining revealed that the formation of new
blood vessels was markedly reduced in the DFU model
(Fig. 1E). CD31 and eNOS, both critical for angiogen-
esis and vascular function [23, 24], showed decreased
expression in DFU wound tissues as conrmed by immu-
nohistochemistry, along with reduced UCHL3 expres-
sion (Fig.1G, H). In addition, WB detection found that
the expression of VEGF, a marker of angiogenesis, was
signicantly decreased and the expression of TSP-1 was
signicantly increased in the wound tissue of rats after
modeling (Fig.1I). ese results indicate that the DFU rat
model was successfully established and that UCHL3 was
downregulated in DFU rats.
Overexpression of UCHL3 alleviates DFU
To assess the therapeutic potential of UCHL3, we evalu-
ated its eects on DFU. Resultse results indicated
that UCHL3 expression was signicantly elevated in
the oe-UCHL3 group compared to the oe-NC group
(Fig. 2A). Moreover, after the upregulation of UCHL3,
blood glucose levels in DFU rats signicantly decreased
(Fig.2B). e wound healing rate analysis demonstrated
a marked improvement with UCHL3 overexpression,
showing a signicantly accelerated healing rate (Fig.2C).
Histological analysis revealed a notable increase in
newly developed blood vessels in the wound tissue of
UCHL3-overexpressing rats (Fig. 2D). Additionally,
immunohistochemical analysis showed that UCHL3
overexpression led to increased expression of CD31 and
eNOS in the wound tissue (Fig.2E-F). WB assay showed
that the upregulation of UCHL3 signicantly promoted
the expression of VEGF and inhibited the expression of
TSP-1 in the wound tissue of DFU rats (Fig.2G). ese
ndings suggest that UCHL3 overexpression eectively
alleviates DFU, likely through mechanisms involving
enhanced angiogenesis.
UCHL3 inhibits EC damage and promotes angiogenesis
To elucidate the role of UCHL3 in endothelial function,
we examined HG-induced damage in HUVECs with
UCHL3 overexpression. UCHL3 expression was quanti-
ed using RT-qPCR and WB, demonstrating a marked
reduction following HG exposure, whereas UCHL3 over-
expression signicantly elevated its expression levels
under these conditions (Fig.3A, B). Cell viability analysis
using the CCK-8 assay indicated a signicant decrease in
the HG group relative to the normal glucose (NG) group.
Notably, UCHL3 overexpression signicantly enhanced
cell viability in the HG + oe-UCHL3 group compared to
that in the HG + oe-NC group (Fig.3C). Furthermore, the
scratch assay revealed a signicant reduction in HUVEC
migration under HG conditions, which was notably
improved by UCHL3 overexpression (Fig. 3D). Tube
formation assays indicated that UCHL3 overexpression
eectively counteracted the HG-induced suppression of
the angiogenic capacity of HUVECs (Fig.3E). ese nd-
ings suggest that UCHL3 plays a protective role against
HG-induced EC damage while enhancing angiogenic
potential, underscoring its therapeutic potential in vascu-
lar complications associated with diabetes.
UCHL3 binds to FOXM1 and promotes FOXM1
deubiquitination while inhibiting NLRP3 inammasome
activation
Using Ubibrowser 2.0, we analyzed the downstream tar-
gets of UCHL3 (Fig.4A). Previous studies have indicated
that FOXM1 plays a critical role in promoting wound
healing in DFUs [25]. Our experimental validation
demonstrated that HG exposure resulted in decreased
FOXM1 expression in HUVECs; however, cells over-
expressing UCHL3 exhibited increased FOXM1 levels
compared to control cells (Fig.4B). To further investigate
the interaction between UCHL3 and FOXM1, immuno-
precipitation assays were performed. e results indi-
cated a signicant enrichment of FOXM1 in association
with UCHL3 compared to that in the control IgG group,
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 6 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Fig. 1 (See legend on next page.)
