ArticlePDF Available

Structural and functional analysis of the Nipah virus polymerase complex

February 2025
Cell

DOI:10.1016/j.cell.2024.12.021

License
CC BY 4.0

Authors:

Side Hu

Harvard Medical School

Heesu Kim

Boston University

Yuemin Bian

Shanghai University

Show all 11 authorsHide

Nipah virus (NiV) is a bat-borne, zoonotic RNA virus that is highly pathogenic in humans. The NiV polymerase, which mediates viral genome replication and mRNA transcription, is a promising drug target. We determined the cryoelectron microscopy (cryo-EM) structure of the NiV polymerase complex, comprising the large protein (L) and phosphoprotein (P), and performed structural, biophysical, and in-depth functional analyses of the NiV polymerase. The L protein assembles with a long P tetrameric coiled-coil that is capped by a bundle of ⍺-helices that we show are likely dynamic in solution. Docking studies with a known L inhibitor clarify mechanisms of antiviral drug resistance. In addition, we identified L protein features that are required for both transcription and RNA replication and mutations that have a greater impact on RNA replication than on transcription. Our findings have the potential to aid in the rational development of drugs to combat NiV infection.

Interactions between NiV P and L RdRp (A) Ribbon diagram of the NiV L-P complex. Interactions between L and tetrameric P occur over four main regions, which are indicated by dashed boxes with detailed interactions provided in (B)-(E). (B) Interactions between the P2-XD ⍺-helices and the L RdRp domain. (C) Interactions between the P2 linker, which connects the P2 OD with the P2-XD, and the L RdRp domain. (D) Interactions between the P1, P2, and P4 and the L RdRp domain. (E) Interaction between the P4 peptide extension and the L RdRp domain. L residues mutated in functional assays (Q454 and C457) are indicated with an asterisk. See also Figure S4.

…

Basis for resistance of NiV L to a broad-spectrum paramyxovirus inhibitor (A) Sequence alignment of L protein residues 1164 to 1167 in the CAP domain for the indicated viruses. The broad-spectrum inhibitor GHP-88309 is active against the viruses indicated by the filled circles. 44 (B-D) Docking of GHP-88309 into the predicted binding site in PIV3 L (B), NiV L (C), or NiV L H1165Y mutant (modeled in silico) (D). Predicted interactions or distances between the ring nitrogen of the inhibitor and contacting amino acids are shown as black dashed lines. Residues with asterisks are sites of L substitutions that affect inhibitor susceptibility (see Figures S5B and S5C). (E) Clipping surface showing the position of the GHP-88309 docked in NiV L. The RdRp and CAP domains are shown as surfaces and clipped to reveal template entry and exit channels. (F) Clipping surface showing the position of modeled template and nascent RNA in an AF3 26 prediction of NiV L bound to RNA and nucleotide. An incoming GTP molecule shown as sticks for orientation, but note that the clipping surface does not include the NTP entrance channel, which is out of the plane of view. Active site metals are not shown for clarity. See Figure S5D for pLDDT scores. See also Figure S5.

…

Functional analysis of the intrusion loop using a NiV minigenome system (A) Primer extension analysis of positive-sense RNA generated by the NiV polymerase in the single-step minigenome system, using the primer indicated in Figure 6A. The upper and lower panels show a phosphorimage scan of the same gel, with the intervening region excised. (B) Quantification of the levels of 3 0 le (gray bars) and gs (white bars) initiation products from replicates of the experiment shown in (A). The bars show the mean and SD from three independent experiments for each mutant, except for the H1347A/R1348A (HR) mutant (n = 6). (C) Northern blot analysis of RNAs generated in the single-step minigenome system. The upper panel shows negative-sense minigenome template RNA generated by T7 RNA polymerase. The lower panel shows the corresponding positivesense antigenome RNA and CAT mRNA generated by the NiV polymerase. Note that the antigenome RNA co-migrates with a background band. (D) Quantification of levels of mRNA from replicates of the northern blots shown in (C). The bars show the mean and SD from three independent experiments for each mutant. (E) Northern blot analysis of RNAs generated in the multi-step minigenome system. The upper panel shows negative-sense minigenome template RNA generated by T7 RNA polymerase and amplified by NiV polymerase. The lower panel shows the corresponding positive-sense antigenome RNA and CAT mRNA generated by the NiV polymerase. (F) Quantification of levels of antigenome (gray bars) and minigenome (hatched bars) from replicates of the northern blots shown in (E). The bars show the mean and SD from three independent experiments for each mutant.

…

Figures - uploaded by Heesu Kim

Content may be subject to copyright.

Content uploaded by Heesu Kim

Content may be subject to copyright.

Article

Structural and functional analysis of the Nipah virus

polymerase complex

Graphical abstract

Highlights

dCryo-EM structure of the NiV L-P complex determined

dDocking studies with an inhibitor clarify mechanisms of

intrinsic NiV L resistance

dPalm insert, zinc ﬁngers, and P4 extension are critical for NiV

L activity

dIntrusion loop plays an essential role in RNA replication

Authors

Side Hu, Heesu Kim, Pan Yang, ...,

Yuemin Bian, Rachel Fearns,

Jonathan Abraham

Correspondence

rfearns@bu.edu (R.F.),

jonathan_abraham@hms.harvard.edu

(J.A.)

In brief

The cryo-EM structure and mutational

analysis of the Nipah virus polymerase

complex identify features critical for RNA

replication and transcription with the

potential to aid in the development of

antivirals.

Hu et al., 2025, Cell 188, 1–16

February 6, 2025 ª2024 The Authors. Published by Elsevier Inc.

https://doi.org/10.1016/j.cell.2024.12.021 ll

Article

Structural and functional analysis

of the Nipah virus polymerase complex

Side Hu,

1,9

Heesu Kim,

2,9

Pan Yang,

1,9

Zishuo Yu,

Barbara Ludeke,

Shawna Mobilia,

Junhua Pan,

Margaret Stratton,

Yuemin Bian,

Rachel Fearns,

*and Jonathan Abraham

1,6,7,8,10,

Department of Microbiology, Blavatnik Institute, Harvard Medical School, Boston, MA, USA

Department of Virology, Immunology & Microbiology, Boston University Chobanian & Avedisian School of Medicine, Boston, MA, USA

Biomedical Research Institute and School of Life and Health Sciences, Hubei University of Technology, Wuhan, China

Department of Biochemistry and Molecular Biology, University of Massachusetts, Amherst, MA, USA

School of Medicine, Shanghai University, Shanghai, China

Department of Medicine, Division of Infectious Diseases, Brigham & Women’s Hospital, Boston, MA, USA

Center for Integrated Solutions in Infectious Diseases, Broad Institute of Harvard and MIT, Cambridge, MA, USA

Howard Hughes Medical Institute, Boston, MA, USA

These authors contributed equally

Lead contact

*Correspondence: rfearns@bu.edu (R.F.), jonathan_abraham@hms.harvard.edu (J.A.)

https://doi.org/10.1016/j.cell.2024.12.021

SUMMARY

Nipah virus (NiV) is a bat-borne, zoonotic RNA virus that is highly pathogenic in humans. The NiV polymerase,

which mediates viral genome replication and mRNA transcription, is a promising drug target. We determined

the cryoelectron microscopy (cryo-EM) structure of the NiV polymerase complex, comprising the large protein

(L) and phosphoprotein (P), and performed structural, biophysical, and in-depth functional analyses of the NiV

polymerase. The L protein assembles with a long P tetrameric coiled-coil that is capped by a bundle of ⍺-he-

lices that we show are likely dynamic in solution. Docking studies with a known L inhibitor clarify mechanisms

of antiviral drug resistance. In addition, we identiﬁed L protein features that are required for both transcription

and RNA replication and mutations that have a greater impact on RNA replication than on transcription. Our

ﬁndings have the potential to aid in the rational development of drugs to combat NiV infection.

INTRODUCTION

Nipah virus (NiV) is an enveloped RNA virus in the family Para-

myxoviridae of the order Mononegavirales, the non-segmented

negative-strand RNA viruses (nsNSVs).

In humans, NiV infection

can lead to respiratory illness or encephalitis with a fatality rate

ranging from 40% to 70%.

Since the identiﬁcation of NiV in

Malaysia in 1998, spillover events from bats into humans have

occurred almost annually in Bangladesh, and NiV has also

caused outbreaks in India and in the Philipines.

3–5

Although prior

outbreaks have been limited in size, NiV may have pandemic po-

tential because infected individuals can be asymptomatic, and

the virus can be transmitted from person to person with

droplet-based transmission through coughing.

There is no vac-

cine or antiviral against NiV infection, highlighting a gap in public

health preparedness. For these reasons, NiV is on the World

Health Organization Research & Development Blueprint list of

priority diseases for which there is an urgent need for acceler-

ated research and countermeasure development.

The NiV genome is a single strand of negative-sense RNA that

is transcribed and replicated by the viral polymerase. During

transcription, the polymerase generates capped and polyadeny-

lated monocistronic mRNAs, corresponding to each of the viral

genes.

6–9

During replication it produces full-length, encapsi-

dated replicative RNAs, which are uncapped and lack a poly A

tail.

7–9

The NiV polymerase comprises the large protein (L) and

phosphoprotein (P).

10,11

By analogy with the polymerases of

other nsNSVs, the L protein comprises ﬁve domains: the RNA-

dependent RNA polymerase (RdRp) domain, the capping

domain (CAP), the connector domain (CD), the methyltransfer-

ase (MTase) domain, and the C-terminal domain (CTD).

7–9,12

The P protein serves as an adaptor that allows the polymerase

to associate both with the encapsidated ribonucleoprotein

(RNP) template and with soluble nucleoprotein (N) protein that

is required to encapsidate replicative RNA as it is synthesized.

7–9

P contains an intrinsically disordered N-terminal domain (NTD), a

central oligomerization domain (OD), and a C-terminal X domain

(XD). The CTD of P binds the RNP template, and the NTD of P

binds soluble N protein for encapsidation.

13–16

Although several nsNSV polymerase structures are available,

how the features identiﬁed within them facilitate different poly-

merase functions is generally poorly deﬁned, and it is not fully un-

derstood how the polymerase is regulated to ‘‘switch on’’ and

‘‘switch off’’ the different enzymatic activities that are required

OPEN ACCESS

Cell 188, 1–16, February 6, 2025 ª2024 The Authors. Published by Elsevier Inc. 1

This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

for mRNA transcription versus genome replication.

More com-

plete analyses of the relationship between polymerase structure

and function are necessary to clarify how the polymerase transi-

tions between different enzymatic activities and produces

different RNA products. Additionally, understanding the func-

tional properties of key features will help identify those that could

be leveraged as drug targets.

Here, we determined the 2.3 A

˚cryoelectron microscopy

(cryo-EM) structure of the NiV L-P complex, which reveals how

tetrameric P interacts with L. Structure-function analyses using

single-step and multi-cycle NiV minigenome assays identify fea-

tures of the polymerase that are required for transcription and/or

genome replication, providing information that has the potential

to aid rational design of antiviral molecules against NiV.

RESULTS

Expression and puriﬁcation of NiV L-P

We co-expressed full-length NiV L and P in insect cells (Fig-

ure 1A), puriﬁed L-P complexes, and analyzed samples of puri-

ﬁed complexes by SDS-PAGE analysis (Figure S1A) and liquid

chromatography-mass spectrometry (LC-MS/MS; Data S1).

Analysis of samples by mass photometry revealed a major

peak of 559 kDa, which likely represents L bound to four copies

of P (L-P

complex) (Figure 1B). The L-P complex was active in

an in vitro RNA synthesis assay using an oligonucleotide RNA

template containing the NiV promoter sequence and nucleoside

triphosphates (NTPs) (Figures 1C, 1D, and S1B).

Structure of the NiV L-P complex

We used single-particle cryo-EM to determine the structure of

the NiV L-P complex to a global resolution of 2.3 A

(Figures S1C–S1E; Table S1). NiV L-P is shaped like a tobacco

pipe, with the stem formed by the tetrameric P OD (Figures 1E

and 1F). We observed interpretable density for L residues 5–

1463, encompassing the RdRp and CAP domains, and for the

P tetramer (P1–P4), of which we could observe different lengths

for individual protomers (P1: residues 479–584, P2: 479–708, P3:

477–579, and P4: 479–596) (Figure 1A). Although we observed

low-resolution features in 3D volumes during the earlier steps

of data processing that are consistent with the presence of the

L CD, MTase domain, and CTD, these features were lost during

additional steps of data processing (Figure S1C). Therefore, like

in the structures of the L proteins of respiratory syncytial virus

(RSV) and human metapneumovirus (HMPV) (Pneumoviridae),

the three L C-terminal globular domains in NiV L are probably

too ﬂexible to be visualized by cryo-EM

18–23

(Data S2). For the

RdRp and CAP domains that could be resolved, root-mean-

square deviation values based on the Caranged from 1.7 to

4.7 A

˚between NiV and other nsNSV L proteins (Figure S1F), indi-

cating structural conservation, consistent with the generally

similar transcription and replication mechanisms of nsNSVs.

In the cryo-EM map, the N-terminal end of the OD of the

NiV P tetramer is capped with a mushroom-shaped density

(Figures 1E, S1C, and S1E). Focused reﬁnement on this region

allowed us to resolve individual ⍺-helices, allowing us to model

the region based on a crystal structure of the NiV P OD.

The

⍺-helices form a bundle that folds back onto the outer aspects

of the coiled-coil core (Figure 1F), a feature observed in crystal

structures of the NiV and Sendai virus (SeV) (paramyxovirus)

phosphoproteins.

15,24,25

These prior studies relied on truncated

P constructs comprising only the OD, rather than full-length

15,24,25

Observing the mushroom-shaped cap structure in the

NiV L-P complex reveals that this feature is present when full-

length P associates with L without the potential conformational

biases that could have been introduced by crystallization of P

OD in isolation.

Features of the NiV L protein

The NiV L RdRp domain has a conventional right-hand ‘‘ﬁngers-

palm-thumb’’ organization containing seven motifs involved in

catalysis (A–G), like other nsNSV RdRp domains (Figures 2A

and 2B). Motifs A–E are in the palm while motifs F and G are in

the ﬁngers. Motif C contains a ‘‘GDNE’’ motif (residues 831–

834), which is part of the active site (Figure S2A; Data S3). In

the unliganded active site, protrusion of the b-hairpin loop in

motif F in the ﬁngers domain positions the side chain of R551

near (within 5 A

˚) motif C residue D832 (part of the GDNE motif;

Figure 2C). R551 is universally conserved in nsNSV polymerases

(Figure S2A; Data S3). Prediction of an RNA duplex- and nucle-

otide-bound NiV L with AlphaFold 3 (AF3)

suggests the side

chain of R551 interacts with the phosphates of the incoming

nucleotide during RNA elongation, while the side chains of

D832 (motif C) and D722 (motif A) coordinate active site metals

(Figures 2D and S2D). Interestingly, in the cryo-EM structure of

L-P complexes for parainﬂuenza virus type 3 (PIV3), visualized

without RNA or incoming nucleotide, the analogous motif F argi-

nine is also positioned toward the motif C catalytic aspartate and

an associated active site magnesium (Figures S2B, S2C, and

S2E),

supporting AF3 predictions of the NiV L active site.

