LncRNA ENSSSCG00000035331 Alleviates Hippocampal Neuronal Ferroptosis and Brain Injury Following Porcine Cardiopulmonary Resuscitation by Regulating the miR‐let7a/GPX4 Axis

Abstract

Background
Following successful cardiopulmonary resuscitation, those survivors of cardiac arrest (CA) often suffer from severe brain injury, and the latter can result in significant mortality and morbidity. Emerging evidence implicates that ferroptosis is involved in the pathogenesis of post‐resuscitation brain injury, and its regulatory mechanisms remain to be investigated. Recently, some studies manifested that long noncoding RNAs could be critical regulators of cell ferroptosis in diverse ischemia–reperfusion injuries of vital organs. This study was designed to explore the role and mechanism of a newly screened long noncoding RNA ENSSSCG00000035331 in alleviating post‐resuscitation hippocampal neuronal ferroptosis and further investigate its potential regulation by a novel antioxidant sulforaphane.

Methods and Results
Healthy male pigs and mice were used to establish the models of CA and resuscitation in vivo. A hypoxia/reoxygenation (H/R) model using primary porcine hippocampal neurons was constructed to replicate post‐resuscitation brain injury in vitro. We found that the expression of ENSSSCG00000035331 was significantly decreased in the post‐resuscitation impaired hippocampus using RNA sequencing analysis and verification. Subsequently, ENSSSCG00000035331 overexpression significantly reduced ferroptosis‐related ferrous iron and reactive oxygen species production while markedly increased glutathione and further alleviated post‐resuscitation brain injury. Mechanistically, ENSSSCG00000035331 interacted with miR‐let7a, then inhibited its binding with glutathione peroxidase 4 (GPX4) mRNA and finally promoted the recovery of the latter's translation after H/R stimulation. In addition, sulforaphane treatment significantly increased ENSSSCG00000035331 and GPX4 expression while markedly decreased miR‐let7a expression and hippocampal neuronal ferroptosis and finally alleviated post‐resuscitation brain injury.

Conclusions
Our findings highlighted that ENSSSCG00000035331 was a critical regulator of hippocampal neuronal ferroptosis after CA and resuscitation by targeting the miR‐let7a/GPX4 axis, and additionally, sulforaphane might be a promising therapeutic agent for alleviating post‐resuscitation brain injury by regulating the signaling axis mentioned above.

Full text

1 of 19
CNS Neuroscience & Therapeutics, 2025; 31:e70377
https://doi.org/10.1111/cns.70377
CNS Neuroscience & Therapeutics
ORIGINAL ARTICLE OPEN ACCESS
LncRNA ENSSSCG00000035331 Alleviates Hippocampal
Neuronal Ferroptosis and Brain Injury Following Porcine
Cardiopulmonary Resuscitation by Regulating the
miR- let7a/GPX4 Axis
MaoZhang1, 2,3 | WenbinZhang1, 2,3 | ZiweiChen1,2,3 | LuHe1,2, 3 | QijiangChen4 | PinLan5 | LuluLi6 | XianlongWu7 |
XinguiWu8,9 | JiefengXu1,2,3
1Department of Emergency Medicine, Second A ffiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China | 2Zhejiang Key Laboratory
of Trauma, Burn, and Medical Rescue, Hangzhou, China | 3Zhejiang Province Clinical Research Center for Emergency and Critical Care Medicine,
Hangzhou, China | 4Department of Intensive Care Medicine, The First Hospital of Ninghai, Ningbo, China | 5Department of Emergency Medicine,
Fifth Affiliated Hospital of Wenzhou Medical University, Lishui Central Hospital, Lishui, China | 6Department of Emergency Medicine, First A ffiliated
Hospital, Zhejiang University School of Medicine, Hangzhou, China | 7Department of Emergency Medicine, Taizhou First People's Hospital, Taizhou,
China | 8Institute of Pediatrics, Guangdong Provincial Key Laboratory of Research in Structural Birth Defect Disease, Guangzhou, China | 9Guangzhou
Women and Children's Medical Center, Guangzhou Medical University, Guangzhou,China
Correspondence: Xingui Wu (258090591@qq.com) | Jiefeng Xu (z2jeffxu@zju.edu.cn)
Received: 11 November 2024 | Revised: 13 March 2025 | Accepted: 27 March 2025
Funding: This study was supported by the Zhejiang Provincial Key Research and Development Program of China (2024C04045 and 2021C03073), the
Natural Science Foundation of China (82372204, 82 072126, and 82472234), and the Zhejiang Provincial Chinese Medical Science Foundation (2024ZL207).
Keywords: brain injury| cardiac arrest| ENS SSCG 00000035331| hippocampal neuronal ferroptosis| miR- let7a| sulforaphane
ABSTRACT
Background: Following successful cardiopulmonary resuscitation, those survivors of cardiac arrest (CA) often suffer from
severe brain injury, and the latter can result in significant mortality and morbidity. Emerging evidence implicates that ferropto-
sis is involved in the pathogenesis of post- resuscitation brain injury, and its regulatory mechanisms remain to be investigated.
Recently, some studies manifested that long noncoding RNAs could be critical regulators of cell ferroptosis in diverse ischemia–
reperfusion injuries of vital organs. This study was designed to explore the role and mechanism of a newly screened long noncod-
ing RNA ENSSSCG00000035331 in alleviating post- resuscitation hippocampal neuronal ferroptosis and further investigate its
potential regulation by a novel antioxidant sulforaphane.
Methods and Results: Healthy male pigs and mice were used to establish the models of CA and resuscitation invivo. A hypoxia/
reoxygenation (H/R) model using primary porcine hippocampal neurons was constructed to replicate post- resuscitation brain in-
jury invitro. We found that the expression of ENSSSCG00000035331 was significantly decreased in the post- resuscitation impaired
hippocampus using RNA sequencing analysis and verification. Subsequently, ENSSSCG00000035331 overexpression significantly
reduced ferroptosis- related ferrous iron and reactive oxygen species production while markedly increased glutathione and further
alleviated post- resuscitation brain injury. Mechanistically, ENSSSCG000 00035331 interacted with miR- let7a, then inhibited its bind-
ing with glutathione peroxidase 4 (GPX4) mRNA and finally promoted the recovery of the latter's translation after H/R stimulation.
In addition, sulforaphane treatment significantly increased ENSSSCG00000035331 and GPX4 expression while markedly decreased
miR- let7a expression and hippocampal neuronal ferroptosis and finally alleviated post- resuscitation brain injury.
This is a n open access ar ticle under the terms of t he Creative Commons Attr ibution License, which p ermits use, dis tribution and repro duction in any medium, p rovided the orig inal work is
properly cited.
© 2025 T he Author(s). CNS Neuroscience & Therapeutics published by J ohn Wiley & Sons Ltd .
Mao Zha ng and Wenbin Zhang have c ontributed equa lly to this work.

2 of 19 CNS Neuroscience & Therapeutics, 2025
Conclusions: Our findings highlighted that ENSSSCG00000035331 was a critical regulator of hippocampal neuronal ferropto-
sis after CA and resuscitation by targeting the miR- let7a/GPX4 axis, and additionally, sulforaphane might be a promising thera-
peutic agent for alleviating post- resuscitation brain injury by regulating the signaling axis mentioned above.
1 | Introduction
Cardiac arrest (CA) survivors frequently suffer from severe
brain injury after restoring spontaneous circulation from car-
diopulmonary resuscitation (CPR) [1]. Post- resuscitation brain
injury has become the primary cause of mortality and mor-
bidity at the stage of post- resuscitation care in CA victims [2].
Although therapeutic hypothermia is always recommended to
alleviate post- resuscitation brain injury in clinical guidelines;
however, its therapeutic efficacy is limited [3, 4]. Currently,
the pathogenesis of post- resuscitation brain injury is still re-
quired to explore and further develop its effective therapeutic
strategies.
Ferroptosis, recently identified as a novel form of regulatory
cell death, is characterized by an iron- dependent and caspase-
independent mode of cell death outside of apoptosis and acts as
a central regulator in ischemia–reperfusion injury (IRI) across
various organs [5, 6]. Following IRI, ferrous iron (Fe2+) is abnor-
mally elevated in those injured cells and then promotes the pro-
duction of reactive oxygen species (ROS) via Fenton reactions,
and the latter facilitates lipid peroxidation of polyunsaturated
fatty acids in those biomembranes to produce lipid perox-
ides and finally leads to the occurrence of cell ferroptosis [7].
Additionally, glutathione peroxidase 4 (GPX4) is acknowledged
as a key molecule that negatively regulates the process of ferro-
ptosis by converting lipid peroxides into nontoxic lipid alcohols
via the oxidation of glutathione (GSH) to glutathione disulfide
[8]. Recent studies have highlighted the prominent role of ferro-
ptosis in brain IRI, particularly suggesting its involvement in the
pathogenesis of post- resuscitation brain injury [9, 10]. However,
the regulatory mechanisms of ferroptosis and its potential in-
tervention strategies in post- resuscitation brain injury require
further investigations.
Recent studies have consistently demonstrated that the long
noncoding RNAs (lncRNAs) which act as competing endoge-
nous RNAs are integral to numerous biological processes by in-
teracting with microRNAs [11, 12]. This competing mechanism
is vital in pathological conditions including diverse IRI events,
and highlights the important role of lncRNAs in regulating cel-
lular homeostasis and stress response. Especially, some studies
have confirmed that lncRNAs could regulate the process of cell
ferroptosis and further affect the pathological progression of
regional IRI of multiple vital organs, such as the brain, heart,
liver, and kidney [13–16]. Nonetheless, the exploration of key ln-
cRNAs that regulate brain ferroptosis after CA and resuscitation
remains to be investigated.
In this study, we focused on the hippocampus, a representa-
tive vulnerable region of the brain following CA and resusci-
tation. Then, we employed whole transcriptome sequencing to
successfully identify the top differentially expressed lncRNA
ENSSSCG00000035331 in the post- resuscitation impaired
hippocampus in a clinically relevant, large- animal model. We
proceeded to investigate its role in the process of hippocampal
neuronal ferroptosis after hypoxia/reoxygenation (H/R) invitro
and CA and resuscitation in vivo. Consequently, we demon-
strated that ENSSSCG 00000035331 overexpression significantly
inhibited hippocampal neuronal ferroptosis by recovering the
translation of GPX4 mRNA via interacting with miR- let7a.
Furthermore, we confirmed that a specific antioxidant, sul-
foraphane (SFN) significantly alleviated post- resuscitation
brain injury possibly by inhibiting ferroptosis via regulating the
ENSSSCG00000035331/miR- let7a/GPX4 axis.
2 | Methods
2.1 | Ethical Statement
All experimental animals were managed in strict accordance
with the “Principles of Laboratory Animal Care” established by
the National Medical Research Association and the “Guidelines
for the Care and Use of Laboratory Animals” issued by the
Institute of Laboratory Animal Resources, thereby ensuring hu-
mane treatment throughout the experiment. This experimental
protocol received formal approval from the Institutional Animal
Care and Use Committee of the Second Affiliated Hospital,
Zhejiang University School of Medicine (2024034).
2.2 | Sex as a Biological Variable
In this study, healthy male domestic pigs (4–6 m, 35–42 kg)
were purchased from Shanghai Jiagan Biotechnology Inc.
(Shanghai, China), and healthy male C57BL/6 mice (8–12 w,
20–25 g) were purchased from Zhejiang Vital River Laboratory
Animal Technology Co. Ltd. (Zhejiang, China). Previous re-
search has shown that female animals exhibit better preserva-
tion of hemodynamic parameters and less myocardial damage
following hemorrhage and resuscitation from circulatory ar-
rest, and these differences are independent of sex hormones
[17]. This study aims to investigate the role and mechanism
of the newly discovered lncRNA ENSSSCG00000035331 in
alleviating hippocampal neuronal ferroptosis after CA and
resuscitation. To avoid interference from gender differences
in experimental results, using single- sex adult animals en-
sures physiological consistency among experimental groups.
Selecting adult male pigs and mice effectively reduces vari-
ables introduced by gender differences, thereby enhancing
the accuracy and reproducibility of the experimental results.
Additionally, most of our previous studies have used male
animals [18], which helps establish a consistent research
foundation and facilitates cross- study comparisons and com-
prehensive analysis.

