A review of literature and a reevaluation of Diplocardia verrucosa Ude 1895 resulted in the discovery of a new species in southern New Mexico and west Texas, USA

Abstract

A new earthworm species, Diplocardia farrishi sp. nov., was collected from multiple sites within the Chihuahuan Desert of southern New Mexico and West Texas, USA. This new species was only recently recognized as such after a review of the literature on Diplocardia verrucosa Ude, 1895. Corrections in the literature of D. verrucosa, with additional morphological detail are offered with a detailed description of the species. The description of D. farrishi sp. nov. is compared with D. verrucosa based on the male pore, intestinal origin, genital tumescences, and habitat. Diplocardia farrishi differs from similar species with a posteriorly displaced male field in having an intestinal origin in xviii, male field in xix–xxi, and lacking genital tumescences or markings. A key to Diplocardia species with posteriorly displaced male field is included.

Full text

ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Accepted by D. Marchán: 28 Nov. 2024; published: 19 Feb. 2025 363
Zootaxa 5589 (1): 363–381
https://www.mapress.com/zt/
Copyright © 2025 Magnolia Press Article
https://doi.org/10.11646/zootaxa.5589.1.28
http://zoobank.org/urn:lsid:zoobank.org:pub:15894C40-BF8C-44B6-A883-858B880A5D39
Licensed under Creative Commons Attribution-N.C. 4.0 International https://creativecommons.org/licenses/by-nc/4.0/
A review of literature and a reevaluation of Diplocardia verrucosa Ude, 1895
resulted in the discovery of a new species in southern New Mexico and west
Texas, USA
GEORGE A. DAMOFF1,* & ROBERTO CARRERA-MARTÍNEZ2
1Division of Environmental Science, Arthur Temple College of Forestry and Agriculture, Stephen F. Austin State University, 419 East
College Street, Box 6109, Nacogdoches, TX, USA 75962-6109
�
gdamoff@gmail.com; https://orcid.org/0000-0001-8770-2870
2Department of Integrative Biology, University of Wisconsin–Madison, Madison, WI, USA 53706
�
rcarrmart@gmail.com; https://orcid.org/0000-0002-4945-1887
*Corresponding author
Abstract
A new earthworm species, Diplocardia farrishi sp. nov., was collected from multiple sites within the Chihuahuan Desert
of southern New Mexico and West Texas, USA. This new species was only recently recognized as such after a review
of the literature on Diplocardia verrucosa Ude, 1895. Corrections in the literature of D. verrucosa, with additional
morphological detail are offered with a detailed description of the species. The description of D. farrishi sp. nov. is
compared with D. verrucosa based on the male pore, intestinal origin, genital tumescences, and habitat. Diplocardia
farrishi differs from similar species with a posteriorly displaced male field in having an intestinal origin in xviii, male
field in xix–xxi, and lacking genital tumescences or markings. A key to Diplocardia species with posteriorly displaced
male field is included.
Key words: Diplocardia farrishi, Acanthodrilidae, earthworm, biogeography, Chihuahuan Desert
Resumen
Se colectó una nueva especie, Diplocardia farrishi sp. nov., en varios lugares adyacentes al desierto de Chihuahua al
sur de Nuevo México y el oeste de Texas, Estados Unidos. Esta especie fue identificada únicamente después de una
revisión literaria de Diplocardia verrucosa Ude, 1895. Redescribimos D. verrucosa, expandimos en datos morfológicos
adicionales e incluimos una descripción detallada de la especie. Se compara D. farrishi sp. nov. con D. verrucosa basados
en los poros masculinos, origen del intestino, marcas genitales y hábitats. Diplocardia farrishi se distingue de las demás
especies con el campo masculino posteriormente desplazado en su origen del intestino en xviii, campo masculino en
xix–xxi y al no presentar marcas genitales. Se incluye una clave para las especies de Diplocardia con campo masculino
posteriormente desplazado.
Palabras clave: Diplocardia farrishi, Acanthodrilidae, lombriz de tierra, biogeografía, Desierto de Chihuahua
Introduction
The earthworm genus Diplocardia is indigenous to North America. Most described species are confined to the
eastern half of the US below the Wisconsin glaciation boundary, increasing in number of species from north to
south (James 1995), including high numbers of species in east Texas and Oklahoma (Damoff & Reynolds 2009,
2019; Reynolds & Damoff 2010). There are fewer reports of diplocardian species in west Texas, New Mexico,
Arizona, and southern California, but this could simply be the result of few researchers investigating sites suitable to
diplocardians under favorable weather conditions and appropriate time of year. There are over 50 described species
of Diplocardia (Misirlioğlu et al. 2023), with less than a handful reported from Mexico. There remains large regions

DAMOFF & CARRERA-MARTÍNEZ
364 · Zootaxa 5589 (1) © 2025 Magnolia Press
of the USA and Mexico sparsely surveyed for earthworms and, when rectified, will doubtless extend the range of
many described Diplocardia as well as uncover additional new species for the genus.
In 2005 the first author collected numerous diplocardian specimens from multiple sites in the northeast region
of the Chihuahuan Desert, including a first-time examination of Diplocardia verrucosa Ude, 1895, or so he thought.
The collection of D. verrucosa from this region of the USA seemed confirmed by a description of the species by
Gates (1967) from a collection made in SW New Mexico by D.E. Beck in 1966. These D. verrucosa specimens
along with three other diplocardian species were reported in Reynolds & Damoff (2009).
Every county of Tennessee (TN) was surveyed for earthworms in the late 1960s through the early 1970s that
resulted in a collection of over 4400 diplocardian specimens presently curated by the Canadian Museum of Nature
(CMN). Over a span of nearly ten years through loans to the first author a total of 25 diplocardian species were
reported for the state, 19 for the first time (Damoff & Reynolds 2019), with another reported as a new species
(Damoff & Reynolds 2017). Also, in Damoff & Reynolds (2019) several specimens from western Tennessee
were provisionally identified as Diplocardia sp. nov. TN01 and are revisited in this paper. Additional records of
diplocardian specimens identified by other researchers were reported in Damoff & Reynolds (2019) including one
clitellate specimen identified as D. verrucosa from a site in the southern corner of Tennessee, bordering North
Carolina.
Concurrent with the years of intermittent microscopic examinations of the CMN TN specimens by the first
author, field collections for other research projects were made in Oklahoma (OK) and Texas (TX). These earthworms
aligned with the CMN Diplocardia sp. nov. TN01 specimens collected from western-most counties of TN, all
thought to be the same new species to science. The TN collections are separated by nearly 40 years from the OK
and TX collections. Over a decade prior to the examinations of the CMN specimens and the more recent collections
in TX and OK described above, the diplocardian specimens that were collected by the first author in 2005 in SE
NM and W TX were still thought to be D. verrucosa based on the key by James (1990). However, once a detailed
description was begun for the OK, TN, and TX specimens, a review of the primary source material describing
D. verrucosa was made for the first time, and only then was it realized that the OK, TN, and TX specimens were
D. verrucosa and that the 2005 NM specimens were a possible new species to science. Why the confusion and
misidentification?
Literature review
Confusion on the morphological identity of Diplocardia verrucosa Ude, 1895 can be traced to the earliest
publications of the species when Eisen (1899, 1900) questions Ude’s location of the spermathecal pores in ix and x.
All subsequent publications that detail the morphology of D. verrucosa describe the spermathecal pores in viii and
ix. However, in the latter half of the 20th century morphological questions for D. verrucosa arose associated with
three characters: genital tumescences, segment location of the male pores, and segment origination of the intestine.
Relevant descriptions and comments from the authors will be included to highlight why this correction is necessary
for D. verrucosa, which in turn has resulted in the identification of D. farrishi sp. nov. from specimens collected in
southern New Mexico and west Texas, USA.
Ude (1895) published the original description of Diplocardia verrucosa in German, based on three specimens
curated at the Museum of Nature Hamburg. These specimens were sent to him from Omaha, Nebraska while living
in Switzerland. The male (seminal) grooves are simply described as xix─xxi; the male pore is not referenced
specifically. The strongly expanded midgut (“stark erweiterte Mitteldarm”) or intestine origin begins in xvi. Ude
describes the presence of genital tumescences as follows, paired in xix and xxi, before and after the seminal furrows
(respectively) and three tumescences in xxii, middle tumescence larger than the two on the sides, which are aligned
to the seminal furrows.
Four years later Eisen (1899) describes D. verrucosa with two deep grooves from ½ xix─½ xxi, prostate pores
on xix and xxi, and the male (spermiducal) pores on xx, with intestinal origin in xvi. Numerous ventral papillae
(genital tumescences)—solitary and in pairs—are reported, all postclitellar segments. A year later Eisen (1900)
included a similar description of D. verrucosa based on his 1899 paper.
Descriptions of D. verrucosa remained relatively simple for the first five decades of the 20th century with
numerous researchers variously reporting on the three delineating characters. Smith (1915, 1928) reported