In the assembled NiV L-P complex, there are channels for NTP

entry, template entry, template exit, and nascent RNA exit

(Figures 2E and 2F). The template entrance channel, identiﬁed

by analogy to the Ebola virus (EBOV) and RSV L protein-promoter

RNA-bound structures,

18,31

involves surfaces of the RdRp and

CAP domains (Figure 2F). The putative template exit channel,

identiﬁed by analogy with other viral RdRps, is within the CAP

domain (Figure 2F).

The putative nascent RNA exit channel is

formed by the RdRp domain and the CAP domain on the opposite

side of L relative to the template entrance channel.

A distinctive feature in the NiV RdRp domain, when compared

with that of most other nsNSV polymerases, lies in the region

found between NiV L residues 600–713, which is located imme-

diately N-terminal to motif A in the palm domain (Figures 2A and

2B). We did not observe cryo-EM density for residues 603–709

within this loop. Primary sequence alignments (Figure 2G; Data

S3)

32,33

show that this region of henipavirus and parahenipavirus

L proteins has additional sequence, ranging from 100 to > 200

amino acid residues in length, compared with other nsNSVs,

including most other paramyxoviruses. We refer to this addi-

tional sequence as the palm insert. Other than the large size

and general feature of being rich in lysine and asparagine

residues, there is substantial divergence in the henipavirus and

parahenipavirus palm insert sequences, although it is mostly

conserved among closely related viruses when they are exam-

ined as pairs (Figures 2H and S2F–S2J).

OPEN ACCESS

2Cell 188, 1–16, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

The boundary residues that we could observe for the palm

insert, S602 and T710, are relatively close to each other in the

structure (only 10 A

˚apart) and are located near the putative

nascent RNA exit channel (Figure 2E). The proximity of the

N- and C-terminal regions of the loop and disorder in cryo-EM

maps suggests that the insert may form an appendage that

does not contribute to the fold of the RdRp domain. To test

this hypothesis, we generated NiV L that lacks residues 604–

704 (NiV L

D-P.I

.) and co-expressed it with P in insect cells. Puri-

ﬁed particles examined by negative stain electron microscopy

had a similar shape to particles for the wild-type (WT) NiV L-P

complex (Figures 2I and S2K–S2M). These ﬁndings conﬁrmed

that the palm insert does not contribute to the fold of the RdRp

domain.

The CAP domain

The CAP domain of nsNSV polymerases plays roles in RNA

synthesis initiation and elongation, in addition to catalyzing

the polyribonucleotidyltransferase (PRNTase) step of cap addi-

tion.

7,8,12,34

For vesicular stomatitis virus (VSV), the CAP domain

A B

Figure 1. Structure of the NiV L-P complex

(A) Domain organization of the NiV L and P proteins. The regions of tetrameric P protein that could be resolved vary in length depending on the protomer (P1–P4),

as indicated. P NTD, OD, CTD, and XD boundaries are indicated based on established boundaries.

(B) Mass photometry analysis of puriﬁed NiV L-P complex. The 559 kDa peak likely represents the L-P

complex, the 483 kDa peak is consistent with an L-P

complex, the 248 kDa peak may correspond to the L protein alone, and the 1098 kDa peak may represent L-P

dimers. The 135 kDa and 66 kDa peaks may

represent degradation products or contaminants. This experiment was performed twice, with representative data shown.

(C) Workﬂow diagram of the RNA synthesis assay. The template is the leader (le) sequence of NiV, nucleotides 1–17. The GTP tracer and its incorporation in the

product are in red.

(D) RNA synthesis assay with radioactive products migrated on a denaturing polyacrylamide gel. nt, nucleotide. This experiment was performed four times with

two different L-P preparations, with representative data shown. Note that some product bands migrated as doublets, and products longer than expected were

also generated (indicated with a vertical line). These are likely generated by polymerase stuttering on the template. See also Figure S1B.

(E) Cryo-EM density map of the NiV L-P complex with L domains and P protomers colored as indicated. Two views are shown.

(F) NiV L-P complex with L domains and P protomers colored as indicated.

See also Figure S6

OPEN ACCESS

10 Cell 188, 1–16, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

function, we generated ﬁve additional L mutants. Each of these

residues was individually substituted with alanine, and the

mutant L proteins were tested in the same set of assays as

described above.

Western blot analysis conﬁrmed that each of the L mutants

was efﬁciently expressed relative to WT L protein (Figures S6L

and S6O). Primer extension analysis of the RNA generated by

the L mutants showed a range of phenotypes. Substitution of

T1341 and Q1355 had minimal effect on RNA initiated from the

30end of the le or the ﬁrst gs signal; by contrast, substitution of

F1358 completely inhibited both antigenome and mRNA initia-

tion (Figures 7A and 7B). Substitution of N1344 and L1345 in-

hibited antigenome initiation from the 30end of the le region to

less than 20% of WT levels but had only a modest inhibitory

effect on mRNA initiation from the gs signal (Figures 7A and

7B; note that in Figure 7A the upper and lower panels are derived

from the same gel, allowing direct comparison of RNA levels

within the same reaction). Northern blot analysis of mRNAs

generated in the single-step minigenome assay conﬁrmed that

the T1341A, N1344A, L1345A, and Q1355A L mutants were all

capable of mRNA transcription, albeit at moderately reduced

levels compared with WT polymerase (Figures 7C and 7D).

Luciferase assays showed a similar pattern of gene expression

by each of the mutants as was determined by measuring

mRNA levels with their activities being ranked as follows:

T1341A > Q1355A > N1344A > L1354A > H1347A/R1348A and

F1358A (Figure S6Q). Curiously, the levels of luciferase activity

for the T1341A, Q1355A, N1344A, and L1354A mutants relative

to WT L were slightly lower than the relative levels of mRNA

(compare Figure S6Q with Figures 7B and 7D). It is possible

that these intrusion loop mutations affect the nature of the cap

that is added and/or inhibit cap methylation, thus impairing

mRNA translation, although further research is required to test

these hypotheses.

Assessment of the L mutants in the multi-cycle minigenome

system conﬁrmed that N1344A, L1345A, and F1358A mutants

were highly defective in RNA replication (Figures 7E and 7F).

These mutant L proteins also failed to generate detectable

mRNA in the multi-cycle minigenome system (Figures 7E

and 7F). This is likely because the inhibitory effect of the mu-

tations on RNA replication would have signiﬁcantly reduced

the amount of properly encapsidated minigenome template

Figure 7. Functional analysis of the intru-

sion loop using a NiV minigenome system

(A) Primer extension analysis of positive-sense

RNA generated by the NiV polymerase in the sin-

gle-step minigenome system, using the primer

indicated in Figure 6A. The upper and lower panels

show a phosphorimage scan of the same gel, with

the intervening region excised.

(B) Quantiﬁcation of the levels of 30le (gray bars)

and gs (white bars) initiation products from repli-

cates of the experiment shown in (A). The bars

show the mean and SD from three independent

experiments for each mutant, except for the

H1347A/R1348A (HR) mutant (n=6).

the single-step minigenome system. The upper

panel shows negative-sense minigenome tem-

plate RNA generated by T7 RNA polymerase. The

lower panel shows the corresponding positive-

sense antigenome RNA and CAT mRNA gener-

ated by the NiV polymerase. Note that the anti-

genome RNA co-migrates with a background

band.

(D) Quantiﬁcation of levels of mRNA from repli-

cates of the northern blots shown in (C). The bars

show the mean and SD from three independent

experiments for each mutant.

(E) Northern blot analysis of RNAs generated in the

multi-step minigenome system. The upper panel

shows negative-sense minigenome template RNA

generated by T7 RNA polymerase and ampliﬁed

by NiV polymerase. The lower panel shows the

corresponding positive-sense antigenome RNA

and CAT mRNA generated by the NiV polymerase.

(F) Quantiﬁcation of levels of antigenome (gray

bars) and minigenome (hatched bars) from repli-

cates of the northern blots shown in (E). The bars

show the mean and SD from three independent

experiments for each mutant.

OPEN ACCESS

Cell 188, 1–16, February 6, 2025 11

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

that was available in these reactions compared with the reac-

tions with WT L protein (note that there is a large difference in

the amount of encapsidated (nuclease-resistant) minigenome

template available if the minigenome can be replicated, e.g.,

compare the L WT + MC and L WT + SS samples in

Figures S6C and S6E). These results show that the intrusion

loop has two separate and distinguishable roles in mRNA tran-

scription and genome replication.

DISCUSSION

NiV depends on its L-P polymerase complex to perform all the

enzymatic activities required to generate capped and polyade-

nylated mRNAs and replicative RNAs. Here we determined the

structure of the L-P complex and performed functional analysis

of some features that are shared with other nsNSV polymerase

and features that have been speciﬁcally observed in the NiV

polymerase.

Both transcription and RNA replication are dependent on the

polymerase being able to associate with the template RNP com-

plex, dissociate N protein from the RNA, and feed the RNA into

the template entry channel. It is thought that P plays a key role

in this process. We detected a region of one of the P molecules,

P4, snaking along the surface of L on the opposite face of the po-

lymerase from P2-XD and close to the template entry channel

(Figure 4A). The Q454R/C457E double substitution, which we

used to disrupt the L interaction with P4, did not affect L protein

expression (Figures S6J and S6M) but reduced transcription and

RNA replication compared with WT levels (Figures 6 and S6R).

These ﬁndings suggest that this L-P interface plays an equivalent

role in both processes. The P4 extension binding close to the

template entrance channel might allow P4-XD to play a role in

helping to guide the RNP toward the template entrance channel.

Another feature that might be involved in guiding RNA is the

palm insert (amino acids 603–709), which is close to the putative

nascent RNA exit channel (Figures 2E–2G). Studies with other

paramyxovirus polymerases have shown this region is important

for polymerase activity but did not distinguish if it affected tran-

scription and/or replication.

27,50

Here, we show that the NiV palm

insert plays a key role during transcription and RNA replication

(Figures 6 and S6R). Interestingly, the corresponding palm insert

region of PIV3 L is also largely disordered, but the C-terminal

segment of the region forms a b-strand that augments a b-sheet

in the CTD (‘‘b-latch’’) that may restrict the conformation of the L

C-terminal globular domains.

In the NiV L-P structure, the palm

insert and the C-terminal globular domains are not visible; by

analogy to the PIV3 L structure, however, the C-terminal region

of the NiV L RdRp palm insert could interact with the C-terminal

globular domains.

The ﬁndings presented here demonstrate the multifunctional

nature of the NiV L protein CAP domain. By analogy with the

rhabdovirus polymerases, the CAP domain contains residues

necessary for the GTPase and PRNTase steps of cap addition

and is expected to be required for mRNA transcription. However,

studies presented here show the importance of the CAP domain

for RNA replication in addition to transcription. We examined the

roles of two ZF motifs in CAP, which are conserved among many

nsNSVs (Figures 3A–3C and S3A–S3C). As noted above, ZF1

appears to aid structural integrity of the L protein. However, mu-

tations in both ZF motifs reduced the relative amounts of a trun-

cated form of L, which is presumably generated by cleavage at

the palm insert (Figure S6K). This observation could suggest

direct or long-range interactions between the ZF motifs and

the palm insert or that the ZF motifs inﬂuence the conformational

dynamics of the RdRp core. Substitutions in each of the ZF mo-

tifs inhibited replication in addition to transcription (Figures 6 and

S6R), suggesting that they might play a role common to both

processes. Intriguingly, a structure of the VSV polymerase in as-

sociation with RNP within virions showed that it is oriented such

that the ZF motifs of the CAP are proximal to the N protein of the

RNP.

Thus, it is possible that the ZF motifs aid polymerase as-

sociation with the RNP template.

The other feature of the CAP domain that is required for both

transcription and replication is the intrusion loop. The intrusion

loop can be identiﬁed as a loop in all nsNSV polymerase struc-

tures that have been determined so far (Figures S3D–

S3I).

27,37–39,41,42

The intrusion and priming loops are less or-

dered in the NiV L protein structure than in other paramyxovirus

L protein structures (Figures 3F and S3D–S3F). Here, we exam-

ined the role of the intrusion loop with a panel of substitution mu-

tants. Two of the mutants that were tested were completely

defective in mRNA transcription, namely the H1347A/R1348A

and F1358A mutants (Figures 6,7, and S6R). The HR motif cat-

alyzes the PRNTase reaction required for mRNA cap addition,

and so the H1347A/R1348A mutation could inhibit transcription

by inhibiting cap addition. The mechanism of transcription inhibi-

tion by the F1358A mutation is not known. Both the HR motif and

F1358 also play a role in RNA replication (which does not involve

a cap addition step) (Figures 6,7, and S6R). Likewise, other mu-

tations in the intrusion loop, N1344A, L1345A, and Q1355A, also

inhibited RNA replication, with Q1355A having a more minor ef-

fect. Importantly, the N1344A and L1345A mutations had a more

profound inhibitory effect on RNA replication than mRNA tran-

scription (Figures 7A, 7B, and S6R).

While transcription and replication are distinct processes,

many of the initial steps are shared, including template binding,

promoter recognition, and RNA synthesis initiation at the 30end

of the le region and nascent RNA elongation. The observation

that the N1344A and L1345A mutants could perform each of

these steps during transcription suggests that they were defec-

tive in a step that is speciﬁc to RNA replication. These ﬁndings

are reminiscent of ﬁndings made with RSV polymerase, which

showed that substitution of the threonine residue of the GxxT

motif in the priming loop (T1267) or the arginine residue of

the HR motif of the intrusion loop (R1339) inhibited RNA replica-

tion.

Analysis of the abortive replicative RNAs generated by the

RSV L T1267A and R1339A mutants showed that both mutants

could initiate RNA replication at le position 1U, but rather than

elongating the products to make antigenome RNA, they released

the RNA before they reached the end of the le promoter region.

Given that elongation during RNA replication is thought to be

facilitated by concurrent encapsidation, it seems likely that mu-

tations in the intrusion loop (and the priming loop in the case of

RSV) either directly or indirectly inhibit encapsidation of the

nascent replicative RNA. We suggest that, given that the intru-

sion loop (including the residues we mutated for functional

OPEN ACCESS

12 Cell 188, 1–16, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

analyses) is adjacent to the nascent RNA exit channel

(Figures S3K and S3L), it might help to guide the nascent RNA

appropriately for encapsidation.

Perhaps the most distinctive feature of the complex compared

with that of other nsNSV L-P structures is the ⍺-helical cap struc-

ture at the N-terminal end of the P OD (Data S2). Both cryo-EM

3D variability analysis and molecular dynamics analysis suggest

that the tip of the long coiled-coil that is capped by a bundle of

helices is ﬂexible. This ﬂexibility could be important during

RNA replication, in which it is thought that a region near the N ter-

minus of P molecules that are associated with L delivers unas-

sembled N protein onto the nascent RNA.

In summary, we have determined the structure of NiV L-P

complex and performed functional analyses to identify features

that play key roles in transcription and replication. These ﬁndings

enhance our understanding of nsNSV polymerases and the

mechanisms by which they engage in transcription or RNA repli-

cation and have the potential to allow for rational drug design

against NiV infection.

Limitations of the study

The in vitro RNA synthesis assay we performed in puriﬁed NiV

L-P complexes involves a naked RNA oligonucleotide template

rather than encapsidated RNA. While this assay is suitable for

showing if the NiV L-P complex is active, the polymerase might

behave differently on this template compared with an encapsi-

dated RNA template. While we could not resolve the C-terminal

globular domains of NiV L and the intrusion and priming loops,

likely due to ﬂexibility, additional studies will be required to deter-

mine whether binding of ligands, including nucleotides and/or

nucleic acids, causes these regions to become ordered.

