The edible ethanol extract of Rosa hybrida suppresses colon cancer progression by inhibiting the proliferation-cell signaling-metastasis axis

Abstract

BACKGROUND/OBJECTIVES
Rosa hybrida has been demonstrated to exert biological effects on several cell types. This study investigated the efficacy of the edible ethanol extract of R. hybrida (EERH) against human colorectal carcinoma cell line (HCT116) cells.

MATERIALS/METHODS
HCT116 cells were cultured with different concentrations of EERH (0, 400, 600, 800, and 1,000 µg/mL) in Dulbecco’s modified Eagle medium. Cell viability was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide and viable cell counting assays. Cell cycle pattern was observed by flow cytometry analysis. The wound-healing migration assay, invasion assay, and zymography were used to determine the migratory and invasive level of HCT116 cells treated with EERH. The protein expression and binding ability level of HCT116 cells following EERH treatment were analyzed via immunoblotting and the electrophoretic mobility shift assay.

RESULTS
EERH suppressed HCT116 cell proliferation, thus arresting the G1-phase cell cycle. It also reduced cyclin-dependent kinases and cyclins, which are associated with p27KIP1 expression. Additionally, EERH differentially regulated the phosphorylation of extracellular signal-regulated kinase 1/2, c-Jun NH2-terminal kinase, p38, and protein kinase B. Moreover, EERH treatment inhibited the enzymatic activity of matrix metalloproteinase-9 (MMP-9) and MMP-2, resulting in HCT116 cell migration and invasion. The EERH-induced inhibition of MMP-9 and MMP-2 was attributed to the reduced transcriptional binding of activator protein-1, specificity protein-1, and nuclear factor-κB motifs in HCT116 cells. Kaempferol was identified as the main compound contributing to EERH's antitumor activity.

CONCLUSION
EERH inhibits HCT116 cell proliferation and metastatic potential. Therefore, it is potentially useful as a preventive and curative nutraceutical agent against colorectal cancer.

Full text

14
ABSTRACT
BACKGROUND/OBJECTIVES:
Rosa hybrida
has been demonstrated to exert biological eects
on several cell types. This study investigated the ecacy of the edible ethanol extract of
R.
hybrida
(EERH) against human colorectal carcinoma cell line (HCT116) cells.
MATERIALS/METHODS: HCT116 cells were cultured with dierent concentrations of EERH
(0, 400, 600, 800, and 1,000 µg/mL) in Dulbecco’s modied Eagle medium. Cell viability
was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide and
viable cell counting assays. Cell cycle pattern was observed by ow cytometry analysis. The
wound-healing migration assay, invasion assay, and zymography were used to determine
the migratory and invasive level of HCT116 cells treated with EERH. The protein expression
and binding ability level of HCT116 cells following EERH treatment were analyzed via
immunoblotting and the electrophoretic mobility shi assay.
RESULTS: EERH suppressed HCT116 cell proliferation, thus arresting the G1-phase cell cycle.
It also reduced cyclin-dependent kinases and cyclins, which are associated with p27KIP1
expression. Additionally, EERH dierentially regulated the phosphorylation of extracellular
signal-regulated kinase 1/2, c-Jun NH2-terminal kinase, p38, and protein kinase B. Moreover,
EERH treatment inhibited the enzymatic activity of matrix metalloproteinase-9 (MMP-9)
and MMP-2, resulting in HCT116 cell migration and invasion. The EERH-induced inhibition
of MMP-9 and MMP-2 was attributed to the reduced transcriptional binding of activator
protein-1, specicity protein-1, and nuclear factor-κB motifs in HCT116 cells. Kaempferol was
identied as the main compound contributing to EERH's antitumor activity.
CONCLUSION: EERH inhibits HCT116 cell proliferation and metastatic potential. Therefore,
it is potentially useful as a preventive and curative nutraceutical agent against colorectal
cancer.
Keywords: HCT116 cells; cyclin-dependent kinases; cyclins; metalloproteases
Nutr Res Pract. 2025 Feb;19(1):14-29
https://doi.org/10.4162/nrp.2025.19.1.14
pISSN 1976-1457·eISSN 2005-6168
The edible ethanol extract of Rosa
hybrida suppresses colon cancer
progression by inhibiting the
proliferation-cell signaling-metastasis
axis
Hong-Man Kim 1*, Daeun Lee 1*, Jun-Hui Song 1, Hoon Kim 1,
Sanghyun Lee 2, Sangah Shin 1, Sun-Dong Park 3, Young Woo Kim 3,
Yung Hyun Choi 4, Wun-Jae Kim 5, and Sung-Kwon Moon 1§
1Department of Food and Nutrition, Chung-Ang University, Anseong 17546, Korea
2Department of Plant Science and Technology, Chung-Ang University, Anseong 17546, Korea
3Department of Herbal Prescription, School of Korean Medicine, Dongguk University, Goyang 10326, Korea
4Department of Biochemistry, College of Oriental Medicine, Dongeui University, Busan 47340, Korea
5Institute of Urotech, Cheongju 28120, Korea
Received: Jul 3, 2024
Revised: Aug 31, 2024
Accepted: Sep 12, 2024
Published online: Oct 2, 2024
§Corresponding Author:
Sung-Kwon Moon
Department of Food and Nutrition, Chung-Ang
University, 4726 Seodong-daero, Daedeok-
myeon, Anseong 17546, Korea.
Tel. +82-31-670-3284
Fax. +82-31-675-4853
Email. sumoon66@cau.ac.kr
*Hong-Man Kim and Daeun Lee contributed
equally to this work.
©2025 The Korean Nutrition Society and the
Korean Society of Community Nutrition
This is an Open Access article distributed
under the terms of the Creative Commons
Attribution Non-Commercial License (https://
creativecommons.org/licenses/by-nc/4.0/)
which permits unrestricted non-commercial
use, distribution, and reproduction in any
medium, provided the original work is properly
cited.
ORCID iDs
Hong-Man Kim
https://orcid.org/0009-0004-6552-0151
Daeun Lee
https://orcid.org/0009-0007-6869-161X
Original Research
https://e-nrp.org