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 365
specimens collected in 1895 were in abundance in Illinois bottomland forests with male pores in xx, prostate pores
in xix, xxi (implying a male groove xix─xxi); there is no mention of genital tumescences or intestinal origin. Gates
(1977) makes the single observation that the male pores of D. verrucosa are “on segment twenty” in his survey of
earthworms of North America and observes there is “…remarkable variation in the position of the male pores…” for
the genus Diplocardia. Stephenson (1930) does not list D. verrucosa among the six species of diplocardians in his
encyclopedic work, The Oligochaeta. Olson (1933) published the first record of D. verrucosa in Ohio with “Prostate
pores on 19, 21. Spermiducal pores in somites [sic] 20….” based on a single specimen collected on the shore of a
lake. There is no mention of genital tumescences or intestinal origin. Harman (1960) states that the male pores of
D. verrucosa are in xix with no mention of genital tumescences or intestine origin and notes that the species seems
confined to north central USA.
Murchie (1962) provides a thorough review D. verrucosa and includes Michaelsen’s (1900) correction of Ude’s
interpretation of the openings of the spermathecal pores occurring on segments viii and ix rather than ix and x.
Murchie examined many specimens curated at the US National Museum, corresponded with a museum in Germany
where type material is housed, as well as specimens he collected from numerous sites in Oklahoma associated with
heavy alluvial soils associated with large streams. From his observations he concludes there are two subspecies—
with no intergrades—Diplocardia verrucosa verrucosa Ude, 1895 and D. verrucosa recta Murchie, 1962. This
description is based on differences in clitellar margins, position variation in spermathecal pores in viii and ix, and
location of glandular tumescences. Both subspecies have male pores on xx and an intestine that expands abruptly in
xvi, which for the former, Murchie notes is unique for Diplocardia.
At this point in the timeline of descriptions for D. verrucosa something unusual occurs. Gates (1967) reviews
one specimen from Wisconsin and ten from the southwest corner of New Mexico where all have male pores in
xx. However, only the Wisconsin specimen has “abundant” genital tumescences, consistent with the Murchie
(1962) description, but the New Mexico specimens are devoid of this character. Regarding the intestinal origin,
Gates wrestles, “Intestinal origin, doubtfully in xvi (Wisconsin and 2, New Mexico), in xviii (8, New Mexico).
Such variation seemed unusual.” Ten years later Gates (1977) again reviews D. verrucosa (along with three dozen
other diplocardian species) examining 14 specimens (ten adults) from Missouri, Texas, Tennessee, and Illinois. He
continues to mull the apparent variableness of the intestinal origin for D. verrucosa even noting that McKey-Fender
(in lit) was “not clear” on this character after examining specimens from three aforementioned states as well as
Maryland. However, at the end of this paper Gates introduces a key for the genus where he apparently had settled
in his mind that the location of the intestinal origin for D. verrucosa is xviii. Also, though without explicit mention
of Murchie’s 1962 publication that designates two subspecies for D. verrucosa, Gates seemingly dismisses these by
observing, “Genital markings and/or tumescences, with regard to presence or absence, number, regional position,
intrasegmental location or across intersegmental furrows, show greater variation than has yet been recorded in other
diplocardias [sic].” Other than the citation of Murchie (1962), Gates (1967) makes no mention of subspecies for D.
verrucosa.
James (1983,1988, 1989, 1991) includes D. verrucosa in a series of field studies on the response of native and
nonnative earthworm species to fire in tallgrass prairie soils of Kansas. The scope of the projects does not require
morphological descriptions of the species. In James (1990) an updated key for the genus Diplocardia designates the
intestinal origin in xviii for D. verrucosa and makes no mention of the two subspecies delineated by Murchie. Since
the D. verrucosa specimens in these studies were collected in prairie soils not associated with lotic systems and, if
the male groove was in xix–xxi, then it may be possible that these specimens are D. farrishi sp. nov., or perhaps D.
patuxentis Csuzdi & Szlávecz, 2002.
Csuzdi & Szlávecz (2002) note the similarities of D. patuxentis to D. verrucosa with male pores in xx and an
intestinal origin at xviii/xix, though differing from it with an annular clitellum, the shape and position of genital
markings, and the presence of copulatory setae. In addition, they observe that D. patuxentis might be identical to
Diplocardia sp. V. partially described by Gates (1977). This specimen was not conclusively described by Gates due
to its poorly preserved condition, yet he lists it in association with D. verrucosa because it has male pores in xx.
Gates suspects it is a different species because the last hearts are in xiii, not because the intestinal origin is in xviii.
For 17 years no further significant reports of D. verrucosa appear in publications until Damoff & Reynolds (2019)
catalog a large collection of diplocardians from Tennessee, that includes one clitellate specimen of Diplocardia
verrucosa collected in 1963 (but not previously published) from a site in the southern corner of Tennessee that
borders North Carolina. No other D. verrucosa specimens were reported for the entire state at that time.

DAMOFF & CARRERA-MARTÍNEZ
366 · Zootaxa 5589 (1) © 2025 Magnolia Press
Methods
Collection site locations (Figure 1) and descriptions for the D. verrucosa and D. farrishi sp. nov. specimens are
presented in Tables 1 and 2. Coordinates for the Tennessee sites are approximated using Google Earth® based
on 1971 field collection notes of cities/towns, highways, and other landmarks. For New Mexico, Oklahoma, and
Texas, a Magellan GPS Mapping Receiver was used to record coordinates. For the NM, OK, and TX collections,
earthworms were collected by digging with a shovel and handsorting. Specimens were placed in soil bags along
with some of the soil from which they were collected and stored in a cool place out of direct sunlight. No attempts
were made to quantify earthworms per area or volume of soil. Within 24 h the earthworms were processed in a
manner that is conducive for identification of the species under a microscope: specimens were rinsed in water,
relaxed in gradual increases of ethanol concentrations until no longer responsive to touch, fixed in 5% formalin for
48 hours, then triple rinsed and stored in 70% ethanol. DNA samples were taken from several of the OK and TX
specimens. The TN specimens were collected, fixed, and preserved by John Reynolds in 1971 and curated at the
Canadian Museum of Nature (Damoff & Reynolds 2019). The NM specimens collected by Beck (Gates 1967) have
no record of collection or preservation methods. Specimen colorations are described using the color notations in
Munsell® Soil Color Charts (Munsell Color 2000).
FIGURE 1. Map showing locations of specimen collection described in Tables 1 and 2. State abbreviations: AR, Arkansas; LA,
Louisiana; MO, Missouri; MS, Mississippi; NM, New Mexico; OK, Oklahoma; TN, Tennessee; and TX, Texas.

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 367
TABLE 1. Collecting sites of Diplocardia verrucosa Ude, 1895 specimens from three USA states (ST): Oklahoma (OK),
Tennessee (TN), and Texas (TX); from eight counties (Cty); site time stamp; date of collection (YYYYMMDD), latitude
and longitude, nearest lotic system (LO) (stream, creek, river); distance to nearest LO; soil texture and color; and site
characteristics.
ST Cty* Site Date Lat/Lon Stream‡ Distance Soil
characteristics
Topographic features & notes
OK CM 1015 20170520 34˚31’26”N
98˚37’57”W
PO 30 m clay loam, dusky
red
N of creek; roadway shoulder
in wood chips and grasses
GT 1510 20170406 36˚43’22”N
97˚48’02”W
PD < 1 m silty clay loam,
dusky red
E of creek;
saturated soils of stream bank
GT 1330 20170502 36˚43’22”N
97˚48’02”W
PD < 1 m silty clay loam,
dark reddish
brown
E of creek;
saturated soils of stream bank
JK 1230 20181020 34˚39’03”N
99˚33’40”W
TU 6 m silty clay loam,
dark reddish
brown
N of creek; steep slope under
canopy of ash trees
WT 0730 20170524 36˚43’35”N
95˚58’15”W
CA 0.5 km silty clay,
very dark gray
SW of river; closed canopy
of hardwoods in flood
plain, coarse woody debris,
herbaceous plants
TN DY 08 19711130 36˚09’40”N
89˚34’44”W
MS 0.7 km silty clay loam,
brown
WSW of river; under log
DY 14 19711130 36˚03’30”N
89˚38’09”W
MS 4 km silty clay loam,
brown
W of river; under logs
LK 03 19710323 36˚26’38”N
89˚29’39”W
MS 3 km silt loam, grayish
brown
WNW of river; ditch
LK 09 19711129 36˚22’01”N
89˚30’09”W
MS 150 m silty clay loam,
very dark gray
E of river; ditch
LK 12 19711130 36˚20’57”N
89˚28’07”W
MS 4 km silty clay loam,
very dark gray
W of river; under logs
LD 08 19711110 35˚44’52”N
89˚55’42”W
MS 5 m silt loam, grayish
brown
Shoreline of river;
Pink’s Boat Dock - picking
TX MC 1125 20151215 31˚28’04”N
99˚09’38”W
CO 3 m sandy clay loam,
dark brown
S of river;
ledge 5 m above water
MC 0740 20160321 31˚28’04”N
99˚09’38”W
CO 3 m silty clay, brown S of river;
ledge 5 m above water
MC 0950 20160321 31˚00’14”N
99˚16’07”W
SS 6 m clay loam, black S of river; open canopy of small
trees & coarse woody debris
* Counties (Cty): Comanche = CM; Grant = GT; Jackson = JK; Washington = WT; Dyer = DY; Lake = LK; Lauderdale
= LD; McCulloch = MC.
‡ Nearest stream: PO = Little Post Oak Creek; PD = Pond Creek; TU = Turkey Creek; CA = Caney River ; MS =
Mississippi River; CO = Colorado River; SS = San Saba River.