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be

directed to and will be fulﬁlled by the lead contact, Jonathan Abraham

(jonathan_abraham@hms.harvard.edu).

Materials availability

Reagents generated in this study are available from the lead contact upon

request with completed material transfer agreements.

Data and code availability

dProtein Data Bank (PDB) and Electron Microscopy Data Bank (EMDB)

identiﬁcation numbers for the cryo-EM structures and maps reported

in this manuscript are available as of the date of publication. Identiﬁca-

tion numbers are listed in the key resources table. The per-residue root-

mean-square-ﬂuctuation (RMSF) values from MD simulations reported

in this study are provided in Data S4.

dThis paper does not report original code.

dAny additional information required to reanalyze the data reported in this

paper is available from the lead contact.

ACKNOWLEDGMENTS

Cryo-EM data were collected at the Harvard Cryo-EM Center for Structural

Biology at Harvard Medical School. We would like to thank Dr. Bernard

Moss (National Institutes of Health) for providing the pTM1 plasmid and Dr.

Klaus Conzelmann (Ludwig-Maximilians-University Munich) for providing the

BSR-T7 cells used for the minigenome assays. We thank Dr. Bridget Gollan

for her help with generating illustrations for the graphical abstract. Y.B.

received funding support from the National Natural Science Foundation of

China (Excellent Young Scientists Fund [Overseas] and 82404516) and the

Shanghai Municipal Commission of Education. This work was supported by

an award from the Bill & Melinda Gates Foundation (INV-040438) to R.F.

AUTHOR CONTRIBUTIONS

Conceptualization, S.H., H.K., P.Y., J.P., Y.B., R.F., and J.A.; investigation,

S.H., H.K., P.Y., Z.Y., B.L., S.M., J.P., Y.B., R.F., and J.A.; writing – original

draft, S.H., H.K., P.Y., Y.B., R.F., and J.A.; writing – review and editing, S.H.,

H.K., P.Y., Z.Y., B.L., S.M., J.P., M.S., Y.B., R.F., and J.A.; funding acquisition,

M.S., R.F., and J.A.

DECLARATION OF INTERESTS

R.F. is the recipient of a sponsored research agreement with Merck & Co.

STAR+METHODS

Detailed methods are provided in the online version of this paper and include

the following:

dKEY RESOURCES TABLE

dEXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

BInsect cells

BBacterial cells

BCell lines

dMETHOD DETAILS

BCloning and insect cell expression of NiV L-P complexes

BNiV L-P complex protein puriﬁcation

BMass photometry analysis of NiV L-P protein

BIn vitro RNA synthesis assay

BCryo-EM sample preparation and data collection

BCryo-EM image processing

BModel building and reﬁnement

B3D variability analysis

BNegative stain electron microscopy

BIn silico modeling, molecular dynamics simulations and molecular

docking

BAlphaFold 3 modeling

BDesign and cloning of the NiV minigenome system

BReconstitution of minigenome replication and transcription

BHarvesting of transfected cells for Western blot and luciferase

assays

BNorthern blot and hybridization

BPrimer extension analysis

BFigure preparation

dQUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.cell.

2024.12.021.

Received: May 23, 2024

Revised: November 1, 2024

Accepted: December 17, 2024

Published: January 20, 2025

REFERENCES

1. Amarasinghe, G.K., Ayllo

´n, M.A., Ba

`o, Y., Basler, C.F., Bavari, S., Blasdell,

K.R., Briese, T., Brown, P.A., Bukreyev, A., Balkema-Buschmann, A., et al.

(2019). Taxonomy of the order Mononegavirales: update 2019. Arch. Virol.

164, 1967–1980. https://doi.org/10.1007/s00705-019-04247-4.

OPEN ACCESS

Cell 188, 1–16, February 6, 2025 13

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

2. Faus-Cotino, J., Reina, G., and Pueyo, J. (2024). Nipah virus: A multidi-

mensional update. Viruses 16, 179. https://doi.org/10.3390/v16020179.

3. Gurley, E.S., Hegde, S.T., Hossain, K., Sazzad, H.M.S., Hossain, M.J.,

Rahman, M., Sharker, M.A.Y., Salje, H., Islam, M.S., Epstein, J.H., et al.

(2017). Convergence of humans, bats, trees, and culture in Nipah virus

transmission, Bangladesh. Emerg. Infect. Dis. 23, 1446–1453. https://

doi.org/10.3201/eid2309.161922.

4. Arunkumar, G., Chandni, R., Mourya, D.T., Singh, S.K., Sadanandan, R.,

Sudan, P., and Bhargava, B.; Nipah Investigators People and Health Study

Group (2019). Outbreak investigation of Nipah virus disease in Kerala, In-

dia, 2018. J. Infect. Dis. 219, 1867–1878. https://doi.org/10.1093/infdis/

jiy612.

5. Chadha, M.S., Comer, J.A., Lowe, L., Rota, P.A., Rollin, P.E., Bellini, W.J.,

Ksiazek, T.G., and Mishra, A. (2006). Nipah virus-associated encephalitis

outbreak, Siliguri, India. Emerg. Infect. Dis. 12, 235–240. https://doi.org/

10.3201/eid1202.051247.

6. Ogino, M., Green, T.J., and Ogino, T. (2024). The complete pathway for co-

transcriptional mRNA maturation within a large protein of a non-

segmented negative-strand RNA virus. Nucleic Acids Res. 52, 9803–

9820. https://doi.org/10.1093/nar/gkae659.

7. Ouizougun-Oubari, M., and Fearns, R. (2023). Structures and

mechanisms of nonsegmented, negative-strand RNA virus polymerases.

Annu. Rev. Virol. 10, 199–215. https://doi.org/10.1146/annurev-virology-

111821-102603.

8. Liang, B. (2020). Structures of the Mononegavirales polymerases. J. Virol.

94, e00175-20. https://doi.org/10.1128/JVI.00175-20.

9. Pyle, J.D., Whelan, S.P.J., and Bloyet, L.M. (2021). Structure and function

of negative-strand RNA virus polymerase complexes. Enzymes 50, 21–78.

https://doi.org/10.1016/bs.enz.2021.09.002.

10. Halpin, K., Bankamp, B., Harcourt, B.H., Bellini, W.J., and Rota, P.A.

(2004). Nipah virus conforms to the rule of six in a minigenome replication

assay. J. Gen. Virol. 85, 701–707. https://doi.org/10.1099/vir.0.19685-0.

11. Jordan, P.C., Liu, C., Raynaud, P., Lo, M.K., Spiropoulou, C.F., Symons,

J.A., Beigelman, L., and Deval, J. (2018). Initiation, extension, and termina-

tion of RNA synthesis by a paramyxovirus polymerase. PLoS Pathog. 14,

e1006889. https://doi.org/10.1371/journal.ppat.1006889.

12. Ogino, T., and Green, T.J. (2019). RNA Synthesis and capping by non-

segmented negative strand RNA viral polymerases: lessons from a proto-

typic virus. Front. Microbiol. 10, 1490. https://doi.org/10.3389/fmicb.

2019.01490.

13. Blocquel, D., Beltrandi, M., Erales, J., Barbier, P., and Longhi, S. (2013).

Biochemical and structural studies of the oligomerization domain of the Ni-

pah virus phosphoprotein: evidence for an elongated coiled-coil homo-

trimer. Virology 446, 162–172. https://doi.org/10.1016/j.virol.2013.07.031.

14. Bourhis, J.M., Yabukarski, F., Communie, G., Schneider, R., Volchkova,

V.A., Fre

´ne

´at, M., Ge

´rard, F.C., Ducournau, C., Mas, C., Tarbouriech, N.,

et al. (2022). Structural dynamics of the C-terminal X domain of Nipah

and Hendra viruses controls the attachment to the C-terminal tail of the

nucleocapsid protein. J. Mol. Biol. 434, 167551. https://doi.org/10.1016/

j.jmb.2022.167551.

15. Bruhn, J.F., Barnett, K.C., Bibby, J., Thomas, J.M.H., Keegan, R.M., Rig-

den, D.J., Bornholdt, Z.A., and Saphire, E.O. (2014). Crystal structure of

the Nipah virus phosphoprotein tetramerization domain. J. Virol. 88,

758–762. https://doi.org/10.1128/JVI.02294-13.

16. Schiavina, M., Salladini, E., Murrali, M.G., Tria, G., Felli, I.C., Pierattelli, R.,

and Longhi, S. (2020). Ensemble description of the intrinsically disordered

N-terminal domain of the Nipah virus P/V protein from combine d NMR and

SAXS. Sci. Rep. 10, 19574. https://doi.org/10.1038/s41598-020-76522-3.

17. Kleiner, V.A., and Fearns, R. (2024). How does the polymerase of non-

segmented negative strand RNA viruses commit to transcription or

genome replication? J. Virol. 98, e0033224. https://doi.org/10.1128/jvi.

00332-24.

18. Cao, D., Gao, Y., Chen, Z., Gooneratne, I., Roesler, C., Mera, C., D’Cunha,

P., Antonova, A., Katta, D., Romanelli, S., et al. (2024). Structures of the

promoter-bound respiratory syncytial virus polymerase. Nature 625,

611–617. https://doi.org/10.1038/s41586-023-06867-y.

19. Cao, D., Gao, Y., Roesler, C., Rice, S., D’Cunha, P., Zhuang, L., Slack, J.,

Domke, M., Antonova, A., Romanelli, S., et al. (2020). Cryo-EM structure of

the respiratory syncytial virus RNA polymerase. Nat. Commun. 11, 368.

https://doi.org/10.1038/s41467-019-14246-3.

20. Gilman, M.S.A., Liu, C., Fung, A., Behera, I., Jordan, P., Rigaux, P., Yse-

baert, N., Tcherniuk, S., Sourimant, J., Ele

´oue

¨t, J.F., et al. (2019). Structure

of the respiratory syncytial virus polymerase complex. Cell 179, 193–

204.e14. https://doi.org/10.1016/j.cell.2019.08.014.

21. Kleiner, V.A., O Fischmann, T., Howe, J.A., Beshore, D.C., Eddins, M.J.,

Hou, Y., Mayhood, T., Klein, D., Nahas, D.D., Lucas, B.J., et al. (2023).

Conserved allosteric inhibitory site on the respiratory syncytial virus and

human metapneumovirus RNA-dependent RNA polymerases. Commun.

Biol. 6, 649. https://doi.org/10.1038/s42003-023-04990-0.

22. Pan, J., Qian, X., Lattmann, S., El Sahili, A., Yeo, T.H., Jia, H., Cressey, T.,

Ludeke, B., Noton, S., Kalocsay, M., et al. (2020). Structure of the human

metapneumovirus polymerase phosphoprotein complex. Nature 577,

275–279. https://doi.org/10.1038/s41586-019-1759-1.

23. Yu, X., Abeywickrema, P., Bonneux, B., Behera, I., Anson, B., Jacoby, E.,

Fung, A., Adhikary, S., Bhaumik, A., Carbajo, R.J., et al. (2023). Structural

and mechanistic insights into the inhibition of respiratory syncytial virus

polymerase by a non-nucleoside inhibitor. Commun. Biol. 6, 1074.

https://doi.org/10.1038/s42003-023-05451-4.

24. Tarbouriec h, N., Curran, J., Ruigrok, R.W., and Burmeister, W.P. (2000).

Tetrameric coiled coil domain of Sendai virus phosphoprotein. Nat. Struct .

Biol. 7, 777–781. https://doi.org/10.1038/79013.

25. Jensen, M.R., Yabukarski, F., Communie, G., Condamine, E., Mas, C.,

Volchkova, V., Tarbouriech, N., Bourhis, J.M., Volchkov, V., Blackledge,

M., and Jamin, M. (2020). Structural description of the Nipah virus phos-

phoprotein and its interaction with STAT1. Biophys. J. 118, 2470–2488.

https://doi.org/10.1016/j.bpj.2020.04.010.

26. Abramson, J., Adler, J., Dunger, J., Evans, R., Green, T., Pritzel, A., Ron-

neberger, O., Willmore, L., Ballard, A.J., Bambrick, J., et al. (2024). Accu-

rate structure prediction of biomolecular interactions with AlphaFold 3.

Nature 630, 493–500. https://doi.org/10.1038/s41586-024-07487-w.

27. Xie, J., Ouizougun-Oubari, M., Wang, L., Zhai, G., Wu, D., Lin, Z., Wang,

M., Ludeke, B., Yan, X., Nilsson, T., et al. (2024). Structural basis for dimer-

ization of a paramyxovirus polymerase complex. Nat. Commun. 15, 3163.

https://doi.org/10.1038/s41467-024-47470-7.

28. Stourac, J., Vavra, O., Kokkonen, P., Filipovic, J., Pinto, G., Brezovsky, J.,

Damborsky, J., and Bednar, D. (2019). Caver Web 1.0: ident iﬁcation of tun-

nels and channels in proteins and analysis of ligand transport. Nucleic

Acids Res. 47, W414–W422. https://doi.org/10.1093/nar/gkz378.

29. Robert, X., and Gouet, P. (2014). Deciphering key features in prot ein struc-

tures with the new ENDscript server. Nucleic Acids Res. 42, W320–W324.

https://doi.org/10.1093/nar/gku316.

30. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez,

R., McWilliam, H., Remmert, M., So

¨ding, J., et al. (2011). Fast, scalable

generation of high-quality protein multiple sequence alignments using

Clustal Omega. Mol. Syst. Biol. 7, 539. https://doi.org/10.1038/msb.

2011.75.

31. Peng, Q., Yuan, B., Cheng, J., Wang, M., Gao, S., Bai, S., Zhao, X., Qi, J.,

Gao, G.F., and Shi, Y. (2023). Molecular mechanism of de novo replication

by the Ebola virus polymerase. Nature 622, 603–610. https://doi.org/10.

1038/s41586-023-06608-1.

32. McIlhatton, M.A., Curran, M.D., and Rima, B.K. (1997). Nucleotide

sequence analysis of the large (L) genes of phocine distemper virus and

canine distemper virus (corrected sequence). J. Gen. Virol. 78, 571–576.

https://doi.org/10.1099/0022-1317-78-3-571.

OPEN ACCESS

14 Cell 188, 1–16, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

33. Poch, O., Blumberg, B.M., Bougueleret, L., and Tordo, N. (1990).

Sequence comparison of ﬁve polymerases (L proteins) of unsegmented

negative-strand RNA viruses: theoretical assignment of functional do-

mains. J. Gen. Virol. 71, 1153–1162. https://doi.org/10.1099/0022-1317-

71-5-1153.

34. Ogino, M., Green, T.J., and Ogino, T. (2022). GDP polyribonucleotidyl-

transferase domain of vesicular stomatitis virus polymerase regulates

leader-promoter escape and polyadenylation-coupled termination during

stop-start transcription. PLoS Pathog. 18, e1010287. https://doi.org/10.

1371/journal.ppat.1010287.

35. Si, Z., Zhou, K., Tsao, J., Luo, M., and Zhou, Z.H. (2022). Locations and

in situ structure of the polymerase complex inside the virion of vesicular

stomatitis virus. Proc. Natl. Acad. Sci. USA 119, e2111948119. https://

doi.org/10.1073/pnas.2111948119.

