Content uploaded by Francis Harry Shone Villaruel Leonora
Author content
All content in this area was uploaded by Francis Harry Shone Villaruel Leonora on Apr 14, 2025
Content may be subject to copyright.
9
Introduction
e mucosa has an integral role in the sh innate immune
system as the frontline defense against environmental and
biological factors that might make the host susceptible to
disease (Bragadeeswaran, angaraj 2011; Esteban 2012;
Lazado, Caipang 2014). Primarily secreted in the gut,
skin, buccal cavity, nasopharynx, and gills by goblet cells
of the epithelium (Hedmon et al. 2018), mucosa also has
physiological functions such as aiding in the exchange of
nutrients, regulating osmotic and ionic concentrations,
minimizing entry of pollutants, and resisting drag when
swimming (Esteban 2012; Benhamed et al. 2014; Tiralongo
et al. 2020; Ivanova et al. 2022). Its continuous secretion
and subsequent shedding, coupled with the activity of
exogenous immunocompetent molecules, such as proteases,
lysozymes, immunoglobulins, and antibacterial peptides,
prevent the stable colonization of pathogens (Lazado,
Caipang 2014; Dash et al. 2018; Ivanova et al. 2022). In
this accord, numerous studies have been conducted on
the antibacterial properties of sh mucus against dierent
pathogens. Skin mucus from the common eel (Anguilla
anguilla) has antibacterial and hemolytic activities against
a wide range of sh pathogens (Bragadeeswaran, angaraj
2011). Skin mucus extracts from three cultivable sh
species, the Indian carp (Catla catla), mrigal (Cirrhinus
mrigala), and common eel (Anguilla anguilla), had
antifungal activity against phytopathogenic fungal species,
Aspergillus awamori and Colletotrichum falcatum (Pethkar,
Lokhande 2017). Skin mucus extracts of the swamp eel
(Monopterus albus) were found to be eective against oral
and skin pathogens tested on animal models (Hilles et al.
2018; Hilles et al. 2022), as well as fungal pathogens (Ikram,
Ridzwan 2013).
e mucosa is a unique transition between the
environment and the host, permitting a diverse bacterial
community to inhabit it (Larsen et al. 2013; Carda-Dieguez
et al. 2017). Some pathogenic strains, like Aeromonas,
Pseudomonas, Streptococcus, and Vibrio, can thrive in the
mucosa and cause disease in both wild and reared sh;
bacteriosis continues to act as a major bottleneck in natural
and articial aquatic ecosystems (Das et al. 2013; Feng
et al. 2017; Nandi et al. 2017; Chen et al. 2018; Doroteo
et al. 2018; Xia et al. 2019). e dysbiosis in the mucosal
microbiota, especially in the domination of pathogenic
groups, predisposes the host to disease (Petersen, Round
2014; Clinton et al. 2021). However, the mucosa can tolerate
some commensals that can contribute to orchestrating
immune responses against invaders (Gomez et al. 2013;
Lowrey et al. 2015; Yu et al. 2021). Some proposed
Environmental and Experimental Biology (2025) 23: 9–18 Original Paper
http://doi.org/10.22364/eeb.23.02
Isolation and characterization of gill mucus-
associated antagonistic bacteria in the Asian
swamp eel (Monopterus albus)
Francis Harry Shone V. Leonora, Christopher Marlowe A. Caipang*
Division of Biological Sciences, College of Arts and Sciences, University of the Philippines Visayas,
Miag-ao 5023, Iloilo, Philippines
*Corresponding author, E-mail: cacaipang@up.edu.ph
ISSN 2255-9582
Abstract
is study investigated the gill mucus of Asian swamp eel (Monopterus albus) for the presence of antagonistic bacteria against known
aquatic pathogens, Vibrio harveyi and Aeromonas hydrophila. Initial screening of 500 bacterial isolates via the spot-on-lawn and co-
incubation assays, identied ve with signicant antagonistic activity, which were further subjected to morphological, enzymatic,
biochemical, and molecular characterization. All ve isolates were Gram-negative bacilli. Four isolates were identied as belonging to
the Pseudomonas genus, a known probiont with documented biocontrol properties in various plant and animal species. e remaining
isolate exhibited high 16S rRNA gene sequence similarity to Aeromonas dhakensis, a known human pathogen. All isolates demonstrated
the ability to produce at least three of six tested extracellular enzymes: catalase, amylase, protease, lipase, gelatinase, and urease. Given
the observed antagonistic activity of these isolates, further research is warranted to evaluate their potential application as probiotics.
is study represents the rst investigation of antagonistic bacteria in swamp eel gill mucus and contributes to the limited research on
sh gill mucus as a source of such bacteria.
Key words: antagonism, aquaculture, sh health, mucosal immunity, pathogens.
Abbreviations: CFU, colony forming units; NA, Nutrient Agar; NB, Nutrient Broth.
10
mechanisms that allow such commensals to fortify defense
are through the production of metabolites that kill the
pathogens or direct interference with the infection routes
to prevent further infection and disease; bacteria-bacteria
interaction resulting in population regulation is not a new
phenomenon and has been widely explored. ere have been
studies on sh mucosal antagonists that exhibited activity
against dierent sh pathogens. Some Pseudoalteromonas
sp. were isolated from the skin mucus of the Indian goat
sh (Parupenus indicus) and displayed probiotic potential
in in vitro experiments (elma, Asha Devi 2016). Bacillus
cereus isolated from the skin mucus of calbasu sh (Labeo
calbasu) was administered with a previously isolated
autochthonous intestinal Aneurinibacillus aneurinilyticus
that had antagonistic activity against Aeromonas hydrophila
(Bhatnagar, Rathi 2019; Bhatnagar, Dhillon 2023). e
synergism resulted in improved growth, immunity, and
survival of the host sh. An Acinetobacter strain related
to Acinetobacter pittii isolated from the skin mucus of
bighead catsh (Clarias macrocephalus) demonstrated
strong inhibition of several pathogenic strains in vitro
(Bunnoy et al. 2019). Most of these studies targeted the
skin and gut mucus, and there exists a dearth of studies
on the gill mucus (Lazado, Caipang 2014; Reverter et al.
2017). e gill mucus is hypothesized to harbor antagonists
that signicantly aid in immunity, necessitated by its direct
exposure to the constant ingress of pathogens from the
external environment (Ringoe, Holzapfel 2000; Chabrillon
et al. 2006; Clinton et al. 2021). Its potential for sh health
studies is relatively underexplored.
e Asian swamp eel (Monopterus albus) is a freshwater
sh widely distributed in Asian countries, including
China, Malaysia, Indonesia, and the Philippines. Its
unique characteristics include the ability to breathe on
land, allowing it to move across habitats, having a singular
triangular gill slit ventral to its head, being capable of
sex reversion, and can tolerate harsh conditions, such as
uctuations in environmental parameters like salinity
and temperature, and exposure to a wide array of soil and
water pathogens in various habitats (Damsgaard et al.