3 of 19
2.3 | The Establishment of the Pig Model of CA
and Resuscitation
Initially, the pig was sedated with a mixture of intramuscu-
lar thiamylal/zolazepam (5 mg/kg) and xylazine (1 mg/kg),
followed by induction of anesthesia with intravenous propo-
fol (2 mg/kg) and then its continuous maintenance at 4 mg/
kg/h. Subsequently, endotracheal intubation was performed,
and a ventilator (SV350, Mindray, Shenzhen, China) was pro-
grammed with the following ventilation parameters: tidal vol-
ume of 10 mL/kg, respiratory frequency of 12 breaths/min, peak
flow rate of 40 L/min, and a fractional inspired oxygen concen-
tration of 0.21. Concurrently, the levels of end- tidal CO2 were
monitored using an integrated defibrillator/monitor (M Series,
ZOLL Medical Corporation, Chelmsford, America). The moni-
toring of hemodynamics, including heart rate and arterial and
atrial pressures, was achieved using a patient monitoring system
(BeneVision N15, Mindray, Shenzhen, China), in which adhe-
sive electrodes adhered to the skin of the upper and lower limbs,
and two 7 Fr pressure- monitoring catheters were advanced from
the right femoral artery and vein into the thoracic aorta and
right atrium. CA was induced by navigating a 5F pacing catheter
through the right external jugular vein into the right ventricle.
Baseline arterial blood gas was measured using a blood gas ana-
lyzer (i15, Edan, Shenzhen, China).
After the completion of all surgical preparation and baseline
measurements, CA was electrically induced and then untreated
for a continuous 10- min duration. After that, CPR was begun
with a 30:2 compression- to- ventilation ratio. The quality of chest
compression was stably maintained with the help of a real- time
CPR feedback device (PlamCPR, Shangling, Suzhou, China). At
2 min after CPR, epinephrine was intravenously administered
at a dose of 20 μg/kg, followed by a repeated dose every 3 min.
After 6 min of CPR, a 150- J biphasic shock was delivered via the
defibrillator/monitor. This procedure was rigorously carried out
until return of spontaneous circulation (ROSC) was achieved or
for a maximum of 16 min. After resuscitation, the animals were
closely monitored for 4 h and then returned to their cages for
a 20- h extended observation phase. At 24 h after resuscitation,
two independent and blinded investigators evaluated the neu-
rological deficit score (NDS) and cerebral performance category
(CPC) [19], which employed the weighted scoring system to as-
sess the degree of neurological dysfunction. The score of NDS
ranged from 0 (denoting the absence of neurological deficit)
to 400 (signifying death or brain death), and the score of CPC
ranged from 1 to 5 (indicating normal cerebral function, mod-
erate cerebral dysfunction with reduced consciousness, severe
cerebral disability with significant consciousness impairment,
coma or a persistent vegetative state, and death, respectively).
2.4 | The Establishment of the Mouse Model of CA
and Resuscitation
Initially, the mouse was anesthetized with an intraabdominal
injection of pentobarbital sodium (45 mg/kg). The electrocardio-
gram was continuously measured and recorded by a BL- 420N
data acquisition and analysis system (Techman, Chengdu,
China). Subsequently, endotracheal intubation was performed
with a 20- G catheter, the ventilation was implemented using a
ventilator (ALCOTT, Shanghai, China) with an oxygen concen-
tration of 0.21, and then a PE- 10 catheter was inserted into the
right jugular vein for drug delivery. During animal preparation,
body temperature was maintained at 37.0°C ± 0.5°C with the
help of a temperature- regulated heating pad (RWD, Shenzhen,
China). After that, the animal was stabilized for 10 min, and
then a dose of 50 μL of KCl (0.5 mol/L) was rapidly infused into
the jugular vein to induce CA. After 8 min of CA, mechanical
ventilation was resumed with an oxygen concentration of 1.0,
a dose of 0.1 mL of epinephrine (16 μg/mL) was administered,
and meanwhile finger chest compressions were performed at a
rate of approximately 300 compressions per minute. Additional
doses of epinephrine were given every 1 min until ROSC was
achieved. The animal that failed to achieve ROSC within 5 min
or could not be weaned from the ventilator at 1 h of observation
was excluded from the experiment. After resuscitation, the ani-
mal was obser ved for a total of 24 h. Thereafter, two independent
and blinded investigators conducted the evaluation of neurolog-
ical function using two neurological function scoring (NFS)
systems, in which NFS- 1 was obtained according to the levels
of consciousness, respiration, corneal ref lex, coordination, and
movement, and ranged from 0 (coma) to 10 (fully alert); NFS- 2
was obtained according to the levels of consciousness, respira-
tion, corneal ref lex, coordination, movement, and righting re-
flex, and ranged from 0 (coma) to 12 (fully alert).
2.5 | LncRNA- Seq
LncRNA- seq was performed using the fresh hippocampal tissue
samples harvested from the Sham and CA/CPR groups. Briefly,
libraries were constructed using 3 μg of RNA from each sample.
We followed the protocols of the NEBNext Ultra RNA Library
Prep kit for Illumina (New England Biolabs, Ipswich, America).
We used the AMPure XP system (Beckman Coulter, Brea,
America) to purify the fragments, and those fragments with
lengths of 150–500 bp were selected. The cDNA was then di-
gested with USER enzyme before conducting polymerase chain
reaction (PCR). Purification of the PCR products and the cluster-
ing of the index- coded samples were performed on the Agilent
Bioanalyzer 2100 system (Agilent Technologies, Santa Clara,
America) and checked using RNase- free agarose gel electropho-
resis. After total R NA was extracted, rR NAs were removed to re-
tain mRNAs and ncRNAs. The enriched mRNAs and ncRNAs
were fragmented into short fragments by using fragmentation
buffer and reverse transcribed into cDNA with random primers,
second cDNA was synthesized by DNA polymerase I, RNase H,
dNTP (dUTP instead of dTTP), and buffer. Next, the cDNA frag-
ments were purif ied with a QiaQuick PC R extraction kit (Qiagen,
Venlo, Netherlands), end- repaired, poly(A) added, and ligated
to Illumina sequencing adapters. Then Uracil- N- Glycosylase
was used to digest the second- strand cDNA. The digested prod-
ucts were selected by agarose gel electrophoresis, PCR ampli-
fied, and sequenced using Illumina novaseq6000. Qualified
libraries were pooled and sequenced on an Illumina platform
using the PE150 strategy to analyze differentially expressed ln-
cRNAs. Sequenced reads were trimmed for adaptor sequence,
and masked for low- complexity or low- quality sequence, then
mapped to Ensembl_release 100 whole genome using HISAT2
with parameters- rna- strandness RF. Quantification of gene ex-
pression level: feature Counts v1.5.0- p3 was used to count the

4 of 19 CNS Neuroscience & Therapeutics, 2025
reads numbers mapped to each gene. The TPM of each gene was
calculated based on the length of the gene and the reads count
mapped to this gene. FPKM and transcripts per million were
calculated. Differentially expressed genes were identified using
DESeq2 with raw read counts. The potential binding sites be-
tween ENS SSCG000 00035331 and miR- let7a, and between miR-
let7a and GPX4 were analyzed using miRanda (http:// www.
micro rna. org/ micro rna/ home. do), PITA (http:// genie. weizm
ann. ac. il/ pubs/ mir07/ mir07_ dyn_ data. html), and RNAhybrid
(http:// bibis erv. techf ak. uni- biele feld. de/ rnahy brid/ ).
2.6 | Primary Porcine Hippocampal Neuron
Culture
Prepared materials included poly- L- lysine, complete medium for
hippocampal neurons (Zhongqiao Xinzhou, Shanghai, China),
ACCUTASE enzyme (Merck, Darmstadt, German), multiple
pairs of ophthalmic surgical scissors, several pairs of tweezers,
and other necessary cell culture consumables and reagents. The
day before, 6- well plates/T25 f lasks were coated with 0.1 mg/
mL sterile- filtered poly- L- lysine (Merck, Darmstadt, German),
aspirated following overnight incubation for reuse, and rinsed
once with sterile water. Newborn piglet within 24 h of birth
was disinfected twice with 75% alcohol, then the brain tissue
was harvested and rinsed once with phosphate buffer saline
(PBS), in which the skull was opened along the midline using
upward- pointing scissors to minimize brain damage and the in-
tact brain was promptly immersed in ice- cold Dulbecco's modi-
fied eagle medium (TMO, Massachusetts, America). Employing
fine straight and curved tweezers, the hippocampus was care-
fully dissected out, ensuring the removal of any adherent vas-
cular membranes, and promptly transferred to a new ice- cold
Dulbecco's modified eagle medium 6- cm dish. Iris scissors were
used to section the hippocampus into tissue blocks of approxi-
mately 1 mm 3. Sedimentation or centrifugation at 500 rpm for
3 min was allowed, the supernatant was aspirated, 700 μL of
Accutase enzyme was added, and digestion occurred at 37°C
for 15 min with shaking every 5 min. Following digestion,
2 mL of culture medium was added, pipetting was performed
to completely disperse the tissue until no visible tissue blocks
remained, and the supernatant was aspirated into a 15- mL cen-
trifuge tube. Centrifugation at 1000 rpm for 5 min ensued, the
supernatant was aspirated, and the cells were resuspended in a
complete medium. The prepared cells were transferred to a 37°C
CO2 incubator for cultivation, and thereafter, half of the medium
was replaced every 3 d.
2.7 | Enzyme- Linked Immunosorbent Assay
Fresh serum samples were collected and applied to enzyme-
labeled plates precoated with neuron- specific enolase (NSE)
and S100β antibodies (Meixuan Biotechnology Inc., Shanghai,
China), ensuring specific binding of NSE and S100β to their
respective immobilized antibodies within the enzyme- linked
immunosorbent system. The optical density values at 450 nm
were recorded for each well using an ELISA reader (Multiskan
SkyHigh, Massachusetts, America), and the concentrations of
NSE and S100β in the samples were determined by interpolating
these values on a standard curve.
2.8 | Hematoxylin Eosin Staining
Hippocampal and cortical tissues were promptly immersed in
formaldehyde (Beyotime, Shanghai, China) for fixation upon
acquisition to inhibit autolysis and putrefaction, and thus pre-
served the structural integrity of cells and tissues. After that,
dehydration was performed using an ethanol (Sinopharm,
Sichuan, China) gradient, succeeded by xylene (Sinopharm,
Sichuan, China) transparency to enhance paraffin infiltration.
Next, the transparent tissue was embedded in paraffin blocks,
sectioned to a thickness of 5 μm (Leica Biosystems, Wetzlar,
German), dried, dewaxed, and rehydrated. Hematoxylin stain-
ing (Beyotime, Shanghai, China) which stained cell nuclei deep
blue, was applied, followed by eosin staining, which imparted a
pink or red hue to the cytoplasm. The sections were subjected
to alcohol hydration, dehydration, and a second xylene trans-
parency step, then mounted onto glass slides, sealed with resin,
and allowed to cure. At this stage, the stained histological sec-
tions were ready for microscopic (Leica Biosystems, Wetzlar,
German) examination and documentation of hippocampal tis-
sue morphology.
2.9 | TdT- Mediated dUTP Nick- End Labeling Assay
After the sections of hippocampal and cortical tissues were
obtained as mentioned above, they were sequentially washed
with xylene, absolute ethanol, 95% and 75% ethanol, and PBS to
eliminate embedding media. Proteinase K (Beyotime, Shanghai,
China) digestion was used to digest tissue proteins, followed by
rinsing with distilled water and incubation with PBS containing
2% hydrogen peroxide. After a second PBS wash, excess liquid
was removed with filter paper. The TdT enzyme buffer and TdT
reaction mixture (Boster Biological Technology co. ltd, Wuhan,
China) were then added to incubate at 37°C for 1 h. The sections
were next transferred to pre- warmed washing and termination
reaction buffer and incubated at 37°C for 30 min with gentle ag-
itation every 10 min. A final PBS wash was conducted before the
application of the anti- digoxigenin antibody, and then incubated
at room temperature for 30 min. The sections were then sub-
jected to PBS washing, followed by DAB chromogen incubation
for 3–6 min to allow color development. Distilled water washing
was followed by counterstaining with methyl green for 10 min.
The sections were subsequently dehydrated through ascend-
ing grades of distilled water, n- butanol, and xylene, and finally
cover- slipped, dried, and microscopically evaluated (Biological
microscope CX31, Olympus, Japan) for result documentation.
2.10 | Immunofluorescence Staining
Fresh hippocampal tissues were rapidly frozen with liquid ni-
trogen and cryosectioned at a thickness of 10 μm. In accordance
with the ROS detection kit (share- bio, shanghai, China), the
DCFH- DA ROS fluorescence probe was diluted 200–1000- fold
with pure water to formulate a staining working solution. At
room temperature, 200 μL of the prepared washing solution was
carefully applied to fully cover the cryosection and left to stand
for 5–10 min. The washing solution was subsequently removed
by careful aspiration. Subsequently, 100 μL of the staining
working solution was applied, and the sections were incubated