36. Yuan, B., Peng, Q., Cheng, J., Wang, M., Zhong, J., Qi, J., Gao, G.F., and

Shi, Y. (2022). Structure of the Ebola virus polymerase complex. Nature

610, 394–401. https://doi.org/10.1038/s41586-022-05271-2.

37. Abdella, R., Aggarwal, M., Okura, T., Lamb, R.A., and He, Y. (2020). Struc-

ture of a paramyxovirus polymerase complex reveals a unique methyl-

transferase-CTD conformation. Proc. Natl. Acad. Sci. USA 117, 4931–

4941. https://doi.org/10.1073/pnas.1919837117.

38. Horwitz, J.A., Jenni, S., Harrison, S.C., and Whelan, S.P.J. (2020). Struc-

ture of a rabies virus polymerase complex from electron cryo-microsco py.

Proc. Natl. Acad. Sci. USA 117, 2099–2107. https://doi.org/10.1073/pnas.

1918809117.

39. Jenni, S., Bloyet, L.M., Diaz-Avalos, R., Liang, B., Whelan, S.P.J., Grigor-

ieff, N., and Harrison, S.C. (2020). Structure of the vesicular stomatitis virus

L protein in complex with its phosphoprotein cofactor. Cell Rep. 30,53–

60.e5. https://doi.org/10.1016/j.celrep.2019.12.024.

40. Liang, B., Li, Z., Jenni, S., Rahmeh, A.A., Morin, B.M., Grant, T., Grigorieff,

N., Harrison, S.C., and Whelan, S.P.J. (2015). Structure of the L protein of

vesicular stomatitis virus from electron cryomicroscopy. Cell 162,

314–327. https://doi.org/10.1016/j.cell.2015.06.018.

41. Cong, J., Feng, X., Kang, H., Fu, W., Wang, L., Wang, C., Li, X., Chen, Y.,

and Rao, Z. (2023). Structure of the Newcastle disease virus L protein in

complex with tetrameric phosphoprotein. Nat. Commun. 14, 1324.

https://doi.org/10.1038/s41467-023-37012-y.

42. Li, T., Liu, M., Gu, Z., Su, X., Liu, Y., Lin, J., Zhang, Y., and Shen, Q.T.

(2024). Structures of the mumps virus polymerase complex via cryo-elec-

tron microscopy. Nat. Commun. 15, 4189. https://doi.org/10.1038/

s41467-024-48389-9.

43. Punjani, A., and Fleet, D.J. (2021). 3D variability analysis: resolving contin-

uous ﬂexibility and discrete heterogeneity from single particle cryo-EM.

J. Struct. Biol. 213, 107702. https://doi.org/10.1016/j.jsb.2021.107702.

44. Cox, R.M., Sourimant, J., Toots, M., Yoon, J.J., Ikegame, S., Govindara-

jan, M., Watkinson, R.E., Thibault, P., Makhsous, N., Lin, M.J., et al.

(2020). Orally efﬁcacious broad-spectrum allosteric inhibitor of paramyxo-

virus polymerase. Nat. Microbiol. 5, 1232–1246. https://doi.org/10.1038/

s41564-020-0752-7.

45. Cox, R.M., Wolf, J.D., Lieberman, N.A., Lieber, C.M., Kang, H.J., Sticher,

Z.M., Yoon, J.J., Andrews, M.K., Govindarajan, M., Krueger, R.E., et al.

(2024). Therapeutic mitigation of measles-like immune amnesia and exac-

erbated disease after prior respiratory virus infections in ferrets. Nat. Com-

mun. 15, 1189. https://doi.org/10.1038/s41467-024-45418-5.

46. Wolf, J.D., Sirrine, M.R., Cox, R.M., and Plemper, R.K. (2024). Structural

basis of paramyxo- and pneumovirus polymerase inhibition by non-nucle-

oside small-molecule antivirals. Antimicrob. Agents Chemother. 68,

e0080024. https://doi.org/10.1128/aac.00800-24.

47. Ogino, T., and Banerjee, A.K. (2007). Unconventional mechanism of mRNA

capping by the RNA-dependent RNA polymerase of vesicular stomatitis

virus. Mol. Cell 25, 85–97. https://doi.org/10.1016/j.molcel.2006.11.013.

48. Ogino, T., Yadav, S.P., and Banerjee, A.K. (2010). Histidine-mediated RNA

transfer to GDP for unique mRNA capping by vesicular stomatitis virus

RNA polymerase. Proc. Natl. Acad. Sci. USA 107, 3463–3468. https://

doi.org/10.1073/pnas.0913083107.

49. Ogino, T., and Banerjee, A.K. (2010). The HR motif in the RNA-dependent

RNA polymerase L protein of Chandipura virus is required for unconven-

tional mRNA-capping activity. J. Gen. Virol. 91, 1311–1314. https://doi.

org/10.1099/vir.0.019307-0.

50. Duprex, W.P., Collins, F.M., and Rima, B.K. (2002). Modulating the func-

tion of the measles virus RNA-dependent RNA polymerase by insertion

of green ﬂuorescent protein into the open reading frame. J. Virol. 76,

7322–7328. https://doi.org/10.1128/jvi.76.14.7322-7328.2002.

51. Braun, M.R., Deﬂube

´, L.R., Noton, S.L., Mawhorter, M.E., Tremaglio, C.Z.,

and Fearns, R. (2017). RNA elongation by respiratory syncytial virus poly-

merase is calibrated by conserved region V. PLoS Pathog. 13, e1006803.

https://doi.org/10.1371/journal.ppat.1006803.

52. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt,

D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera–a visualization

system for exploratory research and analysis. J. Comput. Chem. 25,

1605–1612. https://doi.org/10.1002/jcc.20084.

53. Goddard, T.D., Huang, C.C., Meng, E.C., Pettersen, E.F., Couch, G.S.,

Morris, J.H., and Ferrin, T.E. (2018). UCSF ChimeraX: meeting modern

challenges in visualization and analysis. Protein Sci. 27, 14–25. https://

doi.org/10.1002/pro.3235.

54. Adams, P.D., Afonine, P.V., Bunko

´czi, G., Chen, V.B., Echols, N., Headd,

J.J., Hung, L.W., Jain, S., Kapral, G.J., Grosse Kunstleve, R.W., et al.

(2011). The Phenix software for automated determination of macromolec-

ular structures. Methods 55, 94–106. https://doi.org/10.1016/j.ymeth.

2011.07.005.

55. Mastronarde, D.N. (2005). Automated electron microscope tomography

using robust prediction of specimen movements. J. Struct. Biol. 152,

36–51. https://doi.org/10.1016/j.jsb.2005.07.007.

56. Zheng, S.Q., Palovcak, E., Armache, J.P., Verba, K.A., Cheng, Y., and

Agard, D.A. (2017). MotionCor2: anisotropic correction of beam-induced

motion for improved cryo-electron microscopy. Nat. Methods 14,

331–332. https://doi.org/10.1038/nmeth.4193.

57. Rohou, A., and Grigorieff, N. (2015). CTFFIND4: fast and accurate defocus

estimation from electron micrographs. J. Struct. Biol. 192, 216–221.

https://doi.org/10.1016/j.jsb.2015.08.008.

58. Zivanov, J., Nakane, T., Forsberg, B.O., Kimanius, D., Hagen, W.J., Lin-

dahl, E., and Scheres, S.H. (2018). New tools for automated high-resolu-

tion cryo-EM structure determination in RELION-3. eLife 7, e42166.

https://doi.org/10.7554/eLife.42166.

59. Punjani, A., Rubinstein, J.L., Fleet, D.J., and Brubaker, M.A. (2017). cryo-

SPARC: algorithms for rapid unsupervised cryo-EM structure determina-

tion. Nat. Methods 14, 290–296. https://doi.org/10.1038/nmeth.4169.

60. Wagner, T., Merino, F., Stabrin, M., Moriya, T., Antoni, C., Apelbaum, A.,

Hagel, P., Sitsel, O., Raisch, T., Prumbaum, D., et al. (2019). SPHIRE-crY-

OLO is a fast and accurate fully automated particle picker for cryo-EM.

Commun. Biol. 2, 218. https://doi.org/10.1038/s42003-019-0437-z.

61. Sanchez-Garcia, R., Gomez-Blanco, J., Cuervo, A., Carazo, J.M., Sor-

zano, C.O.S., and Vargas, J. (2021). DeepEMhancer: a deep learning so-

lution for cryo-EM volume post-processing. Commun. Biol. 4, 874.

https://doi.org/10.1038/s42003-021-02399-1.

62. Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features

and development of coot. Acta Crystallogr. D Biol. Crystallogr. 66,

486–501. https://doi.org/10.1107/S0907444910007493.

63. Williams, C.J., Headd, J.J., Moriarty, N.W., Prisant, M.G., Videau, L.L.,

Deis, L.N., Verma, V., Keedy, D.A., Hintze, B.J., Chen, V.B., et al. (2018).

MolProbity: more and better reference data for improved all-atom struc-

ture validation. Protein Sci. 27, 293–315. https://doi.org/10.1002/

pro.3330.

64. Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N., and Sternberg, M.J.E.

(2015). The Phyre2 web portal for protein modeling, prediction and anal-

ysis. Nat. Protoc. 10, 845–858. https://doi.org/10.1038/nprot.2015.053.

OPEN ACCESS

Cell 188, 1–16, February 6, 2025 15

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

65. Sastry, G.M., Adzhigirey, M., Day, T., Annabhimoju, R., and Sherman, W.

(2013). Protein and ligand preparation: parameters, protocols, and inﬂu-

ence on virtual screening enrichments. J. Comput. Aided Mol. Des. 27,

221–234. https://doi.org/10.1007/s10822-013-9644-8.

66. Bowers, K.J., Chow, E., Xu, H., Dror, R.O., Eastwood, M.P., Gregersen,

B.A., Klepeis, J.L., Kolossvary, I., Moraes, M.A., Sacerdoti, F.D., et al.

(2006). Scalable algorithms for molecular dynamics simulations on com-

modity clusters. In Proceedings of the 2006 ACM/IEEE Conference on

Supercomputing, p. 84.

67. Kwon, J.J., Hajian, B., Bian, Y., Young, L.C., Amor, A.J., Fuller, J.R., Fra-

ley, C.V., Sykes, A.M., So, J., Pan, J., et al. (2022). Structure-function anal-

ysis of the SHOC2-MRAS-PP1C holophosphatase complex. Nature 609,

408–415. https://doi.org/10.1038/s41586-022-04928-2.

68. Jorgensen, W.L., Maxwell, D.S., and Tirado-Rives, J. (1996). Development

and testing of the OPLS all-atom force ﬁeld on conformational energetics

and properties of organic liquids. J. Am. Chem. Soc. 118, 11225–11236.

https://doi.org/10.1021/ja9621760.

69. Fuerst, T.R., Earl, P.L., and Moss, B. (1987). Use of a hybrid vaccinia virus-

T7 RNA polymerase system for expression of target genes. Mol. Cell. Biol.

7, 2538–2544. https://doi.org/10.1128/mcb.7.7.2538-2544.1987.

70. Buchholz, U.J., Finke, S., and Conzelmann, K.K. (1999). Generation of

bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not

essential for virus replication in tissue culture, and the human RSV leader

region acts as a functional BRSV genome promoter. J. Virol. 73, 251–259.

https://doi.org/10.1128/JVI.73.1.251-259.1999.

71. Noton, S.L., Aljabr, W., Hiscox, J.A., Matthews, D.A., and Fearns, R.

(2014). Factors affecting de novo RNA synthesis and back-priming by

the respiratory syncytial virus polymerase. Virology 462–463, 318–327.

https://doi.org/10.1016/j.virol.2014.05.032.

72. Kucukelbir, A., Sigworth, F.J., and Tagare, H.D. (2014). Quantifying the

local resolution of cryo-EM density maps. Nat. Methods 11, 63–65.

https://doi.org/10.1038/nmeth.2727.

OPEN ACCESS

16 Cell 188, 1–16, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

b-tubulin rabbit polyclonal antibody LI-COR Cat# NC9872627

Strep-Tag Classic antibody (Strep-tag II) Bio-Rad Cat# MCA2489, RRID: AB_609795

IRDye 680RD Donkey anti-rabbit IgG secondary antibody LI-COR Cat# 926-68073, RRID: AB_10954442

IRDye 800CW Goat anti-mouse IgG secondary antibody LI-COR Cat# 926-32210, RRID: AB_621842

Bacterial and virus strains

MAX Efﬁciency DH10Baccells Thermo Fisher Scientiﬁc Cat# 10361012

Chemicals, peptides, and recombinant proteins

Biotin Sigma-Aldrich Cat # B4501-5G

cOmplete, Mini, EDTA-free protease inhibitor cocktail Millipore Sigma Cat# 11836170001

Dithiothreitol (DTT) Sigma-Aldrich Cat# 10708984001

Strep-TactinXT 4Flowhigh-capacity resin IBA Lifesciences Cat# 2-5030-010

NiV (Bangladesh strain) L (full-length, with C-terminal

triple strep tag)-P (full-length, with N-terminal

polyhistidine tag)

This paper N/A

NiV L (Bangladesh stain) L (full-length, with residues

604–704 deleted -triple strep-tag)- P (full-length,

with N-terminal polyhistidine tag)

This paper N/A

P] GTP, 250 mCi Revvity Cat# BLU006H250UC

NTP 100 mM each Thermo Fisher Scientiﬁc Cat# R0481

Calf intestinal alkaline phosphatase New England Biolabs Cat# M0525

Lipofectamine 3000 Transfection reagent Invitrogen Cat# L3000015

Aprotinin Thermo Fisher Scientiﬁc Cat# J11388MA

Micrococcal nuclease S7 Roche Cat# 10107921001

[ɣ

P] ATP, 250mCi Revvity Cat #BLU002A250UC

Sensiscript reverse transcriptase QIAGEN Cat# 205211

Moloney murine leukemia virus reverse transcriptase Promega Cat# M1701

AccuGel 19:1 (40%) National Diagnostics Cat# EC-850

Tris-Borate-EDTA Fisher BioReagents Cat# BP1333-1

Urea Sigma Cat# U6504

T4 Polynucleotide kinase New England Biolabs Cat# M0201

Critical commercial assays

Promega Dual-Luciferase Reporter Assay System Promega Cat# E1910

Monarch total RNA Miniprep kit New England Biolabs Cat# T2010S

Deposited data

Cryo-EM map of NiV L-P complex This paper EMD-44465

Model of NiV L-P complex This paper PDB ID: 9BDQ

Experimental models: Cell lines

Sf9 cells (Spodoptera frugiperda) ThermoFisher Cat# 11496015, RRID: CVCL_JF76

BSR-T7 cells Dr. Klaus Conzelmann N/A

Oligonucleotides

NiV (Bangladesh strain) leader sequence 1-17 RNA

(5’ AUUUUCCCUUGUUUGGU 3’)

Integrated DNA technologies N/A

NiV (Bangladesh strain) positions 90-109 primer

(5’ GATATATTTCTTGAGGATCC 3’), PAGE puriﬁed

Invitrogen N/A

(Continued on next page)