DAMOFF & CARRERA-MARTÍNEZ
368 · Zootaxa 5589 (1) © 2025 Magnolia Press
TABLE 2. Collection sites of Diplocardia farrishi sp. nov. specimens collected in two USA states (ST): New Mexico
(NM) and Texas (TX); from three counties (Cty): Eddy (ED), Otero (OT), and Culberson (CU); site time stamp; date of
collection (YYYYMMDD); latitude and longitude; nearest lotic system (LO) (stream, spring); distance to nearest LO;
soil texture and color; and site characteristics.
ST Cty* Site Date Lat/Lon LO‡ Distance Soil texture,
color
Site characteristics
NM ED 1000 20050317 32˚06’24”N
104˚27’25”W
BR ~30 m
above
loam,
very dark
gray
among willow grove & grasses; deep
A horizon; not hydric soil
ED 1400 20050317 32˚17’30”N
104˚20’40”W
un ~3 m
above
sandy loam,
dark reddish
brown
near cactus & juniper; 80% open
field, 20% herbs; washout into
arroyo meters above dry stream
channel
ED 1600 20050317 32˚12’08”N
104˚37’29”W
none - loam,
dark reddish
brown
under old juniper, deep ravine
parallel CR 410; 100% mineral soil;
not hydric soil
OT 1400 20050318 32˚05’29”N
104˚50’41”W
none - sandy loam,
dark reddish
brown
10% mineral, 90% herbs; 2 m above
dry wash filled with cobble
ED 1600 20050321 32˚06’37”N
104˚33’45”W
YD in draw loam,
dark reddish
brown
open canopy; 10% mineral, 90%
herbs, under hdwd litter; coppice of
sugarberry & other woody veg.
ED 1205 20050322 32˚16’46”N
104˚38’00”W
un ~3 m
above
loam,
dark reddish
brown
N facing rock ledge; grasses under
oaks, A horizon 15 cm, over cobble;
creek bed dry, few pools, 5 m wide
ED 1700 20050322 32˚14’40”N
104˚43’23”W
WOS 5 m
above
silt loam,
black
closed canopy; 100% leaf litter over
mineral soil
ED 1700 20050322 32˚14’40”N
104˚43’23”W
WOS 3 km silt loam,
black
in channel, rich OM, silt loam, leaf
particles somewhat discernable
ED 1700 20050322 32˚14’40”N
104˚43’23”W
WOS ~3 m
above
silt loam,
black
North end of ravine under big tooth
maple Acer grandidentatum Nutt.
ED 1030 20050323 32˚11’35”N
104˚44’55”W
none - silt loam,
dark reddish
brown
open canopy; 50% min., 50% herbs,
cedar & lg sprawling oak; grasses in
clumps; not hydric soil
TX CU 1300 20050321 31˚56’23”N
104˚42’45”W
un 0.5 m
above
sandy loam,
dark reddish
brown
0.5 m above stream channel; nearly
closed canopy of cedars; 60 % hdwd,
40% conifer leaf litter over mineral
* Counties (Cty): Eddy = ED; Otero = OT; Culberson = CU
‡ Nearest stream: BR = Black River; YD = Yucca Draw; WOS = White Oak Spring; un = unnamed arroyo/draw/creek/
stream.
Soil texture was determined using the texture-by-feel method (USDA-NRCS 2018). Soil and earthworm color
was determined using Munsell Soil Color Charts (2000). Soil pH was determined with a Lovibond® Soil pH Test
Kit. For the OK and TX soils from which D. verrucosa was collected, all parameters were determined in the lab
within 48 hours of the collecting event; for the soils of the TN counties, pH and soil texture were determined from
online soil series publications (USDA-NRCS 2024).
The last five or so segments from a few D. verrucosa specimens were extracted and preserved in ethanol 95% for
DNA extraction. In March 2022 we attempted to collect living D. farrishi specimens but were unsuccessful because
of low soil moisture. Consequently, we attempted to extract DNA from six specimens from the 2005 formalin fix
collections, following protocols in James et al. (2010). DNA was extracted using the QiagenTM DNeasy® Blood &

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 369
Tissue DNA extraction kit and DNA concentrations were quantified using the QuantiFlour® ONE dsDNA System
(Promega) and a QuantusTM Fluorometer (Promega), following manufacture instructions. Samples were then
amplified for the mitochondrial Cytochrome c Oxidase subunit I (COI) barcode gene using the primers LCO1490
[5` - GGT CAA CAA ATC ATA AAG ATA TTG G - 3`; Folmer et al. (1994)] and COI2198E [5′-TAW ACT TCW
GGG TGW CCR AAR AAT CA-3′, Ikeda et al. (2018)]. PCR protocols, cleanup, and sequencing followed those
described in Carrera-Martínez et al. (2021; 2025). Since all formalin-fixed tissues failed to amplify using this set of
primers, we designed six pairs of primers using Geneious Prime (https://www.geneious.com/) that would amplify
overlaying 130–240 bp of COI fragments within the products of LCO1490 and COI2198E primers described above.
Since no sequence of the species described below is available, we used a consensus sequences generated from the
D. verrucosa samples as the reference sequence. The primers sequences are available in Appendix 1.
Results
A total of 110 adult and subadult Diplocardia verrucosa Ude 1895 specimens were examined with 38 from OK, 55
from TN, and 17 from TX. Key characteristics consistently observed are a male groove in xix─xxi, a high number
of genital tumescences (GT) in pre-, intra- and post-clitellar segments, the intestinal origin in xvi, and relatively low
number of segments (Table 3).
TABLE 3. Comparison of specimen morphological characters for Diplocardia verrucosa Ude, 1895 (Dv) from Oklahoma
(OK), Tennessee (TN), and Texas (TX), USA and Diplocardia farrishi sp. nov. from New Mexico (NM) and TX, USA.
Length (L), diameter (D), and number of segments (S) stacked as mean, range, and number (n)*. Tongue type (T), genital
tumescence (GT), male groove (MG), intestinal origin (IO), and first dorsal pore (FDP).
ST/species L
(mm)
D
(mm)
S T GT‡MGφIOΔFDP
(range,
outliers)
D verrucosa
OK
87
71–123
n = 22
2.1
1.3–2.6
n = 29
129
91–146
n = 29
epilobous ix–xxiv
n = 22
1/4xix–
1/2xxi
xvi
taper absent
n = 29
5/6–15/16,
26/27
n = 36
D verrucosa
TN
107
70–142
n = 14
2.0
1.9–2.7
n = 14
117
80–149
n = 49
epilobous vii–xxii
n = 14
1/4xix–
1/2xxi
xvi
20 taper
n = 49
6/7–13/14
n = 51
D verrucosa
TX
91
65–130
n = 11
2.1
1.8–2.4
n = 11
124
94–143
n = 17
epilobous ix–xxii
n = 11
1/4xix–
1/2xxi
xvi
11 taper
n = 15
8/9–12/13,
19/20
n = 16
D farrishi
TX/NM
90
65–140
n = 32
2.6
2.0–3.7
n = 51
142
95–176
n = 35
epilobous (65)
tanylobous (1)
n = 66
none
n = 56
1/2xix–
1/2xxi
n = 56
xviii
1/2xviii (3)
n = 66
6/7–10/11
n = 18
*n = based on number of specimens that display character. Variance of n within a row is the result of exclusion of
specimens that were cut during collection, an amputee, or an unusable life stage.
‡ GT with various arrangements pre-, intra- and postclitellar; single, paired, tetrads, or asymmetrical within segments or
across intersegmental grooves.
φMG segmental extent for D. verrucosa varies within a range of 1/4–2/3 in xix to 1/3–1/2xxi.
Δ IO, unless otherwise noted, full diameter in entire segment. Taper = gradual expansion from esophagus to full diameter
within segment of origination.