5 of 19
in a dark, 37°C incubator for 20–60 min. The staining solution
was then removed, and the sections were washed two or three
times with PBS. Lastly, the sections were covered with a cover-
slip or glycerol mounting medium and subjected to fluorescent
microscopy (Biological microscope CX31, Olympus, Japan) for
visualization.
2.11 | qRT- PCR
Total RNA from primary porcine hippocampal neurons, por-
cine, and mouse hippocampus tissues was extracted using
TRIzol reagent (Invitrogen, Carlsbad, America). RNA quantifi-
cation was then performed using a Nanodrop instrument (TMO,
Massachusetts, America). Subsequently, cDNA synthesis was
carried out using an RT kit (Yeasen, Shanghai, China). PCR am-
plification was conducted using qPCR Mix (Yeasen, Shanghai,
China). Relative expression levels were calculated using the 2−
ΔΔCt method. The primers utilized in this study were provided in
the TableS1.
2.12 | Fe2+ Detection
Following the instructions of the BC5415 Fe2+ detection kit
(Solarbio, Beijing, China), fresh hippocampal tissues or primary
porcine hippocampal neurons were procured. The samples were
homogenized under ice- bath conditions and then centrifuged to
collect the supernatant. Prepare standard solutions and dilute
them into a series of concentrations. Aliquot each concentration
of the diluted standards and sequentially introduce Reagent II
and chloroform (Sinopharm, Sichuan, China). Measure the ab-
sorbance at 593 nm for each standard, and plot a standard curve
correlating absorbance values with their respective concentra-
tions. Repeat the above procedures on the supernatant obtained
from the test porcine hippocampal tissue or primary porcine
hippocampal neurons. Calculate the corrected absorbance ΔA
as the difference between A_measured (absorbance of the test
sample) and A_blank (absorbance of control without the sam-
ple). Utilize the established standard curve to determine the
sample concentration (x, μmol/L) by substituting ΔA (y, ΔA)
into the relevant formula.
2.13 | GSH Assay
Employ a microplate- based GSH assay kit (Nanjing Jiancheng
Bioengineering Institute, Nanjing, China), and homogenize
those freshly harvested hippocampal tissues or primary por-
cine hippocampal neurons in physiological saline at a defined
ratio. Centrifugation ensued, and the supernatant was har-
vested. A series of standard solutions were prepared by dilut-
ing the stock solution to multiple concentrations. Absorbance
readings at a wavelength of 405 nm were taken for each con-
centration, and a standard curve was constructed accordingly.
The identical procedure was repeated on the supernatant ob-
tained from the samples of hippocampal tissues or primary
porcine hippocampal neurons. The absorbance change (ΔA)
was computed as ΔA = Ameas ured—Abla nk. Utilizing the estab-
lished standard curve, the sample concentration was derived
by incorporating the obtained ΔA value into the relevant
formula.
2.14 | Fluorescence InSitu Hybridization (FISH)
The enhanced sensitive ISH detection kit V (FITC) for FISH
(Boster, Wuhan, China) was utilized for FISH probe labeling
of ENSSSCG00000035331 according to the manufacturer's
guidelines and recommendations. Brief ly, hippocampal paraf-
fin sections were conventionally deparaffinized until reaching
water and succeeded by room temperature digestion to expose
mRNA molecules. Subsequently, the sections were incubated
in a hybridization prebuffer (37°C, 30 min), and followed by
overnight exposure in a room temperature hybridization buffer
containing a 20 μM lncRNA FISH probe mixture. The speci-
mens were then washed in 0.1% Tween- 20 solutions of 2 × SSC,
0.5 × SSC, and 0.2 × SSC, each for 15 min. The sections were sub-
sequently blocked at 37°C for 30 min, followed by the addition
of biotinylated mouse anti- digoxigenin, SABC- FITC, and DAPI
for nuclear staining. Finally, following mounting with an anti-
fade mounting medium, the slides were visualized under a flu-
orescence microscope (Biological microscope CX31, Olympus,
Japan). Probe sequence: 5′GGTTTCACTTGGATTGGTTGCTG
TAAGACGCACTGA AGCCA A'3- FITC.
2.15 | Construction of ENSSSCG00000035331
Overexpression Vector and Establishment
of H/R Model of Primary Porcine Hippocampal
Neurons
The overexpression construct of ENSSSCG00000035331 was
separately integrated into adeno- associated viruses, along with
the construction of a negative control adeno- associated viruses,
all of which were carried out by Quanyang Biotechnology
(Shanghai, China). To begin, primar y porcine hippocampal
neurons were seeded at a density of 5 × 105 cells per well into
6- well plates. Following the transfection for 48 h, primary neu-
rons were treated with glucose- free Dulbecco's modified eagle
medium and placed within an incubator simulating hypoxic
conditions, filled with a gas mixture composed of 1% oxygen,
5% carbon dioxide, and 94% nitrogen, maintained at 37°C for 3 h
to induce hypoxic injury. After that, the culture medium was
replaced with a fresh neuronal basal medium, and then the neu-
rons were subjected to reperfusion culture for an additional 24 h
under normoxic conditions. In contrast, control group neurons
were always cultured under normal conditions in a standard
incubator.
2.16 | miR- let7a Regulation Experiment in
Primary Porcine Hippocampal Neuron
miR- let7a mimics and miR- let7a inhibitors were constructed
by Quanyang Biotechnology (Shanghai, China), and then
stored and diluted according to the manufacturer's instruc-
tions. Briefly, porcine hippocampal neurons were seeded
onto 6- well plates at a density of 5 × 105 cells per well, and
both miRNA and Lipofectamine 3000 (TMO, Massachusetts,

6 of 19 CNS Neuroscience & Therapeutics, 2025
America) were individually diluted in RNase- free water or
Opti- MEM medium (TMO, Massachusetts, America). They
were then mixed at the recommended ratio provided by the
manufacturer to form miRNA transfection complexes. These
complexes were added to the cell culture plates, gently rocking
the plates to ensure even distribution of the complexes over
the cells. After a 48- h transfection period, the cells were sub-
jected to further experiments.
2.17 | Cell Viability and Lactate Dehydrogenase
(LDH)
Cell viability was measured with the CCK- 8 assay kit (Biyuntian
Biotechnology, Shanghai, China) in the 96- well plate. After
10 μL of CCK- 8 reagent was added to each well to incubate for
3 h at 37°C, and then the absorbance was measured at 450 nm
with the microplate reader (Multiskan MK3, Thermo Fisher
Scientific, Waltham, MA). LDH release analysis was performed
with the LDH assay kit (Abcam, Cambridge, MA). After the
cell supernatant was collected and mixed with the LDH assay
buffer, and then they were incubated at 37°C for 1 h. The mix-
ture was measured at 450 nm with the help of the microplate
reader above.
2.18 | Luciferase Reporter Assay
To confirm the binding between ENSSSCG00000035331 and
miR- let7a, the wild- type or mutated ENSSSCG00000035331
sequences were cloned into the psiCHECK2.0 vector
(TongYong Bio, Anhui, China), and HEK- 293T cells were
then transiently co- transfected by the psiCHECK2.0 plasmids
with either miR- let7a mimics or negative controls. After that,
the activities of Firefly and Renilla luciferase were assessed
using the Dual- Luciferase Reporter Assay System (Promega,
Madison, America) according to the manufacturer's instruc-
tions, then measured with a f luorescence spectrophotometer
(Tecan, Männedorf, Switzerland), and finally the relative
ENSSSCG00000035331 Firef ly luciferase activity was nor-
malized to Renilla luciferase activity. To confirm the binding
between miR- let7a and GPX4, the wild- type or mutated GPX4-
3'- UTR sequences were cloned into the psiCHECK2.0 vector
(TongYong Bio, Anhui, China), HEK- 293T cells were similarly
co- transfected, then the activities of Firefly and Renilla lucif-
erase were similarly assessed and measured, and finally the
relative GPX4 Firefly luciferase activity was normalized to
Renilla luciferase activity.
2.19 | RNA Pull- Down Assay
To confirm the interaction between ENSSSCG00000035331 and
miR- let7a, biotin- labeled ENSSSCG000 00035331 or normal con-
trol (NC) (TongYong Bio, Anhui, China) was constructed accord-
ing to the manufacturer's instructions. Firstly, the H/R model of
hippocampal neurons was established. Subsequently, the cells
were incubated with lysis buffer for 10 min, and then cell lysates
were incubated with biotin- labeled ENSSSCG00000035331 or
NC at 4°C overnight. After that, they were combined with M-
280 streptavidin beads to incubate at 4°C for 3 h, followed by
washing w ith low- salt buffer for 3 times. Finally, the enrichment
of miR- let7a was detected by PCR analysis. To confirm the in-
teraction between miR- let7a and GPX4, biotin- labeled GPX4 or
NC (TongYong Bio, Anhui, China) were constructed according
to the manufacturer's instructions. Similarly, the H/R model of
hippocampal neurons was established, and then the cells were
lysed and incubated with biotin- labeled GPX4 or NC, thereafter
combined with streptavidin beads and washed, and finally de-
tected for miR- let7a enrichment using PCR analysis. The biotin-
labeled probe sequences used in this study are listed in TableS2.
2.20 | Western Blot
Fresh samples of hippocampal tissues or primary porcine hip-
pocampal neurons were collected and lysed using the RIPA
lysis buffer (Beyotime, Shanghai, China). Protein samples
(20 μg/well) were loaded onto pre- cast 15% SDS- PAGE gels
(GenScript, Nanjing, China). Subsequently, proteins were trans-
ferred onto polyvinylidene difluoride membranes (Millipore,
Massachusetts, America). Membranes were then blocked with
5% BSA (Beyotime, Shanghai, China), incubated with primary
antibodies, and followed by secondary antibodies. Finally, pro-
tein bands were vi sualized using an EC L detection kit (Mill ipore,
Massachusetts, America) and analyzed using ImageJ software
(NIH, America). The antibodies used included: anti- GPX4 an-
tibody (diluted in 1:1000; Abcam, America), anti- GAPDH anti-
body (diluted in 1:2000; Abcam, America), and goat anti- rabbit
IgG (H + L) HRP- conjugated secondary antibody (diluted in
1:10000; ZSGB, China).
2.21 | Flow Cytometry
Porcine hippocampal neurons were digested, collected, washed
three times with PBS, and centrifuged (1000 g, 5 min) to form
pellets. Resuspend the pellets using Annexin V (share- bio,
shanghai, China), ROS (share- bio, shanghai, China), or BODIPY
581/591 C11 fluorescent probes (MCE, New Jersey, America),
followed by incubation at room temperature in the dark for
10–20 min. Subsequently, rewash the samples to remove ex-
cess fluorescent probes, and finally place them on ice in a 4°C
bath. Following propidium iodide signal detection, the cell cycle
was analyzed utilizing the CytoFLEX flow cytometer (Dalewe,
Shenzhen, China).
2.22 | Statistical Analysis
Statistical analysis was performed using a random blind
method. Before comparisons, all datasets underwent Shapiro–
Wilk or Kolmogorov–Smirnov tests to assess whether they
met the assumption of normal distribution. For those data
that conformed to a normal distribution, they were expressed
as mean ± standard deviation, and Student's t- test was em-
ployed for statistical comparisons between two groups, and
one- way ANOVA and Tukey's multiple comparison tests were
utilized to evaluate the differences among multiple groups
(using GraphPad Prism version 8.3.0). When the data were not
normally distributed, they were expressed as a median (25th,
75th percentiles), and then the Kruskal–Wallis test was used