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 7 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
conrming the binding relationship between these two
proteins (Fig.4C). We also assessed the eect of UCHL3
knockdown on FOXM1 ubiquitination after treatment
with MG132. e ndings revealed that UCHL3 knock-
down enhanced the interaction between ubiquitin and
FOXM1, suggesting that UCHL3 facilitates the deubiqui-
tination of FOXM1 (Fig.4D). Moreover, CHX treatment
indicated that the knockdown of UCHL3 signicantly
decreased FOXM1 stability (Fig.4E). e NLRP3 inam-
masome promotes cellular pyroptosis [26, 27]. In our
study, HG exposure resulted in elevated expression of
NLRP3 and N-GSDMD in HUVECs; conversely, UCHL3
overexpression mitigated these increases (Fig.4F). Col-
lectively, these results suggest that UCHL3 interacts with
FOXM1 to promote its deubiquitination, while concur-
rently inhibiting the activation of the NLRP3 inam-
masome, highlighting a critical molecular mechanism
underlying EC protection in the context of diabetes-
related complications.
Knockdown of FOXM1 leads to pyroptosis of ECs and
inhibits angiogenesis
To investigate the eects of FOXM1 knockdown in ECs
overexpressing UCHL3, we performed western blot
analysis. e results indicated that FOXM1 expression
was signicantly reduced in the oe-UCHL3 + sh-FOXM1
group compared to that in the oe-UCHL3 + sh-NC group,
whereas the expression levels of NLRP3 and N-GSDMD
were signicantly elevated (Fig.5A). In order to further
clarify the regulatory mechanism of uchl3-foxm1 axis in
DFU, DMSO was used as control, and mcc950 (10μm), a
specic inhibitor of NLRP3 inammasome, was used for
intervention in this study. HG-induced FOXM1 knock-
down in ECs overexpressing UCHL3 markedly reduced
cell viability. However, the addition of the NLRP3 inhibi-
tor MCC950 partially mitigated the decrease in cell activ-
ity caused by FOXM1 knockdown (Fig. 5B). In scratch
assays, ECs overexpressing UCHL3 exhibited a signicant
decline in migration rate following FOXM1 knockdown.
Notably, the introduction of MCC950 into these cells
signicantly enhanced their migration rate, even after
FOXM1 knockdown (Fig. 5C). Furthermore, tube for-
mation assays revealed that FOXM1 knockdown in ECs
overexpressing UCHL3 signicantly reduced the length
of the angiogenic structures (Fig. 5D). ese ndings
indicated that FOXM1 knockdown promotes pyroptosis
in ECs and impairs angiogenesis, highlighting the critical
role of FOXM1 in maintaining EC viability and function
during UCHL3 overexpression.
UCHL3 alleviates DFU by promoting the expression of
FOXM1
We constructed a DFU rat model with UCHL3 overex-
pression to investigate the role of FOXM1 in wound
healing. Immunohistochemical analysis revealed that
FOXM1 expression was signicantly reduced in the
oe-UCHL3 + sh-FOXM1 group compared to the oe-
UCHL3 + sh-NC group (Fig. 6A). After the downregu-
lation of FOXM1, the blood glucose levels in rats were
signicantly reduced (Fig. 6B). Furthermore, FOXM1
knockdown in model rats markedly decreased the
wound healing rate (Fig. 6C). Additionally, there was
a signicant reduction in the formation of new blood
vessels and mature granulation tissue (Fig.6D). Immu-
nohistochemical assessments demonstrated that the
inhibition of FOXM1 expression in model rats led to a
substantial decrease in the expression levels of CD31
and eNOS, both of which are critical markers of angio-
genesis (Fig.6E, F). WB analysis found that downregula-
tion of FOXM1 signicantly reversed the upregulation
of UCHL3 on VEGF expression promotion and inhibi-
tion of TSP-1 expression (Fig.6G). In summary, these
results indicate that the knockdown of FOXM1 inhibits
the benecial eects of UCHL3 on DFU, underscoring
the importance of FOXM1 in mediating the therapeu-
tic actions of UCHL3 in this model of diabetes-related
complications.
Discussion
DFUs are a signicant and prevalent complication of
diabetes that profoundly impact patients’ quality of life,
primarily due to the associated risk of amputation [28].
is complication is largely attributed to impaired neo-
vascularization induced by HG levels, leading to isch-
emia, hypoxia, and diculties in transporting essential
nutrients to damaged tissues [29]. Chronic wounds not
only diminish patients’ quality of life but also contribute
to an increased mortality rate [30]. Although the cur-
rent treatment modalities for DFU are comprehensive,
substantial challenges remain, resulting in suboptimal
(See gure on previous page.)