DAMOFF & CARRERA-MARTÍNEZ
370 · Zootaxa 5589 (1) © 2025 Magnolia Press
A total of 66 adult and subadult Diplocardia farrishi sp. nov. specimens were examined by the authors from
collections made in 2005 in SE NM and W TX—59 from nine sites in Eddy County, NM; one from Otero County,
NM; and six from one site in Culberson County, TX (Table 2.) Key characteristics consistently observed are the
male groove in xix─xxi, absence of genital tumescences (GT), and the intestinal origin in xviii, and relatively high
number of segments (Table 3).
Additional collections concurrent with the above included three native species: Diplocardia eiseni (Michaelsen,
1895); Diplocardia smithii Macnab and McKey-Fender, 1955; and Diplocardia texensis (Smith, 1924) and three
nonnative species: Aporrectodea trapezoides (Dugès, 1828); Aporrectodea rosea (Savigny, 1826); and Microscolex
phosphoreus (Dugès, 1837). Notably, no nonnative earthworm species were collected in the remote White Oak
Spring site.
While a limited amount of genomic DNA seems to have been extracted from one specimen of formalin-fixed
D. farrishi (a concentration of 1.56 ng/μL), attempts to sequence COI (either as a single sequence or six overlaying
fragments) failed. COI sequences of two D. verrucosa specimens, one from McCulloch Co., Texas, and the second
from Grant Co., Oklahoma, are freely available on GenBank (accession numbers PP844713 and PP844714,
respectively).
Taxonomy
Family Acanthodrilidae Claus, 1880
Genus Diplocardia Garman, 1888
Type species: Diplocardia communis Garman, 1888.
Diplocardia verrucosa Ude, 1895
(Figure 2 A–C)
Material examined. Representative specimen: Clitellate, USNM 1742101, within the city limits of Bartlesville,
Washington County, Oklahoma, USA (36˚43’35”N, 95˚58’15”W). Collector George A. Damoff on 24 May 2017,
elevation 194 m, 0.5 km southwest of Caney River in a closed canopy of bottomland hardwoods in deep silty clay.
Additional specimens: 21 clitellates and and subadults also collected at numerous sites in Oklahoma and Texas,
USNM 1742102–1742105. Additionally, 55 specimens are curated at the Canadian Museum of Nature, although
recently reported as Diplocardia sp. nov. TN01 in Damoff and Reynolds (2019) for reasons explained above.
Diagnosis. Small-sized, quadrithecal earthworm, 123 mm length X 2.5 mm diameter (xxx). Segment count 141.
Epilobous tongue 1/2 width of segment, open, with minimal slight crisscrossed rugosities that contrast with smooth
surface of ii. Saddled-shaped clitellum with ventral margin slightly dorsad to b. Genital tumescences range from
spherical to irregular margins present in pre-, intra- and post-clitellar segments. Male groove narrow and shallow in
1/2xix─1/3xxi, nearly straight with secondary indentations associated with segmentation. Single dorsal blood vessel
throughout. Last hearts xii. Intestinal origin xvi. Calciferous lamellae absent. Acryptate spermathecae with oblong
diverticulum attached by a short stalk near base of ovoid ampulla.
Description
EXTERNAL.—Small-sized earthworm. For all three states (OK, TN, and TX), mean length of intact adult specimens
94 mm (range 64–142; n = 47); mean segment count of intact subadult and adult specimens 125 (range 71–149; n =
95); mean clitellate width 2.1 mm (range 1.3–2.7).
Body shape cylindrical throughout. Triannulation begins at vi and strongly evident in clitellar and postclitellar
segments, except last five. Other specimens from OK, TN, and TX most often display triannulation over majority
of length, a few specimens do not.

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 371
FIGURE 2. Diplocardia verrucosa: (A) ventral view, spermathecae from (B) viii, and (C) ix; Diplocardia farrishi sp. nov.: (D)
ventral view, spermathecae from (E) viii, and (F) ix. SP, spermathecae pores; F, female pores; P, prostatic pores; and M, male
pores.
No pigmentation. Body color of formalin-fixed, ethanol-stored specimens uniform throughout: pinkish white
(7.5YR 8/2) clitellum pink (7.5YR 7/4). TN specimens color dark reddish brown (2.5 YR 5/4) from 50 years of
storage in ethanol; distinctly different color from OK and TX specimens.
Epilobous tongue about 1/2 width of segment, open though some have crease at base that gives closed appearance.
Slight crisscrossed rugosities that contrast with smooth surface of ii.
First dorsal pore varied widely for populations within and between OK, TN, and TX with a range of 5/6–26/27.
Nephridiopores not obvious.
Saddle-shaped clitellum xiii─xviii. Specifically, dorsal extent variable where anteriorly all or a fraction of xiii
then most often extending posteriorly through all of xviii, though a few all or part of xix. Ventral extent slightly less
than anterior segments and margin varies from slightly lateral to b or to a. Setal pairs visible in all clitellar segments.
If first dorsal pore anterior to 13/14 then dorsal pores visible in clitellum.
Setae begin ii, closely paired below mL line. Ambulatory setae conspicuous, somewhat dark, observed in most
segments before periproct. Setal arrangement at x: aa:ab:bc:cd:dd = 5:1:2.7:1.3:16.3 and at xxx: 4.3:1:2.3:1:13.3.
Presence of copulatory setae variable, absent to present; if present, two in viii and two in ix. Penial setae also
variable regardless of lifestage, either absent or present. If present, internally observed in xix and xxi; infrequently

DAMOFF & CARRERA-MARTÍNEZ
372 · Zootaxa 5589 (1) © 2025 Magnolia Press
visible externally at one to all tips of male grooves. The penial setae of the TN specimens easily seen (red) in xix
and xxi, length 0.5 mm, width about 0.05 mm. Setae a and b less conspicuous in viii and ix than in vii and x. Setae
a and b missing in xix, xx, and xxi.
Spermathecal pores near anterior margin of viii, ix, all 0.1 mm in diameter, slightly raised (about 0.1 mm) on
conical papillae (about 0.2 mm diameter). Pores of viii 0.3 mm from anterior margin, 0.25 mm from setae, and <0.05
mm lateral to a; pores of ix 0.5 mm from anterior margin, 0.3 mm from setae and <0.05 mm lateral to a.
Ovipores in xiv, presetal, slightly mesad or in line with a, less than 0.1 mm diameter. Commonly observed
pinkish white papillae (“halo”) surrounding the single pair of ovipores, oval to slight dumbbell-shaped boundary
that extends slightly lateral to b─b. Strong brown color of papillae in TN specimens same as clitellum.
Male groove, in line with a, extends from 1/2xix–1/3xxi, nearly straight to slightly sigmoid with secondary
indentations associated with intersegmental grooves and secondary annulations. Shallow, narrow (greatest width
about 0.1 mm), and flush with surrounding adjacent ventral surface. Prostatic pores inconspicuous in tips of male
groove. Male pore xx, at anterior-most margin of 19/20 within male groove, occasionally conspicuous. Associated
with numerous genital tumescences (GT).
GT are frequently in ix to xxiv, in intersegmental furrows frequently in 12/13 to 16/17, 18/19; these segments
can have up to 7 GTs, some are occasionally unpaired mV. All are slightly raised above the external body wall.
Paired GT vary in width apart, from slightly merged within a─a, to widely separated each between a─b. GT not
spanning an intersegmental groove are postsetal. As with dorsal pores, GT distribution varied for populations within
and between states. OK and TX specimens typically had a similar range of segments with GT, x to xxiv, and number
of GT per segment, 1, 2, 4, and less frequent, 3. These differed from the TN specimens with range of GT segments,
vii to xxii, and number of GT per segment, 1, 2, 4, 6 and less frequent, 3, 5, or 7. Most GT are circular though some
have irregular margins that vary in diameter 0.2─0.9 mm. Color of GT for OK and TX specimens are a near white
inner area contrasted by a narrow border of light brown; TN specimens are shades of reddish brown. Contrast with
surrounding tissue is not sharp.
Spermatophores. None observed adhering to the exterior body wall.
INTERNAL.—Septa thickened 6/7─12/13 and slight musculature evident in 6/7─10/11, with greatest thickness
7/8─9/10. All septa posterior to 12/13 same thickness. All preclitellar septa drape anteriorly covering all internal
organs in the adjacent anterior segment where septa attach to the body wall. Intersegmental bands extend posteriorly
from the surface of the pharynx (ii–iv) and gizzards (v–vi). Transeptal muscles numerous in ii–xii, with greatest
abundance associated with the pharynx, penetrate muscled septa at oblique angles. Most transeptal muscle bands
confined to two adjacent segments, yet at least one penetrates through 6/7─8/9 septa. Anterior end attached to an
organ of the alimentary canal and the posterior end attached to the body wall. Integument and body musculature
(longitudinal and transverse muscle layers) each about 0.1 mm thick.
Coagulum (preserved coelomic fluids), abundant throughout, denser in segments anterior to intestine, especially
in ix─xi. Same opaque white as seminal vesicle making it difficult to parse the two.
Alimentary canal. Pharynx in ii–iv covered in transeptal muscle bands, whitish in color, 0.1–0.2 mm width, in
numerous distinct layers over dorsal and lateral surfaces of the pharynx, extending posteriorly, anchored in body
wall. Two gizzards in v–vi without distinct demarcation also with numerous transeptal muscle bands extending
posteriorly for one or two segments. Esophagus vii–xv, uniform in diameter from xiii–xv. Calciferous glands or
lamellae absent. Intestinal origin xvi, fully expanded at junction with esophagus at septum 15/16. The intestine of
a few specimens expands (tapers) gradually to full diameter in xvi, while a few others display an abrupt expansion
somewhere well within xvi; only one of the 110 specimens had the intestinal origin in xvii and this may have been
a result of obvious external trauma to the body wall during development. Simple lamelliform typhlosole most often
begins in xviii, occasionally in xix, and extends about 0.5 mm into lumen or 1/4 to 1/3 of the inside lumen diameter.
Remainder of gut lining generally smooth with few ridges.
Nephridia. Holoic, in iii to terminal segments near periproct. Tubules about 0.03 mm diameter, centered on d.
Exoic duct exits coelom 0.2─0.3 mm anterior to d. Avesiculate.
Vascular system. Dorsal vessel single throughout; blood engorgement often observed but span of segments
highly variable between specimens. Ventral vessel most easily observed in xvi; dorsal to and immediately adjacent
to the ventral nerve cord; greatest diameter 0.4 mm. Paired latero-esophageal vessels (hearts) x–xii often engorged
with blood. Extra-esophageal vessels vii–ix, about 1/4 less diameter than hearts and occupy same position in each
segment as the hearts.