Jun-Hui Song
https://orcid.org/0000-0002-7711-0983
Hoon Kim
https://orcid.org/0000-0001-9153-382X
Sanghyun Lee
https://orcid.org/0000-0002-0395-207X
Sangah Shin
https://orcid.org/0000-0003-0094-1014
Sun-Dong Park
https://orcid.org/0000-0002-4521-6249
Young Woo Kim
https://orcid.org/0000-0002-3323-7106
Yung Hyun Choi
https://orcid.org/0000-0002-1454-3124
Wun-Jae Kim
https://orcid.org/0000-0002-8060-8926
Sung-Kwon Moon
https://orcid.org/0000-0002-4514-3457
Funding
This research was supported by the Basic
Science Research Program through the
National Research Foundation of Korea
(NRF) funded by the Ministry of Education
(2018R1A6A1A03025159). This research was
also supported by the Chung-Ang University
Graduate Research Scholarship Grants in
2023.
Conflict of Interest
The authors declare no potential conflicts of
interests.
Author Contributions
Conceptualization: Kim HM, Lee D, Moon SK;
Formal analysis: Kim HM, Lee D, Song JH, Kim
H, Lee S, Shin S; Investigation: Song JH, Kim
H, Lee S, Shin S; Methodology: Kim HM, Lee D;
Project administration: Moon SK; Supervision:
Park SD, Kim YW, Choi YH, Kim WJ, Moon SK;
Validation: Kim HM, Lee D, Song JH, Kim H,
Lee S, Shin S, Park SD, Kim YW, Choi YH, Kim
WJ; Writing - original draft: Kim HM, Lee D,
Moon SK; Writing - review & editing: Kim HM,
Lee D, Moon SK.
INTRODUCTION
Colorectal cancer is the third most common and second leading cause of mortality related
to malignant carcinoma worldwide, with adenocarcinoma originating from the colonic and
rectal epithelia accounting for approximately 90% of cases. The incident rates in developed
countries are approximately 4 times higher than those in transitioning countries [1,2].
While surgical resection remains the optimal treatment, it is applicable to only 20–25% of
stage I and II patients. Post-operative recurrence rates range from 40% to 70%. Palliative
chemotherapy becomes necessary for generally inoperable, recurrent, and metastatic
cases, with adjuvant chemotherapy recommended for stage III post-surgery [3,4]. Notably,
liver metastasis is a primary cause of death in colorectal cancer, yielding a mortality rate
exceeding 70% [5]. Stage II and III cancers, exhibiting p27KIP1 loss or loss of heterozygosity
at chromosomes 5q, 17p, and 18q, demonstrate dismal prognosis [3,4]. Recent advancements
in chemotherapy have improved patient survival; however, stage IV remains largely incurable
[6,7]. For research into cancer biology, colon cancer, and liver metastasis, the human
colorectal carcinoma cell line (HCT116) serves as an ideal model [8,9].
Eukaryotic mitosis comprises 4 phases: G1, G2, S, and M, each regulated by cell-cycle
checkpoints. Cell cycle inhibitors, cyclin-dependent kinases (CDKs), and cyclins act as
cell-cycle regulators, modulating various stages of signal cascades [10-12]. The DNA damage
response suppresses individual cyclin/CDK complex activity via CDK inhibitors (CDKIs),
impeding cell cycle progression [8,9]. CDKIs, including p21WAF1 and p27KIP1, block G1-
to S-phase progression, inhibiting the kinase activities of cyclin/CDK complexes [10-12].
Interestingly, conicting results suggest that p21WAF1 also plays inuential, supportive, and
proliferative roles in activating cyclin/CDK [13]. Poor prognoses are observed in patients with
colorectal cancer lacking or with reduced p27KIP1 levels [14]. Apart from p27KIP1, superior
molecular markers for colon cancer-specic or overall mortality have not yet been identied
[15]. Therefore, stabilizing p27KIP1 potentially prevents the progression of precancerous
adenoma into malignant carcinomas [16].
Mismatch-repair defects are prevalent in colorectal cancer, potentially attenuating p53
pathway activity [6]. Wild-type p53, when activated by multiple cellular stresses, orchestrates
cell-cycle arrest and acts as a cell-death checkpoint [17]. Among the numerous biological
processes, such as cell proliferation, inammation, migration, dierentiation, and invasion,
central cascades include the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) and
mitogen-activated protein kinase (MAPK) signaling pathways [18]. Notably, RAS and BRAF
oncogenic mutations, occurring in 37% and 13% of colorectal cancers, respectively, activate
the MAPK and PI3K/AKT signaling pathways [18,19].
Matrix metalloproteinase-9 (MMP-9) and MMP-2, zinc-dependent endopeptidases, facilitate
tumor-cell degradation into extracellular matrix (ECM) components during migration and
invasion [20]. MMP-9 and MMP-2 promote HCT116 cell migration and invasion by degrading
type IV collagen, potentially causing epithelial cell instability [21,22]. The abundance of
MMP-9 and MMP-2 in tissue and serum correlates with muscle-invasive disease [20,23].
Transcription factors, such as specicity protein 1 (Sp-1), activator protein 1 (AP-1), and
nuclear factor kappa B (NF-κB), control MMP-9 and MMP-2 expression at promoter regions
[20,23]. Consequently, the repression of MMP-9 and MMP-2 expression is a potentially
crucial process in preventing cellular migration and invasion [23,24].
15
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

Most current anti-cancer molecules aect essential functions in both normal and cancer cells
[25]. Discovering agents that specically target cancer cells while remaining safe and well
tolerated in patients has been an ongoing endeavor in oncology. Natural products derived
from edible plants have gained attention owing to their potential as eective and safer
alternatives in tumor prevention or treatment [26]. Edible
Rosa hybrida
, a renowned source
of aromatic oils and physiological components in the nutraceutical and cosmetic industries,
predominantly comprises gallic acid and volatiles, such as 1-butanol, cyclododecane,
and dodecyl acrylate. Its extracts, recognized for their anti-inammator y, antimicrobial,
antioxidant, and neuroprotective properties, exert diverse nutritional and physiological
eects [27,28]. Our previous study revealed the preventive role of the water extract of
R.
hybrida
against the proliferation and migration of platelet-derived growth factor-stimulated
vascular smooth muscle cells [29]. Furthermore, we identied kaempferol as the major active
compound in the ethanol extract of
R. hybrida
(EERH) through nuclear magnetic resonance
(NMR) and mass spectrometry (MS) analysis, which was conrmed by high-performance
liquid chromatography (HPLC). This compound demonstrated signicant antitumor eects
in bladder cancer T24 cells [30]. Building on these ndings, our study investigated the eects
of EERH on HCT116 cell proliferation, migration, and invasion.
MATERIALS AND METHODS
Materials
Antibodies against p38MAPK (#9212), phospho-p38MAPK (#9211), c-Jun NH2-terminal
kinase (JNK; #9258), phospho-JNK (#9251), extracellular signal-regulated kinases1/2
(ERK; #9102), phospho-ERK (#9101), AKT (#9272), phospho-AKT (#9271), normal rabbit
immunoglobulin G (IgG; #2729S), and mouse IgG Isotype control (#5415S) were acquired
from Cell Signaling (Danvers, MA, USA). Anti-CDK4 (sc-23896), cyclin D1 (sc-8396),
CDK2 (sc-6248), cyclin E (sc-247), p21WAF1 (sc-6246), p27KIP1 (sc-1641), and p53 (sc-126)
antibodies as well as glyceraldehyde 3-phosphate dehydrogenase (sc-47724) were obtained
from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Anti-MMP-9 (#04-1150) and
anti-MMP-2 (#AB19167) antibodies were secured from Millipore (Burlington, MA, USA).
U0126, SB203580, LY294002, and SP600125 were purchased from Calbiochem (San Diego,
CA, USA). Electrophoretic mobility shi assay (EMSA) (AY1XXX) and nuclear extraction kits
were procured from Panomics (Fremont, CA, USA).
Preparation of the EERH
R. hybrida
owers were purchased from the Agricultural Technology Center (Jincheon, Korea).
Dried petals (1.96 kg) were extracted using 50% ethanol for 3 h at 80°C. Aer ltering, the
extract was concentrated under reduced pressure. Finally, 62.39 g of the ethanol extract was
obtained and weighed.
Cell culture
The HCT116 and fetal human cell (FHC) cell lines were acquired from the American Type
Culture Collection (Manassas, VA, USA). Both cell culture media comprised Dulbecco’s
modied Eagle medium (Sigma-Aldrich, San Diego, CA, USA) supplemented with 100 μg/mL
streptomycin, 10% fetal bovine serum (FBS; 35-010-CV, Corning, NY, USA), and 100 U/mL
penicillin. The cells were maintained at 37°C in a humidied incubator with 5% CO2.
16https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