Fig. 1 UCHL3 is lowly expressed in DFU. (A) Volcanic map of dierentially expressed genes in GSE134431. (B) The intersection Venn diagram of DEGs with
vascular formation related factors downloaded from GeneCard database and DUBs collected from UbiNet 2.0 database. (C) Detection of changes in blood
glucose levels in rats before and after modeling. (D) Assessment of alterations in wound healing rate in rats before and after modeling. (E) HE staining was
used to compare histological and morphological characteristics of the wound before and after modeling. (F) Immunohistochemical analysis of changes
in CD31 expression in wound tissue before and after modeling. (G) Immunohistochemical analysis of changes in eNOS expression in wound tissue before
and after modeling. (H) Immunohistochemical analysis of changes in UCHL3 expression in wound tissue before and after modeling. (I) WB detection of
changes in angiogenesis-related proteins (VEGF and TSP-1) in rat wound tissues before and after modeling. n = 6. The magnication of images D, E, F and
G is 100 times (scale = 400μm) and 200 times (scale = 200μm) respectively. **** P < 0.0001. The detection between the two groups was analyzed using
t-test. Two factor analysis of variance (ANOVA) will be used for three or more sets of data, and Tukey’s will be used for post hoc testing
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 8 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Fig. 2 Overexpression of UCHL3 alleviates DFU. (A) Immunohistochemical detection of UCHL3 expression to verify overexpression eciency. (B) As-
sessment of wound healing rate in rats after UCHL3 overexpression. (C) Detection of blood glucose levels in rats to evaluate metabolic eects of UCHL3
overexpression. (D) HE staining was used to analyze histological and morphological changes in the wound after UCHL3 overexpression. (E) Immunohisto-
chemical detection of CD31 expression to assess angiogenesis following UCHL3 overexpression. (F) Immunohistochemical detection of eNOS expression
to evaluate endothelial function after UCHL3 overexpression. (G) WB analysis of angiogenesis-related proteins (VEGF and TSP-1) in wound tissues after
UCHL3 overexpression. n = 6. The magnication of images A, D, E and F is 100 times (scale = 400μm) and 200 times (scale = 200μm) respectively. ***
P < 0.001, **** P < 0.0001. The detection between the two groups was analyzed using t-test. Two factor analysis of variance (ANOVA) will be used for three
or more sets of data, and Tukey’s will be used for post hoc testing
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 9 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
therapeutic outcomes in many patients [31]. e TRIM
family has been reported to be associated with inam-
mation and angiogenesis in endothelial cells ECs [32,
33] Using bioinformatics analysis, we identied three
deubiquitinating factors associated with diabetic
nephropathy: UCHL3, PSMD14, and TNFAIP3. UCHL3
plays an important role in regulating protein deubiq-
uitination, contributing to the maintenance of intra-
cellular protein homeostasis and regulation of various
cellular processes [14]. PSMD14, a component of the
26 S proteasome, participates in deubiquitination by
regulating protein degradation and cell cycle control
[34]. TNFAIP3 inhibits the NF-κB signaling pathway
through its deubiquitination activity and exerts immu-
nomodulatory and anti-inammatory eects [35]. In
our dataset, UCHL3 showed the highest statistical sig-
nicance, suggesting that it might play a key role in the
biological processes or pathological mechanisms under
investigation. In our study, we observed a signicant
downregulation of UCHL3 in both DFU rat models and
HG-treated ECs, suggesting that UCHL3 may play a
crucial role in the pathophysiology of DFU.
Fig. 3 UCHL3 inhibits endothelial cell damage and promotes angiogenesis. (A) RT-qPCR detection of UCHL3 mRNA expression levels in HUVECs. (B) WB
detection of UCHL3 protein expression in HUVECs. (C) CCK-8 assay to measure HUVEC proliferation activity. (D) Scratch wound healing assay to evaluate
HUVEC migration ability. (E) Tube formation assay to assess angiogenesis capacity of HUVECs. n = 3. The magnication of images D and E is 100 times
(scale = 400μm). ** P < 0.01, *** P < 0.001, **** P < 0.0001. Three or more sets of data were analyzed using one-way ANOVA and subjected to post hoc
testing using Tukey’s
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 10 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Fig. 4 (See legend on next page.)