7 of 19
to analyze these nonparametric data. Statistical significance
was set at p < 0.05.
3 | Results
3.1 | Brain Injury Was Observed in a Pig Model
of CA and Resuscitation
To recreate brain injury after CA and resuscitation, three
pigs were used to establish the pig model using the setting
of 10 min of CA and 6 min of CPR. Those physiological indi-
cators (body weight, heart rate, mean arterial pressure, and
end- tidal CO2), arterial blood gas (pH, PCO2, PO2, and lac-
tate), and brain injury biomarkers (NSE, S100β) at baseline
were not different between the Sham and CA/CPR groups
(Figure S1A–H, Figure 1A,B). During the model establish-
ment, coronary perfusion pressure was regularly monitored
and the outcomes of CPR including duration of CPR, dosage
of epinephrine, and number of defibrillations were recorded
in the CA/CPR group, in which similar results were observed
among the three pigs. Finally, all three pigs obtained ROSC
(Figure S1I–M). After resuscitation, the serum levels of NSE
and S100β were significantly increased at all time points, and
the scores of NDS and CPC at 24 h were markedly elevated
in the CA/CPR group when compared with the Sham group
(Figure1A–D). Furthermore, hippocampal and cortical tissue
analysis indicated that pathological injury including tissue
structure disarrangement, cell integrity damage, nucleus pyc-
nosis, and inf lammatory cell infiltration was obvious and the
FIGUR E  | Brain injury occurred after cardiac arrest (CA) and resuscitation in pigs. (A, B) Changes of serum concentrations of neuron- specif ic
enolase (NSE) and S100β protein (S100β) at baseline (BL), and 1 h, 2 h, 4 h, and 24 h post- resuscitation. (C, D) Evaluation of neurological func-
tion using neurological deficit score (NDS) and cerebral performance category (CPC) at 24 h post- resuscitation. (E, F) Representative photographs
of hematoxylin and eosin staining in hippocampal and cortical tissues at 24 h post- resuscitation (Scale bar = 300 μm, ×200 magnif ication). (G–J)
Representative photographs of TdT- mediated dUTP nick- end labeling staining in hippocampal and cortical tissues at 24 h post- resuscitation (Scale
bar = 3 00 μm, ×20 0 magnification) and their apoptotic index (AI). CPR, ca rdiopulmonary resuscitation. Each g roup included three sa mples. *p < 0.05
denotes significant differences compared to the Sham group.

8 of 19 CNS Neuroscience & Therapeutics, 2025
ratio of cell apoptosis was significantly higher in the CA/CPR
group when compared to the Sham group (Figure1E–J). These
results indicated that post- resuscitation brain injury was suc-
cessfully recreated in this pig model of CA and resuscitation.
3.2 | The Phenomenon of Cell Ferroptosis
Occurred in the Impaired Hippocampus After CA
and Resuscitation in Pigs
To confirm that cell ferroptosis was involved in the pathological
process of brain injury after CA and resuscitation, the phenome-
non of cell ferroptosis was ev aluated in the post- resuscitation im-
paired hippocampus in this pig model. First, those productions
related to ferroptosis, including Fe2+, ROS, and GSH, were mea-
sured. We observed that Fe2+ levels and ROS production were
significantly increased while GSH contents were significantly
decreased in the post- resuscitation hippocampus in the CA/CPR
group when compared with the Sham group (Figure 2A–D).
Second, those key genes related to ferroptosis, including the
antioxidant defense gene GPX4, iron storage protein- encoding
gene ferritin heavy chain 1 (FTH1), lipid metabolism- related
gene acyl- CoA synthetase long- chain family member 4
(ACSL4), ROS- producing enzyme NADPH oxidase 1 (NOX1),
and inflammation- related gene cyclooxygenase- 2 (COX2) were
measured. We observed that the relative expression levels of
GPX4 and FTH1 mRNA were significantly decreased while the
relative expression levels of ACSL4, NOX1, and COX2 mR NA
were significantly increased in the post- resuscitation hippocam-
pus in the CA/CPR group when compared to the Sham group
(Figure 2E–I). These results indicated that the phenomenon
of cell ferroptosis occurred in the post- resuscitation impaired
FIGUR E  | Ferroptosis was evident in the impaired hippocampus after cardiac arrest (CA) and resuscitation in pigs. (A) Levels of ferrous iron
(Fe2+) in hippocampal tissues at 24 h post- resuscitation. (B, C) Representative photographs of immunofluorescence staining of reactive oxygen spe-
cies production in hippocampal tissues at 24 h post- resuscitation (scale bar = 300 μm, ×200 magnif ication) and its quantification. (D) Glutathione
(GSH) contents in hippocampal tissues at 24 h post- resuscitation. (E–I) Relative mRNA expression levels of ferroptosis- associated genes including
glutathione peroxidase 4 (GPX4) (E), ferritin heav y chain 1 (FTH1) (F), acyl- CoA synthetase long- chain family member 4 (ACSL4) (G), NADPH ox-
idase 1 (NOX1) (H), and cycloox ygenase- 2 (COX2) (I) in hippocampal tissues at 24 h post- resuscitation. CPR, cardiopulmonary resuscitation. Each
group included three samples. *p < 0.05 denotes significant dif ferences compared to the Sham group.

9 of 19
hippocampus, which might participate in the pathological pro-
cess of brain injury after CA and resuscitation in pigs.
3.3 | ENSSSCG00000035331 Overexpression
Promoted Cell Survival and Inhibited Its Ferroptosis
After H/R Stimulation in Primary Porcine
Hippocampal Neurons
To explore the potential key lncRNA regulating post-
resuscitation hippocampal neuronal damage, we employed
lncRNA- Seq technology to conduct deep sequencing, sys-
tematic analysis, and experimental verification in the post-
resuscitation impaired hippocampus. The results showed
that 85 genes were upregulated and meanwhile 36 genes were
downregulated in the CA/CPR group when compared with
the Sham group (Figure3A,B). Among these, six top differen-
tially expressed lncRNAs including ENSSSCG00000035331,
ENSSSCG00000031079, ENSSSCG00000040228,
ENSSSCG00000032037, ENSSSCG00000034990, and
ENSSSCG00000038924 were verified using qRT- PCR, in which
the expression level of ENSSSCG00000035331 was confirmed
to be significantly decreased in the post- resuscitation impaired
hippocampus in the CA /CPR group when compared to the Sham
group (Figure3C, FigureS2A–E). Furthermore, the same result
of ENSSSCG00000035331 expression was observed using FISH
detection, and its location was confirmed to be primarily in the
cytoplasm (Figure3D,E).
To investigate the role of ENSSSCG00000035331 in hip-
pocampal neuronal damage after H/R stimulation,
ENSSSCG00000035331 overexpression was constructed
in hippocampal neurons using adenoviral transduction
and then confirmed using f luorescence and qRT- PCR
(Figure S3A,B, Figure 3F). Subsequently, the effects of
ENSSSCG00000035331 overexpression on cell viability, LDH
release, apoptosis, and cytosolic ROS production were eval-
uated in hippocampal neurons after H/R stimulation. We
observed that H/R stimulation significantly decreased cell
viability while significantly increased LDH release, apoptosis
ratio, and cytosolic ROS production in hippocampal neurons;
however, all the changes were significantly reversed in the
H/R + oe- ENSSSCG00000035331 group when compared with
the H/R group (Figure S4A–F). These results indicated that
ENSSSCG00000035331 overexpression could promote hippo-
campal neuronal survival after H/R stimulation.
To further investigate the role of ENSSSCG00000035331 in
regulating hippocampal neuronal ferroptosis after H/R stim-
ulation, ENSSSCG00000035331 overexpression was simi-
larly constructed in hippocampal neurons, and then those
ferroptosis- related productions including Fe2+, lipid ROS, and
GSH were measured after H/R stimulation. We observed that
H/R stimulation significantly increased Fe2+ levels and lipid
ROS production while significantly decreased GSH contents in
hippocampal neurons; however, ENSSSCG00000035331 over-
expression significantly decreased Fe2+ levels and lipid ROS
production and meanwhile increased GSH contents in hippo-
campal neurons in the H/R + oe- ENSSSCG00000035331 group
when compared to the H/R group (Figure3G–J). These results
indicated that ENSSSCG00000035331 overexpression could in-
hibit hippocampal neuronal ferroptosis after H/R stimulation.
3.4 | miR- let7a Identified as a Downstream Target
of ENSSSCG00000035331 Regulated Hippocampal
Neuronal Ferroptosis After H/R Stimulation
To identify the potential downstream target of
ENSSSCG00000035331, a series of bioinformatic analyses and
experimental verification were performed. First, the two tools
including miRanda and RNAhybrid were used to success-
fully predict miR- let7a as a potential downstream target of
ENSSSCG00000035331 (Figure4A). Thereafter, the potential
binding between ENSSSCG00000035331 and miR- let7a was
explored using a dual- luciferase reporter assay and RNA pull-
down assay. Consequently, the dual- luciferase reporter revealed
that relative luciferase activity was significantly decreased by
miR- let7a mimics in ENSSSCG00000035331 wild- type HEK-
293T cells (Figure4B). Furthermore, RNA pull- down revealed
that miR- let7a could bind with ENSSSCG00000035331 in hip-
pocampal neurons under normal culture condition and after
H/R stimulation (Figure 4C–E). These results indicated that
miR- let7a was identified as a feasible downstream target of
ENSSSCG00000035331 in hippocampal neurons.
To further investigate the role of miR- let7a in regulating hippo-
campal neuronal ferroptosis after H/R stimulation, miR- let7a
mimics and miR- let7a inhibitors were constructed to use in hip-
pocampal neurons, and then the relative expression of miR- let7a
was confirmed using qRT- PCR (Figure4F). Subsequently, the
effects of miR- let7a on cell viability and those ferroptosis- related
productions mentioned above were evaluated in hippocampal
neurons after H/R stimulation. Similarly, we observed that H/R
stimulation significantly decreased cell viability and GSH con-
tents while significantly increased Fe2+ levels and lipid ROS pro-
duction in hippocampal neurons. In addition, miR- let7a mimics
further significantly decreased cell viability and promoted fer-
roptosis in hippocampal neurons in the H/R + miR- let7a m imics
group when compared with the H/R group. However, miR- let7a
inhibitors significantly recovered cell viability and inhibited
ferroptosis in hippocampal neurons in the H/R + mi R- let7a in-
hibitor group when compared to the H/R group (Figure4G–K).
These results indicated that miR- let7a could play a key role
in mediating hippocampal neuronal ferroptosis after H/R
stimulation.
3.5 | ENSSSCG00000035331 Inhibited
Post- Resuscitation Hippocampal Neuronal
Ferroptosis via Regulating the miR- let7a/GPX4 Axis
To explore the potential mechanism by which miR- let7a regu-
lated hippocampal neuronal ferroptosis after H/R stimulation,
miRanda and RNAhybrid were also used to predict the potential
downstream target of miR- let7a, and then their potential bind-
ing was similarly explored using dual- luciferase reporter assay
and RNA pull- down assay. The result showed that GPX4 was
one candidate for downstream targets of miR- let7a, and had the
targeted binding site with miR- let7a (Figure5A,B). In addition,