2014; Hilles et al. 2018; Liu et al. 2019; Xia et al. 2019). Such
resilience has attracted interest for its use in aquaculture
in other countries, but it is yet to be extensively utilized in
the Philippines (Liu et al. 2019). Further, the documented
invasive success of the swamp eel around the world can
be attributed to its adaptive characteristics and robust
immunity, making it a good model species for screening
antagonists in the gill mucus (Stevens et al. 2016).
is study aimed to characterize the antagonistic
bacterial species present in the gill mucus of the Asian
swamp eel (M. albus) and utilized a funneled approach
to narrow down the species to those that have high
antagonistic activity against ubiquitous aquatic pathogens,
Aeromonas hydrophila and Vibrio harveyi, through the
spot-on-lawn and co-incubation assays. Characterization
included morphological, enzymatic, biochemical, and
molecular phases. is study hopes to contribute to the
body of knowledge by demonstrating that the gill mucus
can be a rich source of antagonistic bacteria against
keystone pathogens and can have potential applications
in disease management in aquaculture, such as sources of
bioactive compounds or use as probiotics. Moreover, the
study investigated a relatively untapped eld in sh health
– the gill mucus, an interesting microenvironment to study
as a site of much pathogen ingress in sh.
Materials and methods
Gill mucus collection and bacterial isolation
Six Asian swamp eel (Monopterus albus Zuiew) specimens
were sourced from a local sh farm in Zarraga, Iloilo,
Philippines, and placed in sterile plastic bags with rice eld
water where they were caught and stored for three days to
ensure the isolation of putative autochthonous bacteria.
e sh were immobilized through immersion in 50 g L–1
sodium bicarbonate solution for 10 min (Caipang et al. 2021)
before spiking the head (Reverter et al. 2017). Although the
sh were sacriced at the sh farm, all handling procedures
were done in accordance with institutional and national
guidelines on proper sh handling and welfare. e ventral
surface of the head of the sh was disinfected with 70% ethyl
alcohol prior to dissection of the gill slit. e gill mucus
from each eel specimen was collected using sterile cotton
swabs (Stevens et al. 2016; Clinton et al. 2021; Lorgen-
Ritchie et al. 2022) and stored in sterile centrifuge tubes
containing 1 mL of normal saline solution. Within 3 h from
collection, the gill mucus was subjected to serial dilution
and plated on Nutrient Agar (NA) to obtain colonies. Aer
incubation at 28 °C for 22 h, plate counts were performed
for each eel specimen, and bacterial isolates with distinct
colonial morphology from all plates were pooled and
restreaked on fresh agar plates. Subcultures were prepared
every two weeks. Eel specimens were sent to the University
of the Philippines Visayas Museum of Natural Sciences for
conrmation of the target species.
Evaluation of in vitro antagonistic activity: indicator
pathogenic strains
e isolates were narrowed down to those with in vitro
antagonistic activity against ubiquitous aquatic pathogens,
Aeromonas hydrophila and Vibrio harveyi (de la Peña et
al. 2001), sourced from the Microbiology Laboratory of
the University of the Philippines Visayas and Fish Health
Section of the Southeast Asian Fisheries Development
Center, respectively.
Evaluation of in vitro antagonistic activity: spot-on-lawn
assay
Nutrient Broth (NB) cultures of the indicator strains
were standardized using MacFarland 0.5 turbidity to
F.H.S.V. Leonora, C.M.A. Caipang
11
approximate 1.5 × 108 colony forming units (CFU) per
milliliter density (Ikram, Ridzwan 2013; Hilles et al. 2022)
for the spot-on-lawn assay. Culture media for V. harveyi
were accordingly supplemented with 1.5% NaCl to cater to
its salt requirements (Doroteo et al. 2018). e standardized
culture was inoculated on fresh NA using the spread plate
method and allowed to be absorbed by the medium for 1 h.
e isolates were then individually spotted on the pathogen
lawn and incubated overnight at 28 °C (Caipang et al. 2010).
In vitro antagonistic activity of an isolate was recorded as
a zone of inhibition around it or an abundance of growth
over the pathogen lawn. e inhibition zone indicates the
exclusion mechanism of antagonism of an isolate where
it produces metabolites to exclude the growth of another
species within its proximity (Lazado, Caipang 2014).
Abundant growth, on the other hand, is representative of
the displacement antagonistic mechanism where the isolate
is able to displace another species, in this case, the initially
inoculated pathogen lawn. Isolates that demonstrated
antagonism against both pathogens were subjected to co-
incubation assay.
Evaluation of in vitro antagonistic activity: co-incubation
assay
For the co-incubation assay, the isolates and the indicator
strains were plated on NA and subsequently inoculated
in NB. Overnight cultures were standardized using UV
spectrophotometry (600 nm) and plate count methods and
diluted to 103 CFU mL–1 concentration with normal saline
(Doroteo et al. 2018). In a sterile 1.5-mL centrifuge tube,
equal aliquots of an isolate and pathogen were added and
mixed. For the control, equal amounts of the pathogen and
sterile culture media were combined in the tube (Caipang
et al. 2023). All tubes were incubated in a rotary incubator
at 28 °C, 100 rpm for 24 h.
Aer incubation, serial dilutions of each tube were
prepared and plated on selective culture media: glutamate-
starch-phenol red agar supplemented with 20 mg L–1
ampicillin (Perales 2003) for tubes co-incubated with A.
hydrophila and thiosulfate-citrate-bile salts-sucrose agar for
V. harveyi (Doroteo et al. 2018), for the enumeration of the
pathogens following co-incubation (Caipang et al. 2023).
e bacterial isolates tested did not grow in both selective
media, as determined by preliminary assay; thus, only the
pathogens could be counted on the media post-incubation.
e plates were incubated at 28 °C for 36 h (Speare, Septer
2019). Plate counts were reported in log10 CFU mL–1.
Reduction was indicated by a decrease of log10 CFU mL–1 in
the count of the pathogen (Caipang et al. 2023). Reduction
in pathogen counts in the co-incubated groups was also
expressed as a percentage reduction relative to the count
in the control setup. e experiments were performed in
triplicate. Isolates with remarkable activity were subjected
to characterization.
Characterization of bacterial isolates
e bacterial isolates with noticeable antagonistic
activity from the co-incubation assay were subjected to
morphological, enzymatic, biochemical, and molecular
characterization. e rst three phases, morphological,
enzymatic, and biochemical tests, were performed
following the published protocols by the American Society
for Microbiology (Smith, Hussey 2005; Breakwell et al.
2007; MacWilliams 2009a; MacWilliams 2009b; McDevitt
2009; Shields, Cathcart 2011; dela Cruz, Torres 2012; Lal,
Cheeptham 2012; Reiner 2012).