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 11 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
e generation of new blood vessels is crucial in the
wound healing process in patients with DFU, as hypoxia
in the wound tissue caused by vascular injury can delay
healing [36]. In normal wound healing, angiogenesis
relies on a delicate balance between promoting vascular
growth and proliferation and supporting vascular matu-
ration and stasis [11]. However, in patients with diabetes,
this balance is disrupted, severely hindering angiogene-
sis and leading to slow or non-healing wounds [37]. Our
experiments demonstrated that HG conditions damaged
HUVECs with decreased cell activity, impaired migra-
tion, and reduced angiogenic capacity. Furthermore, we
observed a decrease in the number of newly developed
blood vessels in the DFU rat model, which was detri-
mental to angiogenesis and wound healing in patients
with diabetes. By validating the role of UCHL3 through
overexpression, we conrmed that its overexpression sig-
nicantly ameliorated these adverse eects. is suggests
that promoting wound healing in patients with DFU
through UCHL3 may be an eective therapeutic strategy.
FOXM1 is a transcription factor associated with cell
proliferation and is widely expressed during the cell
cycle [38]. Our ndings indicate that HG treatment of
HUVECs resulted in increased FOXM1 expression in
cells overexpressing UCHL3. In addition, we demon-
strated that UCHL3 promotes the deubiquitination of
FOXM1. Ubiquitination of FOXM1 promotes protein
degradation, whereas UCHL3 enhances FOXM1 pro-
tein stability by promoting deubiquitination. We also
found that the alleviating eect of UCHL3 on DFU was
reversed by inhibiting FOXM1 expression. Previous stud-
ies have shown that FOXM1 promotes endothelial regen-
eration and vascular repair in lung tissue while alleviating
inammation [16]. Notably, downregulation of FOXM1
expression in DFU mice has been linked to impaired
wound healing [15]. ese observations suggest that
FOXM1 facilitates endothelial regeneration and vascular
repair in DFU by suppressing inammatory responses.
Additionally, activation of the NLRP3 inammasome
has been associated with inammation and pyroptosis
[27]. Our results indicate that NLRP3 expression lev-
els were reduced in cells overexpressing UCHL3. How-
ever, inhibition of FOXM1 expression increased NLRP3
and N-GSDMD expression levels. GSDMD mediates
pro-inammatory cell lysis, leading to pyroptosis. e
NLRP3 inammasome can induce GSDMD lysis, result-
ing in the release of N-GSDMD, which drives pyroptotic
cell death [17]. In our experiments, we induced HG levels
in HUVECs overexpressing UCHL3 by knocking down
FOXM1 and using NLRP3 inhibitors. Under these con-
ditions, we observed a decrease in FOXM1 expression
and an increase in NLRP3 and N-GSDMD expression
along with the inhibition of cell viability and angiogen-
esis. However, the addition of MCC950 reversed these
adverse eects. ese ndings support our hypothesis
that UCHL3 inhibits NLRP3 inammasome activation
and pyroptosis via FOXM1 deubiquitination, thereby
promoting wound healing in DFU rats.
Although this study demonstrated that UCHL3 pro-
motes wound healing by mediating the deubiquitination
of FOXM1 in a DFU rat model and high glucose-induced
endothelial cells, we recognize that UCHL3, as a deu-
biquitinating enzyme, may regulate multiple substrates
that collectively contribute to the wound healing pro-
cess. erefore, in future studies, we plan to employ
high-throughput approaches such as proteomic screen-
ing to systematically identify additional potential sub-
strates of UCHL3, in order to gain a more comprehensive
understanding of its regulatory network and biological
functions. Moreover, considering the important roles
of keratinocytes and broblasts in tissue repair, we also
intend to incorporate these cell types in subsequent
experiments to further investigate the role of UCHL3 in
intercellular interactions, thereby elucidating the multi-
cellular mechanisms underlying diabetic wound healing
in a more integrated manner.