Cell viability: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) assay
A concentration of 6 × 103 cells per well was cultivated in 96-well plates. The cells were
incubated with EERH, and MTT solution (0.5 mg/mL, Sigma-Aldrich) was subsequently
added to the cells for 1 h. Aer removing the solution, dimethyl sulfoxide was added, and the
samples’ absorbance values at 540 nm were determined using a uorescent plate reader.
Viable cell counting assay
Cell viability values were expressed as percentages of the control group (untreated
group). Cells were detached using a solution containing 0.25% trypsin–0.2%
ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientic, Waltham, MA, USA). Cell
morphology was visualized using a phase-contrast microscope. The cells were reacted with
0.4% trypan blue (Sigma-Aldrich) and counted using a hemocytometer.
Cell cycle analysis
Aer treatment with EERH, cells were trypsinized, washed, and xed in ethanol (70%) at −20°C
for 24 h. The cells were washed several times with ice-cold phosphate-buered saline (PBS) and
subsequently incubated with a buer containing 1 mg/mL RNase A and 50 mg/mL propidium
iodide for the cell cycle assay. Using a Muse® Cell Analyzer equipped with analysis soware
(Merck Millipore, Darmstadt, Germany), cell-cycle phases were distributed and quantied.
Immunoblotting and immunoprecipitation
Cells were washed 2–3 times with ice-cold PBS and resuspended in lysis buer, which
comprised 150 mM NaCl, 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
(HEPES, pH 7.5), 1 mM EDTA, 2.5 mM ethylene glycol tetraacetic acid (EGTA), 1 mM
dithiothreitol (DTT), 0.1 mM Na3VO4, 1 mM NaF, 10 mM β-glycerophosphate, 10% glycerol,
0.1 mM phenylmethylsulfonyl uoride (PMSF), 0.1% Tween-20, 2 μg/mL aprotinin, and 10
μg/mL leupeptin at 4°C for 30 min. Thereaer, the cells were collected and stored on ice
for 10 min. The extracts were subsequently centrifuged at 12,000 × g and 4°C for 15 min.
The total protein concentration of the cell lysates was quantied using the bicinchoninic
acid protein assay reagent kit (Thermo Fisher Scientic). The total proteins (25 μg) were
loaded onto 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE)
gels and subsequently transferred to nitrocellulose membranes (Hybond®; GE Healthcare
Bio-Sciences, Marlborough, MA, USA). A 5% skim milk solution was used to block the
membrane for 2 h. Thereaer, the membrane was incubated with primary antibodies and
subsequently reacted with peroxidase-conjugated secondary antibodies. To detect the protein
bands, an electrochemiluminescence kit (GE Healthcare Bio-Sciences) was employed. For
immunoprecipitation, the proteins (200 μg) from the cell lysates were added to the indicated
antibodies and incubated at 4°C overnight. Protein A Sepharose® beads (sc2003, Santa Cruz)
were incubated with the mixture at 4°C for 2 h. Final immunoprecipitation samples were
collected and rinsed, and an equal amount of protein was utilized for SDS–PAGE separation,
followed by immunoblotting.
Wound-healing migration assay
Cells (3 × 105/well) were incubated in 6-well plates. A 2-mm-wide pipette tip was used to
scratch the cellular surface. Thereaer, the cells were washed and cultured in fresh medium
supplemented with various EERH concentrations for 24 h. Subsequently, the width of the
wound area was photographed and determined by quantitating cell migration into the
scratched region using ImageJ soware (National Institutes of Health, Bethesda, MD, USA).
17
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

Invasion assay
Cells (2.5 × 104/well) were implanted and incubated in a serum-free culture medium
supplemented with various EERH concentrations for 2 h in the upper chamber of the
incorporated Transwell™ insert with 8-μm polycarbonate pores (Sigma-Aldrich). Thereaer,
culture medium containing 10% FBS was added and kept at 37°C in the lower chamber.
Aer 24-h incubation, the cells invading the lower chamber were washed, xed in ethanol
for 30 min, and subsequently stained with 0.1% crystal violet in 20% ethanol for 30 min.
Photographs were taken and cells counted. The percentage of invading cells was compared
with those in the control group.
Zymography
MMP-9 and MMP-2 activities were evaluated using the gelatin zymographic assay. Cells
were implanted and treated with various EERH concentrations for 24 h. Thereaer, the
conditioned medium was collected, and electrophoresis was performed on a 0.25% gelatin–
polyacrylamide gel. Prior to incubation with renaturing buer (150 mM NaCl, 50 mM Tris-
HCl, and 10 mM CaCl2; pH 7.5) at 37°C overnight, the gel was rinsed with 2.5% Triton X-100
solution for 15 min at room temperature. Finally, the gel was stained with 0.2% Coomassie
blue to visualize gelatinase activities using a light box. White bands were visualized against a
blue background and measured as MMP-9 and MMP-2 gelatinase activities.
EMSA
The nuclear proteins in EERH-treated cells were extracted using the nuclear extraction
kit (AY2002, Panomics). Aer centrifugation, the cells were rinsed and incubated on ice
for 15 min in a buer (10 mM KCl, 10 mM HEPES [pH 7.9], 1 mM DTT, 0.1 mM EGTA,
0.5 mM PMSF, and 0.1 mM EDTA). Subsequently, the cells were reacted with 0.5% NP-40
and centrifuged to obtain a nuclear pellet. Finally, the nuclear extracts were extracted via
incubation at 4°C for 15 min using a buer containing 400 mM NaCl, 20 mM HEPES (pH 7.9),
1 mM PMSF, 1 mM EGTA, 1 mM DTT, and 1 mM EDTA.
Samples (10–20 μg) were blended with 100-fold excess unlabeled oligonucleotides at
4°C for 30 min. In this study, sequences were prepared as follows: AP-1, CTGACCCCTGA
GTCAGCACT T; Sp-1, GCCCAT TCCTTCCGCCCCCAGATGAAGCAG; and NF-κB, CAG
TGGAATT CCCCAGCC. The solutions were subsequently incubated at 4°C for 20 min with a
buer (25 mM HEPES buer [pH 7.9], 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, and 2.5%
glycerol) comprising poly dI/dC (2 μg) and 5 fmol (2 × 104 cpm) from a Klenow end-labeled (32P
adenosine triphosphate) 30-mer oligonucleotide, thus expanding the DNA-binding element of
the MMP-9 and MMP-2 promoter. A 6% PAGE system at 4°C was used to separate the reaction
solution. Aer exposing the gel to an X-ray lm, the values of the gray blots were visually
evaluated using Image-Pro Plus 6.0 soware (Media Cybernetics, Rockville, MD, USA).
HPLC-ultraviolet (UV) analysis of kaempferol from EERH
Samples were prepared for HPLC analysis by dissolving 10 to 20 mg of the petal extracts in
1 mL MeOH. A standard stock solution was prepared by dissolving 1 mg kaempferol in 1 mL
MeOH. All samples were ltered through a 0.45-µm polyvinylidene uoride lter prior to use.
An HPLC system was used, and chromatographic separation was achieved using an INNO
C18 column (250 mm × 4.6 mm, 5 µm; Young Jin Biochrom Co., Ltd., Seongnam, Korea).
A gradient elution of 0.5% acetic acid in water and methanol was used (0–30 min: 50%
methanol, 30–45 min: 50% methanol, and 45–60 min: 50–10% methanol). The owrate and
injection volume were 1 mL/min and 10 μL, respectively. The UV detector was set at 270 nm.
18https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