Macroscopic and microscopic features of the isolates
were described. For the macroscopic description, the colony
morphology, including colour, form, elevation, margin,
opacity, and texture were noted. For the microscopic
description, the isolates were Gram-stained, and cell
shapes were observed under the microscope at 400× and
1000× magnication. For motility, the isolates were stab-
inoculated into a sulde-indole-motility medium and
observed for growth from the stab for one week.
e isolates were tested for the production of enzymes,
catalase (3% H2O2), amylase (2% starch agar), protease (1%
skim milk agar), lipase (1% olive oil agar), gelatinase (12%
nutrient gelatin), and urease (urea broth). Culture media
formulations were prepared based on the procedures of
Simora et al. (2015) and Doroteo et al. (2018).
e isolates were subjected to indole (sulde-indole
medium), methyl red, Vogues-Proskauer tests (methyl
red-Vogues-Proskauer broth), citrate (Simmons citrate
agar slant), hydrogen sulde production (sulde-indole
medium), and fermentation of glucose and lactose (triple-
sugar-iron agar slant) tests. Isolates were inoculated and
observed for characteristic results based on previously
described protocols of the American Society for
Microbiology.
Molecular identication
For molecular characterization, genomic DNA (gDNA)
was extracted from overnight cultures of the isolates in 5
mL broth using a commercial kit (Purelink Genomic DNA
Mini, ermo Fisher Scientic, California, USA) following
the instructions of the manufacturer. Extracted gDNA was
analyzed using NanoDrop spectrophotometry to ensure
sample quality. 16S DNA was amplied using universal
primers (Forward: GAGAGTTTGATCCTGGCTCAG;
Reverse: CTACGGCTACCTTGTTACGA) (Bianciotto et
al. 2003). e 25 μL PCR was comprised of 2 μL (10 to 15
ng) DNA as template, 2 μL of each primer (5 pmol), 2.5 μL
PCR buer, 1.5 μL 2 mM dNTP, 1 μL 50 mM MgCl2 and
distilled water. PCR amplication was performed following
the protocol of Caipang et al. (2010), and the products
were sent for sequencing (Macrogen, Korea). Each isolate
was putatively identied using BLASTn search. 16S rRNA
sequences of related strains were downloaded from NCBI
Genbank (blast.ncbi.nlm.nih.gov) and aligned using the
Gill mucus-associated antagonistic bacteria in swamp eel
12
ClustalW method of MEGA 11.0 soware (Tamura et al.
2021). A maximum likelihood phylogenetic tree with 1000
bootstrap replications was constructed using IQTREE
(http://iqtree.cibiv.univie.ac.at/) (Trinopoulus et al. 2016)
and visualized using iTOL soware (https://itol.embl.de/)
(Letunic, Bork 2021).
Data analysis
In a co-incubation assay, colony counts (expressed as log10
CFU mL–1) were analyzed using one-way ANOVA (Systat
version 8; Systat Soware Inc., San Francisco, CA, USA)
to compare co-incubated and control treatments. Where
ANOVA indicated signicant dierences, Student’s t-tests
were performed for pairwise comparisons. A signicance
level of p ≤ 0.05 was applied for all statistical analyses.
Results
Bacterial isolates in the gill mucuss
e gill mucus of the Asian swamp eel had a bacterial
count ranging from 104 to 106 CFU mL–1 as derived from
the plate count of the six specimens. A total of 500 bacterial
isolates with distinct morphology were subcultured from
the dilutions of the gill mucus from all specimens.
In vitro antagonistic activity of the isolates
Five hundred isolates were subjected to parallel spot-on-
lawn assays against the indicator (pathogenic) strains.
A total of 11 isolates had a zone of inhibition against A.
hydrophila, while 14 isolates presented a zone of inhibition
against V. ha r ve yi (Table 1). In this assay, the presence of
a zone of inhibition suggests an antagonistic mechanism
of exclusion. Conversely, displacement is characterized by
prolic growth of the isolate over the pathogen lawn. A
total of 64 bacterial isolates (12.8%) exhibited some form
of antagonistic activity, either exclusion or displacement,
against the two bacterial pathogens.
Of the 64 isolates that had activity against both
pathogens, eight isolates were tested using co-incubation
assay to quantitatively evaluate their antagonistic activity
against the two pathogens. e narrowing down in the
number of isolates was based on the preliminary assay of
the growth of the isolates on the selective media that were
used to check for the growth of the indicator pathogens.
Following co-incubation with various bacterial isolates,
a statistically signicant reduction was observed in the
population density of both A. hydrophila and V. h a r v e yi .
Specically, the A. hydrophila counts decreased by 6.6
to 22.5%, while V. h a r v ey i counts were reduced by 18.3
to 29.7%. Five isolates with the highest mean reduction
percentages were subjected to subsequent characterization
methods. ese chosen isolates reduced the pathogen
count by more than 20%.
Tab le 1 . Number and percentage of the bacterial isolates that displayed in vitro antagonistic activity against Aeromonas hydrophila and
Vibrio harveyi evaluated using spot-on-lawn assay. Data are shown as number of bacterial colonies and their corresponding percentages
out of the 500 bacterial colonies. Exclusion characteristic is qualied when there is a zone of inhibition around the bacterial isolate over
the pathogen lawn. Displacement characteristic was indicated by abundant growth of the bacterial isolate on the pathogen lawn
Pathogen In vitro antagonistic activity against the pathogen
Number of bacterial colonies exhibiting
exclusion characteristic
Number of bacterial colonies exhibiting
displacement characteristic
Aeromonas hydrophila 11 (2.2%) 129 (25.8%)
Vibrio harveyi 14 (2.8%) 139 (27.8%)
Both pathogens 64 (12.8%)
Table 2. Aeromonas hydrophila and Vibrio harveyi bacterial counts and their reduction (mean ± SD) aer co-incubation with dierent
bacterial isolates. Pathogen counts aer co-incubation are reported in log10 CFU mL–1. Reduction in pathogen count was also reported
in percentages relative to the control. * indicates a signicant reduction in bacterial count at p < 0.05
Isolate A. hydrophila V. harveyi Mean reduction in
pathogen count
Counts Reduction (%) Counts Reduction (%)
Control 8.60 ± 0.14 – 8.58 ± 0.20 – –
A13 6.79 ± 0.20* 21.00 ± 0.20 6.88 ± 0.09* 19.80 ± 0.09 20.4
C4 6.67 ± 0.32* 22.50 ± 0.30 6.48 ± 0.01* 24.40 ± 0.01 23.4
C16 7.02 ± 0.14* 18.40 ± 0.14 7.00 ± 0.24* 18.30 ± 0.24 18.4
C24 6.90 ± 0.25* 19.80 ± 0.25 6.71 ± 0.10* 21.80 ± 0.10 20.8
C25 7.29 ± 0.16* 15.20 ± 0.16 6.39 ± 0.56* 25.50 ± 0.56 20.4
C27 7.13 ± 0.02* 17.20 ± 0.02 6.56 ± 0.12* 23.50 ± 0.12 20.3
C30 8.03 ± 0.05* 6.60 ± 0.05 6.52 ± 0.25* 24.00 ± 0.25 15.3
C64 6.91 ± 0.14* 19.70 ± 0.14 6.03 ± 0.05* 29.70 ± 0.05 24.7
F.H.S.V. Leonora, C.M.A. Caipang
13
Characterization of the isolates
e results of the characterization assays are reected in
Table 3. All ve isolates were Gram-negative and bacillus-
shaped. A13 had a distinct colony morphology compared
to the rest having a yellowish colony colour, irregular form,
raised elevation, wavy margin, translucent opacity, and
matte texture; C4, C24, C25, and C64 had similar colonial
characteristics of white or yellowish colony colour, circular
form, at elevation, entire margin, translucent opacity, and
moist texture. e isolates were able to produce at least
three of the six extracellular enzymes tested. All isolates
were positive for catalase, lipase, and citrate tests. Isolates
A13, C4, and C64 produced gelatinase. None produced
hydrogen sulde and urease. Only A13 was positive for all
enzymatic tests except for urease and was the only isolate
that fermented glucose and lactose.