(See gure on previous page.)
Fig. 4 UCHL3 binds to FOXM1 and promotes FOXM1 deubiquitination while inhibiting NLRP3 inammasome activation. (A) The targeting relationship
of UCHL3 in Ubibrowser 2.0. (B) WB analysis of FOXM1 expression in HUVECs. (C) Immunoprecipitation detection of the binding relationship between
UCHL3 and FOXM1. (D) Immunoprecipitation assay was used to detect the deubiquitination modication of FOXM1 by UCHL3. (E) CHX treatment was
used to detect the eect of UCHL3 on the stability of FOXM1 protein. (F) WB detection of NLRP3 and N-GSDMD in HUVECs. n = 3. **** P < 0.0001. Three or
more sets of data will be analyzed using one-way or two-way ANOVA, and Tukey’s will be used for post hoc testing
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 12 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Fig. 5 Knockdown of FOXM1 leads to pyroptosis of endothelial cells and inhibits angiogenesis. (A) WB detection of FOXM1, NLRP3, and N-GSDMD expres-
sion in HUVECs. (B) CCK-8 assay measuring proliferation activity of HUVECs. (C) Scratch wound healing assay detecting migration ability of HUVECs. (D)
Tube formation assay evaluating angiogenesis capacity of HUVECs. n = 3. The magnication of images D and E is 100 times (scale = 400μm). *** P < 0.001,
**** P < 0.0001. Three or more sets of data will be analyzed using one-way or two-way ANOVA, and Tukey’s will be used for post hoc testing
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 13 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Conclusions
In summary, this study demonstrated that UCHL3 pro-
motes wound healing in DFU rats by binding to FOXM1
and facilitating its deubiquitination and degradation. Fur-
thermore, UCHL3 inhibits GSDMD degradation through
the FOXM1/NLRP3 inammasome pathway, suppress-
ing EC pyroptosis under high-glucose conditions and
promoting angiogenesis, thereby exerting a protective
eect against DFU.
Acknowledgements
Not applicable.
Author contributions
Zhonghua Fu and Guanghua Guo prepared the manuscript preparation,
Xincheng Liao and Zhengying Jiang designed this study. All authors reviewed
the manuscript.
Fig. 6 UCHL3 alleviates DFU by promoting the expression of FOXM1. (A) Immunohistochemical detection of FOXM1 expression in rat wound tissue. (B)
Wound healing rate assessment in rats. (C) Blood glucose level monitoring in rats. (D) HE staining analysis of wound histology and morphology. (E) Immu-
nohistochemical detection of CD31 (angiogenesis marker) in wound tissue. (F) Immunohistochemical detection of eNOS (endothelial function marker) in
wound tissue. (G) WB analysis of angiogenesis-related proteins (VEGF and TSP-1) in wound tissues. n = 6. The magnication of images A, D,E and F is 100
times (scale = 400μm) and 200 times (scale = 200μm) respectively. ** P < 0.01, *** P < 0.001. The detection between the two groups was analyzed using
t-test. Two factor analysis of variance (ANOVA) will be used for three or more sets of data, and Tukey’s will be used for post hoc testing
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 14 of 14
Liao et al. Journal of Orthopaedic Surgery and Research (2025) 20:488
Funding
It is supported by National Natural Science Foundation of China (Grant No.
82160380).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethical approval
This experiment has been approved by the Animal Ethics Committee of
Hunan Evidence-based Biotechnology Co., Ltd. (ABTZ24002). All procedures
and reporting were performed according to the ARRIVE guidelines including
the 3R concept.
Competing interests
The authors declare no competing interests.
Received: 1 April 2025 / Accepted: 11 May 2025
References
1. Li X, Xie X, Lian W, Shi R, Han S, Zhang H, et al. Exosomes from adipose-
derived stem cells overexpressing Nrf2 accelerate cutaneous wound healing
by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med.
2018;50:1–14.
2. Ahluwalia R, Lazaro-Martinez JL, Reichert I, Maulli N. Advances in phar-
macotherapy for diabetic foot osteomyelitis. Expert Opin Pharmacother.
2021;22:2281–91.