Statistical analysis
Each experiment was performed in triplicate, and all data are expressed as the mean ± SD.
The data were analyzed using student’s
t
-test, and statistical signicance was set at
P
< 0.05.
RESULTS
EERH inhibited the proliferation of HCT116 cells by arresting the G0/G1 phase
of the cell cycle
MTT assay and cell counting data demonstrated a dose-dependent decrease in HCT116
cell growth upon EERH treatment for 24 h (Fig. 1A and B). This decline in cell growth was
consistent across various EERH concentrations (0, 400, 600, 800, and 1,000 μg/mL), as
19
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
**
*
*
0
120
80
40
(A)
Cell viability (% of control)
EERH (µg/mL)
0 400 600 800 1,000
*
**
*
0
120
80
40
(B)
Cell counting (% of control)
EERH (µg/mL)
0 400 600 800 1,000
0
120
80
40
(D)
Cell viability (% of control)
EERH (µg/mL)
0 400 600 800 1,000
0
120
80
40
(F)
Cell counting (% of control)
EERH (µg/mL)
0 400 600 800 1,000
(C)
Control
EERH (µg/mL)
400 600 800 1,000
Fig. 1. Effect of EERH on the proliferation of human colon cancer HCT116 cells and their morphology. HCT 116 cells
were treated with or without EERH under various concentrations (0, 400, 600, 800, and 1,000 µg/mL) for 24 h.
(A) Cell viability was determined using the MTT assay. (B) Cell counts were performed using a hemocytometer
and microscope. (C) The morphological changes of HCT116 cells were imaged using an inverted microscope (×40
magnification). (D, E) MTT and cell counting assay were performed in EERH-treated FHC colon normal cells.
Values are presented as the mean ± SD of 3 independent experiments (*) compared with the control.
EERH, ethanol extract of Rosa hybrida; HCT116, human colorectal carcinoma cell line; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; FHC, fetal human cell.
*P < 0.05.

depicted in Fig. 1A and B. Similar results were conrmed for cell proliferation via microscopic
examination (Fig. 1C). Additionally, aer 48 h of EERH treatment, the cell growth at 1,000
μg/mL concentration decreased by approximately 20% (Supplementary Fig. 1). In contrast,
EERH treatment did not signicantly aect cell growth in normal colon epithelial FHC cells,
suggesting that EERH selectively inhibits the proliferation of cancer cells (Fig. 1D and E).
Flow cytometry revealed an increased proportion of cells with EERH-induced G0/G1 phase
arrest compared with that in the control group (Fig. 2). This eect was notably observed at
EERH concentrations ranging from 400 to 1,000 μg/mL (Fig. 2).
EERH induced G0/G1 phase arrest via cyclin/CDK complexes downregulation
and p27KIP1 upregulation
Further investigation into the mechanisms underlying EERH-induced G0/G1 arrest focused
on cell-cycle protein regulation during the G0/G1 phase. CDK4 and CyclinD1 protein
expression levels signicantly decreased upon EERH treatment (Fig. 3A). Additionally,
p27KIP1 protein expression exhibited a marked increase compared with that of p21WAF1 and
p53 aer EERH treatment (Fig. 3B). Notably, the increased expression of p27KIP1 responded
to EERH treatment dose-dependently, suggesting the crucial role of p27KIP1 as a cell-cycle
inhibitor (Fig. 3B). Interestingly, p21WAF1 and p53 expression levels did not appear to
relate to EERH-mediated G1-phase cell cycle arrest (Fig. 2). Further investigation revealed a
considerable increase in CDK4/p27KIP1 complex formation in EERH-treated cells (Fig. 3C).
Collectively, these ndings suggest that EERH-induced G1-phase cell cycle arrest in HCT116
cells is associated with CDK4 and cyclin D1 downregulation via upregulation of p27KIP1.
EERH induced the phosphorylation of ERK, JNK, and AKT and inhibited the
phosphorylation of p38
We subsequently performed the immunoblot experiment to identify the regulator y signaling
pathways in EERH-treated HCT116 cells. In HCT116 cells, EERH induced the phosphorylation
of ERK, JNK, and AKT but suppressed that of p38 (Fig. 4A). The EERH-induced
phosphorylation of JNK, ERK, and AKT was conrmed using specic kinase inhibitors
(U0126, SP600125, and LY294002) (Fig. 4B). The results revealed that EERH potentially
20https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
(A)
DNA content index
DNA content profile
GG
S
GM
.
.
.
0
01 2 3 4 5 6 7 8 9 10
350
300
250
200
150
100
50
Count
(B)
DNA content index
DNA content profile
GG
S
GM
.
.
.
0
01 2 3 4 5 6 7 8 9 10
350
300
250
200
150
100
50
Count
(D)
DNA content index
DNA content profile
GG
S
GM
.
.
.
0
01 2 3 4 5 6 7 8 9 10
350
300
250
200
150
100
50
Count
(E)
DNA content index
DNA content profile
GG
S
GM
.
.
.
0
01 2 3 4 5 6 7 8 9 10
350
300
250
200
150
100
50
Count
(C)
DNA content index
DNA content profile
GG
S
GM
.
.
.
0
01 2 3 4 5 6 7 8 9 10
350
300
250
200
150
100
50
Count
0
60
40
20
% Cells
*
*
*
*
GG
***
*
S
***
*
GM
A: Control
B: EERH ( µg/mL)
C: EERH ( µg/mL)
D: EERH ( µg/mL)
E: EERH (, µg/mL)
Fig. 2. EERH induced G0/G1-phase arrest in human colon cancer HCT116 cells. Cells were treated with (A) 0, (B) 400, (C) 600, (D) 800, and (E) 1,000 µg/mL of
EERH for 24 h. Flow cytometry analysis was performed to determine the effect of EERH on the cell cycle. The percentage of cells in each phase is displayed as the
mean ± SD of 3 independent experiments (*).
EERH, ethanol extract of Rosa hybrida; G0/G1, gap 0/gap 1; HCT116, human colorectal carcinoma cell line.
*P < 0.05.

stimulated dierent interconnected signaling pathways during the EERH-stimulated
inhibition of HCT116 cell proliferation (Fig. 4B). These ndings suggest that EERH modulates
cell growth by regulating the p38, JNK, ERK, and AKT pathways.
EERH mitigated the migratory and invasive potential of HCT116 cells
Migration and invasion of HCT116 cells are critical factors in tumor progression, oen
leading to cancer metastasis to distant organs, such as the liver [25,26]. To assess the eect
of EERH on migratory and invasive processes, wound-healing and invasion assays were
21
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
0
1.2
0.8
0.4
Fold of control
CDK
**
*
*
CDK
**
*
*
Cyclin D Cyclin E
Control
EERH (µg/mL)
   ,
A
GAPDH
EERH (µg/mL)
   ,
CDK
CDK
Cyclin D
Cyclin E
0
1.8
1.2
0.6
Fold of control
**
p
*
**
*
p p
B
GAPDH
EERH (µg/mL)
   ,
p
p
p
Control
EERH (µg/mL)
   ,
C
α CDKp
EERH (µg/mL)
   ,
IP: anti CDK
0
15
10
5
Fold of control
*
**
0 400 800600 1,000
EERH (µg/mL)
Fig. 3. EERH altered the expression levels of G0/G1-phase cell cycle-related proteins for 24 h. EERH induced G0/G1-phase cell-cycle arrest by decreasing CDK4
and cyclin D1 expression and increasing p27KIP1 expression. (A, B) HCT116 cells were treated with various concentrations (0, 400, 600, 800, and 1,000 µg/mL) of
EERH for 24 h. Immunoblot analysis was performed using individual antibodies. GAPDH was used as a loading control. (C) IP was confirmed using an anti-CDK4
antibody, followed by immunoblotting with p27KIP1. CDK4 immunoprecipitation was performed using an anti-CDK4 antibody. Values are presented as the mean ±
SD of 3 independent experiments (*) compared with the control.
EERH, ethanol extract of Rosa hybrida; G0/G1, gap 0/gap 1; CDK, cyclin-dependent kinase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IP,
immunoprecipitation; HCT116, human colorectal carcinoma cell line; p27KIP1, cyclin-dependent kinase inhibitor 1B.
*P < 0.05.