Molecular characterization of the isolates revealed
that A13 was a putative Aeromonas, while the rest were
Pseudomonas. From the BLASTn alignment (Table 4) and
phylogenetic analysis (Fig. 1), the identities of the isolates
were inferred: A13 was 93% identical to the sequence of
the strain 202108B3 of Aeromonas dhakensis, while C4
was 95% similar to the sequence of strain D116_SP6R of
Pseudomonas azotoformans supported by a clear sub-group
in the phylogenetic tree. Both C24 and C25 were highly
similar to putative Pseudomonas parafulva (strain PRS09-
11288) with percentages, 98% and 96%, respectively. Lastly,
C64 was 97% identical to strain NBSII of Pseudomonas
gessardii.
Discussion
e sh mucosa provides protection to the host through the
activity of immunocompetent molecules and metabolites,
as well as the antagonism of commensal bacteria against
pathogens (Lazado, Caipang 2014; Das et al. 2018; Ivanova
Tab le 3. Morphological, enzymatic, and biochemical characterization of the selected bacterial isolates from the gill mucus
Characteristic Isolate
A13 C4 C24 C25 C64
Morphological Gram stain – – – – –
Cell shape rod rod rod rod rod
Color yellowish white yellowish yellowish white
Form irregular circular circular circular circular
Elevation raised at at at at
Margin wavy entire entire entire entire
Opacity translucent translucent translucent translucent translucent
Texture matte moist moist moist moist
Motility + – – – –
Enzymatic Catalase + + + + +
Amylase + – + + –
Protease + + – – –
Lipase + + + + +
Gelatinase + + – – +
Urease – – – – –
Biochemical Indole test + – – – –
Methyl red + – + + –
Vogues-Proskauer + – – – –
Citrate test + + + + +
H2S production – – – – –
Glucose fermentation + – – – –
Lactose fermentation + – – – –
Tab le 4. Molecular identication of the bacterial isolates from the gill mucus based on BLASTn search (16S rRNA)
Isolate Sequence
length (bp)
Highest identity Strain code GenBank
accession No.
Identities
(match/total)
Percentage
similarity
Query
cover
A13 1100 Aeromonas dhakensis 202108B3 OQ283677.1 1041/1125 93% 99%
C4 1185 Pseudomonas azotoformans D116_SP6R MK883209.1 1036/1095 95% 92%
C24 1185 Pseudomonas parafulva PRS09-11288 CP019952.1 1011/1030 98% 86%
C25 1206 Pseudomonas parafulva PRS09-11288 CP019952.1 1098/1142 96% 94%
C64 1198 Pseudomonas gessardii NBSII KT184489.1 1117/1151 97% 95%
Gill mucus-associated antagonistic bacteria in swamp eel
14
et al. 2022). e ndings of this research support the
hypothesis that the gill mucus can be a good source of
antagonistic bacteria aside from the gut and skin mucosa.
From this study, around 12.8% of the isolates screened
exhibited antagonism against the tested aquatic pathogens,
A. hydrophila and V. harveyi in the spot-on-lawn assay,
comparative to the results obtained by previous studies that
screened autochthonous antagonists (Caipang et al. 2010;
Stevens et al. 2016; Caipang et al. 2022; Bhatnagar, Rathi
2023). To quantitatively evaluate the antagonistic activity,
the ve isolates that were subjected to co-incubation assay
for further characterization reduced pathogen count by at
least 20%, similar to the percentages obtained by Caipang
et al. (2023) on the isolation of potential probionts with
anti-V. ha r v e yi activity. Antagonism against the indicator
pathogens can be due to mechanisms such as competition,
displacement, or exclusion (El-Saadony et al. 2021).
Competition can be one of the plausible mechanisms
for the antagonism observed since the pathogen and the
antagonistic bacteria were co-incubated in equal amounts
(Lazado et al. 2011), apart from exclusion and displacement
mechanisms displayed by the isolates in the spot-on-lawn
as s ay.
From this study, the ve isolates that had notable activity
from the antagonism assays performed were characterized
by their morphological, enzymatic, biochemical, and
molecular proles, which revealed that they were putative
Aeromonas and Pseudomonas. Antagonism is an important
prerequisite property of probiotics, and these genera are
among the common sources of probiotics that have the
potential for use in aquaculture, along with Lactobacillus,
Leuconostoc, Enterococcus, Carnobacterium, Shewanella,
and several others (Ringoe, Holzapfel 2000; Kesarcodi-
Watson et al. 2007; Nayak 2010; Allameh et al. 2012; Teneva
et al. 2016; Yu et al. 2021). Pseudomonas encompasses
ubiquitous strains found in soil and aquatic environments
and even animal tissues (Burr et al. 2010; Lauritsen et al.
2021). It is an integral member of the core microbiota of
dierent tissues and mucosal layers of several sh species
(Larsen et al. 2013; Leonard et al. 2014; Kearns et al. 2017;
Reverter et al. 2017; Rosado et al. 2018; Chen et al. 2019;
Rosado et al. 2023), having purported contributions to the
physiological functions of the host, including nutrition,
metabolism, host-microbe interactions, and immunity
(Nayak 2010; Stevens et al. 2016; Chen et al. 2019).
Although Pseudomonas harbours several strains that are
pathogenic, previous studies have isolated strains with their
secreted secondary metabolites that presented biocontrol
and probiotic properties (Heikkinen et al. 2014; Mancuso
et al. 2015; Rizzo et al. 2020; Lauritsen et al. 2021; Zheng et
al. 2021; Oni et al. 2022).
e isolated strains are putative P. azotoformans,
P. parafulva, and P. gessardii and have previously been
reported to have activity against a wide range of bacterial
and fungal pathogens in rice and cucumber (Wul et al.
2010; Sang et al. 2014; Liu et al. 2015; Fang et al. 2016; Hoe
2021; Zheng et al. 2021). e concurrent isolation of these
strains in rice and the swamp eel is thought to be a result of
a shared ecological niche in a rice paddy habitat. All isolates
were able to produce at least one benecial enzyme among
catalase, amylase, protease, and lipase, which are benecial
for eventual probiotic application (El Saadony et al. 2021;
Rodrigues et al. 2021; Caipang et al. 2022; Khushboo et al.
2023). Further, all isolates can utilize citrate as a sole energy
source. Isolates C4 and C64, putative P. azotoformans and P.
gessardii, respectively, produced gelatinase, which is highly
associated with pathogenicity and virulence in bacteria
(Rodrigues et al. 2021).