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 373
Nervous system. Dorsal bi-lobed cerebral ganglion on dorsal surface of pharynx in iii united with ventral nerve
cord by circumpharyngeal connectives that pass over the lateral surface of the pharynx. Ventral nerve cord easily
observed, sandwiched between the ventral blood vessel and body wall; opaque and about the same diameter as the
ventral blood vessel.
Male sexual system. Testes holandric in x and xi, attached near mV posterior surface of septa 9/10 and 10/11,
respectively. Series of strings branching from a single trunk attached to septum has a similar appearance, though
smaller size, as ovaries of some diplocardians. Periesophageal testis sac not detected. Male funnels, conspicuous
(about 0.5 mm diameter), attached to anterior surfaces of septa 10/11 and 11/12, near a–b. Iridescence observed on
both testes and male funnels. Racemose seminal vesicles in ix typically smaller than those in xii which often fills the
entire coelomic cavity; often absent in ix for the OK specimens, especially for those collected in Jackson County.
Prostates paired in xix and xxi, in line with a. Sharp transition in diameter from duct to gland. Curved prostatic duct
short (ca. 2 mm long) and narrow (<0.1 mm diameter). Gland with smooth margin and sharp folds—sometimes
more than six 90° and 180° loops—with asymmetrical distribution of R/L, anterior/posterior prostates that span
three or more pre- and post-segments adjacent to segment of duct; overall length can exceed 3 cm. Penisetal bundles
about 0.5 mm in length and 0.05 mm diameter, in xix and xxi, penetrating body wall with prostatic duct. Transverse
muscle bands observed only in TN specimens.
Female sexual system. Ovaries in xiii, conspicuous conical cluster (not distinct strings) attached to ventrad
posterior surface of septum 12/13. Ovarian funnels conspicuous, attached to ventrad anterior surface of septum
13/14, irregular wavy rim about 0.3 mm diameter. Oviducts pass through 13/14 septum, short duct in xiv about 0.2
mm diameter, penetrates body wall adjacent to ventral nerve cord, near a.
Spermathecae. Quadrithecal, in viii and ix. Duct emerges near a, length about 1─2 mm long by <1 mm diameter.
Acryptate. Diverticulum sessile or on a short stalk attached near ectal end (near ampulla); oblong single chamber;
length at least double the width; with iridescence on some specimens. Ampulla ovoid, relatively large compared to
overall size of clitellate specimens, 1─2 mm long by 1─2 mm wide, sometimes width slightly greater than length;
iridescence not observed (Fig. 2).
Remarks
Ude’s 1895 original description of Diplocardia verrucosa is based on three specimens that are supposed to be the
type series. There are only two specimens presently curated in the Museum of Nature Hamburg, Germany that are
designated syntypes (accession number: ZMH-ANN-OL-V382). While at the current time we are unable to study
the specimens in person (due to the fragility of the material, shipping for examination was not an option), digital
photographs provided by the museum curator of one of the two specimens shows that it has its male field in xix-xxi,
consistent to D. verrucosa, but completely lacks the genital tumescence described by Ude and recognized as a major
diagnostic feature for this species by multiple authorities (e.g., Murchie 1962, Gates 1967, 1977). Furthermore, this
specimen lacks a clitellum, while Ude describes the presence of it. The second specimen in this lot lacks its anterior
portion and therefore its identification is not possible. Given this and that Ude used three specimens, and that one
of the specimens do not seem to fit Ude’s description, it is possible that these specimens might not be those used
by Ude to describe D. verrucosa and were mislabeled at some point. Another possibility is that these specimens
have been worn due to their age and these diagnostic characters have been damaged or lost. In any case, careful in
person examination of the one full specimen should be carried out to confirm if it fits the original description by Ude
(1895). If this specimen is indeed an inadequate representation of the species, a neotype could be proposed from
its type locality at Omaha, Nebraska following the International Commission on Zoological Nomenclature Code
(1999) Article 75. Such determination should be carried out in a future study.
The Tennessee specimens differ from the other specimens in numbers per segment and segment range of GT;
other than slight variation in overall size (likely due to site quality), this single character is the only notable difference
for all 110 specimens from all three states.
Gut content mostly fine sand (0.05 mm dia.) with low amount (<10%) of short dark fibers and scattered pieces
of woody material (up to 1 X 2 mm); TX specimens had slightly larger sand grains.
Based on collection records that span over a century from multiple sites in more than a dozen states in the USA
D. verrucosa clearly prefers hydric soils.

DAMOFF & CARRERA-MARTÍNEZ
374 · Zootaxa 5589 (1) © 2025 Magnolia Press
Diplocardia farrishi Damoff & Carrera-Martínez sp. nov.
urn:lsid:zoobank.org:act:12A34A02-93E9-4D4A-9D68-B74A6C29C3BB
Figure 2 D–F
Synonyms. Diplocardia verrucosa Gates, 1967, 1977 (in part).
Material examined. Holotype: Clitellate, USNM 1742106. White Oak Springs, Lincoln National Forest, Eddy
County, New Mexico, USA (32˚14’40”N, 104˚43’23”W; elevation 1562 m). Collectors George A. Damoff and
Michael A. Damoff on 22 March 2005. Site accessed by approximately 0.5 km hike from north terminus of side
road off of Forest Service Road 525. Closed canopy of mixed hardwoods in deep narrow ravine with deep silt loam
among boulders in the Chihuahuan Desert. Paratypes: 12 .USNM 1742107–1742118.
Etymology. Named in honor of Ken Farrish, the dissertation director of the first author, whose engaging manner
during soil lectures was the providential means first used to direct his attention to the great need of earthworm
ecology research. In the many years that have followed, Ken has continued to give much enthusiastic guidance,
support, and encouragement. There is a slight regret that the specimens named in his honor lack semblance of colors
to the Farrish tartan, but this deficiency may be overlooked if the species proves to enhance the flavor of the family
haggis recipe.
Diagnosis. Small-sized, quadrithecal earthworm, 140 mm length X 3.4 mm diameter (xxx). Segment count
134. Epilobous tongue 1/2 width of segment, open, with minimal slight rugosities parallel to long axis of organism.
Saddled-shaped clitellum, dorsal and ventral extent all of xiii–xix, with ventral margin slightly ventrad to a.
No genital tumescences. Male groove narrow and shallow in 1/2xix─1/2xxi, nearly straight without secondary
indentations associated with segmentation. Single dorsal blood vessel throughout. Last hearts xii. Intestinal origin
xviii. Calciferous lamellae absent. Acryptate spermathecae with sessile quadruple-lobed diverticulum near base of
ovoid ampulla.
Description
EXTERNAL.—Small-sized earthworm. Mean length, width, segment count and other character traits are in figure
2 and table 3.
Body shape generally cylindrical throughout. Widest at vi–ix, postclitellum diameter uniform nearly to last
dozen segments where body on some specimens somewhat flattens. Biannulation begins around iv and transitions
to triannulate around viii through xii, little or no annulation in clitellar segments xiii–xix, triannulation resumes at
xx and continues through remaining segments, with the last half dozen or more absent of any annulation.
Pigmentation absent. Body color of formalin-fixed, ethanol-stored specimens (nearly 20 years) uniform
throughout: brown (7.5YR 5/4), clitellum strong brown (7.5YR 5/8).
Epilobous tongue ca. 1/2 width of segment, with some isolated populations at divergent sites with a closed
epilobous tongue and others open. One specimen tanylobous. Rugosae on peristomium slight and mostly parallel
with the long axis.
First dorsal pore 6/7 or 7/8, no dorsal pores evident in clitellar segments, with dorsal pores evident in all
postclitellar segments except last few. Nephridiopores inconspicuous at d.
Saddle-shaped clitellum xiii─xix filling all segments both dorsally and ventrally, though less thick in xiii and
xix. Ventral margin of clitellum distinct, 0.1 mm within a–a, resulting in a distinct ventral 0.3 mm region absent of
clitellar material extending all of xiii–xix. All setal pairs visible in all clitellar segments.
Setae begin ii, closely paired below mL line. Ambulatory setae, both pairs, conspicuous in all segments before
periproct including viii, ix, xiv, xix, and xxi; only a and b of xx not observed. Holotype setal arrangement the same
at x and xxx: aa:ab:bc:cd:dd = 4.4:1:3.2:1.2:17.6. Copulatory and penial setae are unmodified or absent.
Spermathecal pores in line with a, on anterior margins of viii, ix, both the same size (less than 0.1 mm in
diameter), slightly raised (about 0.1 mm) on conical papillae (about 0.2 mm diameter) that extends anteriad about
0.1 mm over intersegmental furrow.
Ovipores in xiv, slightly within a–a (less than 0.1 mm) and midway between anterior margin and a. The pair
of pores slightly raised on a single ovoid papilla (“halo”) that extends slightly lateral to a–a; similar strong brown
color as clitellum.