conducted. EERH treatment signicantly reduced the migratory capacity of HCT116 cells
(Fig. 5A). In addition, HCT116 cell invasiveness was notably hindered in the presence of
EERH (Fig. 5B). These ndings demonstrate that EERH eectively inhibits the migratory and
invasive capability of HCT116 cells, potentially impeding tumor progression and metastasis.
EERH inhibited MMP-9 and MMP-2 activity by abolishing the binding
capacities of transcriptional factors (Sp-1, AP-1, and NF-κB) in HCT116 cells
MMP-9 and MMP-2 expression levels serve essential roles in HCT116 cell migration and
invasion [25]. Therefore, EERH’s inhibitor y eect on MMP-9 and MMP-2 expression levels
in HCT116 cells was investigated using the gelatin zymographic assay. HCT116 cell treatment
with EERH signicantly attenuated MMP-9 and MMP-2 activity in a dose-dependent manner
22https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
0
2.8
2.1
1.4
0.7
Fold of control
p-ERK/ERK
p-ERK
p-JNK
p-p
p-AKT
AKT
GAPDH
p
JNK
ERK
*
*
*
*
*
***
p-JNK/JNK
*
****
p-pp p-AKT/AKT
Control
EERH (µg/mL)
   ,
EERH (µg/mL)

  ,
(A)
*
#
0
3
2
1
GAPDH
−++−
−−++
p-ERK
ERK
EERH ( µg/mL)
U (. µM)
(B)
Fold of control
−++−
−−++
GAPDH
p-JNK
JNK
EERH ( µg/mL)
SP ( µM)
*
#
0
3
2
1
Fold of control
p-AKT
AKT
−++−
−−++
GAPDH
EERH ( µg/mL)
LY (. µM)
*
#
0
3
2
1
Fold of control
Fig. 4. EERH induced ERK, JNK, and AKT phosphorylation in human colon cancer HCT116 cells for 24 h. HCT116 cells were treated with various concentrations of
EERH (0, 400, 600, 800, and 1,000 µg/mL) for 24 h. (A) EERH increased the phosphorylation of ERK and JNK and decreased that of p38 MAPK in HCT116 cells for
24 h. EERH increased AKT phosphorylation in HCT116 cells for 24 h. (B) HCT116 cells were incubated with specific inhibitors: U0126 (2.5 µM), SP600125 (10 µM),
and LY294002 (2.5 µM) for ERK, JNK, and AKT, respectively, for 30 min, followed by treatment with EERH (600 µg/mL). Immunoblotting was performed using
indicated antibodies against specific antibodies. GAPDH was used as an internal control. Values are presented as the mean ± SD of 3 independent experiments
compared with the control (*) or EERH treatment (#).
EERH, ethanol extract of Rosa hybrida; ERK, extracellular signal-regulated kinases1/2; JNK, c-Jun N-terminal kinases; AKT, protein kinase B; GAPDH,
glyceraldehyde 3-phosphate dehydrogenase; p38 MAPK, p38 mitogen-activated protein kinases; HCT116, human colorectal carcinoma cell line; U0126, MEK
inhibitor; SP600125, JNK inhibitor; LY294002, AKT inhibitor.
*P < 0.05; #P < 0.05.

(Fig. 6A). To further elucidate the molecular mechanism underlying EERH’s eect on MMP
regulation, an EMSA was conducted using nuclear extracts. Briey, the binding anities of
the AP-1, Sp-1, and NF-κB motifs, which are responsible for MMP-9 and MMP-2 expression,
were assessed. EERH strongly suppressed binding abilities to the AP-1, Sp-1, and NF-κB
motifs in HCT116 cells (Fig. 6B). These results indicate that EERH prevented MMP-9 and
MMP-2 expression via the repressive binding activities of the transcription factors Sp-1, AP-1,
and NF-κB in HCT116 cells (Fig. 6B).
EERH fraction contains kaempferol as the key bioactive compound
The presence of bioactive compound was analyzed through HPLC method (Supplementary
Fig. 2A). The EERH fractions were investigated to identify the bioactive components
responsible for their eects on HCT116 cell proliferation. Among the fractions, the d-fraction
exhibited the strongest activity (Supplementary Fig. 2B and C) Comprehensive NMR and
MS analyses identied kaempferol as the predominant bioactive compound in the d-fraction
[30]. Our results conrmed that kaempferol was the main component responsible for the
biological activity observed in HCT116 cells.
DISCUSSION
R. hybrida
, utilized in the nutraceutical and cosmetic industries [27], exhibits diverse
biological properties, such as antioxidant, anti-inammatory, antimicrobial, and
23
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
(A)
**
*
*
0
1.2
0.8
0.4
Wound healing
(fold of control)
EERH (µg/mL)
0 400 600 800 1,000
0 h
24 h
EERH (µg/mL)
400Control 600 800 1,000
(B)
*
**
*
0
1.2
0.8
0.4
Invasion
(fold of control)
EERH (µg/mL)
0 400 600 800 1,000
EERH (µg/mL)
400Control 600 800 1,000
Fig. 5. Effect of EERH on the wound healing migration and invasion of human colon cancer HCT116 cells. (A) Cells (90% confluence) were scratched using a 10
µL-pipette tip and washed twice with PBS to remove the medium. The cells were subsequently treated with EERH (0, 400, 600, 800, and 1,000 µg/mL) for 24 h.
Migration distance was measured using photomicrographs (×40 magnification). (B) The cells were seeded to the upper chamber of a gelatin-coated well and
incubated with EERH (0, 400, 600, 800, and 1,000 µg/mL) for 24 h. Cells invading the lower surface of the membrane were captured using a microscope (×40
magnification). Values are designated as the mean ± SD of 3 independent experiments (*) compared with the control.
EERH, ethanol extract of Rosa hybrida; HCT116, human colorectal carcinoma cell line; PBS, phosphate-buffered saline.
*P < 0.05.

neuroprotective activities [27,28]. This study is the rst to ascertain whether
R. hybrida
extract
exerts suppressive molecular eects on the proliferative, migratory, and invasive activities of
HCT116 cells as a colorectal cancer model.
A key cellular hallmark of tumors is uncontrolled cell-cycle regulation, resulting in aberrant
cell proliferation [31,32]. Several anti-cancer agents arrest specic phases of the cell cycle
[33]. Therefore, controlling proteins that suppress specic cell-cycle phases is a potentially
valuable anti-tumor treatment strategy [33,34]. G1-to-S transition during the mammalian
cell cycle is regulated by CDK/cyclin complexes [35]. Our ndings demonstrate that EERH
induced cell-cycle arrest at the G1 phase in HCT116 cells, suppressing cyclin and CDK
expression. Specically, EERH signicantly reduced the protein expression of CDK4 and its
respective binding partner, cyclin D1. The cell cycle is coordinated by CDKIs, cyclins, and
24https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org
NF-κB ► Sp-1 ►
NF-κB
− − 600 800
−
−−−−
++
+
+
1,000
+
EERH (µg/mL)
Nuclear extract
HeLa extract
(B)
*
**
0
1.2
0.8
0.4
Fold of control
**
**
0
1.2
0.8
0.4
Fold of control
−
AP-1 ►
**
0
1.2
0.8
0.4
Fold of control
AP-1
− − 600 800
−
−−−
++
+
+
1,000
+
Sp-1
− − 600 800
−
− − − −
++
+
+
1,000
+
(A)
0
1.2
0.4
0.8
Zymography
(Fold of control)
*
*
*
*
MMP-9
*
*
*
*
MMP-2
MMP-9 ►
MMP-2 ►
EERH (µg/mL)
4000 600 800 1,000
Fig. 6. EERH suppressed expression levels of MMP-9 and MMP-2 by inhibiting the binding activities of the transcription factors NF-κB, AP-1, and Sp-1 in human
colon cancer HCT116 cells. (A) Cells were treated with EERH (0, 400, 600, 800, and 1,000 µg/mL) for 24 h. The supernatants of indicated cells were employed to
examine MMP-2 and MMP-9 activities using gelatin zymography. (B) Nuclear extracts were collected from the cells and executed EMSA to evaluate the binding
activities of NF-κB, AP-1, and Sp-1. Values are dipicted as the mean ± SD of 3 independent experiments (*) compared with the control.
EERH, ethanol extract of Rosa hybrida; MMP, matrix metalloproteinase; NF-κB, nuclear factor kappa B; AP-1, activator protein 1; Sp-1, specificity protein 1;
HCT116, human colorectal carcinoma cell line; EMSA, electrophoretic mobility shift assay.
*P < 0.05.