Interestingly, one of the isolates (A13) characterized
had high sequence similarity with Aeromonas dhakensis, an
Fig. 1. Phylogenetic trees of the Aeromonas and Pseudomonas isolates from the gill mucus of the swamp eel. Trees were generated based
on maximum likelihood inference with 1000 bootstrap replications. Sequence data of the isolates were aligned with related strains from
BLASTn search in NCBI.
F.H.S.V. Leonora, C.M.A. Caipang
15
emerging sh and human pathogen. Of all the isolates, this
had the lowest sequence similarity possibly consequential
to the misidentication of A. dhakensis as other Aeromonas
strains, such as A. hydrophila, A. caviae, and A. veronii in
previous isolation studies and discrepancies in biochemical
proling (Martinez-Murcia et al. 2008; Aravena-Roman
et al. 2011; Esteve et al. 2012; Beaz-Hidalgo et al. 2013;
Chen et al. 2016; Teunis, Figueras 2016). Using genomic
data, it has no unambiguous signature to distinguish it
from A. caviae, as seen with the outgroup cluster in the
phylogenetic tree (Chen et al. 2016). It is also possible
that the isolated strain in this study is a novel species, but
this can only be conrmed by further characterization to
dene its biological properties. Aeromonas is a repository
of opportunistic pathogenic strains widely distributed
in dierent sh species (Chen et al. 2016; Xia et al. 2019;
Rathinam et al. 2022). Particularly, A. dhakensis has been
isolated as a predominant species in diseased wild and
farmed eels (Esteve et al. 2012; Yi et al. 2013). In this study,
the isolated strain tested positive for motility, catalase,
amylase, protease, lipase, gelatinase, and carbohydrate
fermentation, providing a survival advantage in various
habitats (Fernández-Bravo, Figueras 2020; Khushboo et al.
2023). Converging evidence over the past years proves that
A. dhakensis infections exhibit greater virulence than other
Aeromonas infections (Chen et al. 2016). However, this is
the rst documentation of the antagonism of A. dhakensis
against other pathogens. Another bacterium, Pseudomonas
aeruginosa, is a serious pathogen in humans, but has a
strain that has reported antagonism against pathogens in
economically important crops (Shi et al. 2015). is might
be the same case with the isolated A. dhakensis and can be
potentially harnessed for potent bioactive compounds.
However, it should also be noted that the observed
antagonism of a bacterial species should not mask the
possibility that it can still be pathogenic, eliciting the
importance of in vivo studies involving pathogenicity
and survival experiments. Corollary to this nding is that
some species have selective antagonism against dierent
pathogens, wherein they promote the growth of other
pathogens while reducing the population of another (Xu
et al. 2023). It is also possible that such bacterial groups
can convert into pathogenic groups due to alterations in the
host microbiota structure (Gan et al. 2021). Antagonistic
eects and disease occurrence in aquaculture are not only
implicated due to the virulence of the pathogen but also
encompass multifactorial interactions with other species
in the microbiota of the host. In-depth analyses of such
interactions are necessary to magnify desired antagonistic
eects against pathogens and mitigate counteractive events.
Conclusions
Taken together, using Asian swamp eel as a model, the gill
mucus, an underexplored mucosal surface, is a rich source
of bacterial isolates with antagonistic properties that have
great potential applications for biocontrol in aquaculture.
As the rst study to screen antagonists in the gill mucus
of the swamp eel, and one of the few studies that studied
the gill mucus of sh species, in general, this encourages
more investigations to be conducted on the gill mucus
and its implications in sh health. From this study, the
isolates that can be subjected to further characterization
would be C24 and C25, which are putative P. parafulva.
For the other isolates, their presence in the swamp eel and
documented antagonistic activity may be leveraged for
further investigation of their contributions as antagonists
against pathogens. A future direction for this study is the
probiotic characterization of the isolates, highlighting in
vivo studies in order to elucidate their potential eects on
the growth, metabolism, and survival of sh.
Acknowledgements
e authors would like to acknowledge the support provided
by the Division of Biological Sciences, College of Arts and
Sciences, University of the Philippines Visayas (DBS-CAS-
UPV), throughout the conduct of the research. ey would also
like to thank the National Institute of Molecular Biology and
Biotechnology (NIMBB-UPV), the Institute of Fish Processing
Technology, College of Fisheries and Ocean Sciences (IFPT-
CFOS, UPV) for allowing the use of laboratory facilities, and the
Fish Health Section of the Southeast Asian Fisheries Development
Center-Aquaculture Department (SEAFDEC-AQD) for the
provision of bacterial culture. FHS Leonora is also grateful for
the scholarship support provided by the Department of Science
and Technology - Science Education Institute (DOST-SEI). e
technical assistance of Mr. Garner Algo Alolod of the Tokyo
University of Marine Science and Technology in the construction
of the phylogenetic tree is gratefully acknowledged.
References
Allameh S.K., Daud H., Yuso F.M., Saad C.R,, Ideris A. 2012.
Isolation, identication and characterization of Leuconostoc
mesenteroides as a new probiotic from intestine of snakehead
sh (Channa striatus). Afr. J. Biotechnol. 11: 3810–3816.
Aravena-Roman M., Harnett G.B., Riley T.V., Inglis T.J.J., Chang
B.J. 2011. Aeromonas aquariorum is widely distributed in
clinical and environmental specimens and can be misidentied
as Aeromonas hydrophila. J. Clin. Microbiol. 49: 3006–3008.
Beaz-Hidalgo R., Martínez-Murcia A., Figueras M.J. 2013.
Reclassication of Aeromonas hydrophila subsp. dhakensis
Huys et al. 2002 and Aeromonas aquariorum Martínez-
Murcia et al. 2008 as Aeromonas dhakensis sp. nov. comb nov.
and emendation of the species Aeromonas hydrophila. Syst.
Appl. Microbiol. 36: 171–176.
Benhamed S., Guardiola F.A., Mars M., Esteban M.A. 2014.
Pathogen bacteria adhesion to skin mucus of shes. Vet.
Microbiol. 171: 1–12.
Bhatnagar A., Dhillon O. 2019. Characterization, screening, and
application of bacteria with probiotic properties isolated from
the gut of Labeo calbasu (Hamilton). Fisher. Aquat. Life 27:
178–189.
Gill mucus-associated antagonistic bacteria in swamp eel
16
Bhatnagar A., Rathi P. 2023. Isolation and characterization of
autochthonous probiotics from skin mucus and their in
vivo validation with dietary probiotic bacteria on growth
performance and immunity of Labeo calbasu (Hamilton
1822). Fish Physiol. Biochem. 49: 191–208.
Bianciotto V., Lumini E., Bonfante P., Vandamme P. 2003.
‘Candidatus Glomeribacter gigasporarum’ gen. nov., sp. nov.,
an endosymbiont of arbuscular mycorrhizal fungi. Int. J. Syst.
Evol. Microbiol. 53: 121–124.