10 of 19 CNS Neuroscience & Therapeutics, 2025
FIGUR E  | LncRNA ENSSSCG00000035331 overexpression alleviated hippocampal neuronal ferroptosis after hypoxia/reoxygenation (H/R)
stimulation. (A) Volcano plot representing differentially expressed genes in hippocampal tissues at 24 h post- resuscitation bet ween the cardiac arrest
and cardiopulmonary resuscitation (CA/CPR) and Sham groups. Red color indicates that those genes were signif icantly upregulated, green color
indicates that those genes were significantly downregulated, and gray color indicates that those genes' ex pression weren't changed. (B) Heatmap plot
analysis of the differentially expressed genes identified in (A), which indicates that lncRNAs ENSSSCG00000035331 and ENSSSCG00000031079
were signi ficantly downre gulated, and lncR NA ENSSSCG 0000 0032307 wa s significa ntly upregulated in the CA /CPR group compared with the Sha m
group. (C) The comparative analysis of relative expression levels of ENSSCG00000035331 in hippocampal tissues at 24 h post- resuscitation between
the CA/CPR and Sham groups. (D) Fluorescence insitu hybridization showing the localization of ENSSCG00000035331 in hippocampal tissues at
24 h post- resuscitation (Scale bar = 300 μm, ×200 magnification). (E) Quantitative analysis of average fluorescent intensity of ENSSCG00000035331
in (D). (F) Confi rmation of ENSSCG 00000 035331 overexpression in prima ry porcine hippoca mpal neurons after the tra nsfection of adeno- as sociated
viruses. (G) Levels of ferrous iron (Fe2+) in hippocampal neurons at 24 h after H/R stimulation. (H) Flow cytometric analysis and quantification of
lipid reactive oxygen species (ROS) production in hippocampal neurons at 24 h after H/R stimulation. (I) Glutathione (GSH) contents in hippocam-
pal neurons at 24 h after H/R stimulation. NC, normal control. Each group included three samples in animal experiments and three replicates in
cell experiments, respectively. *p < 0.05 denotes significant differences compared to the Sham group or the NC group; #p < 0.05 denotes s ignific ant
differences compared to the H/R group.

11 of 19
the dual- luciferase reporter revealed that relative luciferase ac-
tivity was significantly decreased by miR- let7a mimics in GPX4
wild- type HEK- 293T cells (Figure5C). RNA pull- down revealed
that miR- let7a could bind with GPX4 mRNA in hippocampal
neurons under normal culture condition and after H/R stimula-
tion (Figure5D–F). These results indicated that miR- let7a could
bind with GPX4 mRNA, and then inhibit its translation in hip-
pocampal neurons after H/R stimulation [20].
To investigate the role of miR- let7a in the ENSSS CG00 000 035331-
induced hippocampal neuronal ferroptosis inhibition after
H/R stimulation, ENSSSCG00000035331 overexpression was
constructed, and meanwhile, miR- let7a mimics were used
in hippocampal neurons. We observed that H/R stimulation
significantly downregulated GPX4 mRNA and protein expres-
sion, and decreased GSH contents and cell viability while sig-
nificantly increased Fe2+ levels and lipid ROS production in
hippocampal neurons. In addition, ENSSSCG00000035331
overexpression significantly increased GPX4 mRNA and
protein expression, recovered cell viability, and inhib-
ited ferroptosis in hippocampal neurons in the H/R + oe -
ENSSSCG00000035331 group when compared with the H/R
group. However, miR- let7a mimics significantly abrogated
those protective effects produced by ENSSSCG00000035331
overexpression mentioned above in hippocampal neurons
in the H/R + oe- ENSSSCG0 000 0035331 + miR- let7a mimics
group when compared to the H/R + oe- ENSSSCG00000035331
group (Figure 5G–M). These results indicated that
FIGUR E  | MiR- let7a wa s identified a s a downstream target of ENSS SCG00000035331 and regulated h ippocampal neuronal ferroptosis after hy-
poxia/reoxygenation (H/R) stimulation. (A) Venn diagram representing miR- let7a as a potential downstream target of ENSSSCG0000 0035331 using
the miRanda and RNAhybrid software. (B) Luciferase reporter assay and analysis of the binding between ENSSSCG0000 0035331 and miR- let7a. (C)
RNA pulldown assay of the binding bet ween ENSSSCG00000035331 and miR- let7a in hippocampal neurons under normal culture conditions and
after H/R stimulation. (D, E) Quantitative analysis of miR- let7a enrichment from two independent RNA pulldown experiments in (C). (F) Relative
expression levels of miR- let7a in primary porcine hippocampal neurons treated with miR- let7a mimics or miR- let7a inhibitor. (G, H) Cell viability
and ferrous iron (Fe2+) levels in hippoc ampal neurons at 24 h after H/R st imulation. (I, J) Flow cy tometric analysis and qua ntification of lipid reactive
oxygen species (ROS) production in hippocampal neurons at 24 h after H/R stimulation. (K) Glutathione (GSH) contents in hippocampal neurons at
24 h after H/R stimulation. NC, normal control. Each group included three replicates. *p < 0.05 denotes significant differences compared to the NC
group; #p < 0.05 denotes significant differences compared to the H/R group.

12 of 19 CNS Neuroscience & Therapeutics, 2025
ENSSSCG00000035331 overexpression could inhibit H/R-
induced hippocampal neuronal ferroptosis by recovering GPX4
mRNA translation via interacting with miR- let7a.
To further confirm the role of ENSSSCG00000035331
in regulating the miR- let7a/GPX4 axis- mediated
post- resuscitation hippocampal neuronal ferroptosis in vivo,
ENSSSCG00000035331 was overexpressed in mouse hippo-
campus using adeno- associated viruses and then its successful
overexpression was confirmed by the IVIS spectrum imaging
system (FigureS5). Subsequently, the mouse model of CA and
resuscitation was established. Baseline physiological indicators
FIGUR E  | ENSSSCG0 0000035331 overexpression inhibited hypoxia/reoxygenation (H/R)- induced hippocampal neuronal ferroptosis via reg-
ulating the miR- let7a/glutathione peroxidase 4 (GPX4) axis. (A) Bioinformatics network analysis illustrating GPX4 as a potential downstream target
of miR- let7a using the miRanda and RNAhybrid software. (B) Diagram showing the binding site of miR- let7a in the 3′UTR region of the GPX4 gene.
(C) Luciferase reporter assay and analysis of the binding bet ween miR- let7a and GPX4. (D) RNA pulldown assay of the binding between miR- let7a
and GPX4 in hippocampal neurons under normal culture conditions and after H/R stimulation. (E , F) Quantitative analysis of miR- let7a enrichment
from two independent RNA pulldown experiments shown in (D). (G) Relative expression levels of GPX4 mR NA in hippocampal neurons at 24 h
after H/R stimulation. (H) Relative expression levels of GPX4 protein in hippocampal neurons at 24 h after H/R stimulation. (I, J) Cell viability and
ferrous iron (Fe2+) levels in hippocampal neurons at 2 4 h after H/R stimulation. (K , L) Flow cytometric analysis and quantification of lipid reactive
oxygen species (ROS) production in hippocampal neurons at 24 h after H/R stimulation. (M) Glutathione (GSH) contents in hippocampal neurons
at 24 h after H/R stimulation. NC, normal control. Each group included three replicates. *p < 0.05 denotes significant differences compared to the
NC group; #p < 0.05 denotes signif icant differences compared to the H/R group; †p < 0.05 denotes significant differences compared to the H/R + oe -
ENSSSCG00000035331 group.