OPEN ACCESS

Cell 188, 1–16.e1–e8, February 6, 2025 e1

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

DynaMarker prestain marker for RNA high Diagnocine Cat# DM260S

Single-stranded DNA ladder Simplex Sciences Cat# ss20

Recombinant DNA

pFastbac Dual vector Thermoﬁsher Cat# 10712024

NiV (Bangladesh strain) L (full-length, with

C-terminal triple strep tag)-P (full-length,

with N-terminal polyhistidine tag)

in pFastBac dual vector

This paper N/A

NiV (Bangladesh stain) L (full-length,

with residues 604–704 deleted triple

strep-tag-P (full-length, with

N-terminal polyhistidine tag)

in pFastBac dual vector

This paper N/A

Multi-cycle minigenome with CAT

and Renilla luciferase reporter gene

This paper N/A

Single-step minigenome with a deletion

of promoter element 2 within the L

nontranslated region and substitutions

at position 1-4 relative to the

5’ end of the trailer region

This paper N/A

pTM1 plasmid Dr. Bernard Moss N/A

Codon optimized NiV (Bangladesh strain)

L open reading frames in modiﬁed pTM1

containing T7 promoter and internal

ribosome entry site with Strep tag on C terminus

This paper N/A

Codon optimized NiV (Bangladesh strain) P open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry site

This paper N/A

Codon optimized NiV (Bangladesh strain) N open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry site

This paper N/A

NiV (Bangladesh strain) L (with D832A) open reading

frames in modiﬁed pTM1 containing T7 promoter

and internal ribosome entry site with

Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with H1347A and R1348A)

open reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry

site with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with Q454R and

C457E in pTM1) open reading frames in

modiﬁed pTM1 containing T7 promoter

and internal ribosome entry site with

Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with residues

604–704 deleted) open reading frames in

modiﬁed pTM1 containing T7 promoter

and internal ribosome entry site

with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with C1236S and

C1239S) open reading frames in modiﬁed

pTM1 containing T7 promoter and internal

ribosome entry site with Strep tag on C terminus

This paper N/A

(Continued on next page)

OPEN ACCESS

e2 Cell 188, 1–16.e1–e8, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

NiV (Bangladesh strain) L (with C1428S and

C1429S) open reading frames in modiﬁed

pTM1 containing T7 promoter and internal

ribosome entry site with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with T1341A) open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry site

with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with N1344A) open

reading frames in modiﬁed pTM1 containing T7

promoter and internal ribosome entry site

with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with L1345A) open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry

site with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with Q1355A) open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry

site with Strep tag on C terminus

This paper N/A

NiV (Bangladesh strain) L (with F1358A) open

reading frames in modiﬁed pTM1 containing

T7 promoter and internal ribosome entry

site with Strep tag on C terminus

This paper N/A

Software and algorithms

UCSF Chimera 1.15 Pettersen et al.

https://www.cgl.ucsf.edu/chimera/,

RRID:SCR_004097

UCSF ChimeraX 1.5 Goddard et al.

https://www.cgl.ucsf.edu/chimerax/,

RRID:SCR_015872

PyMOL 2.5.5 The PyMOL Molecular Graphics

System, Version 3.0

Schro

¨dinger, LLC.

https://pymol.org/2/, RRID:SCR_000305

Phenix 1.20.1-4487 Adams et al.

https://www.phenix-online.org,

RRID: SCR_014224

SerialEM 4.1-beta Mastronarde

http://bio3d.colorado.edu/SerialEM/,

RRID: SCR_017293

MotionCor2 1.6.4 Zheng et al.

https://emcore.ucsf.edu/cryoem-software,

RRID: SCR_016499

CTFFind4 4.1.14 Rohou and Grigorieff

http://grigoriefﬂab.janelia.org/ctfﬁnd4,

RRID: SCR_016732

Relion 3.1.1 Zivanov et al.

https://www3.mrc-lmb.cam.ac.uk/

relion/index.php/Main_Page,

RRID: SCR_016274

cryoSPARC v4.5.1 Punjani et al.

https://cryosparc.com/,

RRID: SCR_016501

cryOLO 1.9.9 Wagner et al.

https://cryolo.readthedocs.io/en/stable/

index.html, RRID: SCR_018392

DeepEMhancer 20220530_cu10 Sanchez-Garcia et al.

https://github.com/rsanchezgarc/

deepEMhancer, RRID: SCR_022573

Coot 0.9 Emsley et al.

http://www2.mrc-lmb.cam.ac.uk/

personal/pemsley/coot/,

RRID: SCR_014222

MolProbity 4.5.2 Williams et al.

http://molprobity.biochem.duke.edu,

RRID: SCR_014226

(Continued on next page)

OPEN ACCESS

Cell 188, 1–16.e1–e8, February 6, 2025 e3

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Insect cells

Sf9 cells (Spodoptera frugiperda) (Thermo Fisher Scientiﬁc Cat# 11496015) cells used for recombinant NiV L-P production were

maintained in Sf-900II SFM (Thermo Fisher Scientiﬁc Cat# 10902088) media at 27C.

Bacterial cells

Escherichia coli MAX Efﬁciency DH10Baccells (Thermo Fisher Scientiﬁc Cat# 10361012) were used for bacmid production to

produce recombinant baculoviruses.

Cell lines

BSR-T7 cells were maintained Glasgow’s MEM (Thermo Fisher Scientiﬁc Cat# 11710035) with 10% (v/v) Fetal Bovine Serum (Thermo

Fisher Scientiﬁc Cat# A5256701), 1% (v/v) MEM Non-Essential Amino Acids Solution (Thermo Fisher Scientiﬁc Cat# 11140050), 1%

(v/v) GlutaMAX(Thermo Fisher Scientiﬁc Cat# 35050061), and 1 mg/ml of Geneticin (G418 sulfate) (Thermo Fisher Scientiﬁc Cat#

10131035) at 37 C, 5–10% CO

, and 100% relative humidity.

METHOD DETAILS

Cloning and insect cell expression of NiV L-P complexes

The coding sequence of NiV L (GenBank: AAY43917.1) and P (GenBank: AAY43912.1) were synthesized and codon-optimized for

Bac-to-Bac expression system using pFastBac Dual transfer vector. The sequences of NiV L and P were fused with a C-terminal

triple-strep tag after a TEV protease cleavage site and an N-terminal His

tag followed by a TEV protease cleavage site, respectively.

NiV L was inserted downstream of the polyhedrin promoter and P was inserted downstream of the p10 promoter in the pFastBac

Dual. Recombinant bacmid containing NiV L and P genes was isolated after transforming into MAX Efﬁciency DH10Baccompetent

cells (Thermo Fisher Scientiﬁc Cat# 10361012) following the user guide of the Bac-to-Bac Baculovirus Expression System (Invitro-

gen). Viral stock generated from puriﬁed bacmids was ampliﬁed and used for protein expression. Two liters of Spodoptera frugiperda

9 (Sf9) cells (Thermo Fisher Scientiﬁc Cat# 11496015) maintained in GibcoSf-900TM II SFM media (Thermo Fisher Scientiﬁc Cat#

10902104) at a density of 2.5x10

cells/ml were infected with ampliﬁed viruses to co-express NiV L and P proteins at 27C for 72 h.

NiV L-P complex protein puriﬁcation

The pellet of Sf9 cells expressing the NiV L-P complex was resuspended in lysis buffer (50 mM Tris, pH 7.5, 500 mM NaCl, 10% (v/v)

glycerol, 6 mM MgSO

, 1 mM dithiothreitol (DTT), 1% (v/v) Triton X-100) supplemented with cOmplete, EDTA-free protease inhib-

itor cocktail (Sigma-Aldrich Cat# 11836170001), carried out for 5 min at 4C. After high-speed centrifugation at 50,000 g for 2 h at 4C,

the supernatant containing the target proteins was incubated with Strep-TactinXT Sepharose resin (IBA Lifesciences Cat#

2-5030-010) at 4C for over 1 h and then loaded onto a gravity column. The beads were washed using buffer A (50 mM Tris pH

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

Refeyn DISCover

v2.3 REFEYN https://www.refeyn.com/

Maestro 2024–3 Schrodinger https://www.schrodinger.com/

maestro, RRID: SCR_016748

Image Studio Lite version 5.2 LI-COR https://www.licor.com/bio/

image-studio-lite/,

RRID: SCR_013715

Prism 10 version 10.3.1 GraphPad Prism https://www.graphpad.com,

RRID: SCR_002798

UNICORNversion 7.8 Cytiva https://www.cytivalifesciences.com/

en/us/shop/chromatography/

software/unicorn-7-p-05649

AlphaFold Server Abramson et al.

https://deepmind.google/technologies/

alphafold/alphafold-server/,

RRID: SCR_025885

CAVER web version 1.2 Stourac et al.

https://loschmidt.chemi.muni.cz/

caverweb/

Clustal Omega Sievers et al.

https://www.ebi.ac.uk/jdispatcher/

msa/clustalo, RRID: SCR_001591

OPEN ACCESS

e4 Cell 188, 1–16.e1–e8, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

8.0, 500 mM NaCl, 10% glycerol (v/v), 2 mM MgSO

, 1 mM DTT), and the bound proteins were eluted using 50 mM biotin in buffer A.

The eluates were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the putative L and P

bands were subjected to LC-MS/MS analysis (Harvard Center for Mass Spectrometry) to conﬁrm their identities. Speciﬁcally, the

NiV L band that is near the 250 kDa marker band on SDS-PAGE (Figure S1A) was cut and sent for trypsin digestion, followed by

LC-MS/MS sequencing. Fragments of NiV L detected by LC-MS/MS are highlighted in gray in Data S1. NiV L has a coverage

over 82%. The sequence C-terminal of residue 2244 is a glycine-serine linker and triple-strep tag. Additionally, the NiV P band

near the 100 kDa marker band on SDS-PAGE (Figure S1A) was cut and sent for LC-MS/MS sequencing. Fragments detected are

highlighted in gray in Data S1. NiV P has a coverage over 94%. The sequence N-terminal of residue 1 is a histidine tag and

serine-glycine linker.

The fractions containing L-P protein were further puriﬁed using a size-exclusion column (Superose 6 Increase 10/300 GL, GE

healthcare) equilibrated with size exclusion chromatography (SEC) buffer (20 mM Tris, pH 7.5, 500 mM NaCl, 2 mM MgSO

1 mM DTT) using an A

¨KTA pureprotein puriﬁcation system (Cytiva) with UNICORNversion 7.8. The peak fractions near 11 ml

were pooled and concentrated. Protein homogeneity was examined by negative stain electron microscopy and mass photometry

(see below).

Mass photometry analysis of NiV L-P protein

Mass photometry analyses were carried out with a Refeyn Two

mass photometer (Refeyn LTD, Oxford, UK) at room temperature.

Glass coverslips and gaskets were cleaned with HPLC-grade water and isopropanol and dried under ﬁltered gas before use. NiV L-P

was diluted to 200 nM in SEC buffer. Eighteen microliters of buffer were used to ﬁnd the camera focus prior to loading 2 ml of the

sample onto the gasket. Acquisition camera image size was set to medium. Data were collected as a 1 min movie and then processed

using ratiometric imaging. To correlate ratiometric contrast to mass, the Refeyn Two

instrument was calibrated using molecular

standards of monomeric bovine serum albumin (BSA) (66 kDa), dimeric BSA (132 kDa), and thyroglobulin (MW 660 kDa) with a

molecular weight error less than 5%. The experiment was performed twice. Data were analyzed using Discover

version 2.3 soft-

ware (Refeyn LTD, Oxford, UK).

In vitro RNA synthesis assay

L protein was quantiﬁed by SDS-PAGE and densitometric comparison with a BSA standard curve on the same gel. L-P complexes

(8–90 nM ﬁnal concentration) were incubated with 2 mM NiV le 1–17 template with the sequence 3’-UGGUUUGUUCCCUUUUA-5’ in a

buffer containing 50 mM Tris-HCl, pH 7.5, 8 mM MgCl

, 5 mM DTT and 10% glycerol (v/v) for 10 min at 30C. Reactions were initiated

by the addition of ATP and CTP to a ﬁnal concentration of 1 mM each and 10 mCi of [a-

P]-GTP tracer (Revvity, 3000 Ci/mmol and

10 mCi/ml, ﬁnal concentration 100–150 nM) in a total reaction volume of 50 ml and allowed to proceed for 1 h at 30C. The polymerase

complex was inactivated by heating to 95C for 5 min. Reactions were subsequently treated with 10 U of calf intestinal alkaline phos-

phatase (NEB, 10,000 U/ml) for 1 h at 37C. 200 ml of 0.25% SDS in nuclease-free water were added to each and RNA products were

isolated by extraction with 250 ml of acid-phenol:chloroform (Invitrogen). After the addition of 170 mM NaCl and 15 mg glycogen

(Invitrogen), RNA products were precipitated with ethanol overnight at -20C. Pellets were washed once with ice-cold 70% (v/v)

ethanol, brieﬂy air-dried and resuspended in 8 ml water. An equal volume of 2 x STOP buffer (20 mM EDTA, 0.01% each bromophenol

blue and xylene cyanol in deionized formamide) was added before heat denaturing samples for 5 min at 95C. Samples were ﬂash

cooled on ice and loaded onto a 20% acrylamide sequencing gel containing 7 M urea in Tris-borate-EDTA buffer. Gels were vacuum

dried at 80C onto Whatman 3MM paper. RNA products were visualized by phosphor imaging (Typhoon IP, GE Healthcare Life

Technologies).

Cryo-EM sample preparation and data collection

An aliquot of 4 ml of NiV L-P complex at 0.7 mg/ml was applied to a freshly glow-discharged Quantifoil Cu 1.2/1.3 400 mesh grid (Elec-

tron Microscopy Sciences Cat# Q4100CR1.3). The sample was blotted for 3 s after incubation for 15 s at 4C with a relative humidity

of 100%, then plunge-frozen in liquid ethane using Vitrobot Mark IV (Thermo Fisher Scientiﬁc, USA), and stored in liquid nitrogen.

Cryo-EM data were collected on a Titan Krios microscope (Thermo Fisher Scientiﬁc, USA) (300 kV) equipped with a K3 Summit direct

electron detector (Gatan, USA) at the Harvard Cryo-Electron Microscopy Center for Structural Biology. Movie stacks were automat-

ically recorded using SerialEM 4.1-beta

in counting mode at a nominal magniﬁcation of 105,000 x, corresponding to a physical pixel

size of 0.83 A

˚. The defocus was set to from -1.0 to -2.5 mm. A total exposure dose of 53 e

was fractionated into 50 frames for each

movie stack. We obtained one cryo-EM dataset of NiV L-P complex including a total number of 7803 movie stacks.

Cryo-EM image processing

All images were processed using Relion 3.1,

movie frames were gain-normalized and motion-corrected using MotionCor2 version

1.6.4

, and contrast transfer function (CTF) correction was performed using CTFFind4 version 4.1.14,

as implemented in Relion

3.1. Particle-picking was performed in crYOLO version 1.9.9

and 1,871,392 particles from 7,803 micrographs were picked. Picked

particles were imported to Relion, extracted, binned to a pixel size of 1.66 A

˚and subjected to 2D classiﬁcation. Good classes of par-

ticles from the 2D classiﬁcation were selected and imported to cryoSPARC version 4.5.1

to generate an initial model. Three rounds

of 3D classiﬁcation with C1 symmetry were imposed on 1,842,231 particles, 477,936 particles of which were selected and subjected

OPEN ACCESS

Cell 188, 1–16.e1–e8, February 6, 2025 e5

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

to auto-reﬁnement to generate a 2.7 A

˚map. CTF reﬁnement and Bayesian polishing were performed to improve the resolution.