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 375
Male groove, in line with a, extends from 1/2xix–1/2xxi, nearly straight to slightly crescentic without secondary
indentations associated with intersegmental grooves or secondary annulations. Short (slightly greater than 1 mm
length), shallow (less than 0.1 mm), narrow (greatest width less than 0.1 mm). Slight ridge entire circumference
(about 0.1 mm height). Prostatic pores inconspicuous in tips of male groove. Male pore at anterior-most margin of
xx within male groove.
Genital tumescences (GT) absent on all specimens examined.
Spermatophores. None observed adhering to the exterior body wall.
INTERNAL.—Septa thickened yet translucent 6/7─9/10, musculature not evident. All septa posterior to 12/13
same thickness. Many preclitellar septa drape anteriad covering internal organs in the adjacent anterior segment
where septa attach to the body wall. Intersegmental bands extend posteriorly from the surface of the pharynx (ii–iv)
and gizzards (v–vi). Slender transeptal muscle bundles (less than 0.1 mm diameter) extend posteriorly, with greatest
abundance associated with the pharynx, penetrate septa at oblique angles. Anterior end attached to an organ of the
alimentary canal and the posterior end attached to the body wall.
Coagulum (preserved coelomic fluids), not overly abundant in segments anterior to intestine. Body musculature
gracile throughout though slightly thicker in vi–xx.
Alimentary canal. Pharynx in ii–iv covered in slender transeptal muscle bands, whitish in color, in numerous
distinct layers over dorsal and lateral surfaces of the pharynx, extending posteriorly, anchored in body wall. Two
gizzards in v–vi without distinct demarcation also with numerous transeptal muscle bands extending posteriorly for
one or two segments. Esophagus vii–xvii, generally uniform in diameter (about 0.7 mm) from xiii–xv. Calciferous
glands or lamellae absent. Intestinal origin xviii fully expanded (1.8 mm diameter) at junction with esophagus at
septum xvii/xviii with few exceptions where intestine tapers to full diameter in xviii. Simple lamelliform typhlosole
begins in or near xxi and extends over half of intestinal length, protrudes about 0.5 mm into lumen or 1/4 to 1/3 of
the inside lumen diameter. Gut lining smooth with few ridges.
Nephridia. Holoic, in iii to terminal segments near periproct. Tubules 2–3 loops, overall length 3–4 mm,
diameter uniform less than 0.1 mm. Exoic duct exits coelom anterior to d. Avesiculate.
Vascular system. Dorsal vessel single throughout. Ventral vessel most easily observed in xv–xvii dorsad and
in contact with the ventral nerve cord. Paired latero-esophageal vessels (hearts) x, xi, and xii often engorged with
blood. Extra-esophageal vessels vii–ix, less diameter than hearts and occupy same position in each segment as the
hearts.
Nervous system. Dorsal bi-lobed cerebral ganglion on dorsal surface of pharynx in iii united with ventral nerve
cord by circumpharyngeal connectives that pass over the lateral surface of the pharynx. Ventral nerve cord 0.2 mm
diameter easily observed in xv–xvii, sandwiched between the ventral blood vessel and body wall.
Male sexual system. Testes holandric, inconspicuous, lack iridescence, in x and xi. Male funnels, iridescent and
conspicuous (ca. 0.8 mm dia.), attached to anterior surfaces of septa 10/11 and 11/12. Racemose seminal vesicles
in ix half the size of those in xii. Prostates paired in xix and xxi. Sharp transition in diameter from duct to gland.
Prostatic duct straight and short (0.2 mm long) and narrow (<0.1 mm dia.). Gland (ca. 0.4 mm dia.) with smooth
margin and sharp folds with asymmetrical distribution of R/L anterior/posterior prostates that span three or more
pre-segments and five or more post-segments. Penisetal bundles and transverse muscle bands absent in xix and
xxi.
Female sexual system. Ovaries in xiii, conspicuous cluster, no distinct strings, attached to ventrad posterior
surface of septum 12/13. Ovarian funnels conspicuous, attached to ventrad anterior surface of septum 13/14,
irregular wavy rim ca. 0.3 mm diameter. Oviducts pass through 13/14 septum, short duct in xiv ca. 0.2 mm diameter,
penetrates body wall adjacent to ventral nerve cord, mesiad to a.
Spermathecae. Quadrithecal, in viii and ix. Duct emerges near a, length about 1─2 mm long by <1 mm
diameter. Acryptate. Diverticulum (length twice as long as width) sessile or short stalk (<0.1 mm) attached near
base of ampulla; oblong quadruple seminal chamber; iridescence on most specimens. Ampulla ovoid, relatively
large compared to overall size of clitellate specimens, 2.4 mm long by 1.8 mm wide (Fig. 2).
Remarks
Gut ingesta varies according to soils at diverse sites. Most specimens with an abundance of fine sand, with a
few sand grains larger than diameter of esophagus (range <0.01–1.0 mm dia.). Light brown fine-grained organic

DAMOFF & CARRERA-MARTÍNEZ
376 · Zootaxa 5589 (1) © 2025 Magnolia Press
material suspended in coagulated mucus. Large (ca. 0.5 mm dia.) opaque white spheres with a globular surface,
perhaps calcium aggregates, randomly distributed in the ingesta, similar in distribution and scarcity as the large sand
grains.
Ingesta of the White Oak Spring (WOS) specimens limited to relatively low amount of very fine sand and an
abundance of dark brown (Munsell 7.5 YR 3/3) hemic organic matter. The spring is in a deep narrow ravine with a
nearly closed canopy of white oak (Quercus sp.), bigtooth maple (Acer grandidentatum), Texas madrone (Arbutus
xalapensis), very little understory vegetation, and a deep layer of leaf litter over deep silt loam soil. Even here,
though, earthworms were in soils well above the spring pool. The specimens from the north end of WOS appeared
post reproductive as evidenced by slight rings of brown pigment in the preclitellar intersegmental furrows, a lack
of iridescence on diverticula and male funnels, less prominent spermathecal pores than most other adult specimens
collected at the other sites, and spermathecae that appeared collapsed.
Five D. eiseni specimens, along with Aporrectodea rosea, were collected in a black loam hydric soil of the Black
River in Eddy County; D. farrishi was not collected at this site. Elsewhere in the USA, it is our observation that D.
eiseni is often found in hydric soils. In the numerous papers referenced above where James collects purported D.
verrucosa he also reports D. smithii. Our single collection of D. smithii (along with numerous Ap. rosea) is from
one site on a ledge 3 m above a small stream. D. texensis, with a male groove that spans xx—xxii, was collected at
three sites associated with hydric soils and never collected with D. farrishi. The only earthworm species collected
at the White Oak Spring site was D. farrishi, the site from which the holotype was selected.
Because of the unique region from which D. farrishi was collected, we propose as a common name the
Chihuahuan Desert earthworm.
Discussion
Diplocardia verrucosa first entered the scientific literature in 1895 and in less than five years discrepancies in
morphological traits appeared in subsequent publications on the species. As noted above, some corrections have
been made, yet additional incongruities have entered and remain in the literature. Diplocardia farrishi sp. nov. first
appeared in the scientific literature when Gates (1967) struggled to describe poorly preserved specimens from SW
New Mexico and misidentified the specimens as D. verrucosa. Then again, ten years later, Gates (1977) continues to
wrestle with a precise description of the intestinal origin of D. verrucosa, where he references Murchie (1962) and
McKey-Fender (in lit), without a firm conclusion. In both these publications by Gates the stark difference of genital
tumescences combined with differences in the intestinal origin do not factor into his conclusions. Therefore, contrary
to publications by Gates (1967) and after revising specimens from Reynolds and Damoff (2009), D. verrucosa is
likely not present in New Mexico. The one exception may be a single adult specimen collected by Reynolds and
Brody in 1998 where they report collecting it from a riverbank (Reynolds & Damoff 2009), habitat that resembles
the preponderance of reports for D. verrucosa specimens collected from multiple other states in the USA since
1895.
Murchie’s 1962 redescription of D. verrucosa (originally described by Ude, 1895) proposes two subspecies
based on the extent of ventral development of the clitellum, location of spermathecal pores, and patterns of genital
tumescences (GT). In our estimation the first two characters can also be understood as variations within populations
collected from disparate sites. The GT of the Tennessee populations reported in this paper generally align with the
pattern described for Murchie’s D. verrucosa verrucosa and the GT patterns of the Oklahoma and Texas specimens
reported here with D. verrucosa recta. Murchie’s redescription is based on a relatively limited number of specimens
in comparison to what is now available from twelve US states (Iowa, Illinois, Indiana, Kansas, Maryland, Missouri,
Nebraska, Ohio, Oklahoma, Tennessee, Texas, and Wisconsin). While these patterns seem to be consistent with
Murchie’s (1962) description of both subspecies, we avoid treating both subspecies in this paper until molecular
data and more populations between collections sites and respective type localities are available. Curiously, Murchie
notes, “Intestine expands abruptly in XVI”, yet apparently, he does not regard this trait as noteworthy in the
description of the species, an oversight that later influences both Gates (1977) and James (1990) in the development
of their keys for the genus.
James first worked with specimens he identified as D. verrucosa in 1983 and continued to do so even after
making his 1990 key (James, 1991, 1992). It is possible when James externally observed the male groove in xix–