CDKs [31,32,36]. CDKIs, such as p27KIP1, bind to cyclin–CDK complexes, downregulating
cell-cycle progression and inhibiting their kinase activities [37]. Clinical investigations have
reported the loss of p27KIP1 expression and cytoplasmic localization of p27KIP1 in colon
cancer [38], where a reduced p27KIP1 level promoted tumor development primarily driven
by oncogenic events [16]. In the present study, EERH controlled the action mode of p27KIP1,
but not that of p53, promoting the binding of p27KIP1 to CDK4, thereby suppressing G1-to-S
cell-cycle phase transition. These results indicate that EERH-induced HCT116 cell inhibition
involves arresting the G1 phase by upregulating p27KIP1.
MAPK and AKT signaling cascades play signicant roles in various biological pathways,
including proliferation, dierentiation, migration, invasion, and inammation, following
growth factor treatment or stress stimulation [18,39]. MAPKs (p38 kinase, JNK, and ERK)
and AKT possess established roles as early responsive kinases in regulating cancer cell
proliferation [40-43]. The phosphorylation of p38, JNK, ERK, and AKT is closely associated
with the inhibition of cell proliferation in several tumor cell lines [18,44]. The MAPK
pathway is involved in the anti-apoptotic process, allowing colorectal cancer cells to survive,
evade apoptosis, and develop chemo-resistance, oen activated aberrantly in patients
with colorectal cancer [39]. Recent studies have elucidated the critical roles of oncogenic
mutations, such as KRAS and BRAF, which occur in approximately 37% and 13% of colorectal
cancers, respectively [18,19]. These mutations lead to dierential activation of downstream
signaling pathways, including the ERK pathway. Specically, BRAFV600E mutations are
associated with robust and sustained ERK activation across various cellular contexts, whereas
KRAS mutations, such as KRASG12V, exhibit a more selective ERK activation that is highly
dependent on the cellular environment [45]. This selective activation results in diverse
cellular outcomes, including reduced proliferation and migration. Our ndings indicate that
EERH aected the increase in JNK, AKT, and ERK phosphorylation and the decrease in p38
phosphorylation in HCT116 cells for 24 h. Studies have cumulatively demonstrated that the
integration of multiple signaling pathways determines cell growth, proliferation, growth
retardation, apoptosis, and dierentiation in tumor progression [46]. Our ndings suggest
that EERH regulates the inhibition of HCT116 cell proliferation via dierential multiple
signaling pathways.
Wound healing migration and invasion experiments have been performed to determine
whether EERH inhibits the metastatic potential of HCT116 cells [47]. Typically, elevated
individual MMP levels strongly and positively correlated with advanced cancer stages
in patients [48]. Both membrane-anchored and secreted MMPs [49] serve crucial roles
in invasion and metastasis through their proteolytic activity [49]. Cancer invasion
and migration constitute the initial step in metastasis, primarily mediated by type IV
collagenases, such as MMP-9 (gelatinase B) and MMP-2 (gelatinase A) [47,50]. Metastasis
involves tumor cells leaving a primary site, migrating to dierent body sites through the
circulatory system, and forming malignant tumors [51]. The liver is a signicant organ for
colorectal cancer metastasis [23]. MMPs selectively degrade various ECM components and
secrete cytokines and growth factors within the ECM [47,50]. Patients with colorectal cancer
display high plasma levels of MMP-9 [47,50]. Bile from patients with metastasis possesses
higher MMP-2 levels than that from those without metastasis [23]. Only invasive colorectal
cancer, not a benign tumor, expresses MMP-2 [52]. Tumor cells may have a better survival
rate within clusters than as individual cells in circulation [48]. The metastatic foci complex
intrinsically includes transendothelial migration and invasion through the subendothelial
basement membrane [48]. In our study, EERH treatment inhibited HCT116 cell migration
25
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

and invasion, a process that co-occurred with a reduction in MMP-9 and MMP-2 enzymatic
activity. A signicant EERH-induced decrease in the wound-healing and invasive ability of
HCT116 cells suggests EERH’s potential for preventing and treating colorectal cancer. EERH
potentially provides a supportive basis for the development of chemotherapeutic reagents for
patients with colorectal cancer.
Numerous studies have suggested that the transcription factors AP-1, Sp-1, and NF-κB
regulate MMP-2 and MMP-9 expression in tumor cells [28]. In addition, 3 major MAPKs,
including the p38, JNK, and ERK pathways, regulate MMP-9 and MMP-2 expression [23].
Our study demonstrated that the inhibitory eect of EERH treatment on these transcription
factors is responsible for reducing MMP-9 and MMP-2 activity. In colorectal cancer cells,
MMP-9 and MMP-2 aid the metastasis and invasion of tumor cells to adjacent tissues or
distant organs. Therefore, EERH treatment’s inhibitory eect on MMP-9 and MMP-2 may be
valuable in impeding tumor migration and invasion. These ndings demonstrate that EERH
prevented the migration and invasion of HCT116 cells via the suppression of MMP-9 and
MMP-2 expression by inhibiting the binding activities of AP-1, Sp-1, and NF-κB motifs.
Kaempferol, a avonoid compound found widely in edible plants and herbs, exhibits a range
of biological activities including antioxidant, anti-inammatory, and anticancer eects
[53,54]. Recent studies have highlighted potential of kaempferol in antitumor activity across
various cancers, such as non-small cell lung cancer, prostate cancer, and pancreatic tumors
[55-58]. Kaempferol regulates key signaling pathways like AKT/PI3K and ERK, and inhibits
the phosphorylation of TIMP2 and MMP-2 [56-58]. Additionally, kaempferol downregulates
the expression of proteins such as Bcl-2, cyclin D1, and claudin-2. It also promotes apoptosis
by upregulating pro-apoptotic factors, including PTEN, Bax, miR-340, and cleaved-caspases
3, 8, and 9 [56,57]. Kaempferol also induce ROS-dependent apoptosis in pancreatic cancer
cells via TGM2-mediated AKT/mTOR signaling [58]. These multifaceted mechanisms
underscore kaempferol’s potential as a broad-spectrum anticancer agent, warranting further
investigation into its therapeutic applications in various cancer models. In our study, the
EERH was fractionated to identify the bioactive components responsible for its eects on
HCT116 cells. The kaempferol present in the d-fraction exhibited the strongest activity in
inhibiting cell proliferation. These ndings emphasize the crucial role of kaempferol in
mediating the antitumor eects of EERH, supporting its potential as a therapeutic agent
across a variety of cancers.
In conclusion, our study elucidated the molecular mechanisms underlying the eects
of EERH on HCT116 cells. Its ndings suggest that EERH inhibits the proliferation of
HCT116 cells via p27KIP1-mediated G1-phase cell-cycle arrest, attributed to a reduction in
the cyclin D1/CDK4 complex. Additionally, HCT116 cell treatment with EERH aects the
phosphorylation of the p38, JNK, ERK, and AKT signaling pathways. Furthermore, EERH
treatment impedes HCT116 cell migration and invasion via diminished MMP-9 and MMP-
2 expression by reducing the binding activities of AP-1, Sp-1, and NF-κB motifs. Chemical
analysis identied kaempferol as the primary bioactive compound driving the antitumor
eects observed in EERH. These ndings further suggest that EERH holds promise in
preventing and treating colorectal cancer. Further studies are required to investigate EERH’s
antitumor ecacy in animal models. Additional work should identify the active components
of EERH available in colon cancer.
26https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