Consequently, a ﬁnal map was generated to 2.3 A

˚. To improve the local resolution of P ⍺-helical cap structure, focused 3D auto-

reﬁnement was performed, allowing us to obtain a masked a 3.0 A

˚map. We also used DeepEMhancer version 20220530_cu10

for cryo-EM volume post-processing.

Model building and reﬁnement

The structures of the ﬁve domains (RdRp, CAP, CD, MTase domain and CTD domain) of L and of monomeric P were predicted using

Phyre2 version 2.0.

These predicted structures and the crystal structure of the NiV P OD (PDB code: 4N5B,

residues 476–576)

were used to build the atomic model of NiV L-P complex. The RdRp and CAP domains of L and tetrameric P OD plus a single P XD

were docked and rigid-body ﬁtted well into the cryo-EM map using UCSF Chimera. Extra residues of P were built manually in Coot

version 0.9.

Based on interpretable density, we could model L residues 5–1463, with the exception of residues 601–709, 1148–

1153, 1266–1289 (priming loop), and 1342–1362 (intrusion loop). We could model P1 residues 479–584, P2 residues 479–708 (except

for residues 581–591 and 612–630), P3 residues 477–579, and P4 residues 479–596. We performed manual model building to

improve local ﬁt using Coot

and real space reﬁnement using Phenix.

MolProbity

was used to validate the model. Statistics

are provided in Table S1.

3D variability analysis

3D variability analysis (3DVA) was performed using cryoSPARC.

43,59

Particle stacks and reference map from Relion ﬁnal 3D auto-

reﬁne were imported. 3DVA was performed using a mask generated from Relion 3.1. Twenty components were generated, of which

major components showed ﬂexibility in the P segment. The frames from these components were visualized and recorded in UCSF

Chimera

as a volume series (see Video S1).

Negative stain electron microscopy

For negative stain electron microscopy experiments, 4 ml of puriﬁed protein samples were applied to glow-discharged continuous

carbon ﬁlms supported by 400-mesh copper grids (Electron Microscopy Sciences Cat#: FCF400-Cu-50) stained with 1.5% (w/v)

uranyl formate. Stained grids were imaged on a Philips CM10 transmission electron microscope (100 kV) equipped with a Gatan

UltraScan 894 (2k x 2k) CCD camera. Images were collected at a magniﬁcation of 52,000x (2.06 A

˚/pixel) and processed using cry-

oSPARC.

Particles were selected using Blob picker and particles were subjected to several rounds of reference-free alignment and

2D classiﬁcation.

In silico modeling, molecular dynamics simulations and molecular docking

The cryo-EM structure of the NiV L-P complex was prepared before modelling and simulations. The module of Protein Preparation in

Schro

¨dinger Maestro

was applied to cap termini, repair residues, optimize H-bond assignments, and run restrained minimizations

following default settings.

The Schro

¨dinger Desmond MD engine 2024–3

was used for simulations.

An orthorhombic water box was applied to bury pre-

pared protein systems with a minimum distance of 10 A

˚to the edges from the protein. Water molecules were described using the SPC

model. Na

ions were placed to neutralize the total net charge. All simulations were performed following the OPLS4 force ﬁeld.

The

ensemble class of NPT was selected with the simulation temperature set to 300K (Nose-Hoover chain) and the pressure set to

1.01325 bar (Martyna-Tobias-Klein). A set of default minimization steps pre-deﬁned in the Desmond protocol was adopted to relax

the MD system. The simulation time was set to 100 ns for the protein system with three duplicate MD runs. One frame was recorded

per 200 ps during the sampling phase. Post-simulation analysis of the RMSF was performed using a Schro

¨dinger simulation inter-

action diagram. RMSF values from the Caof each residue were used for plotting.

The molecular docking was performed using the Glide module in Schro

¨dinger. The binding pocket on NiV L was deﬁned by select-

ing residues E922, S925, S928, Y1001, I1068, and H1165/Y1165 along with surrounding residues. Similarly, the binding pocket on

PIV3 L (PDB: 8KDC)

was deﬁned by selecting residues E863, S866, S869, Y942, I1009, T1010, and Y1106 along with surrounding

residues. The 3D conformation of the compound GHP-88309 was prepared using LigPrep. Glide SP, in standard precision mode,

was used without constraints to generate binding poses. Up to 20 docked poses were allowed to be generated for GHP-88309 inside

the deﬁned pockets for each protein. Among these poses, the top 10 poses underwent the post-docking minimization. The prior

study by Cox et al.

was referred to guide the visual inspection of minimized poses. Representative conformations that could repro-

duce the predicted binding pose

were selected and investigated to be reported in this manuscript.

AlphaFold 3 modeling

Predicted structures for RNA-bound NiV L (Bangladesh strain, GenBank: AAY43917.1) or PIV3 L (GenBank: WCF97250.1) were

generated using AF3.

Modeling was performed using the leader RNA 1–16 (underlined) plus six adenines as the template RNA

(50-UUUUCCCUUGUUUGGUAAAAAA-30for NiV and 50-UCUUCUCUUGUUUGGUAAAAAA-30for PIV3) and the complementary

sequence of leader RNA 1–9 (underlined) plus three adenines as the nascent RNA (50-AAAACCAAACAA-30) along with a GTP mole-

cule, two magnesium ions, and two zinc ions. Note that non-speciﬁc adenines were added to the template and nascent RNAs to

ensure that their 30and 50ends, respectively, remained single stranded in the model.

OPEN ACCESS

e6 Cell 188, 1–16.e1–e8, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

Design and cloning of the NiV minigenome system

The minigenome system was designed based on sequences from the NiV Bangladesh strain (GenBank: AY988601.1). The cis-acting

elements inserted into the multi-cycle replication minigenome were determined based on a previously described NiV minigenome

template.

The multi-cycle minigenome contained in 3’ to 5’ order, the ﬁrst 112 nt of the NiV genome sequence, including the 55

nt leader region, Ngene start signal, and 46 nt of non-translated sequence from the 3’ end of the Ngene, which includes promoter

element 2 (CNNNNN)

, 519 nt derived from the bacterial chloramphenicol acetyltransferase (CAT) gene, 105 nt of sequence derived

from the N-P gene junction region (nucleotides 2247–2351 of the NiV Bangladesh complete genome) that includes the Ngene end

signal, trinucleotide intergenic, and Pgene start signal, followed by 939 nt Renilla luciferase reporter gene sequence, and then the 5’

100 nt of the NiV genome, including 56 nt of non-translated sequence from the 5’ end of the L gene, which contains the complement of

promoter element 2, the Lgene end signal and the 30 nt 5’ trailer region. Together with inserted restriction sites, the total minigenome

length is 1794 nt. The minigenome cassette was ﬂanked by a hepatitis delta virus ribozyme sequence adjacent to the leader region

and a T7 promoter sequence adjacent to the trailer region (Figure S6A). This minigenome was used as a template to generate a single-

step minigenome limited to the antigenome synthesis step of replication. This minigenome had a deletion of promoter element 2

within the L nontranslated region and substitutions at position 1–4 relative to the 5’ end of the trailer region, which inactivated the

trailer promoter at the 3’ end of the antigenome and created an optimal T7 promoter sequence (Figure S6A). The multi-cycle mini-

genome followed the ‘‘rule of six’’ except for two additional G residues contributed by the T7 promoter; the single-step minigenome

followed the rule of six including the additional G residues contributed by the T7 promoter. Codon optimized versions of NiV

Bangladesh strain N, P, and L open reading frames (Synbio) were inserted into a modiﬁed version of plasmid pTM1 (a kind gift

from Dr. Bernard Moss),

which contains a T7 promoter and internal ribosome entry site. Each open reading frame was inserted

such that the initiating codon was inserted into the plasmid NcoI site, and the 30end of the open reading frame was ﬂanked with

a 17 nt poly A sequence.

In addition, the open reading frame of L contained a C-terminal strep tag. All plasmids were sequenced

in their entirety (Plasmidsaurus) and their integrity and purity was conﬁrmed by agarose gel electrophoresis prior to each transfection.

Reconstitution of minigenome replication and transcription

BSR-T7 cells (a kind gift from Dr. Klaus Conzelmann)

in six-well dishes were transfected with (per well) 0.3 mg of the relevant

minigenome plasmid, 0.4 mg of N, 0.2 mg of P, 0.1 mg of L and 0.04 mg of ﬁreﬂy expression minigenome using Lipofectamine 3000

(Invitrogen Cat# L3000015). Each transfection reaction was set up in duplicate. Followed by incubation at 37C for 22–24 h, the trans-

fection mixture was replaced with OptiMem containing 2% (v/v) fetal bovine serum. Cells were harvested 44–48 h after transfection.

Harvesting of transfected cells for Western blot and luciferase assays

For Western blot and luciferase analyses, cells from one transfected well were lysed in 500 ml passive lysis buffer (Promega). A 100 ml

aliquot of the lysate was passed through a QIAshredder column (Qiagen Cat# 79656) and a 14 ml aliquot was subjected to electro-

phoresis on an 8% SDS-polyacrylamide gel alongside a PageRuler Plus Prestained Protein Ladder (Thermo Fisher Scientiﬁc Cat#

26619). Proteins were transferred to nitrocellulose by Western blotting and the blots were probed with beta-tubulin rabbit polyclonal

antibody (LI-COR) at 1:1000 and a Strep-tag classic mouse monoclonal antibody (Bio-Rad Cat# MCA2489) at 1:500 dilution, followed

by incubation with IRDye 680RD-conjugated donkey anti-rabbit (LI-COR Cat# 926-68073) and IRDye 800CW-conjugated goat anti-

mouse (LI-COR Cat# 926-32210) antibodies, each at 1:20,000 dilution. Blots were scanned using an OdysseyCLx imager (LICOR).

For quantiﬁcation a box of equivalent size as used for other bands of the same protein species was drawn at the corresponding po-

sition on the -L sample lane and used to set the background to 0. The resulting values were then normalized to the corresponding

value from the L WT reaction, which was set to 1.

For luciferase assays, aliquots of cell lysates were diluted 1:30 and assessed for ﬁreﬂy and Renilla luciferase activity using a Dual-

Luciferase Reporter Assay System (Promega Cat# E1910) according to the manufacturer’s instructions. Quantiﬁcation of the relative

luciferase activity for each sample was performed by normalizing the Renilla luciferase value to the ﬁreﬂy luciferase value. The -L

value was subtracted to account for background. The resulting values were then normalized to the corresponding value from the

L WT reaction, which was set to 1.

Northern blot and hybridization

For analysis of total intracellular RNA cells from a transfected well were pelleted and RNA was extracted using a Monarch total RNA

miniprep kit (NEB Cat# T2010S). In the case of micrococcal treatment, each transfection reaction was set up in duplicate wells.

Following harvest, the cell pellet from one well of the duplicate was resuspended in 100 ml of nuclease lysis buffer 10 mM NaCl,

10 mM Tris, pH 7,5, 1.5 mM MgCl

, 1% Triton X-100, 0.5% sodium deoxycholate, 10 mM CaCl

,1ml of aprotinin (Thermo Fisher

Scientiﬁc Cat# J11388MA) and then lysis buffer from the Monarch total RNA miniprep kit (NEB Cat# T2010S) was added directly.

The cell pellet from the other well was resuspended in 100 ml of nuclease lysis buffer and 10 ml of micrococcal nuclease S7 (Roche

Cat# 10107921001) was added. The reaction containing micrococcal nuclease was incubated at 30C for 1 h with occasional

shaking, following which the Monarch total RNA miniprep kit (NEB) lysis buffer was added. RNA from the untreated and treated cells

was isolated using the Monarch total RNA miniprep kit (NEB) according to the manufacturer’s instructions. Isolated RNA was sub-

jected to denaturing gel electrophoresis alongside a molecular weight ladder (DynaMarker prestain marker for RNA high; Diagnocine

Cat# DM260S) in a 1.5% (w/v) agarose gel containing 0.44 M formaldehyde in MOPS buffer. The RNA was transferred to a nylon

OPEN ACCESS

Cell 188, 1–16.e1–e8, February 6, 2025 e7

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

membrane (Cytiva), which was stained with methylene blue to conﬁrm that equal amounts of RNA were loaded in each lane and to

allow visualization of the molecular weight markers. Negative- and positive-sense

P-labled CAT-speciﬁc riboprobes corresponding

to minigenome (or complementary) sequence were synthesized by T7 RNA polymerase and puriﬁed by phenol-chloroform extrac-

tion. The appropriate riboprobe was hybridized to the membrane in 6X SSC, 2X Denhardt’s solution, 0.1% SDS, and 100 mg/ml of

sheared salmon sperm DNA for a minimum of 18 h at 65C. The membranes were washed at 65C in 2X SSC-0.1% SDS for 2 h

and in 0.1X SSC-0.1% SDS for 15 min. Phosphorimager analysis was performed using an Azure Sapphire FL Biomolecular Imager

(IS4000) and signals were quantiﬁed using Image Studio (LI-COR). The CAT mRNA would be expected to be 636 nt (excluding the

poly A tail which is heterogeneous in length), the antigenome and genome RNAs would be expected to be 1,776 nt in the case of the

single-step minigenome, and the replicated antigenome and genome RNAs would be expected to be 1,794 nt in the case of the multi-

cycle minigenome. To quantify the RNA levels, a box of equivalent size as used for other bands of the same RNA species was drawn

at the corresponding position on the -L sample lane and used to set the background to 0. The resulting values were then normalized to

the corresponding value from the L WT reaction, which was set to 1.

Primer extension analysis

Primer extension reactions were carried out using 4–8 mg of total intracellular RNA isolated from transfected cells. RNA was extracted

using a Monarch Total RNA Miniprep Kit (NEB). The RNA initiated from position 1U at the 3’ end of the le region, and RNA initiated at

the ﬁrst gs signal was detected with a

P-end-labeled primer (5’-GATATATTTCTTGAGGATCC-3’), which corresponds to nucleo-

tides 90-109 from the 3’ end of the minigenome le region. Thus, the cDNA products derived from RNA initiated at the 3’ end of le

or the gs signal would be expected to be 109 nt or 54 nt, respectively. Each reaction was prepared with either Sensiscript reverse

transcriptase (QIAGEN Cat# 205211) or Moloney murine leukemia virus reverse transcriptase (Promega Cat# M1701), following

the manufacturer’s instructions. Using Sensiscript reverse transcriptase, the RNA samples were reverse transcribed at 50C for

1.5 hours. With M-MLV, the RNA samples were incubated for at 42C for 1.5 hours. After incubation with reverse transcriptase,

2X STOP buffer (deionized formamide, 20 mM EDTA, 0.1% (w/v) bromophenol blue, and xylene cyanol) was added. A single-

stranded DNA ladder (Simplex Cat# ss20) was end-labeled using T4 Polynucleotide Kinase (NEB Cat# M0201), following the man-

ufacturer’s instructions. The primer extension products were then separated by electrophoresis on 8% polyacrylamide gels contain-

ing 7 M urea in Tris-borate-EDTA buffer. After electrophoresis, the gels were dried onto 3MM paper using a vacuum drier at 80C.

Phosphorimager analysis was performed using an Azure Sapphire FL Biomolecular Imager (IS4000), and signals were quantiﬁed us-

ing Image Studio (LI-COR). A box of equivalent size to those used for other bands of the same RNA species was drawn at the cor-

responding position on the negative control lane and used to set the background to 0. The resulting values were then normalized to

the corresponding value from the L WT reaction, which was set to 1.