13 of 19
(body weight, heart rate, and body temperature) were not dif-
ferent among the four groups (Figure S6A–C). During CA and
resuscitation, those indicators of CPR outcomes including the
rates of resuscitation success, duration of CPR, and dosage of
epinephrine were uniform in the CA/CPR and CA/CPR + oe-
ENSSSCG00000035331 groups (Figure S6D,E). At 24 h after
resuscitation, brain injury biomarkers (NSE, S100β) were
significantly increased while neurological functional scores
(NFS- 1, NFS- 2) were significantly decreased in the CA/CPR and
CA/CPR + oe- ENSSSCG00000035331 groups when compared
with the Sham group. Tissue analysis indicated that patholog-
ical injury (tissue disarrangement, cell damage, nucleus pycno-
sis, and inf lammatory infiltration) was significantly severe and
cell apoptosis was significantly increased in the hippocampus
and cortex in these two groups when compared with the Sham
group. However, ENSSSCG00000035331 overexpression sig-
nificantly alleviated brain injury and neurological dysfunction,
and meanwhile significantly reduced hippocampal and cortical
pathological injury and apoptosis increased in the CA/CPR + oe-
ENSSSCG00000035331 group when compared to the CA/CPR
group (Figure 6A–H, FigureS7A,B). In addition, GPX4 protein
expression and GSH contents were significantly decreased while
miR- let7a expression, Fe2+ levels, and ROS production were sig-
nifica ntly increased in the hippoca mpus in the CA/CPR and CA /
CPR + oe- ENSSSCG00000035331 groups when compared with
the Sham group. Nevertheless, ENSSSCG00000035331 over-
expression significantly downregulated miR- let7a expression,
upregulated GPX4 protein expression, and alleviated hippo-
campal ferroptosis in the CA/CPR + oe- ENSSSCG00000035331
group when compared to the CA/CPR group (Figure 7I–O).
Together with the data from the cell study, we speculated
that ENSSSCG00000035331 overexpression alleviated post-
resuscitation brain injury and hippocampal neuronal ferroptosis
via regulating the miR- let7a/GPX4 axis.
3.6 | Sulforaphane Treatment Alleviated
Post- Resuscitation Brain Injury and Hippocampal
Neuronal Ferroptosis Possibly by Regulating
the ENSSSCG00000035331/miR- let7a/GPX4 Axis
Currently, it's difficult to construct porcine hippocampal
ENSSSCG00000035331 overexpression and then explore its role
in regulating hippocampal ferroptosis via the miR- let7a/GPX4
axis in a pig model of CA and resuscitation. Considering that
the antioxidant, SFN treatment has been confirmed to alleviate
cardiac and cerebral IRI by inhibiting GPX4- mediated ferro-
ptosis [21–24], the SFN was chosen to investigate its potential
regulatory effects on post- resuscitation hippocampal ferroptosis
mediated by the ENSSSCG00000035331/miR- let7a/GPX4 axis
in a pig model.
First, baseline physiological indicators, arterial blood gas, and
brain injury biomarkers mentioned above were measured, and
no differences i n all of them were observed among the Sha m, CA/
CPR, and CA/CPR + SFN groups (FigureS8A–H, Figure7A , B).
Subsequently, the pig model of CA and resuscitation was simi-
larly established. Consequently, the values of coronary perfusion
pressure during CPR and the outcomes of CPR including the du-
ration of CPR, dosage of epinephrine, number of defibrillations,
and rate of ROSC were equally obtained, in which no differences
were observed between the CA/CPR and CA/CPR + SFN groups
(Figure S8I–M). These results indicated that the same baseline
and CA/CPR characteristics were achieved in the CA/CPR and
CA/CPR + SFN groups.
After resuscitation, the serum levels of NSE and S100β were sig-
nificantly increased in the CA/CPR and CA/CPR + SFN groups
when compared with the Sham group; however, the increases in
NSE and S100β were slower in the CA/CPR + SFN group than
in the CA/CPR group, in which the serum levels of NSE starting
4 h after resuscitation and the serum levels of S100β starting 2 h
after resuscitation were significantly different between the two
groups (Figure 7A,B). At 24 h after resuscitation, the scores of
NDS and CPC were significantly increased in the CA/CPR and
CA/CPR + SFN groups when compared to the Sham group; how-
ever, both of them were signif icantly lower in the CA/CPR + SFN
group than in the CA/CPR group (Figure 7C,D). Furthermore,
hippocampal and cortical tissue analysis indicated that the ratio
of cell apoptosis was sig nificantly higher in the CA /CPR and CA/
CPR + SFN groups than in the Sham group; however, SFN treat-
ment significantly decreased both hippocampal and cortical
apoptosis when compared to the CA/CPR group (Figure7E–H).
These results indicated that SFN treatment could provide effec-
tive post- resuscitation brain protection in this pig model of CA
and resuscitation.
To investigate whether SFN treatment could regulate the
ENSS SCG00 000 035331/miR- let7a/GPX4 axis a nd further inhibit
post- resuscitation hippocampal ferroptosis in this pig model, the
relative expression levels of ENSSSCG00000035331, miR- let7a,
and GPX4 in hippocampus were measured at 24 h after resus-
citation. We observed that ENSSSCG00000035331 expression
and GPX4 mRNA and protein expression were significantly de-
creased while miR- let7a expression was significantly increased
in the hippocampus in the CA/CPR and CA/CPR + SFN groups
when compared with the Sham group; however, SFN treatment
significantly reversed ENSSSCG00000035331, GPX4, and miR-
let7a expression in hippocampus when compared to the CA/CPR
group (Figure 7I–M). Thereafter, those ferroptosis- related pro-
duction in the hippocampus was measured at 24 h after resus-
citation in pigs. Consequently, Fe2+ levels and ROS production
were significantly increased while GSH contents were signifi-
cantly decreased in the hippocampus in the CA/CPR and CA/
CPR + SFN groups when compared with the Sham group; how-
ever, SFN treatment significantly alleviated post- resuscitation
hippocampal ferroptosis when compared to the CA/CPR group
(Figure 7N–Q). These results indicated that SFN treatment
could inhibit post- resuscitation hippocampal ferroptosis possi-
bly through regulating the ENSSSCG00000035331/miR- let7a/
GPX4 axis in pigs.
To further confirm the role of SFN treatment in regulating
the ENSSSCG00000035331/miR- let7a/GPX4 axis- mediated
hippocampal neuronal ferroptosis, the in vitro study of H/R
stimulation was performed in primary porcine hippocam-
pal neurons. Initially, the range of safe concentration of SFN
treatment (≤ 20 μM) was confirmed using a cell viability assay
(Figure8A). Subsequently, the concentration of 20 μM of SFN
treatment was chosen to use for the remaining experiments.
We observed that H/R stimulation significantly downregu-
lated GPX4 protein expression, and decreased GSH contents

14 of 19 CNS Neuroscience & Therapeutics, 2025
FIGUR E  | ENSSSCG00000035331 overexpression alleviated post- resuscitation brain injury and hippocampal neuronal ferroptosis possibly by
regulating the miR- let7a/glutathione peroxidase 4 (GPX4) axis. (A, B) Changes of serum concentrations of neuron- specif ic enolase (NSE) and S100β
protein (S100β) at 24 h post- resuscitation. (C, D) Evaluation of neurological function using two methods of neurological functional scores (NFS) at
24 h post- resuscitation. (E- H) Representative photographs of TdT- mediated dUTP nick- end labeling staining in hippocampal and cortical tissues at
24 h post- resuscitation (scale bar = 300 μm, ×200 magnif ication) and its quantif ication(n = 3). (I) Relative miR- let7a expression levels in hippocampal
tissues at 24 h post- resuscitation. (J, K) Relative expression levels of GPX4 protein in hippocampal tissues at 24 h post- resuscitation. (L) Levels of fer-
rous iron (Fe2+) in hippocampal tissues at 2 4 h post- resuscitation. (M, N) Representative photographs of immunofluorescence staining of reactive ox-
ygen species (ROS) production in hippocampal tissues at 24 h post- resuscitation (scale bar = 300 μm, ×200 magnif ication) and its quantification. (O)
Glutathione (GSH) contents in hippocampal tissues at 24 h post- resuscitation. CA, cardiac arrest. CPR, cardiopulmonary resuscitation. Each group
included six samples in (A–D) and three samples in (E–O). *p < 0.05 denotes significant differences compared to the Sham group; #p < 0.05 denotes
significant differences compared to the CA/CPR group.

15 of 19
and cell viability while significantly upregulated miR- let7a
expression, and increased Fe2+ levels, and lipid ROS produc-
tion when compared with the NC group. However, SFN treat-
ment significantly reversed the changes of all those indicators
mentioned above in the H/R + SFN group when compared
to the H/R group. In addition, similar results were observed
after H/R stimulation in those hippocampal neurons over-
expressing ENSSSCG00000035331. Most importantly, the
combination of SFN treatment and ENSSSCG00000035331
overexpression further significantly downregulated miR- let7a
expression, upregulated GPX4 protein expression, and inhib-
ited hippocampal neuronal ferroptosis after H/R stimulation
FIGUR E  | Sulforaphane (SFN) alleviated post- resuscitation brain injury and hippocampal neuronal ferroptosis possibly by regulating the
ENSSSCG00000035331/miR- let7a/glutathione peroxidase 4 (GPX4) axis. (A, B) Changes of serum concentrations of neuron- specific enolase (NSE)
and S100β protein (S100β) at baseline (BL), and 1 h, 2 h, 4 h, and 24 h post- resuscitation. (C, D) Evaluation of neurological f unction using neurological
deficit score (NDS) and cerebral performance category (CPC) at 24 h post- resuscitation. (E–H) Representative photographs of TdT- mediated dUTP
nick- end labeling staining in hippocampal and cortical tissues at 24 h post- resuscitation (scale bar = 300 μm, ×200 magnification) and its quanti-
fication. (I–K) Relative expression levels of ENSSSCG00000035331 (I), miR- let7a (J), and GPX4 mRNA (K) in hippocampal tissues at 24 h post-
resuscitation. (L, M) Relative expression levels of GPX4 protein in hippocampal tissues at 24 h post- resuscitation. (N) Levels of ferrous iron (Fe2+) in
hippocampal tissues at 24 h post- resuscitation. (O, P) Representative photographs of immunofluorescence staining of reactive oxygen species (ROS)
production in hippocampal tissues at 24 h post- resuscitation (scale bar = 300 μm, ×200 magnification) and its quantification. (Q) Glutathione (GSH)
contents in hippocampal tissues at 24 h post- resuscitation. CA, cardiac arrest. CPR, cardiopulmonary resuscitation. Each group included 3–5 sam-
ples. *p < 0.05 denotes significant differences compared to the Sham group；
#p < 0.05 denotes signif icant differences compared to the CA/CPR group.

16 of 19 CNS Neuroscience & Therapeutics, 2025
when compared with the H/R + SF N group or t he H/R + oe -
ENSSSCG00000035331 group (Figure8B–I). Together with
the data from the pig study, we speculated that SFN treat-
ment could alleviate post- resuscitation brain injury and in-
hibit hippocampal neuronal ferroptosis by regulating the
ENSSSCG00000035331/miR- let7a/GPX4 axis.
4 | Discussion
In this study, we utilized a large animal model simulating clin-
ical scenarios to uncover the novel mechanism of ferroptosis
regulation in hippocampal neurons after CA and resuscita-
tion. We demonstrated for the first time that a novel lncRNA,
ENSSSCG00000035331, significantly protected against post-
resuscitation hippocampal neuronal injury by inhibiting fer-
roptosis. Mechanistically, ENSSSCG00000035331 exerted its
protective effects by antagonizing miR- let7a, thereby indirectly
modulating the expression of key genes such as GPX4. In ad-
dition, treatment with the antioxidant SFN resulted in signifi-
cantly higher ENSSSCG00000035331 and GPX4 expression,
markedly lower miR- let7a expression, and further alleviated
post- resuscitation hippocampal neuronal ferroptosis and brain
injury. These results indicated that those therapeutic approaches
by targeting lncRNAs might provide effective post- resuscitation
brain protection in the clinical setting of CA and resuscitation.
Recent research on CA and resuscitation has shown that the
overall prognosis remains grim [25, 26]. Post- resuscitation
brain injury is recognized as one of the key factors contrib-
uting to the high morbidity and mortality [27]. Regrettably,
effective treatment options for such neurological injuries re-
main scarce. Ferroptosis, a novel form of programmed cell
death driven by iron- dependent lipid peroxidation reactions,
has gained significant attention in recent years across vari-
ous disease models, particularly in the realm of research on
brain IRI [25–27]. Of particular interest is the exceptional
sensitivity of certain specific neuronal populations (e.g., CA1
neurons in the hippocampus, cortical, cerebellar, striatal, and
thalamic neurons) to IRI, likely closely associated with their
heightened susceptibility to ferroptosis [28, 29]. In the present
study, we successfully established a pig model of CA and re-
suscitation using electrical defibrillation, meticulously moni-
toring various baseline physiological parameters throughout
the experiment to ensure the precision and credibility of the
model construction. Despite all experimental pigs regaining
spontaneous circulation, those animals in the CA/CPR group
exhibited more severe neurological dysfunction (NDS and
FIGUR E  | Sulforaphane (SFN) inhibited hypoxia/reoxygenation (H/R)- induced hippocampal neuronal ferroptosis possibly by regulating the
ENSSSCG00000035331/miR- let7a/glutathione peroxidase 4 (GPX4) axis. (A, B) Cell viability in hippocampal neurons was assessed using CCK- 8
assay. (C) Levels of ferrous iron (Fe2+) in hippocampal neurons at 24 h after H/R stimulation. (D, E) Flow cytometric analysis and quantification of
lipid reactive oxygen species (ROS) production in hippocampal neurons at 24 h after H/R stimulation. (F) Glutathione (GSH) contents in hippocam-
pal neurons at 24 h after H/R stimulation. (G) Relative expression levels of miR- let7a in hippocampal neurons at 24 h after H/R stimulation. (H, I)
Relative expression levels of GPX4 protein in hippocampal neurons at 24 h after H/R stimulation. NC, normal control. Each group included three
replicates. *p < 0.05 denotes significant differences compared to the NC group; #p < 0.05 denotes significant differences compared to the H/R group;
†p < 0.05 denotes significant differences compared to the H/R + SFN group or the H/R + oe- ENSSSCG00000035331 group.