SUPPLEMENTARY MATERIALS
Supplementary Fig. 1
EERH inhibited the proliferation of human colon cancer HCT116 cells aer 48 h of treatment.
The cells were treated with 0, 400, 600, 800, and 1,000 µg/mL of EERH for 48 h. MTT assay
(A) and cell counting (B) were conducted to measure cell viability. Values are presented as the
mean ± SD of 3 independent experiments (*) compared with the control.
Supplementary Fig. 2
Kaempferol identied as the bioactive compound in the EERH fractions. (A) HPLC analysis
conrming the presence of kaempferol as the major component in the d-fraction. (B, C) The
inhibitory eects of various EERH fractions on HCT116 cell proliferation were determined
using the MTT assay and cell counting assay. Values are designated as the mean ± SD of 3
independent experiments (*) compared with the control.
REFERENCES
1. Fleming M, Ravula S, Tatishchev SF, Wang HL. Colorectal carcinoma: pathologic aspects. J Gastrointest
Oncol 2012;3:153-73. PUBMED | CROSSREF
2. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics
2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA
Cancer J Clin 2021;71:209-49. PUBMED | CROSSREF
3. Bertagnolli MM, Warren RS, Niedzwiecki D, Mueller E, Compton CC, Redston M, Hall M, Hahn HP,
Jewell SD, Mayer RJ, et al. p27Kip1 in stage III colon cancer: implications for outcome following adjuvant
chemotherapy in cancer and leukemia group B protocol 89803. Clin Cancer Res 2009;15:2116-22.
PUBMED | CROSSREF
4. Watanabe T, Wu TT, Catalano PJ, Ueki T, Satriano R, Haller DG, Benson AB 3rd, Hamilton SR. Molecular
predictors of survival aer adjuvant chemotherapy for colon cancer. N Engl J Med 2001;344:1196-206.
PUBMED | CROSSREF
5. Neo JH, Ager EI, Angus PW, Zhu J, Herath CB, Christophi C. Changes in the renin angiotensin system during
the development of colorectal cancer liver metastases. BMC Cancer 2010;10:134. PUBMED | CROSSREF
6. Markowitz SD, Bertagnolli MM. Molecular origins of cancer: molecular basis of colorectal cancer. N Engl J
Med 2009;361:2449-60. PUBMED | CROSSREF
7. Boyle P, Ferlay J. Mortality and survival in breast and colorectal cancer. Nat Clin Pract Oncol 2005;2:424-5.
PUBMED | CROSSREF
8. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cip1 is a potent
inhibitor of G1 cyclin-dependent kinases. Cell 1993;75:805-16. PUBMED | CROSSREF
9. Harper JW, Elledge SJ, Keyomarsi K, Dynlacht B, Tsai LH, Zhang P, Dobrowolski S, Bai C, Connell-
Crowley L, Swindell E. Inhibition of cyclin-dependent kinases by p21. Mol Biol Cell 1995;6:387-400.
PUBMED | CROSSREF
10. Waldman T, Kinzler KW, Vogelstein B. p21 is necessary for the p53-mediated G1 arrest in human cancer
cells. Cancer Res 1995;55:5187-90. PUBMED
11. Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D. p21 is a universal inhibitor of cyclin
kinases. Nature 1993;366:701-4. PUBMED | CROSSREF
12. Toyoshima H, Hunter T. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21.
Cell 1994;78:67-74. PUBMED | CROSSREF
13. Koshiji M, Kageyama Y, Pete EA, Horikawa I, Barrett JC, Huang LE. HIF-1α induces cell cycle arrest by
functionally counteracting Myc. EMBO J 2004;23:1949-56. PUBMED | CROSSREF
14. Hershko DD, Shapira M. Prognostic role of p27Kip1 deregulation in colorectal cancer. Cancer
2006;107:668-75. PUBMED | CROSSREF
15. Curran S, Murray GI. Matrix metalloproteinases in tumour invasion and metastasis. J Pathol
1999;189:300-8. PUBMED | CROSSREF
27
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

16. Nickeleit I, Zender S, Kossatz U, Malek NP. p27kip1: a target for tumor therapies? Cell Div 2007;2:13.
PUBMED | CROSSREF
17. Vazquez A, Bond EE, Levine AJ, Bond GL. The genetics of the p53 pathway, apoptosis and cancer therapy.
Nat Rev Drug Discov 2008;7:979-87. PUBMED | CROSSREF
18. Vivanco I, Sawyers CL. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer
2002;2:489-501. PUBMED | CROSSREF
19. Siena S, Sartore-Bianchi A, Di Nicolantonio F, Balfour J, Bardelli A. Biomarkers predicting clinical
outcome of epidermal growth factor receptor-targeted therapy in metastatic colorectal cancer. J Natl
Cancer Inst 2009;101:1308-24. PUBMED | CROSSREF
20. Shin SS, Song JH, Hwang B, Noh DH, Park SL, Kim WT, Park SS, Kim WJ, Moon SK. HSPA6 augments
garlic extract-induced inhibition of proliferation, migration, and invasion of bladder cancer EJ cells;
Implication for cell cycle dysregulation, signaling pathway alteration, and transcription factor-associated
MMP-9 regulation. PLoS One 2017;12:e0171860. PUBMED | CROSSREF
21. Senior RM, Grin GL, Fliszar CJ, Shapiro SD, Goldberg GI, Welgus HG. Human 92- and 72-kilodalton
type IV collagenases are elastases. J Biol Chem 1991;266:7870-5. PUBMED | CROSSREF
22. Marshall DC, Lyman SK, McCauley S, Kovalenko M, Spangler R, Liu C, Lee M, O’Sullivan C, Barry-
Hamilton V, Ghermazien H, et al. Selective allosteric inhibition of MMP9 is ecacious in preclinical
models of ulcerative colitis and colorectal cancer. PLoS One 2015;10:e0127063. PUBMED | CROSSREF
23. Mook OR, Frederiks WM, Van Noorden CJ. The role of gelatinases in colorectal cancer progression and
metastasis. Biochim Biophys Acta 2004;1705:69-89. PUBMED
24. Lee SJ, Cho YH, Kim H, Park K, Park SK, Ha SD, Kim WJ, Moon SK. Inhibitory eects of the ethanol
extract of Gleditsia sinensis thorns on human colon cancer HCT116 cells in vitro and in vivo. Oncol Rep
2009;22:1505-12. PUBMED | CROSSREF
25. Hopkins AL. Network pharmacology: the next paradigm in drug discovery. Nat Chem Biol 2008;4:682-90.
PUBMED | CROSSREF
26. Li Y, Li S, Meng X, Gan RY, Zhang JJ, Li HB. Dietar y natural products for prevention and treatment of
breast cancer. Nutrients 2017;9:728. PUBMED | CROSSREF
27. Choi EM, Hwang JK. Investigations of anti-inammatory and antinociceptive activities of Piper cubeba,
Physalis angulata and Rosa hybrida. J Ethnopharmacol 2003;89:171-5. PUBMED | CROSSREF
28. Lee HR, Lee JM, Choi NS, Lee JM. The antioxidative and antimicrobial ability of ethanol extracts from
Rosa hybrida
. Korean J Food Sci Technol 2003;35:373-8.
29. Lee SJ, Won SY, Park SL, Song JH, Noh DH, Kim HM, Yin CS, Kim WJ, Moon SK. Rosa hybrida extract
suppresses vascular smooth muscle cell responses by the targeting of signaling pathways, cell cycle
regulation and matrix metalloproteinase-9 expression. Int J Mol Med 2016;37:1119-26. PUBMED | CROSSREF
30. Hwang B, Gho Y, Kim H, Lee S, Hong SA, Lee TJ, Myung SC, Yun SJ, Choi YH, Kim WJ, et al.
Rosa hybrida
petal extract exhibits antitumor eects by abrogating tumor progression and angiogenesis in bladder
cancer both in vivo and in vitro. Integr Cancer Ther 2022;21:15347354221114337. PUBMED | CROSSREF
31. Weinberg RA. The retinoblastoma protein and cell cycle control. Cell 1995;81:323-30. PUBMED | CROSSREF
32. Davis RJ. The mitogen-activated protein kinase signal transduction pathway. J Biol Chem 1993;268:14553-6.
PUBMED | CROSSREF
33. Ravishankar D, Rajora AK, Greco F, Osborn HMI. Flavonoids as prospective compounds for anti-cancer
therapy. Int J Biochem Cell Biol 2013;45:2821-31. PUBMED | CROSSREF
34. Gordon EM, Ravicz JR, Liu S, Chawla SP, Hall FL. Cell cycle checkpoint control: the cyclin G1/Mdm2/
p53 axis emerges as a strategic target for broad-spectrum cancer gene therapy - a review of molecular
mechanisms for oncologists. Mol Clin Oncol 2018;9:115-34. PUBMED | CROSSREF
35. Li A, Blow JJ. The origin of CDK regulation. Nat Cell Biol 2001;3:E182-4. PUBMED | CROSSREF
36. Sherr CJ. Cancer cell cycles. Science 1996;274:1672-7. PUBMED | CROSSREF
37. Sherr CJ, Roberts JM. Inhibitors of mammalian G1 cyclin-dependent kinases. Genes Dev 1995;9:1149-63.
PUBMED | CROSSREF
38. Ogino S, Shima K, Nosho K, Irahara N, Baba Y, Wolpin BM, Giovannucci EL, Meyerhardt JA, Fuchs CS. A
cohort study of p27 localization in colon cancer, body mass index, and patient survival. Cancer Epidemiol
Biomarkers Prev 2009;18:1849-58. PUBMED | CROSSREF
39. Yang SY, Miah A, Sales KM, Fuller B, Seifalian AM, Winslet M. Inhibition of the p38 MAPK pathway
sensitises human colon cancer cells to 5-uorouracil treatment. Int J Oncol 2011;38:1695-702. PUBMED |
CROSSREF
40. Chambard JC, Leoch R, Pouysségur J, Lenormand P. ERK implication in cell cycle regulation. Biochim
Biophys Acta 2007;1773:1299-310. PUBMED | CROSSREF
28https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org