Bragadeeswaran S., angaraj S. 2011. Hemolytic and antibacterial
studies on skin mucus of eel sh, Anguilla anguilla Linnaeus,
1758. Asian J. Biol. Sci. 4: 272–276.
Breakwell D., Woolverton C., Maconald B., Smith K., Robinson
R. 2007. Colony morphology protocol. American Society for
Microbiology, 7 p.
Bunnoy A., Na-Nakorn U., Kayansamruaj P., Srisapoome P. 2019.
Acinetobacter strain KUO11TH, a unique organism related
to Acinetobacter pittii and isolated from the skin mucus of
healthy bighead catsh and its ecacy against several sh
pathogens. Microorganisms 7: 549.
Burr S.E., Gobeli S., Kuhnert P., Goldschmidt-Clermont E., Frey
J. 2010. Pseudomonas chlororaphis subsp. piscium subsp. nov.,
isolated from freshwater sh. Int. J. Syst. Evol. Microbiol. 60:
2753–2757.
Caipang C.M.A., Brinchmann M.F., Kiron V. 2010. Antagonistic
activity of bacterial isolates from intestinal microbiota of
Atlantic cod, Gadus morhua, and an investigation of their
immunomodulatory capabilities. Aquacult. Res. 41: 249–256.
Caipang C.M.A., Deocampo J.E.Jr., Pakingking R.V.Jr., Fenol J.T.,
Onayan F.B. 2022. Rapid screening of potential probionts from
the gut microbiota of climbing perch, Anabas testudineus. J.
Biodivers. Ecol. Sci. 21: 82–88.
Caipang C.M.A., Deocampo J.E. Jr., Pakingking R.V. Jr.,
Suharman I., Fenol J.T., Onayan F.B. 2021. Utilization of
sodium bicarbonate as anesthetic during routine husbandry
activities in ornamental sh. IOP Conf. Ser. Earth Environ. Sci.
934: 012001.
Caipang C.M.A., Trebol K.M.P., Suharman I., Pakingking R.V. Jr.,
Deocampo J.E.Jr. 2023. Isolation of potential probionts from
brackishwater enriched with high levels of carbon source. J.
Microbiol. Biotechnol. Food Sci. 13: e9819.
Carda-Dieguez M., Ghai R., Rodriguez-Valera F., Amaro C. 2017.
Wild eel microbiome reveals that skin mucus of sh could
be a natural niche for aquatic mucosal pathogen evolution.
Microbiome 5: 162.
Chabrillon M., Arijo S., Diaz-Rosales P., Balebona M.C., Moriñigo
M.A. 2006. Interference of Listonella anguillarum with
potential probiotic microorganisms isolated from farmed
gilthead seabream (Sparus aurata, L.). Aquaculture 37: 78–86.
Chen P.-L., Lamy B., Ko W.-C. 2016. Aeromonas dhakensis, an
increasingly recognized human pathogen. Front. Microbiol.
7: 793.
Chen X., Fang S., Wei L., Zhong Q. 2019. Systematic evaluation of
the gut microbiome of swamp eel (Monopterus albus) by 16S
rRNA gene sequencing. PeerJ 7: e8176.
Chen X., Lai C., Wang Y., Wei L., Zhong Q. 2018. Disinfection
eect of povidone-iodine in aquaculture water of swamp eel
(Monopterus albus). PeerJ 6: e5523.
Clinton M., Wyness A.J., Martin S.A.M., Brierley A., Ferrier
D.E.K. 2021. Sampling the sh gill microbiome: a comparison
of tissue biopsies and swabs. BMC Microbiology 21: 313.
Damsgaard C., Findorf J., Helbo S., Kocagoz Y., Buchanan R.,
Huong D.T.T., Weber R.E., Fago A., Bayley M., Wang T. 2014.
High blood oxygen anity in the air-breathing swamp eel
Monopterus albus. Comp. Biochem. Physiol. 178: 102–108.
Das A., Nakhro K., Chowdhury S., Kamilya D. 2013. Eects of
potential probiotic Bacillus amyloliquifaciens FPTB16 on
systemic and cutaneous mucosal immune responses and
disease resistance of catla (Catla catla). Fish Shellsh Immunol.
35: 1547–1553.
Dash S., Das S.K., Samal J., atoi H.N. 2018. Epidermal mucus, a
major determinant in sh health: a review. Iranian J. Vet. Res.
19: 72–81.
Dela Cruz T.E.E., Torres J.M.O. 2012. Gelatin hydrolysis test
protocol. American Society for Microbiology. 10 p.
de la Peña L.D., Lavilla-Pitogo C., Paner M.G. 2001. Luminescent
vibrios associated with mortality in pond-cultured shrimp
Penaeus monodon in the Philippines: species composition.
Fish Pathol. 36:133–138.
Doroteo A.M., Pedroso F.L., Lopez J.D.M., Apines-Amar M.J.S.
2018. Evaluation of potential probiotics isolated from saline
tilapia in shrimp aquaculture. Aquacult. Int. 26: 1095–1107.
El-Saadony M.T., Alagawany M., Patra A.K., Kar I., Tiwari R.,
Dawood M.A.O., Dhama K., Abdel-Latif H.M.R. 2021. e
functionality of probiotics in aquaculture: an overview. Fish
Shellsh Immunol. 117: 36–52.
Esteban M.A. 2012. An overview of the immunological defenses
in sh skin. ISRN Immunol. 2012: 853470.
Esteve C., Alcaide E., Blasco M.D. 2012. Aeromonas hydrophila
subsp. dhakensis isolated from feces, water and sh in
Mediterranean Spain. Microbes Environ. 27: 367–373.
Fang Y., Wu L., Chen G., Feng G. 2016. Complete genome
sequence of Pseudomonas azotoformans S4, a potential
biocontrol bacterium. J. Biotechnol. 227: 25–26.
Feng J., Lin P., Guo S., Jia Y., Wang Y., Zadlock F., Zhang Z. 2017.
Identication and characterization of novel conserved 46 kD
maltoporin of Aeromonas hydrophila as a versatile vaccine
candidate in European eel (Anguilla anguilla). Fish Shellsh
Immunol. 64: 93–103.
Fernández-Bravo A., Figueras M.J. 2020. An update on the genus
Aeromonas: taxonomy, epidemiology, and pathogenicity.
Microorganisms 8: 129.
Gan L., Xu W.-H., Xiong Y., Lv Z., Zheng J., Zhang Y. Lin J., Liu J.,
Chen S., Chen M., Guo Q., Wu J., Chen J., Su Z., Sun J., He Y.,
Liu C., Wang W., Verstraete W., Sorgeloos P., Defoirdt T., Qin
Q., Liu Y. 2021. Probiotics: their action against pathogens can
be turned around. Sci. Rep. 11: 13247.
Gomez D., Sunyer J.O., Salinas I. 2013. e mucosal immune
system of sh: the evolution of tolerating commensals while
ghting pathogens. Fish Shellsh Immunol. 35: 1729–1739.
Hedmon O., Jacqueline A., Ko K.T., Drago K.C., Engeu O.P.
2018. Fish mucus: a neglected reservoir for antimicrobial
peptides. Asian J. Pharm. Res. 6: 6–11.