3. Aicale R, Cipollaro L, Esposito S, Maulli N. An evidence based narrative
review on treatment of diabetic foot osteomyelitis. Surgeon. 2020;18:311–20.
4. Ramsey DJ, Kwan JT, Sharma A. Keeping an eye on the diabetic foot: the
connection between diabetic eye disease and wound healing in the lower
extremity. World J Diabetes. 2022;13:1035–48.
5. Yan C, Chen J, Wang C, Yuan M, Kang Y, Wu Z, et al. Milk exosomes-mediated
miR-31-5p delivery accelerates diabetic wound healing through promoting
angiogenesis. Drug Deliv. 2022;29:214–28.
6. Ahluwalia R, Maulli N, Lazaro-Martinez JL, Kirketerp-Moller K, Reichert I.
Diabetic foot o loading and ulcer remission: exploring surgical o-loading.
Surgeon. 2021;19:e526–35.
7. Chamberlain RC, Fleetwood K, Wild SH, Colhoun HM, Lindsay RS, Petrie JR,
et al. Foot ulcer and risk of lower limb amputation or death in people with
diabetes: A National Population-Based retrospective cohort study. Diabetes
Care. 2022;45:83–91.
8. Canha F, Soares R. The use of innovative targeted angiogenic therapies for
ischemic diabetic foot ulcer repair: from nanomedicine and MicroRNAs
toward hyperbaric oxygen therapy. Porto Biomed J. 2023;8:e187.
9. Bitar MS. Diabetes impairs angiogenesis and induces endothelial cell senes-
cence by up-regulating Thrombospondin-CD47-Dependent signaling. Int J
Mol Sci. 2019;20.
10. Brem H, Jacobs T, Vileikyte L, Weinberger S, Gibber M, Gill K, et al. Wound-
healing protocols for diabetic foot and pressure ulcers. Surg Technol Int.
2003;11:85–92.
11. Guo S, Dipietro LA. Factors aecting wound healing. J Dent Res.
2010;89:219–29.
12. Kitamura H. Ubiquitin-Specic proteases (USPs) and metabolic disorders. Int J
Mol Sci. 2023;24.
13. Zhao Y, Fan S, Zhu H, Zhao Q, Fang Z, Xu D, et al. Podocyte OTUD5 alleviates
diabetic kidney disease through deubiquitinating TAK1 and reducing podo-
cyte inammation and injury. Nat Commun. 2024;15:5441.
14. Zhao J, Huo Q, Zhang J, Sun K, Guo J, Cheng F, et al. UCHL3 promotes hepato-
cellular carcinoma progression by stabilizing EEF1A1 through deubiquitina-
tion. Biol Direct. 2024;19:53.
15. Sawaya AP, Stone RC, Brooks SR, Pastar I, Jozic I, Hasneen K, et al. Deregulated
immune cell recruitment orchestrated by FOXM1 impairs human diabetic
wound healing. Nat Commun. 2020;11:4678.
16. Huang X, Zhang X, Machireddy N, Evans CE, Trewartha SD, Hu G, et al.
Endothelial FoxM1 reactivates aging-impaired endothelial regeneration for
vascular repair and resolution of inammatory lung injury. Sci Transl Med.
2023;15:eabm5755.
17. Zhen Y, Zhang H. NLRP3 inammasome and inammator y bowel disease.
Front Immunol. 2019;10:276.
18. Mu X, Wu X, He W, Liu Y, Wu F, Nie X. Pyroptosis and inammasomes in
diabetic wound healing. Front Endocrinol (Lausanne). 2022;13:950798.
19. Chen J, Liu Y, Zhang J, Yang Y, Liang H, Li T, et al. External application of
human umbilical Cord-Derived mesenchymal stem cells in hyaluronic acid
gel repairs foot wounds of types I and II diabetic rats through paracrine
action mode. Stem Cells Transl Med. 2023;12:689–706.
20. Lai TC, Chen YC, Cheng HH, Lee TL, Tsai JS, Lee IT, et al. Combined exposure to
ne particulate matter and high glucose aggravates endothelial damage by
increasing inammation and mitophagy: the involvement of vitamin D. Part
Fibre Toxicol. 2022;19:25.