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 377
xxi—the only diplocardian at the time in the literature to have that segment range—and then internally observed the
last pair of hearts in xii and the intestinal origin in xviii, plus being recently influenced by Gates’ key (1977), there
was no reason to question otherwise that he was observing D. verrucosa. However, the tallgrass prairie habitat of D.
verrucosa (and other diplocardian species) that James describes aligns more closely with the habitat described for
D. farrishi (Table 2). Thus in 2005, when the first author encountered for the first time diplocardian specimens with
the male groove in xix–xxi, followed by the internal characters that aligned with those highlighted by Gates (1977)
and James (1990), D. verrucosa was a reasonable conclusion. A reasonable conclusion until years later when the
first author observed numerous diplocardian specimens with a male groove in xix–xxi, an intestine that originates
in xvi (for most, abruptly), an abundance of genital tumescences, and all taken from hydric soils, most often with a
silty soil texture (Table 1).
As noted above, it is a combination of four distinct characters that set D. farrishi apart from all other
diplocardians. The first trait, male groove in xix–xxi, D. farrishi shares with only two other diplocardian species, D.
verrucosa and D. patuxentis. The two morphologic traits, as noted above, that delimit D. verrucosa and D. farrishi
are genital tumescences and the intestinal origin. The fourth characteristic, habitat preference, is contrasted in tables
1 and 2. Most D. farrishi specimens collected in 2005 were dug out of semi-arid to xeric soils of the Chihuahuan
Desert, well-removed from hydric soils, associated with arroyos (dry washes/gullies), on ledges high above stream
channels, and in open grassland areas. The few sites near stream channels did not have saturated soils. The March
2005 Chihuahuan Desert excursion was intentionally made at this time because the region had relatively high soil
moisture due to numerous measurable precipitation events spread out over the previous year, including several
months prior this trip. The White Oak Spring (WOS) specimens seem an exception to all others collected during
the 2005 excursion, yet maybe this somewhat greater soil moisture location is a relic of more typical habitat in the
region centuries prior. A fifth more subtle characteristic that somewhat delineates the two species is segment count.
Though the range of segment counts for both species overlap considerably, with the low end similar, the upper end
appears much higher for D. farrishi (Table 3).
While D. farrishi seems to be more closely related to D. verrucosa and D. patuxentis, other Diplocardia species
(D. texensis, D. woodi James, 1994, D. montana James, 1994, and D. californica James, 1994) resembles D. farrishi
in having a posterior displacement of the male field, two pairs of spermathecae, and lacking GT. Diplocardia
woodi, D. montana and D. californica all have their male field in xxi–xxiii, and a longer clitellum in xii–xxi, xxii
(James 1994). Similarly, D. texensis has a slightly longer clitellum (xiii–xx) and more posteriorly displaced male
field (xx–xxii) (Smith 1924, Csuzdi & Szlávecz 2002). Diplocardia farrishi differs from D. patuxentis in having
a saddle-shaped clitellum, and lacking GT, penial, and copulatory setae (Csuzdi & Szlávecz 2002). An additional
species, D. keyesi Eisen, 1896, shares many similarities with this group as well, with a male field in xx–xxii, lacking
GT, and having four spermathecae. However, this species differs from all mentioned before in having its intestinal
origin reportedly in xv and without a typhlosole (Eisen 1896). Nonetheless, D. keyesi has not been collected ever
since its original description, which is based on one posteriorly amputated, and poorly preserved specimen. Damoff
& Reynolds (2019) discuss in more details the systematics of D. keyesi. Since most of these species were described
after James’ (1990) key to Diplocardia species, we have included a key for species with the male field starting in
or after xix.
Most of the species with this combination of characters are found in the Southwestern states of the USA and
Northern region of Mexico. While the evolutionary history of this group is still unknown, it is likely that the
development of harsh biogeographical boundaries has promoted diversification in isolated places that function as
‘refugia,’ as suggested by Gates (1967). Furthermore, it appears that some of these species might have specialized to
dryer habitats that would normally be considered harsh for earthworms (James 1994; Wood & James 1993). On the
other hand, D. verrucosa and D. patuxentis might have specialized in hydric or more semiaquatic habitats (Csuzdi
& Szlávecz 2002), allowing them to perhaps disperse further east. With the discovery of D. farrishi and limited
sampling on drier regions on the Southwest and West USA, more ‘xerophilic’ species might be awaiting description.
However, before any conclusions can be drawn, further sampling and molecular data are needed in similar habitats
of the region (particularly in southern California) to understand the evolutionary history of the Diplocardia in this
region. Unfortunately, we were unable to obtain barcodes from the D. farrishi formalin-fixed specimens. These
specimens likely had their DNA broken down to small fragments and other techniques, or preferably fresh material
would be needed to obtain reliable molecular data.

DAMOFF & CARRERA-MARTÍNEZ
378 · Zootaxa 5589 (1) © 2025 Magnolia Press
Key to species of Diplocardia with posteriorly displaced male field
1. Male field in xxi–xxiii; clitellum in xii–xxi, xxii ............................................................ 2
- Male field in xix–xxi or xx–xxii; clitellum ending at or before xx ............................................... 4
2. Testes in xi only; prostomium prolobous ......................................................... D. montana
- Testes in x and xi; prostomium epilobous .................................................................. 3
3. Penial setae present, straighten, 25–30 μm long; typhlosole small, < 1/10 of the intestinal lumen ........... D. californica
- Penial setae absent or not modified; typhlosole medium, about 1/5 of the intestinal lumen .................... D. woodi
4. Male field in xx–xxii .................................................................................. 5
- Male field in xix–xxi .................................................................................. 6
5. Intestinal origin in xv; typhlosole absent (at least in the anterior 40 segments) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. keyesi
- Intestinal origin in xix; typhlosole present ......................................................... D. texensis
6. Genital tumesces absent; penial setae absent or not modified . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. farrishi sp. nov.
- Genital tumesces present in several segments between vii–xxiv; penial setae present or sometimes absent or not modified . . .
................................................................................................... 7
7. Clitellum annular; intestinal origin in xviii ....................................................... D. patuxentis
- Clitellum saddle-shaped; intestines starting in xvi, either abrupt or gradual ............................. D. verrucosa
Acknowledgements
We thank Mike Damoff, the first author’s brother, for all the enthusiastic help with the fieldwork and Dr. Sean D.
Schoville for the support during the molecular work on the formalin preserved specimens of D. farrishi. We also
thank Dr. Jenna Moore (Museum of Nature Hamburg) for her assistance in locating the syntypes of D. verrucosa and
providing pictures of the specimens. We are also thankful for the comments of Dr. Csaba Csuzdi and an anonymous
reviewer, which greatly improved earlier versions of the manuscript.
References
Carrera-Martínez, R., Jones, D., Schoville, S.D., Snyder, B.A. & Callaham Jr., M.A. (2021) Two new species of Bimastos
(Oligochaeta, Lumbricidae) from the Southern Appalachian Mountains, North America. Zootaxa, 5052 (3), 395–405.
https://doi.org/10.11646/zootaxa.5052.3.5
Carrera-Martínez, R., Taylor, M.K., Jones, D., Schoville, S.D., Snyder, B.A. & Callaham Jr., M.A. (2025) The unseen diversity
of the semi-aquatic earthworms of the genus Sparganophilus (Oligochaeta: Sparganophilidae) from the Southeastern
Appalachian Piedmont. Zootaxa, 5589 (1), 382–409.
https://doi.org/10.11646/zootaxa.5589.1.29
Claus, C. (1880) Grundzüge der Zoologie. Zum wissenschaftlichen Gebrauche. Marburg. N.G. Elwert’sche Verlagsbuchhandlung,
822 pp.
https://doi.org/10.5962/bhl.title.1113
Csuzdi, Cs. & Szlávecz, K. (2002) Diplocardia patuxentis, a new earthworm species from Maryland, North America (Oligochaeta:
Acanthodrilidae). Annales Historico-naturales Musei Nationalis Hungarici, 94, 193–208.
Damoff, G.A. & Reynolds, J.W. (2009) The earthworms (Oligochaeta: Acanthodrilidae, Eudrilidae, Lumbricidae, Megascolecidae,
Ocnerodrilidae, and Sparganophilidae) of east Texas, USA. Megadrilogica, 13 (8), 113–140.
Damoff, G.A. & Reynolds, J.W. (2017) Diplocardia deborahae, a new earthworm species (Annelida: Oligochaeta:
Acanthodrilidae) from eastern Tennessee, USA. Megadrilogica, 22 (12), 229–240.
Damoff, G.A. & Reynolds, J.W. (2019) The earthworms (Annelida: Oligochaeta: Acanthodrilidae) of Oklahoma, USA, revisited.
Megadrilogica, 24 (7), 73–95.
Dugès, A.L. (1828) Recherche sur la circulation, la respiration, et la reproduction des Annélides sétigéres abranches. Annales
des Sciences Naturelles Paris, 15, 284–336.
Dugès, A.L. (1837) Nouvelles observations sur la zoologie et l’anatomie des Annélides sétigéres abranches. Annales des Sciences
Naturelles Paris, Series 2, Zoologie, 8, 15–35.
Eisen, G. (1896) Pacific coast Oligochaeta II. Memoirs of the California Academy of Sciences, 2, 146–150.
Eisen, G. (1899) Notes on the North-American earthworms in the genus Diplocardia [sic]. Zoological Bulletin, 2 (4),