Figure preparation

UCSF Chimera version 1.15, ChimeraX version 1.5, and PyMOL version 2.5.5 (Schro

¨dinger LLC) were used for structure visualization

and ﬁgure generation. Prism 10 version 10.3.1 (GraphPad Prism) was used to prepare the bar charts shown in Figures 6,7, and S6.

QUANTIFICATION AND STATISTICAL ANALYSIS

The data analysis function in Microsoft Excel (version 16.62) was used to conduct the unpaired, two-tailed Student’s t-test to

compare mean RMSF values from two groups. Statistical signiﬁcance was deﬁned as p< 0.05. Data from the Image Studio Lite

(version 5.2) and luciferase readings were inputted into Prism 10 (GraphPad Prism version 10.3.1) and means and standard deviations

were calculated by Prism 10. The details of tests, including the number of replicates, are included in ﬁgure legends.

OPEN ACCESS

e8 Cell 188, 1–16.e1–e8, February 6, 2025

Please cite this article in press as: Hu et al., Structural and functional analysis of the Nipah virus polymerase complex, Cell (2025), https://

doi.org/10.1016/j.cell.2024.12.021

Article

Supplemental ﬁgures

(legend on next page)

OPEN ACCESS

Article

Figure S1. Puriﬁcation and cryo-EM reconstruction of NiV L-P, activity assay, and structural alignment with other nsNSV L proteins, related

to Figure 1

(A) Size exclusion chromatography proﬁle of NiV L-P complex. The complex has a retention volume of 11 mL. A sample obtained from the 11 mL peak fraction

was examined using SDS-PAGE, with a Coomassie-stained gel shown (inset). NiV L has a molecular weight of 260 kDa. NiV P has a molecular weight of 80 kDa

but has an apparent size that is larger than its molecular weight (100 kDa).

(B) RNA synthesis activity assay with radioactive products migrated on a denat uring polyacrylamide gel, as described for Figures 1C and 1D. Different amounts of

polymerase complexes were used in this experiment as indicated (values indicate nM amounts of L). This analysis clearly shows products that are longer than the

input template. Based on the observed migration patterns of the longer products (with incremental single nucleotide additions) and prior ﬁndings that nsNSV

polymerases are prone to reiterative stuttering,

11,71

we conclude that these additional bands are due to polymerase stuttering on U tracts within the promoter,

although further experiments are required to show this conclusively.

(C) Workﬂow used for cryo-EM data processing of the NiV L-P complex. Low -resolution features in 3D volumes consistent with the presence of ﬂexible portions of

the L C-terminal globular domains (CD, MTase, and CTD) are indicated with a dashed circled.

(D) Fourier shell correlation (FSC) curves. The threshold used to estimate the resolution is 0.143.

(E) Local resolution estimates of the NiV L-P complex obtained using ResMap.

(F) Structural alignment of NiV L (residues 5–1463) with the L proteins of the indicated nsNSVs calculated over C-⍺positions. The alignment was performed using

PyMOL. RMSD, root-mean-square deviation.

OPEN ACCESS Article

(legend on next page)

OPEN ACCESS

Article

Figure S2. Partial sequence alignments of nsNSV L proteins, active site predictions, and negative stain images of NiV L, related to Figure 2

(A) Partial sequence alignment of nsNSV L proteins showing motifs A, C, and F. Motif C GDNE/Q is the catalytic site in the RdRp domain and is conserved among

all the L proteins aligned. The fourth residue is glutamine in most sequenced viruses but is glutamate in a few viral sequences, including NiV L. Motif A D722, motif

C D832, and motif F R551 are indicated by black triangles. See Table S2 for virus name abbreviations and GenBank accession numbers.

(B) PIV3 L polymerase active site in the 2.7 A

˚cryo-EM structure of the PIV3 L-P complex.

Active site residues D773 (motif C), D663 (motif A), and R552 (motif F)

are shown as sticks. A magnesium ion (green sphere) was resolved in the cryo-EM structure interacting with D773 in the catalytic center.

prediction of the PIV3 L active site in the presence of a duplex RNA, GTP, and two magnesium ions (green spheres). D663 (motif A) and D773 (motif C)

are predicted to coordinate metals, and R552 (motif F) is positioned to interact with the phosphate of the incoming nucleotide. Template and nascent RNA are

shown in dark and light gray, respectively. Parts of motifs A and D are shown as semi-transparent for clarity.

(D and E) pLDDT of the active sites of the AF3 model of NiV L-RNA (D) and PIV3 L-RNA (E). Residues with very high conﬁdence (pLDDT > 90) are shown in deep

blue, conﬁdence (90 > pLDDT > 70) in light blue, low conﬁdence (70 > pLDDT > 50) in yellow, and very low conﬁdence (pLDDT < 50) in orange.

(F–I) Amino acid sequence alignment of palm insert regions of NiV and HeV (F), MojV and LayV (G), NiV and CedPV (H), and NiV and GhV (I). CedPV has a

particularly long palm insert.

(J) Phylogenetic tree of the indicated parahenipaviruses (MojV and LayV) and henipaviruses (GhV, NiV, HeV, and CedPV) based on L amino acid sequences

generated using Clustal Omega.

(K) SDS-PAGE gel of eluted fraction from Streptactin puriﬁcation of NiV L

D-P.I.

-P run under reducing conditions. Imaging was performed with a stain-free gel

system.

(L) Negative stain image of NiV L-P WT. After Streptactin puriﬁcation, NiV L-P was diluted to 0.03 mg/mL for imaging by negative stain electron microscopy. The

scale bar is 50 nm.

(M) Negative stain image of NiV L

D-P.I.

-P. After Streptactin puriﬁcation, NiV L

D-P.I.

-P was diluted to 0.06 mg/mL for negative stain electron microscopy. The scale

bar is 50 nm.

OPEN ACCESS Article

Figure S3. CAP domain features for additional polymerase structures, related to Figure 3

(A–C) AF3

predicted ZFs of HeV (A), LayV (B), and MojV (C). Zinc ions are shown as gray spheres, and residues coordinating zinc ions are shown as sticks.

(D–I) Cryo-EM structures of PIV3 L-P (PDB: 8KDC)

(D), NDV L-P (PDB: 7YOU)

(E), PIV5 L-P (PDB: 6V85)

(F), VSV L-P (PDB: 6U1X)

(G), RSV L-P (6PZK)

(H),

and RSV L-P-RNA (PDB: 8SNX)

(I). The L protein RdRp domains are shown in surface representation with partially clipped surfaces, and the CAP domains are

shown as ribbon diagrams. The priming (green) and intrusion (purple) loops are shown. The disordered portions within these loops that were not resolved in the

cryo-EM structures are shown as dashed lines. HR residues are indicated. Except for NDV, whose intrusion loop HR motif arginine (R1269) was in a disordered

segment, the HR residues could be resolved. Nucleic acids are shown in orange.

(J) pLDDT scores of an AF3

model of the NiV L RdRp and CAP domains in the absence of RNA. The priming and intrusion loops are indicated and shown with

thicker ribbon representation.

(legend continued on next page)

OPEN ACCESS

Article

(K) AF3 model of RNA-bound NiV L showing the location of the priming (green) and intrusion (purple) loops with respect to the putative nascent RNA channel, the

general location of which is indicated by the yellow oval. Intrusion loop residues N1344, L1345, and R1348, which are indicated, were subjected to mutational

analysis using minigenome assays (see Figure S6R). Priming loop residue T1276 is equivalent to RSV priming loop residue T1267, which is a part of the

GxxT motif.

(L) Cryo-EM structure of RSV L-P bound to promoter RNA (PDB: 8SNX)

showing the location of the priming (green) and intrusion (purple) loops with respect to

the putative nascent RNA channel, the general location of which is indicated by the yellow oval. RSV L intrusion loop residues N1335, Y1336, and R1339 are

equivalent to NiV L residues N1344, L1345, and R1348. RSV L priming loop residue T1267 is equivalent to NiV L residue T1276.

OPEN ACCESS Article

Figure S4. Tetrameric P is ﬂexible when assembled onto the L polymerase core, related to Figure 4

(A) Per-residue root-mean-square-ﬂuctuation (RMSF) from 100 ns molecular dynamics (MD) simulations of the protein complex. Three thin lines represent

individual MD runs. A thick line represents averaged RMSF values. For the RdRp/CAP portion of the plot, regions denoted as ‘‘D’’ are stretches of residues that

had no observable or interpretable density in cryo-EM maps and therefore were not modeled in atomic coordinates, and high RMSF ﬂuctuations in these regions

are likely due to interruption of the polypeptide chain.

(B) Mean RMSF values calculated during MD simulations for L (RdRp/CAP), P1, P2, P3, and P4 are plotted. The comparison of mean RMSF values between two

groups was performed using an unpaired, two-tailed Student’s t test. Error bars represent standard errors. ***p< 0.001.

OPEN ACCESS

Article

Figure S5. GHP-88309 structure, previously described activity proﬁle, and conservation of inhibitor binding site, related to Figure 5

(A) Structure of the broad-spectrum paramyxovirus antiviral GHP-88309 in 2D (top) and 3D (bottom) representations.

(B) Summary of results of antiviral activity assays for GHP-88309 as determined by Cox et al. using minigenome assays for NiV, PIV3, MeV, or recombinant SeV.

(C) Partial sequence alignment of the L proteins of the indicated viruses. Residues implicated in inhibitor resistance by Cox et al.

or near the drug in docking

experiments are indicated.

(D) pLDDT of AF3

model of NiV L-RNA complex.

OPEN ACCESS Article

Figure S6. Validation of the single-step minigenome assay, mutant L expression, gene expression activities of L mutants measured by

luciferase activity, and summary of functional studies, related to Figures 6 and 7

(A) Sequence alignment of the 30ends of the antigenome RNAs of the multi-cycle and single-step minigenomes (Figures 6A and 6B). The alignment shows the

internal NiV promoter element (promoter element 2; blue type), the complement of the trailer region (green type), and the T7 promoter (black type). The T7 RNA

polymerase initiates opposite the C residues that are underlined to synthesize negative-sense RNA. Dashes indicate residues that were deleted in the single-step

minigenome. Substitutions introduced into the trailer promoter of the single-step minigenome are shown in lowercase type and were designed to ablate the

promoter and enhance T7 promoter activity. The multi-cycle minigenome followed the rule of six (i.e., its nucleotide length was divisible by six) except for the

(legend continued on next page)

OPEN ACCESS

Article

additional G residues contributed by the T7 promoter, and the single-step minigenome followed the rule of six, including the additional G residues contributed by

the T7 promoter.

(B and C) Northern blot analysis of negative-sense (minigenome sense) RNA generated by either T7 RNA polymerase and NiV polymerase in the case of the multi-

cycle minigenome or by T7 RNA polymerase alone in the case of the single-step minigenome. The blots show RNA generated in cells transfected with plasmids

expressing either WT L or L with a substitution in the GDNE motif of the RdRp (L D832A). Cells were transfected with plasmids expressing either multi-cycle (MC)

or single-step (SS) replication minigenomes, or minigenome (MG) was omitted from the transfection (MG). (B) shows total RNA harvested from transfected cells.

(C) shows RNA from a parallel transfection in which the cell lysate was treated with micrococcal nuclease prior to RNA puriﬁcation to reduce levels of

unencapsidated RNA and distinguish encapsidated minigenome template RNA.

(D and E) Quantiﬁcation of the bands from replicates of the experiments shown in (B) and (C), respectively.

(F and G) RNA from the same transfections as used for (B) and (C), in which the northern blot was probed to detect positive-sense RNA (antigenome and CAT

mRNA).

(H and I) Quantiﬁcation of the bands from replicates of the experiments shown in (F) and (G), respectively. (H) shows quantiﬁcation of CAT mRNA, and (I) shows

quantiﬁcation of nuclease-resistant antigenome RNA.

The data shown in (B), (C), (F), and (G) are representative of two independent experiments. The bars in (D), (E), (H), and (I) show the two data points and the mean

for the two independent experiments, with normalization to L WT + MC minigenome in each case.

This experiment shows that the single-step replication minigenome had a stronger T7 promoter than the multi-cycle replication minigenome (B andD). However,

the single-step replication minigenome was not ampliﬁed by WT L protein (C and E) and consequently produced relatively low levels of CAT mRNA (F and H) and

antigenome (G and I).

(J–L) Western blot analysis of minigenome-transfected cell lysates probed with a strep-tag-speciﬁc antibody to detect L (green), and tubulin (red) was detected

with a speciﬁc antibody as a loading control. The band marked with an asterisk is the appropriate molecular weight to be truncated L protein that had been

cleaved at the palm insert.

(M–O) Quantiﬁcation of the full-length NiV L band from replicates of the experiments sho wn in (J)–(L), respectively. Each bar represents the mean and SD derived

from three independent experiments.

(P and Q) Renilla luciferase activity of L mutants in assays with a single-step minigenome. The bars show the mean and SD from three independent experiments,

except for the H1347A/R1348A (HR) and Q454R/C457E (P4) mutants (n=7).

(R) Summary of functional studies with NiV minigenome system. *Activity levels determined by primer extension analysis of RNA initiated at the 30end of the

le region (replication) or gs signal (transcription).

OPEN ACCESS Article

Structure of the measles virus ternary polymerase complex

Article

Full-text available

Apr 2025

Measles virus (MeV) is a highly contagious pathogen that causes significant morbidity worldwide. Its polymerase machinery, composed of the large protein (L) and phosphoprotein (P), is crucial for viral replication and transcription, making it a promising target for antiviral drug development. Here we present cryo-electron microscopy structures of two distinct MeV polymerase complexes: Lcore-P and Lfull-P-C. The Lcore-P complex characterizes the N-terminal domain, RNA-dependent RNA polymerase (RdRp), and GDP poly-ribonucleotidyltransferase of the L protein, along with the tetrameric P of varying lengths. The Lfull-P-C complex reveals that C protein dimer binds at the cleft between RdRp and the flexible domains of the L protein: the connecting domain, methyltransferase domain, and C-terminal domain. This interaction results in the visualization of these domains and creates an extended RNA channel, remodeling the putative nascent replicated RNA exit and potentially regulating RNA synthesis processivity. Our findings reveal the architecture and molecular details of MeV polymerase complexes, providing new insights into their mechanisms and suggesting potential intervention targets for antiviral therapy.

Structural basis of Nipah virus RNA synthesis

Article

Full-text available

Mar 2025

Nipah virus (NiV) is a non-segmented negative-strand RNA virus (nsNSV) with high pandemic potential, as it frequently causes zoonotic outbreaks and can be transmitted from human to human. Its RNA-dependent RNA polymerase (RdRp) complex, consisting of the L and P proteins, carries out viral genome replication and transcription and is therefore an attractive drug target. Here, we report cryo-EM structures of the NiV polymerase complex in the apo and in an early elongation state with RNA and incoming substrate bound. The structure of the apo enzyme reveals the architecture of the NiV L-P complex, which shows a high degree of similarity to other nsNSV polymerase complexes. The structure of the RNA-bound NiV L-P complex shows how the enzyme interacts with template and product RNA during early RNA synthesis and how nucleoside triphosphates are bound in the active site. Comparisons show that RNA binding leads to rearrangements of key elements in the RdRp core and to ordering of the flexible C-terminal domains of NiV L required for RNA capping. Taken together, these results reveal the first structural snapshots of an actively elongating nsNSV L-P complex and provide insights into the mechanisms of genome replication and transcription by NiV and related viruses.