Heikkinen J., Tiirola M., Mustonen S.M., Eskelinen P., Navia-
Paldanius D., Von Wright A. 2014. Suppression of Saprolegnia
infection in rainbow trout (Oncorhynchus mykiss) eggs using
protective bacteria and ultraviolet irradiation of the hatchery
water. Aquacult. Res. 47: 925–939.
Hilles A.R., Mahmood S., Kaderi M.A., Hashim R., Jalal T.K., Salleh
M.A. 2018. In-vitro evaluation of the antifungal activities of
eel skin mucus from Asian swamp eel (Monopterus albus).
Fungal Territ. 2: 1–2.
Hilles A.R., Mahmood S., Waly M.I., Kaderi M.A., Ahmed
Q.U., Azmi S.N.H., A;Asmari A.F., Ali N., Alharbi M., Rauf
F.H.S.V. Leonora, C.M.A. Caipang
17
M.A. 2022. e therapeutic potential of skin mucus from
Asian swamp eel (Monopterus albus): In vivo evaluation and
histological evidence. J. King Saud Univ. Sci. 34: 102011.
Hoe M. 2021. e use of Pseudomonas spp. as bacterial biocontrol
agents to control plant disease. In: Kohl J., Ravensberg W.
(Eds.) Microbial Bioprotectants for Plant Disease Management.
Burleigh Dodds Science Publishing, London. 400 p.
Ikram M.N.N.M., Ridzwan B.H. 2013. A preliminary screening
of antifungal activities from skin mucus extract of Malaysian
local swamp eel (Monopterus albus). Int. Res. J. Pharm. 3: 1–8.
Ivanova L., Rangel-Huerta O.D., Tartor H., Gjessing M.C., Dahle
M.K., Uhlig S. 2022. Fish skin and gill mucus: a source of
metabolites for non-invasive health monitoring and research.
Metabolites 12: 28.
Kearns P.J., Bowen J.L., Tlusty M.F. 2017. e skin microbiome of
cow-nose rays (Rhinoptera bonasus) in an aquarium touch-
tank exhibit. Zoo Biol. 36: 226–230.
Kesarcodi-Watson A., Kaspar H., Lategan M.J., Gibson L.
2007. Probiotics in aquaculture: the need, principles and
mechanisms of action and screening processes. Aquaculture
274: 1–14.
Khushboo, Karnwal A., Malik T. 2023. Characterization and
selection of probiotic lactic acid bacteria from dierent
dietary sources for development of functional foods. Front.
Microbiol. 14: 1170725.
Lal A., Cheeptham N. 2012. Starch agar protocol. American
Society for Microbiology. 11 p.
Larsen A., Tao Z., Bullard S.A., Arias C.R. 2013. Diversity of the
skin microbiota of shes: evidence for host species specicity.
FEMS Microbiol. Ecol. 85: 483–494.
Lauritsen J.G., Hansen M.L., Bech P.K., Jeisbak L., Gram L., Strube
M.L. 2021. Identication and dierentiation of Pseudomonas
species in eld samples using an rpoD amplicon sequencing
methodology. mSystems 6: e00704-21.
Lazado C.C., Caipang C.M.A., Brinchmann M.F., Kiron V. 2011. In
vitro adherence of two candidate probiotics from Atlantic cod
and their interference with the adhesion of two pathogenic
bacteria. Vet. Microbiol. 148: 252–259.
Lazado C.C., Caipang C.M.A. 2014. Mucosal immunity and
probiotics in sh. Fish Shellsh Immunol. 39: 78– 89.
Leonard A.B., Carlson J.M., Bisho D.E., Sandelbach S.I., Yung
S.B., Ramzanali S. 2014. e skin microbiome of Gambusia
anis is dened and selective. Adv. Microbiol. 4: 335–343.
Letunic I., Bork P. 2021. Interactive Tree of Life (iTOL) v5: an
online tool for phylogenetic tree display and annotation.
Nucleic Acids Res. 49: 293–296.
Liu W., Fan Y., Li Z., Zhao J., Zhou Y., Jiang N., Zeng J., Cain
K., Zeng L. 2019. Isolation, identication, and classication
of novel rhabdovirus from diseased Chinese rice-eld eels
(Monopterus albus). Arch. Virol. 164: 105–116.
Liu Q., Zhang Y., Yu N., Bi Z., Zhu A., Zhan X., Wu W., Yu P., Chen
D., Cheng S., Cao L. 2015. Genome sequence of Pseudomonas
parafulva CRS01-1, an antagonistic bacterium isolated from
rice eld. J. Biotechnol. 206: 89–90.
Lorgen-Ritchie M., Clarkson M., Chalmers L., Taylor J.F., Migaud
H., Martin S.A.M. 2022. Temporal changes in skin and gill
microbiomes of Atlantic salmon in a recirculating aquaculture
system - why do they matter? Aquaculture 558: 738352.
Lowrey L., Woodhams D.C., Tacchi L., Salinas I. 2015.
Topographical mapping of the rainbow trout (Oncorhynchus
mykiss) microbiome reveals a diverse bacterial community
with antifungal properties in the skin. Appl. Environ.
Microbiol. 81: 6915–6925.
MacWilliams M.P. 2009a. Indole test protocol. American Society
for Microbiology. 9 p.
MacWilliams M.P. 2009b. Citrate test protocol. American Society
for Microbiology. 7p .
Mancuso M., Rappazzo A.C., Genovese M., El Hady M., Ghonimy
A., Ismail M., Reda R., Cappello S., Genovese L., Maricchiolo
G. 2015. In vitro selection of bacteria and isolation of
probionts from farmed Sparus aurata with potential for use as
probiotics. Int. J. Animal Biol. 1: 93–98.
Martinez-Murcia A.J., Saavedra M.J., Mota V.R., Maier T.,
Stackebrandt E., Cousin S. 2008. Aeromonas aquariorum sp.
nov., isolated from aquaria of ornamental sh. Int. J. Syst. Evol.
Microbiol. 58:1169–1175.
McDevitt S. 2009. Methyl red and Voges-Proskauer test protocols.
American Society for Microbiology. 9 p.
Nandi A., Banerjee G., Dan S.K., Ghosh P., Ghosh K., Ray A.K.
2017. Screening of autochthonous intestinal microbiota as
candidate probiotics isolated from four freshwater teleosts.
Curr. Sci. 113: 767–773.
Nayak S.K. 2010. Probiotics and immunity: a sh perspective. Fish
Shellsh Immunol. 29: 2–14.
Oni F.E., Esmaeel Q., Onyeka J.T., Adeleke R., Jacquard C., Clement
C., Gross H., Barka E.A., Hoe M. 2022. Pseudomonas
lipopeptide-mediated biocontrol: chemotaxonomy and
biological activity. Molecules 27: 372.
Perales I. 2003. Chapter 19 Culture media for Aeromonas spp. and
Plesiomonas shigelloides. In: Corry J.E.L., Curtis G.D.W., Baird
R.M. (eds) Handbook of Culture Media for Food Microbiology.
Elsevier, Amsterdam, pp. 317–344.