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 379
161─172.
https://doi.org/10.2307/1535422
Eisen, G. (1900) Researches in American Oligochaeta, with especial reference to those of the Pacific coast and adjacent islands.
Proceedings of the California Academy of Sciences, 3 Series, (2), 85─269.
Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome
c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299.
Garman, H. (1888) On the anatomy and histology of a new earthworm (Diplocardia communis, gen. et, sp. nov.). Bulletin of the
Illinois State Laboratory of Natural History, III (Art. 4), 1–77.
https://doi.org/10.21900/j.inhs.v3.111
Gates, G.E. (1967) On two little-known species of the earthworm genus Diplocardia. The Great Basin Naturalist, 27 (1),
1–10.
Gates, G.E. (1977) More on the earthworm genus Diplocardia. Megadrilogica, 3 (1), 1–47.
Ikeda, H., Fukumori, K., Shoda-Kagaya, E., Takahashi, M., Ito, M.T., Sakai, Y. & Matsumoto, K. (2018) Evolution of a key
trait greatly affects underground community assembly process through habitat adaptation in earthworms. Ecology and
Evolution, 8, 1726–1735.
https://doi.org/10.1002/ece3.3777
International Commission on Zoological Nomenclature (Eds) (1999) International Code on Zoological Nomenclature. Available
from: https://code.iczn.org/?frame=1 (accessed 26 November 2024)
Harman, W.J. (1960) Studies on the taxonomy and musculature of the earthworms of central Illinois. PhD dissertation. University
of Illinois, Urbana, Illinois, 107 pp.
James, S.W. (1983) Effects of burning on populations of three earthworm species in tall grass prairie. PhD dissertation. The
University of Michigan, Ann Arbor, Michigan 188 pp.
James, S.W. (1988) The postfire environment and earthworm populations in tallgrass prairie. Ecology, 69 (2), 476–483.
https://doi.org/10.2307/1940446
James, S.W. & Cunningham, M.R. (1989) Feeding ecology of some earthworms in Kansas tallgrass prairie. The American
Midland Naturalist, 121 (1), 78–83.
https://doi.org/10.2307/2425658
James, S.W. (1990) Oligochaeta: Megascolecidae and other earthworms from Southern and Midwestern North America. In:
Dindal, D.L. (ed.) Soil biology guide. John Wiley & Sons, New York, New York, pp. 379−386.
James, S.W. (1991) Soil, nitrogen, phosphorus, and organic matter processing by earthworms in tallgrass prairie. Ecology, 72
(6), 2101–2109.
https://doi.org/10.2307/1941562
James, S.W. (1994) New species of Diplocardia and Argilophilus (Annelida: Oligochaeta: Megascolecidae) from Southern
California. Proceedings of the Biological Society of Washington, 107 (4), 622–633.
James, S.W. (1995) Systematics, biogeography and ecology of earthworms from eastern, central, southern and southwestern
USA. In: Hendrix, P.F. (Ed.), Earthworm Ecology and Biogeography in North America. CRC Press, Inc., Boca Raton,
Florida, pp. 29–51.
James, S.W., Porco, D., Decaëns, T., Richard, B., Rougerie, R. & Erséus, C. (2010) DNA barcoding reveals cryptic diversity in
Lumbricus terrestris L., 1758 (Clitellata): resurrection of L. herculeus (Savigny, 1826). PLoS ONE, 5 (12), e15629.
https://doi.org/10.1371/journal.pone.0015629
MacNab, J.A. & McKey-Fender, D. (1955) Studies in the genus Diplocardia. The Wasmann Journal of Biology, 13 (1), 113–
143.
Michaelsen, W. (1895) Die Regenwurm-Fauna von Florida und Georgia. Zoologische Jahrbücher, Abteilung für Systematik,
Geographie und Biologie der Tiere, 8, 177–194.
Michaelsen, W. (1900) Oligochaeta, Das Tierreich 10. Vermes, Berlin, 575 pp.
https://doi.org/10.5962/bhl.title.11605
Misirlioğlu, M., Reynolds, J.W., Stojanović, M., Trakić, T., Sekulić, J., James, S.W., Csuzdi, C., Decaëns, T., Lapied, E., Phillips,
H.R.P., Cameron, E.K. & Brown, G.G. (2023) Earthworms (Clitellata, Megadrili) of the world: an updated checklist of
valid species and families, with notes on their distribution. Zootaxa, 5255 (1), 417–438.
https://doi.org/10.11646/zootaxa.5255.1.33
Munsell Color (Firm) (2000) Munsell soil color charts: with genuine Munsell color chips. Munsell Color, Munsell Color (Firm).
(2000). Munsell soil color charts: with genuine Munsell color chips. Grand Rapids, Michigan, 10 pp and 18 soil color
charts.
Murchie, W.R. (1962) A new subspecies of diplocardian earthworm from Oklahoma (Oligochaeta: Megascolecidae). The Ohio
Journal of Science, 62 (4), 185–190.
Olson, H.W. (1933) Two new species of earthworms for Ohio. The Ohio Journal of Science, 32, 192–193.
Reynolds, J.W. & Damoff, G.A. (2009) The earthworms (Oligochaeta: Acanthodrilidae, Lumbricidae) of New Mexico, USA.
Megadrilogica 13 (5), 37–52.
Reynolds, J.W. & Damoff, G.A. (2010) The earthworms (Oligochaeta: Acanthodrilidae, Lumbricidae, Megascolecidae, and
Sparganophilidae) of Oklahoma, USA. Megadrilogica, 13 (12), 173–193.
Savigny, J.C. (1826) Analyse d’un Mémoire sur les Lombrics par Cuvier. Mémoires de l’Académie des sciences de l’Institut de

DAMOFF & CARRERA-MARTÍNEZ
380 · Zootaxa 5589 (1) © 2025 Magnolia Press
France, 5, 176–184
Smith, F. (1915) Two new varieties of earthworms with a key to described species in Illinois. Bulletin of the Illinois State
Laboratory of Natural History, 10, 551–559.
https://doi.org/10.21900/j.inhs.v10.378
Smith, F. (1924) A new earthworm from Texas belonging to the genus Diplocardia. Proceedings of the United States National
Museum, 66 (2549), 1–6.
https://doi.org/10.5479/si.00963801.2549
Smith, F. (1928) An account of changes in the earthworm fauna of Illinois and a description of one new species. Bulletin of the
Illinois State Natural History Survey, 17 (10), 347–362.
https://doi.org/10.21900/j.inhs.v17.289
Stephenson, J. (1930) The Oligochaeta. Oxford: Clarendon Press, 978 pp.
Ude, H. (1895) Beiträge zur Kenntnis der Enchytraeiden und Lumbriciden. Zeitschrift für wissenschaftliche Zoologie, 56,
111–141.
USDA-NRCS (2018) Guide to texture by feel. [online] Available from: https://www.nrcs.usda.gov/wps/portal/nrcs/detail/soils/
edu/?cid=nrcs142p2_054311 (accessed 21 March 2005)
USDA-NRCS (2024) Web Soil Survey. Online. Available from: https://websoilsurvey.nrcs.usda.gov/app/HomePage.htm
(accessed 30 May 2024)
Wood, H.B. & James, S.W. (1993) Native and introduced earthworms from selected chaparral, woodland, and riparian zones
in southern California. Gen. Tech. Rep. PSW-GTR-142. U.S. Department of Agriculture, Forest Service, Pacific Southwest
Research Station, Albany, California, 20 pp.
https://doi.org/10.2737/PSW-GTR-142

REEVALUATION OF DIPLOCARDIA VERRUCOSA WITH A NEW SPECIES Zootaxa 5589 (1) © 2025 Magnolia Press · 381
APPENDIX 1. Primers of overlapping COI fragments for formalin-fixed Diplocardia earthworms.
Fragment Primer Name Direction Seq. L
(bp)
Primer Sequence Reference
1 LCO1490 Forward 234 GGTCAACAAATCATAAAG ATATTGG Folmer et al.
(1994)
DiploVCOI_1R Reverse GGTGCACCAAGTATTAGGGGT This study
2 DiploVCOI_2F Forward 242 CAACCTGGAGCATTCCTAGG This study
DiploVCOI_2R Reverse TCCTGCACCTTTTTCAACGG This study
3 DiploVCOI_3F Forward 153 AGCATTCCCCCGACTAAACA This study
DiploVCOI_3R Reverse TACTGATGGACCTGCGTGAG This study
4 DiploVCOI_4F Forward 202 TTATTAGTCAGGTCCGCGGC This study
DiploVCOI_4R Reverse AGTCGTAATCCGGATCATCGT This study
5 DiploVCOI_5F Forward 211 AACATAGCTCACGCAGGTCC This study
DiploVCOI_5R Reverse GCACCTGCTAGTACTGGTAGTG This study
6 DiploVCOI_6F Forward 134 CGAGTTCCACTATTTGTGTGAGC This study
COI2198E Reverse TAWACTTCWGGGTGWCCRAARAATCA Ikeda et al. (2018)