A deep learning and molecular modeling approach to repurposing Cangrelor as a potential inhibitor of Nipah virus

Article

Full-text available

May 2025

Deforestation, urbanization, and climate change have significantly increased the risk of zoonotic diseases. Nipah virus (NiV) of Paramyxoviridae family and Henipavirus genus is transmitted by Pteropus bats. Climate-induced changes in bat migration patterns and food availability enhances the virus’s adaptability, in turn increasing the potential for transmission and outbreak risk. NiV infection has high human fatality rate. With no antiviral drugs or vaccines available, exploring the complex machinery involved in viral RNA synthesis presents a promising target for therapy. Drug repurposing provides a fast-track approach by identifying existing drugs with potential to target NiV RNA-dependent RNA polymerase (L), bypassing the time-consuming process of developing novel compounds. To facilitate this, we developed an attention-based deep learning model that utilizes pharmacophore properties of the active sites and their binding efficacy with NiV L protein. Around 500 FDA-approved drugs were filtered and assessed for their ability to bind NiV L protein. Compared to the control Remdesivir, we identified Cangrelor, an antiplatelet drug for cardiovascular diseases, with stronger binding affinity to NiV L (glide score of -12.30 kcal/mol). Molecular dynamics simulations further revealed stable binding (RMSD of 3.54 Å) and a post-MD binding energy of -181.84 kcal/mol. The strong binding of Cangrelor is illustrated through trajectory analysis, principal component analysis, and solvent accessible surface area, further confirming the stable interaction with the active site of NiV RdRp. Cangrelor can interact with NiV L protein and may potentially interfere with its replication. These findings suggest that Cangrelor will be a potential drug candidate that can effectively interact with the NiV L protein and potentially disrupt the viral replication. Further in vivo studies are warranted to explore its potential as a repurposable antiviral drug.

Construction of Minigenome Replicon of Nipah Virus and Investigation of Biological Activity

Article

May 2025

Nipah virus (NiV), a highly lethal zoonotic pathogen causing encephalitis and respiratory diseases with mortality rates up to 40–70%, faces research limitations due to its strict biosafety level 4 (BSL-4) containment requirements, hindering antiviral development. To address this, we generated two NiV minigenome replicons (Fluc- and EGFP-based) expressed via helper plasmids encoding viral N, P, and L proteins, enabling replication studies under BSL-2 conditions. The minigenome replicon recapitulated the cytoplasmic inclusion body (IB) formation observed in live NiV infections. We further demonstrated that IB assembly is driven by liquid–liquid phase separation (LLPS), with biochemical analyses identifying the C-terminal N core domain of the N protein, as well as N0 and XD domains and the intrinsically disordered region (IDR) of the P protein, as essential structural determinants for LLPS-mediated IB biogenesis. The targeted siRNA silencing of the 5′ and 3′ untranslated regions (UTRs) significantly reduced replicon-derived mRNA levels, validating the regulatory roles of these regions. Importantly, the minigenome replicon demonstrated sensitivity to type I/II/III interferons and antivirals (remdesivir, azvudine, molnupiravir), establishing its utility for drug screening. This study provides a safe and efficient platform for investigating NiV replication mechanisms and accelerating therapeutic development, circumventing the constraints of BSL-4 facilities while preserving key virological features.

Structural basis of paramyxo- and pneumovirus polymerase inhibition by non-nucleoside small-molecule antivirals

Article

Full-text available

Aug 2024
ANTIMICROB AGENTS CH

Small-molecule antivirals can be used as chemical probes to stabilize transitory conformational stages of viral target proteins, facilitating structural analyses. Here, we evaluate allosteric pneumo- and paramyxovirus polymerase inhibitors that have the potential to serve as chemical probes and aid the structural characterization of short-lived intermediate conformations of the polymerase complex. Of multiple inhibitor classes evaluated, we discuss in-depth distinct scaffolds that were selected based on well-understood structure-activity relationships, insight into resistance profiles, biochemical characterization of the mechanism of action, and photoaffinity-based target mapping. Each class is thought to block structural rearrangements of polymerase domains albeit target sites and docking poses are distinct. This review highlights validated druggable targets in the paramyxo- and pneumovirus polymerase proteins and discusses discrete structural stages of the polymerase complexes required for bioactivity.

The complete pathway for co-transcriptional mRNA maturation within a large protein of a non-segmented negative-strand RNA virus

Article

Full-text available

Jul 2024
NUCLEIC ACIDS RES

Non-segmented negative-strand (NNS) RNA viruses, such as rabies, Nipah and Ebola, produce 5′-capped and 3′-polyadenylated mRNAs resembling higher eukaryotic mRNAs. Here, we developed a transcription elongation-coupled pre-mRNA capping system for vesicular stomatitis virus (VSV, a prototypic NNS RNA virus). Using this system, we demonstrate that the single-polypeptide RNA-dependent RNA polymerase (RdRp) large protein (L) catalyzes all pre-mRNA modifications co-transcriptionally in the following order: (i) 5′-capping (polyribonucleotidylation of GDP) to form a GpppA cap core structure, (ii) 2′-O-methylation of GpppA into GpppAm, (iii) guanine-N7-methylation of GpppAm into m7GpppAm (cap 1), (iv) 3′-polyadenylation to yield a poly(A) tail. The GDP polyribonucleotidyltransferase (PRNTase) domain of L generated capped pre-mRNAs of 18 nucleotides or longer via the formation of covalent enzyme–pre-mRNA intermediates. The single methyltransferase domain of L sequentially methylated the cap structure only when pre-mRNAs of 40 nucleotides or longer were associated with elongation complexes. These results suggest that the formation of pre-mRNA closed loop structures in elongation complexes via the RdRp and PRNTase domains followed by the RdRp and MTase domains on the same polypeptide is required for the cap 1 formation during transcription. Taken together, our findings indicate that NNS RNA virus L acts as an all-in-one viral mRNA assembly machinery.

How does the polymerase of non-segmented negative strand RNA viruses commit to transcription or genome replication?

Article

Full-text available

Jul 2024
J VIROL

The Mononegavirales, or non-segmented negative-sense RNA viruses (nsNSVs), includes significant human pathogens, such as respiratory syncytial virus, parainfluenza virus, measles virus, Ebola virus, and rabies virus. Although these viruses differ widely in their pathogenic properties, they are united by each having a genome consisting of a single strand of negative-sense RNA. Consistent with their shared genome structure, the nsNSVs have evolved similar ways to transcribe their genome into mRNAs and replicate it to produce new genomes. Importantly, both mRNA transcription and genome replication are performed by a single virus-encoded polymerase. A fundamental and intriguing question is: how does the nsNSV polymerase commit to being either an mRNA transcriptase or a replicase? The polymerase must become committed to one process or the other either before it interacts with the genome template or in its initial interactions with the promoter sequence at the 3´ end of the genomic RNA. This review examines the biochemical, molecular biology, and structural biology data regarding the first steps of transcription and RNA replication that have been gathered over several decades for different families of nsNSVs. These findings are discussed in relation to possible models that could explain how an nsNSV polymerase initiates and commits to either transcription or genome replication.

Structures of the mumps virus polymerase complex via cryo-electron microscopy

Article

Full-text available

May 2024

The viral polymerase complex, comprising the large protein (L) and phosphoprotein (P), is crucial for both genome replication and transcription in non-segmented negative-strand RNA viruses (nsNSVs), while structures corresponding to these activities remain obscure. Here, we resolved two L–P complex conformations from the mumps virus (MuV), a typical member of nsNSVs, via cryogenic-electron microscopy. One conformation presents all five domains of L forming a continuous RNA tunnel to the methyltransferase domain (MTase), preferably as a transcription state. The other conformation has the appendage averaged out, which is inaccessible to MTase. In both conformations, parallel P tetramers are revealed around MuV L, which, together with structures of other nsNSVs, demonstrates the diverse origins of the L-binding X domain of P. Our study links varying structures of nsNSV polymerase complexes with genome replication and transcription and points to a sliding model for polymerase complexes to advance along the RNA templates.

Accurate structure prediction of biomolecular interactions with AlphaFold 3

Article

Full-text available

May 2024
NATURE

The introduction of AlphaFold 2¹ has spurred a revolution in modelling the structure of proteins and their interactions, enabling a huge range of applications in protein modelling and design2, 3, 4, 5–6. Here we describe our AlphaFold 3 model with a substantially updated diffusion-based architecture that is capable of predicting the joint structure of complexes including proteins, nucleic acids, small molecules, ions and modified residues. The new AlphaFold model demonstrates substantially improved accuracy over many previous specialized tools: far greater accuracy for protein–ligand interactions compared with state-of-the-art docking tools, much higher accuracy for protein–nucleic acid interactions compared with nucleic-acid-specific predictors and substantially higher antibody–antigen prediction accuracy compared with AlphaFold-Multimer v.2.37,8. Together, these results show that high-accuracy modelling across biomolecular space is possible within a single unified deep-learning framework.

Structural basis for dimerization of a paramyxovirus polymerase complex

Article

Full-text available

Apr 2024

The transcription and replication processes of non-segmented, negative-strand RNA viruses (nsNSVs) are catalyzed by a multi-functional polymerase complex composed of the large protein (L) and a cofactor protein, such as phosphoprotein (P). Previous studies have shown that the nsNSV polymerase can adopt a dimeric form, however, the structure of the dimer and its function are poorly understood. Here we determine a 2.7 Å cryo-EM structure of human parainfluenza virus type 3 (hPIV3) L–P complex with the connector domain (CD′) of a second L built, while reconstruction of the rest of the second L–P obtains a low-resolution map of the ring-like L core region. This study reveals detailed atomic features of nsNSV polymerase active site and distinct conformation of hPIV3 L with a unique β-strand latch. Furthermore, we report the structural basis of L–L dimerization, with CD′ located at the putative template entry of the adjoining L. Disruption of the L–L interface causes a defect in RNA replication that can be overcome by complementation, demonstrating that L dimerization is necessary for hPIV3 genome replication. These findings provide further insight into how nsNSV polymerases perform their functions, and suggest a new avenue for rational drug design.

Therapeutic mitigation of measles-like immune amnesia and exacerbated disease after prior respiratory virus infections in ferrets

Article

Full-text available

Feb 2024

Measles cases have surged pre-COVID-19 and the pandemic has aggravated the problem. Most measles-associated morbidity and mortality arises from destruction of pre-existing immune memory by measles virus (MeV), a paramyxovirus of the morbillivirus genus. Therapeutic measles vaccination lacks efficacy, but little is known about preserving immune memory through antivirals and the effect of respiratory disease history on measles severity. We use a canine distemper virus (CDV)-ferret model as surrogate for measles and employ an orally efficacious paramyxovirus polymerase inhibitor to address these questions. A receptor tropism-intact recombinant CDV with low lethality reveals an 8-day advantage of antiviral treatment versus therapeutic vaccination in maintaining immune memory. Infection of female ferrets with influenza A virus (IAV) A/CA/07/2009 (H1N1) or respiratory syncytial virus (RSV) four weeks pre-CDV causes fatal hemorrhagic pneumonia with lung onslaught by commensal bacteria. RNAseq identifies CDV-induced overexpression of trefoil factor (TFF) peptides in the respiratory tract, which is absent in animals pre-infected with IAV. Severe outcomes of consecutive IAV/CDV infections are mitigated by oral antivirals even when initiated late. These findings validate the morbillivirus immune amnesia hypothesis, define measles treatment paradigms, and identify priming of the TFF axis through prior respiratory infections as risk factor for exacerbated morbillivirus disease.

Nipah Virus: A Multidimensional Update

Article

Full-text available

Jan 2024

Nipah virus (NiV) is an emerging zoonotic paramyxovirus to which is attributed numerous high mortality outbreaks in South and South-East Asia; Bangladesh’s Nipah belt accounts for the vast majority of human outbreaks, reporting regular viral emergency events. The natural reservoir of NiV is the Pteropus bat species, which covers a wide geographical distribution extending over Asia, Oceania, and Africa. Occasionally, human outbreaks have required the presence of an intermediate amplification mammal host between bat and humans. However, in Bangladesh, the viral transmission occurs directly from bat to human mainly by ingestion of contaminated fresh date palm sap. Human infection manifests as a rapidly progressive encephalitis accounting for extremely high mortality rates. Despite that, no therapeutic agents or vaccines have been approved for human use. An updated review of the main NiV infection determinants and current potential therapeutic and preventive strategies is exposed.

Structures of the promoter-bound respiratory syncytial virus polymerase

Article

Full-text available

Dec 2023
NATURE

The respiratory syncytial virus (RSV) polymerase is a multifunctional RNA-dependent RNA polymerase composed of the large (L) protein and the phosphoprotein (P). It transcribes the RNA genome into ten viral mRNAs and replicates full-length viral genomic and antigenomic RNAs¹. The RSV polymerase initiates RNA synthesis by binding to the conserved 3′-terminal RNA promoters of the genome or antigenome². However, the lack of a structure of the RSV polymerase bound to the RNA promoter has impeded the mechanistic understanding of RSV RNA synthesis. Here we report cryogenic electron microscopy structures of the RSV polymerase bound to its genomic and antigenomic viral RNA promoters, representing two of the first structures of an RNA-dependent RNA polymerase in complex with its RNA promoters in non-segmented negative-sense RNA viruses. The overall structures of the promoter-bound RSV polymerases are similar to that of the unbound (apo) polymerase. Our structures illustrate the interactions between the RSV polymerase and the RNA promoters and provide the structural basis for the initiation of RNA synthesis at positions 1 and 3 of the RSV promoters. These structures offer a deeper understanding of the pre-initiation state of the RSV polymerase and could aid in antiviral research against RSV.

Structural and mechanistic insights into the inhibition of respiratory syncytial virus polymerase by a non-nucleoside inhibitor

Article

Full-text available

Oct 2023

The respiratory syncytial virus polymerase complex, consisting of the polymerase (L) and phosphoprotein (P), catalyzes nucleotide polymerization, cap addition, and cap methylation via the RNA dependent RNA polymerase, capping, and Methyltransferase domains on L. Several nucleoside and non-nucleoside inhibitors have been reported to inhibit this polymerase complex, but the structural details of the exact inhibitor-polymerase interactions have been lacking. Here, we report a non-nucleoside inhibitor JNJ-8003 with sub-nanomolar inhibition potency in both antiviral and polymerase assays. Our 2.9 Å resolution cryo-EM structure revealed that JNJ-8003 binds to an induced-fit pocket on the capping domain, with multiple interactions consistent with its tight binding and resistance mutation profile. The minigenome and gel-based de novo RNA synthesis and primer extension assays demonstrated that JNJ-8003 inhibited nucleotide polymerization at the early stages of RNA transcription and replication. Our results support that JNJ-8003 binding modulates a functional interplay between the capping and RdRp domains, and this molecular insight could accelerate the design of broad-spectrum antiviral drugs.

Structural and functional analysis of the Nipah virus polymerase complex

Abstract and Figures

Recommended publications

Structural and functional analysis of the Nipah virus polymerase complex

Structural basis of Nipah virus RNA synthesis

Structural basis of Nipah virus replication

Cryo-EM structure of Nipah virus RNA polymerase complex