Petersen C., Round J.L. 2014. Dening dysbiosis and its inuence
on host immunity and disease. Cell. Microbiol. 16: 1024–1033.
Pethkar M.R., Lokhande M.V. 2017. Antifungal activity of skin
mucus of three cultivable sh species (Catla catla, Cirrhinus
mrigala and Anguilla anguilla). Int. J. Zool. Stud. 2: 1–3.
Rathinam R.B., Iburahim S.A., Ramanan S.S., Tripathi G. 2022. A
scientometric mapping of research on Aeromonas infection in
sh across the world (1998-2020). Aquacult. Int. 30: 341–363.
Reiner K. 2012. Carbohydrate fermentation protocol. American
Society for Microbiology. 10 p.
Reverter M., Sasal P., Tapissier-Bontemps N., Lecchini D., Suzuki
M. 2017. Characterisation of the gill mucosal bacterial
communities of four butterysh species: a reservoir of
bacterial diversity in coral reef ecosystems. FEMS Microbiol.
Ecol. 93: x051.
Ringoe E., Holzapfel W. 2000. Identication and characterization
of Carnobacteria associated with the gills of Atlantic salmon
(Salmo salar L.). Syst. Appl. Microbiol. 23: 523–527.
Rizzo C., Gugliandolo C., Giudice A.L. 2020. Exploring
Mediterranean and Arctic environments as a novel source of
bacteria producing antibacterial compounds to be applied in
aquaculture. Appl. Sci. 10: 4006.
Rodrigues N.P.A., Garcia E.F., De Souza E.L. 2021. Selection of
lactic acid bacteria with promising probiotic aptitudes from
fruit and ability to survive in dierent food matrices. Braz. J.
Microbiol. 52: 2257–2269.
Rosado D., Canada P., Silva S.M., Ribeiro N., Diniz P., Xavier R.
2023. Disruption of skin, gill, and gut mucosae microbiome
of gilthead seabream ngerlings aer bacterial infection and
antibiotic treatment. FEMS Microbes 4: 1–13.
Rosado D., Perez-Losada M., Severino R., Cable J., Xavier R.
2018. Characterization of the skin and gill microbiomes of the
Gill mucus-associated antagonistic bacteria in swamp eel
18
farmed seabass (Dicentrarchus labrax) and seabream (Sparus
aurata). Aquaculture 500: 57–64.
Sang M.K., Kim E.N., Han G.D., Kwack M.S., Jeun Y.C., Kim K.D.
2014. Priming-mediated systemic resistance in cucumber
induced by Pseudomonas azotoformans GC-B19 and
Paenibacillus elgii MM-B22 against Colletotrichum orbiculare.
Biol. Control 104: 834–842.
Shi Z., Ren D., Hu S., Hu X., Wu L., Lin H., Hu J., Zhang G., Guo
L. 2015. Whole genome sequence of Pseudomonas aeruginosa
F9676, an antagonistic bacterium isolated from rice seed. J.
Biotechnol. 211: 77–78.
Shields P., Cathcart L. 2011. Motility test medium protocol.
American Society for Microbiology. 10 p.
Simora R.M.C., Trafalgar R.F.M., Legario F.S. 2015.
Characterization of extracellular enzymes from culturable
autochthonous gut bacteria in rabbitsh (Siganus guttatus).
ELBA Bioux 7: 67–76.
Smith A.C., Hussey M.A. 2005. Gram stain protocols. American
Society for Microbiology. 9 p.
Speare L., Septer A.N. 2019. Coincubation assay for quantifying
competitive interactions between Vibrio scheri isolates. J.
Visual. Exp. 149: e59759.
Stevens J.L., Jackson R.L., Olson J.B. 2016. Bacteria associated with
lionsh (Pterois volitans/miles complex) exhibit antibacterial
activity against known sh pathogens. Mar. Ecol. Prog. Ser.
558: 167–180.
Tamura K., Stecher G., Kumar S. 2021. MEGA 11: Molecular
Evolutionary Genetics Analysis Version 11. Mol. Bio. Evol. 38:
3022–3027.
Teneva D.G., Goranov B.G., Denkova R.S., Denkova Z.R., Kostov
G.A. 2016. Antimicrobial activity of Lactobacillus plantarum
strains against Escherichia coli strains. Sci. Works Univ. Food
Technol. 63: 199–206.
Teunis P., Figueras M.J. 2016. Reassessment of the
enteropathogenicity of mesophilic Aeromonas species. Front.
Microbiol. 7: 1–12.
elma J., Asha Devi N.K. 2016. Evaluation of probiotics from
mucus associated epibiotic bacteria on marine shes. J. Mar.
Biol. Oceanogr. 5: 2.
Tiralongo F., Messina G., Lombardo B.M., Longhitano L., Volti
G.L., Tibullo D. 2020. Skin mucus of marine sh as a source
for the development of antimicrobial agents. Front. Mar. Sci.
7: 1–7.
Trinopoulus J., Nguyen L.T., Von Haeseler A., Minh B.Q. 2016.
W-IQ-TREE: a fast online phylogenetic tool for maximum
likelihood analysis. Nucleic Acids Res. 44: W232–W235.
Wul E.G., Sorensen J.L., Lubeck M., Nielsen K.F., rane U.,
Torp J. 2010. Fusarium spp. associated with rice Bakanae:
ecology, genetic diversity, pathogenicity and toxigenicity.
Environ. Microbiol. 12: 649–657.
Xia L., Han P., Cheng X., Li Y., Zheng C., Yuan H., Zhang W., Xu
Q. 2019. Aeromonas veronii caused disease and pathological
changes in Asian swamp eel Monopterus albus. Aquacult. Res.
50: 2978–2985.
Xu W., Lv Z., Guo Q., Deng Z., Yang C., Cao Z., Li Y., Huang C.,
Wu Z., Chen S., He Y., Sun J., Liu Y., Gan L. 2023. Selective
antagonism of Lactiplantibacillus plantarum and Pediococcus
acidilactici against Vib rio and Aeromonas in the bacterial
community of Artemia nauplii. Microbiol. Spectrum 11:
e00533-23.
Yi S.-W., You M.-J., Cho H.-S., Lee C.-S., Kwon J.-K., Shin G.-
W. 2013. Molecular characterization of Aeromonas species
isolated from farmed eels (Anguilla japonica). Vet. Microbiol.
164: 195–200.
Yu Y.-Y., Ding L.-G., Huang Z.-Y., Xu H.-Y., Xu Z. 2021.
Commensal bacteria-immunity crosstalk shapes mucosal
homeostasis in teleost sh. Rev. Aquacult. 13: 2322–2343.
Zheng W., Wang X., Chen Y., Dong Y., Zhou D., Liu R., Zhou H.,
Bian X., Wang H., Tu Q., Ravichaandarn V., Zhang Y., Li A.,
Fu J., Yin J. 2021. Recombineering facilitates the discovery
of natural product biosynthetic pathways in Pseudomonas
parafulva. Biotechnol. J. 16: 2000575.
Received 4 February 2025; received in revised form 2 March 2025; accepted 3 March 2025
F.H.S.V. Leonora, C.M.A. Caipang