41. Chang F, Steelman LS, Shelton JG, Lee JT, Navolanic PM, Blalock WL, Franklin R, McCubrey JA.
Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK pathway (Review). Int J
Oncol 2003;22:469-80. PUBMED
42. Vadlakonda L, Pasupuleti M, Pallu R. Role of PI3K-AKT-mTOR and Wnt signaling pathways in transition
of G1-S phase of cell cycle in cancer cells. Front Oncol 2013;3:85. PUBMED | CROSSREF
43. Wang X, Martindale JL, Holbrook NJ. Requirement for ERK activation in cisplatin-induced apoptosis. J
Biol Chem 2000;275:39435-43. PUBMED | CROSSREF
44. Kamiyama M, Naguro I, Ichijo H. In vivo gene manipulation reveals the impact of stress-responsive MAPK
pathways on tumor progression. Cancer Sci 2015;106:785-96. PUBMED | CROSSREF
45. Brandt R, Sell T, Lüthen M, Uhlitz F, Klinger B, Riemer P, Giesecke-Thiel C, Schulze S, El-Shimy IA,
Kunkel D, et al. Cell type-dependent dierential activation of ERK by oncogenic KRAS in colon cancer
and intestinal epithelium. Nat Commun 2019;10:2919. PUBMED | CROSSREF
46. Lin A. Activation of the JNK signaling pathway: breaking the brake on apoptosis. BioEssays 2003;25:17-24.
PUBMED | CROSSREF
47. Shin DY, Lu JN, Kim GY, Jung JM, Kang HS, Lee WS, Choi YH. Anti-invasive activities of anthocyanins
through modulation of tight junctions and suppression of matrix metalloproteinase activities in HCT-116
human colon carcinoma cells. Oncol Rep 2011;25:567-72. PUBMED | CROSSREF
48. Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev
2006;25:9-34. PUBMED | CROSSREF
49. Bauvois B. New facets of matrix metalloproteinases MMP-2 and MMP-9 as cell surface transducers:
outside-in signaling and relationship to tumor progression. Biochim Biophys Acta 2012;1825:29-36.
PUBMED | CROSSREF
50. Tien YW, Lee PH, Hu RH, Hsu SM, Chang KJ. The role of gelatinase in hepatic metastasis of colorectal
cancer. Clin Cancer Res 2003;9:4891-6. PUBMED
51. Matrisian LM. Metalloproteinases and their inhibitors in matrix remodeling. Trends Genet 1990;6:121-5.
PUBMED | CROSSREF
52. Zeng ZS, Cohen AM, Guillem JG. Loss of basement membrane type IV collagen is associated with
increased expression of metalloproteinases 2 and 9 (MMP-2 and MMP-9) during human colorectal
tumorigenesis. Carcinogenesis 1999;20:749-55. PUBMED | CROSSREF
53. Ren J, Lu Y, Qian Y, Chen B, Wu T, Ji G. Recent progress regarding kaempferol for the treatment of various
diseases. Exp Ther Med 2019;18:2759-76. PUBMED | CROSSREF
54. Calderón-Montaño JM, Burgos-Morón E, Pérez-Guerrero C, López-Lázaro M. A review on the dietary
avonoid kaempferol. Mini Rev Med Chem 2011;11:298-344. PUBMED | CROSSREF
55. Wang F, Wang L, Qu C, Chen L, Geng Y, Cheng C, Yu S, Wang D, Yang L, Meng Z, et al. Kaempferol
induces ROS-dependent apoptosis in pancreatic cancer cells via TGM2-mediated Akt/mTOR signaling.
BMC Cancer 2021;21:396. PUBMED | CROSSREF
56. Sonoki H, Tanimae A, Endo S, Matsunaga T, Furuta T, Ichihara K, Ikari A. Kaempherol and luteolin
decrease claudin-2 expression mediated by inhibition of STAT3 in lung adenocarcinoma A549 cells.
Nutrients 2017;9:597. PUBMED | CROSSREF
57. Zhao Y, Wang L, Huang Q, Jiang Y, Wang J, Zhang L, Tian Y, Yang H. Radiosensitization of non-small cell
lung cancer cells by inhibition of TGF-β1 signaling with SB431542 is dependent on p53 status. Oncol Res
2016;24:1-7. PUBMED | CROSSREF
58. Qin Y, Cui W, Yang X, Tong B. Kaempferol inhibits the growth and metastasis of cholangiocarcinoma in
vitro and in vivo. Acta Biochim Biophys Sin (Shanghai) 2016;48:238-45. PUBMED | CROSSREF
29
https://doi.org/10.4162/nrp.2025.19.1.14
Effect of Rosa hybrida on colon cancer cells
https://e-nrp.org