21. Lin X, Huang S, Gao S, Liu J, Tang J, Yu M. Integrin beta5 subunit regulates
hyperglycemia-induced vascular endothelial cell apoptosis through FoxO1-
mediated macroautophagy. Chin Med J (Engl). 2024;137:565–76.
22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T )) method. Methods.
2001;25:402–8.
23. Zhang Z, Gan Q, Han J, Tao Q, Qiu WQ, Madri JA. CD31 as a probable respond-
ing and gate-keeping protein of the blood-brain barrier and the risk of
Alzheimer’s disease. J Cereb Blood Flow Metab. 2023;43:1027–41.
24. Leo F, Suvorava T, Heuser SK, Li J, LoBue A, Barbarino F, et al. Red blood
cell and endothelial eNOS independently regulate Circulating nitric oxide
metabolites and blood pressure. Circulation. 2021;144:870–89.
25. Sawaya AP, Stone RC, Mehdizadeh S, Pastar I, Worrell S, Baluko NC, et al.
FOXM1 network in association with TREM1 suppression regulates NET forma-
tion in diabetic foot ulcers. EMBO Rep. 2022;23:e54558.
26. Xiao Y, Zhao C, Tai Y, Li B, Lan T, Lai E, et al. STING mediates hepatocyte pyrop-
tosis in liver brosis by epigenetically activating the NLRP3 inammasome.
Redox Biol. 2023;62:102691.
27. Li N, Zhou H, Wu H, Wu Q, Duan M, Deng W, et al. STING-IRF3 contributes to
lipopolysaccharide-induced cardiac dysfunction, inammation, apoptosis
and pyroptosis by activating NLRP3. Redox Biol. 2019;24:101215.
28. Xie J, Liu X, Wu B, Chen B, Song Q, Guan Y, et al. Bone transport induces the
release of factors with multi-tissue regenerative potential for diabetic wound
healing in rats and patients. Cell Rep Med. 2024;5:101588.
29. You J, Sun J, Ma T, Yang Z, Wang X, Zhang Z, et al. Curcumin induces
therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via
modulating the function of endothelial progenitor cells. Stem Cell Res Ther.
2017;8:182.
30. Armstrong DG, Boulton AJM, Bus SA. Diabetic foot ulcers and their recur-
rence. N Engl J Med. 2017;376:2367–75.
31. Kerstan A, Dieter K, Niebergall-Roth E, Klingele S, Junger M, Hasslacher C, et
al. Translational development of ABCB5(+) dermal mesenchymal stem cells
for therapeutic induction of angiogenesis in non-healing diabetic foot ulcers.
Stem Cell Res Ther. 2022;13:455.
32. Wang Y, Li J, Huang Y, Dai X, Liu Y, Liu Z, et al. Tripartite motif-containing
28 bridges endothelial inammation and angiogenic activity by retain-
ing expression of TNFR-1 and – 2 and VEGFR2 in endothelial cells. FASEB J.
2017;31:2026–36.
33. Liu J, Xu J, Huang J, Gu C, Liu Q, Zhang W, et al. TRIM27 contributes to
glomerular endothelial cell injury in lupus nephritis by mediating the FoxO1
signaling pathway. Lab Invest. 2021;101:983–97.
34. He L, Yu C, Qin S, Zheng E, Liu X, Liu Y, et al. The proteasome component
PSMD14 drives myelomagenesis through a histone deubiquitinase activity.
Mol Cell. 2023;83:4000–16. e6.
35. Liu L, Jiang Y, Steinle JJ. TNFAIP3 is anti-inammatory in the retinal vascula-
ture. Mol Vis. 2022;28:124–9.
36. Okonkwo UA, DiPietro LA. Diabetes and wound angiogenesis. Int J Mol Sci.
2017;18.
37. Altabas V, Diabetes. Endothelial dysfunction, and vascular repair: what should
a diabetologist keep his eye on? Int J Endocrinol. 2015;2015:848272.
38. Liao GB, Li XZ, Zeng S, Liu C, Yang SM, Yang L, et al. Regulation of the master
regulator FOXM1 in cancer. Cell Commun Signal. 2018;16:57.
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional aliations.
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com