17 of 19
CPC), suggesting potential adverse effects of the resuscitation
process on porcine cognition and other neural functions. In
addition, laboratory test data indicated that when compared
to the Sham group, the pigs in the CA/CPR group have signifi-
cantly elevated serum levels of brain injury biomarkers (NSE
and S100β), concurrent with neuronal reduction and exacer-
bated apoptosis in hippocampal neurons. Collectively, these
findings confirmed substantive damage to neurons during the
resuscitation process. Further investigation revealed distinct
features of ferroptosis in damaged hippocampal tissues after
resuscitation, characterized by increased Fe2+ levels, height-
ened oxidative stress (manifested by elevated ROS produc-
tion), decreased GSH contents, and downregulated expression
of ferroptosis- suppressing genes. The evidence suggested that
ferroptosis may be involved in the damage process of these
neurons within hours to days following CA and resuscitation.
LncRNA is a novel type of RNA molecule defined as being
longer than 200 nucleotides and has been shown to effectively
regulate gene expression at both the transcriptional and trans-
lational levels [28]. Recent evidence suggests that lncRNAs are
associated with neurological dysfunction following CA and re-
suscitation. Notably, lncRNA GAS5 inhibits miR- 137, promoting
INPP4 expression, thereby suppressing PI3K/Akt pathway acti-
vation and leading to cell apoptosis and inf lammation, which
are involved in the hypoxic response axis of astrocyte- microglia
crosstalk following CA and resuscitation [29]. Additionally,
lncRNA- PS is a critical driver of ShcA activation, leading to
cognitive impairment in mice following CA and resuscitation
[30]. Despite the identification of an increasing number of ln-
cRNAs through transcriptome sequencing analysis, which may
be involved in the pathological process of post- resuscitation
brain injury [31], unfortunately, to date, the functions of most
lncRNAs and their specific regulatory mechanisms remain un-
clear. In our study, following bioinformatics analysis of hippo-
campal tissues from both the CA/CPR and Sham groups, our
focus shifted to a differentially expressed lncRNA, designated
ENSSSCG00000035331. Given these premises, we postulated
that ENSSSCG00000035331 served as a pivotal regulator in the
progression of brain injury following CA and resuscitation, spe-
cifically in the context of ferroptosis mediation. Neuronal loss
resulting from ferroptosis is closely linked to a variety of neuro-
logical dysfunctions, such as memory decline and cognitive defi-
cits. Moreover, it may impede self- repair following brain injury
by disrupting neural regeneration processes, such as inhibiting
proliferation, differentiation, and migration of neural stem cells.
Interestingly, we found that ENSSSCG00000035331 overexpres-
sion significantly enhanced the survival capability of porcine
hippocampal neurons after H/R stimulation, concurrently re-
ducing intracellular ROS production and further reducing the
incidence of cell ferroptosis.
Previous scientific investigations have convincingly demon-
strated that the functionality and mechanisms of lncRNAs are
intimately tied to their precise subcellular localization [20].
Particularly in the context of IRI, interactions with miRNAs
in the cytoplasm have emerged as a central regulatory axis.
This perspective is grounded in a wealth of experimental evi-
dence illustrating how cytoplasmic lncRNAs can act as “mo-
lecular sponges,” sequestering miRNAs and relieving their
suppressive effects on target mRNAs, thereby influencing
post- transcriptional gene expression regulation [32]. Given the
specific enrichment of ENSSSCG00000035331 in the cytoplasm
of neuronal cells as revealed by RNA- FISH, we were led to hy-
pothesize that this lncRNA potentially exerted its influence at
the cytoplasmic level by directly engaging in or modulating
miRNA- mediated post- transcriptional regulatory networks,
thereby impacting the expression of target genes.
Using bioinformatics tools, including miRanda and
RNAhybrid software for Venn diagram analysis, we success-
fully identified miR- let7a as a potential downstream target of
ENSSSCG00000035331. Previous studies have shown that ele-
vated miR- let7a expression levels could inhibit cell proliferation
and increase intracellular ROS production [33]. Furthermore,
miR- let7a downregulates key proteins involved in glucose me-
tabolism and changes closely associated with the ferroptosis
process, implying that miR- let7a promotes ferroptosis by modu-
lating redox homeostasis and energy metabolism pathways [34].
Going further, miR- let7a can directly or indirectly regulate the
expression of key genes in the ferroptosis process, such as tar-
geting glutamine transporter SLC1A5 to modulate ferroptosis in
melanoma cells [35]. As SLC1A5 is a transporter mediating glu-
tamine uptake, its function is inhibited by miR- let7a, leading to
disrupted glutamine metabolism, exacerbating iron- dependent
lipid peroxide accumulation and the occurrence of ferroptosis
[36]. Through dual luciferase reporter assays, we confirmed
miR- let7a as a key downstream target of ENSSSCG00000035331
and uncovered an interaction between the two molecules. Our
experimental data showed that the suppression of miR- let7a ex-
pression facilitated to alleviate hippocampal neuronal ferropto-
sis after H/R stimulation.
To further investigate how miR- let7a mediates the regula-
tion of post- resuscitation hippocampal neuronal ferroptosis by
ENSSSCG00000035331, we examined the downstream target
genes of the typical miRNA pathway. We employed miRanda
and RNAhybrid software to deeply mine the miRNA- mRNA in-
teraction network, revealing a potential regulatory relationship
between miR- let7a and GPX4 mRNA. GPX4 is an antioxidant
enzyme that reduces phospholipid hydroperoxides in mem-
branes, thereby protecting cells against ferroptosis [37]. In our
study, we further enriched this theory by demonstrating that
miR- let7a could directly act on GPX4 mRNA, suppressing its
gene expression, and thus aggravating neuronal ferroptosis in-
duced by H/R stimulation. These findings collectively revealed
the central position of ENSSSCG00000035331 in the ferroptosis
regulatory network and suggested that the therapeutic strategies
targeting ENSSSCG00000035331 might have a positive impact
on mitigating post- resuscitation brain injury.
Currently, nuclear factor erythroid 2- related factor 2 (Nrf2),
known as a classic and key antioxidant regulatory gene, has
been confirmed to be involved in the regulation of ferroptosis
in various diseases [38]. Especially, the Nrf2/GPX4 axis has
been proven to play an important role in inhibiting neuronal
ferroptosis after regional cerebral IRI [39, 40]. In addition,
the SFN used as a Nrf2 activator has been shown to promote
GPX4 expression to inhibit the ferroptosis, and finally ame-
liorate cerebral injury after ischemic stroke [23]. Thus, SFN
treatment could be a potential therapeutic medication for al-
leviating IRI- induced neuronal ferroptosis via regulating the

18 of 19 CNS Neuroscience & Therapeutics, 2025
Nrf2/GPX4 axis, but its regulatory mechanism remains to be
investigated. In the present study, the newly discovered ln-
cRNA ENSSSCG00000035331 was shown to recover GPX4
expression by interacting with miR- let7a, and finally inhibit
neuronal ferroptosis after CA and resuscitation. Additionally,
the inhibition of miR- let7a expression was shown to be an ef-
fective neuroprotective approach after regional cerebral IRI in
several studies [41, 42]. Based on the evidence above, we at-
tempted to investigate the regulatory effect of SFN treatment
on the ENSSSCG00000035331/miR- let7a/GPX4 axis- mediated
hippocampal neuronal ferroptosis after CA and resuscitation.
In our in vivo study, a dose of 2 mg/kg of SFN treatment was
chosen to administer at 5 min after resuscitation, which has
been shown to exert effective protective effects by inhibiting
cardiac ferroptosis and lung pyroptosis after CA and resusci-
tation in pigs [22, 43]. In our in vitro study, a feasible concen-
tration of 20 μM of SFN treatment was obtained using a cell
viability assay. Our results showed that SFN treatment signifi-
cantly increased ENSSSCG00000035331 and GPX4 expression
while decreased miR- let7a expression and neuronal ferropto-
sis in invitro and invivo studies. Hence, SFN treatment could
inhibit post- resuscitation hippocampal neuronal ferroptosis by
regulating the ENSSSCG00000035331/miR- let7a/GPX4 axis.
Our study had several limitations. First, we focused on tissue
sampling and analysis at specific time points after resuscitation,
but did not systematically track the dynamic evolution of ferro-
ptosis and its regu latory mechanisms across d ifferent time stages
following CA and resuscitation. Second, our observation set a
short- term to intermediate- term post- resuscitation period so
that the evaluation of long- term (weeks to months) aspects was
lacked, such as neurological function recovery, scar formation,
and neural regeneration. Third, although our study revealed the
critical role of ENSSSCG00000035331 in ferroptosis regulation
through its interactions with miR- let7a and GPX4 in a series of
cell and mouse experiments, but our mechanistic investigation
was difficult to implement in a pig model. Fourth, the use of pigs
as experimental animals led to high costs and a limited sample
size. Fifth, although we explored the effect of SFN treatment on
the signaling axis mentioned above, it remains unclear whether
this axis plays a dominant role.
5 | Conclusions
Our study demonstrated that a novel lncRNA,
ENSSSCG00000035331, could alleviate post- resuscitation brain
injury and hippocampal neuronal ferroptosis by regulating the
miR- let7a/GPX4 axis. In addition, the SFN, as a potent antioxi-
dant, could produce effective post- resuscitation brain protection
possibly by inhibiting neuronal ferroptosis via regulating the
ENSSSCG00000035331/miR- let7a/GPX4 axis.
Author Contributions
Xingui Wu and Jiefeng Xu designed the study. Mao Zhang, Wenbin
Zhang, Ziwei Chen, Lu He, Qijiang Chen, Pin Lan, Lulu Li, and
Xianlong Wu performed the experiments and recorded the data. Mao
Zhang and Wenbin Zhang analyzed the data and wrote the manuscript.
Acknowledgments
We thank Dr. Feng Ge, Jinjiang Zhu, and Guangli Cao for their contri-
bution to the animal preparation.
Conflicts of Interest
The authors declare no conflicts of interest.
Data Availability Statement
The data that support the findings of this study are available from the
corresponding author upon reasonable request.
References
1. G. D. Perkins, C. W. Callaway, K. Hay wood, etal., “Brain Injury After
Cardiac A rrest,” Lancet 398, no. 10307 (2021): 1269–1278.
2. C. Sandroni, T. Cronberg, and M. Sekhon, “Brain Injury After Car-
diac Ar rest: Pathophysiology, Treatment, and P rognosis,” Intensive Care
Medicine 47, no. 12 (2021): 1393–1414.
3. C. Sandroni, D. Natalini, and J. P. Nolan, “Temperature Control After
Cardiac A rrest,” Critical Care 26, no. 1 (2022): 361.
4. P. Li, Z. Sun, T. Tian, D. Yu, H. Tian, and P. Gong, “Recent Devel-
opments and Controversies in Therapeutic Hypothermia After Cardio-
pulmonary Resuscitation,” American Journal of Emergency Medicine 64
(2023): 1–7.
5. W. Cai, L. Liu, X. Shi, etal., “Alox15/15- HpETE Aggravates Myocar-
dial Ischemia- Reperfusion Injury by Promoting Cardiomyocyte Ferro-
ptosis,” Circulation 147, no. 19 (2023): 1444–1460.
6. Y. Li, Y. Cao, J. Xiao, etal., “Inhibitor of Apoptosis- Stimulating Pro-
tein of p53 Inhibits Ferroptosis and Alleviates Intestinal Ischemia/
Reperfusion- Induced Acute Lung Injury,” Cell Death and Differentia-
tion 27, no. 9 (2020): 2635–2650.
7. Y. Chen, H. Fan, S. Wang, G. Tang, C. Zhai, and L. Shen, “Ferroptosis:
A Novel Therapeutic Target for Ischemia- Reperfusion Injury,” Frontiers
in Cell and Developmental Biology 9 (2021): 688605.
8. B. R. Stockwell, J. P. Friedmann Angeli, H. Bayir, etal., “Ferroptosis:
A Regulated Cell Death Nexus Linking Metabolism, Redox Biolog y, and
Disease,” Cell 171, no. 2 (2017): 273–285.
9. Y. Lin, Q. Chen, G. Zhang, etal., “Sodium Octanoate Alleviates Car-
diac and Cerebral Injury After Traumatic Cardiac Arrest in a Porcine
Model,” American Journal of Emergency Medicine 78 (2024): 48–56.
10. Z. Ye, F. Zhang, P. Wang, et al., “Baicalein Relieves Brain Injury
via Inhibiting Ferroptosis and Endoplasmic Reticulum Stress in a Rat
Model of Cardiac Arrest,” Shock 59, no. 3 (2023): 434–441.
11. Y. Huang, “The Novel Regulatory Role of lncRNA- miRNA- mRNA
Axis in Cardiovascular Diseases,” Journal of Cellular and Molecular
Medicine 22, no. 12 (2018): 5768–5775.
12. L. Chen, Y. Zhou, and H. Li, “L ncRNA, miR NA and lncRNA- miRNA
Interaction in Viral Infection,” Virus Research 257 (2018): 25–32.
13. J. Lu, F. Xu, and H. Lu, “LncRNA PVT1 Regulates Ferroptosis
Through miR- 214- Mediated TFR1 and p53,” Life Sciences 260 (2020):
118305, https:// doi. org/ 10. 1016/j. lfs. 2020. 118305.
14. W. Sun, X. Wu, P. Yu, etal., “LncAA BR07025387.1 Enhances Myo-
cardial Ischemia/Reperfusion Injury via miR- 205/ACSL4- Mediated
Ferroptosis,” Frontiers in Cell and Developmental Biolog y 10 (2 022):
672391.
15. Z. Yang, W. Gao, K. Yang, W. Chen, and Y. Chen, “The Protective
Role of RACK1 in Hepatic Ischemia–Reperfusion Injury- Induced Fer-
roptosis,” Inflammation Research 73 (2024): 1–19.

19 of 19
16. Z. Sun, J. Wu, Q. Bi, and W. Wang, “Exosomal lncRNA TUG1 De-
rived From Human Urine- Derived Stem Cells Attenuates Renal Isch-
emia/Reperfusion Injury by Interacting With SRSF1 to Regulate
ACSL4- Mediated Ferroptosis,” Stem Cell Research & Therapy 13, no. 1
(2022): 297.
17. E. Semenas, A. Nozari, and L. Wiklund, “Sex Differences in Cardiac
Injury After Severe Haemorrhage and Ventricular Fibrillation in Pigs,”
Resuscitation 81, no. 12 (2010): 1718–1722.
18. W. Chen, H. Wang, Z. Wang, C. Zhao, J. Xu, and Q. Chen, “Resolvin
D1 Improves Post- Resuscitation Cardiac and Cerebral Outcomes in A
Porcine Model of Cardiac Arrest,” Shock 54, no. 4 (2020): 548–554.
19. J. Xu, M. Zhang, F. Liu, etal., “Mesenchymal Stem Cells Alleviate
Post- Resuscitation Cardiac and Cerebral Injuries by Inhibiting Cell Py-
roptosis and Ferroptosis in a Swine Model of Cardiac Arrest,” Frontiers
in Pharmacology 12 (2021): 793829.
20. J. Carlevaro- Fita and R. Johnson, “Global Positioning System: Un-
derstanding Long Noncoding RNA s Through Subcellular Localiza-
tion,” Molecular Cell 73, no. 5 (2019): 869–883.
21. D. Li, R. Shao, N. Wang, etal., “Sulforaphane Activates a Lysosome-
Dependent Transcriptional Program to Mitigate Oxidative Stress,” Au-
tophagy 17, no. 4 (2021): 872–887.
22. Z. Zheng, J. Xu, Y. Mao, et al., “Sulforaphane Improves Post-
Resuscitation Myocardial Dysfunction by Inhibiting Cardiomyocytes
Ferroptosis via the Nrf2/IRF1/GPX4 Pathway,” Biomedicine & Phar-
macotherapy = Biomedecine & Pharmacotherapie 179 (2024): 117408,
https:// doi. org/ 10. 1016/j. biopha. 2024. 117408.
23. W. Fan, H. Chen, M . Li, etal., “NR F2 Activation Ameliorates Blood–
Brain Barrier Injur y After Cerebral Ischemic Stroke by Regulating Fer-
roptosis and Inf lammation,” Scientific Reports 14, no. 1 (2024): 5300,
https:// doi. org/ 10. 1038/ s4159 8- 024- 53836 - 0.
24. H. Tian, Y. Xiong, Y. Zhang, etal., “Activation of NR F2/FPN1 Path-
way Attenuates Myocardial Ischemia–Reperfusion Injury in Diabetic
Rats by Regulating Iron Homeostasis and Ferroptosis,” Cell Stress &
Chaperones 27, no. 2 (2022): 149–164, https:// doi. org/ 10. 1007/ s1219 2-
022- 01257 - 1.
25. A. Granfeldt, M. J. Holmberg, and L. W. Andersen, “Extracorporeal
Cardiopulmonary Resuscitation for Cardiac Arrest,” JAMA 329, no. 19
(2023): 1693–1694.
26. G. D. Perkins, I. G. Jacobs, V. M. Nadkarni, etal., “Cardiac Arrest
and Cardiopulmonary Resuscitation Outcome Reports: Update of the
Utstein Resuscitation Registry Templates for Out- of- Hospital Cardiac
Arrest: A Statement for Healthcare Professionals From a Task Force of
the International Liaison Committee on Resuscitation (American Hear t
Association, European Resuscitation Council, Au stralian and New Zea-
land Council on Resuscitation, Heart and Stroke Foundation of Canada,
InterAmerican Heart Foundation, Resuscitation Council of Southern
Africa, Resuscitation Council of Asia); and the American Heart Asso-
ciation Emergency Cardiovascular Care Committee and the Council
on Cardiopulmonary, Critical Care, Perioperative and Resuscitation,”
Circulation 132, no. 13 (2015): 1286–1300, https:// doi. org/ 10. 1161/ CIR.
00000 00000 000144.
27. T. Henson, C. Rawanduzy, M. Salazar, etal., “Outcome and Prog-
nostication After Cardiac Arrest,” Annals of the New York Academy of
Sciences 1508, no. 1 (2022): 23–34.
28. A. B. Herman, D. Tsitsipatis, and M. Gorospe, “Integrated lncRNA
Function Upon Genomic and Epigenomic Regulation,” Molecular Cell
82, no. 12 (2022): 2252–2266.
29. W. Jing, X. Tuxiu, L. Xiaobing, et al., “LncRNA GAS5/miR- 137 Is
a Hypoxia- Responsive A xis Involved in Cardiac Arrest and Cardiopul-
monary Cerebral Resuscitation,” Frontiers in Immunology 12 (2021):
790 750.
30. Y. H. Zhang, F. Peng, L. Zhang, etal., “Long Noncoding R NA Up-
regulates Adapter SHCA Protein Expression to Promote Cognitive
Impairment After Cardiac Arrest and Resuscitation,” Shock 58, no. 2
(2022): 169–178.
31. C. Chen, C. Liu, Z. Niu, etal., “RNA- Seq Analysis of the Key Long
Noncoding RNAs and mRNAs Related to Cognitive Impairment After
Cardiac A rrest and Cardiopulmonary Resuscitation,” Aging (Albany
NY) 12, no. 14 (2020): 14490–14505.
32. X. Kong, Y. Duan, Y. Sang, etal., “LncRNA- CDC6 Promotes Breast
Cancer Progression and Function as ceR NA to Target CDC6 by Spong-
ing microR NA- 215,” Journal of Cellular Physiology 234, no. 6 (2019):
9105–9117.
33. Y. Mi, F. Liu, X. Liang, et al., “Tumor Suppressor Let- 7a Inhibits
Breast Cancer Cell Proliferation, Migration and Invasion by Targeting
MAGE- A1,” Neoplasma 66, no. 1 (2019): 54– 62.
34. D. Rosolen, E. Nunes- Souza, R. Marchi, et al., “MiRNAs Action
and Impact on Mitochondria Function, Metabolic Reprogramming and
Chemoresistance of Cancer Cells: A Systematic Review,” Biomedicine
11, no. 3 (2023): 693, https:// doi. org/ 10. 3390/ biome dicin es110 30693 .
35. S. Diao, “Lentivirus- Mediated Overexpression of MiR- 122a, a Liver
Specific MicroRNA for Gain- of- Function Study in HCCs. Chinese Uni-
versity of Hong Kong,” 20 08.
36. M. Luo, L. Wu, K. Zhang, etal., “miR- 137 Regulates Ferroptosis by
Targeting Glutamine Transporter SLC1A5 in Melanoma,” Cell Death
and Differentiation 25, no. 8 (2018): 1457–1472.
37. Q. Xue, D. Yan, X. Chen, et al., “Copper- Dependent Autophagic
Degradation of GPX4 Drives Ferroptosis,” Autophagy 19, no. 7 (2023):
1982–1996.
38. R . Yan, B. Lin, W. Jin, L. Tang, S. Hu, and R. Ca i, “NRF2, a S uperstar
of Ferroptosis,” Antioxidants 12, no. 9 (2023): 1739.
39. K. Chen, B. Xu, L . Long, et al., “Inhibition of Phosphodiesterase 4
Suppresses Neuronal Ferroptosis A fter Cerebral Ischemia/Reperfu-
sion,” Molecular Neurobiology 62, no. 3 (2025): 3376–3395.
40. H. Liu, T. A. Zhang, W. Y. Zhang, S. R. Huang, Y. Hu, and J. Sun,
“Rhein Attenuates Cerebral Ischemia- Reper fusion Injury via Inhibition
of Ferroptosis Through NR F2/SLC7A11/GPX4 Pathway,” Experimental
Neurology 369 (2023): 114541.
41. Z. Wang, F. F. Liu, Y. Wang, X. M. Jiang, and X. F. Yu, “Let- 7a Gene
Knockdown Protects Against Cerebral Ischemia/Reperfusion Injury,”
Neural Regeneration Research 11, no. 2 (2016): 262–269.
42. A. Vinciguerra, P. Cepparulo, S. Anzilotti, etal., “Remote Postc ondi-
tioning Ameliorates Stroke Damage by Preventing Let- 7a and miR- 143
Up- Regulation,” Theranostics 10, no. 26 (2020): 12174–12188, ht tps ://
doi. org/ 10. 7150/ thno. 48135 .
43. Y. Li, M. Yang, L. Xie, G. Zhang, J. Xu, and S. Xu, “Sulforaphane
Alleviates Post- Resuscitation Lung P yroptosis Possibly via Activating
the Nrf2/HO- 1 Pathwasy,” Shock 60, no. 3 (2023): 427–433.
Supporting Information
Additional supporting information can be found online in the
Supporting Information section.