Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: Wu, J.; Lang, T.; Zhang, C.;
Yang, F.; Yang, F.; Qu, H.; Pu, Z.; Feng,
J. Chromosomal Localization and
Diversity Analysis of 5S and 18S
Ribosomal DNA in 13 Species from
the Genus Ipomoea.Genes 2024,15,
1340. https://doi.org/10.3390/
genes15101340
Academic Editors: Shaopei Gao,
Mingku Zhu and Lifei Huang
Received: 16 September 2024
Revised: 12 October 2024
Accepted: 18 October 2024
Published: 19 October 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
genes
G C A T
T A C G
G C A T
Article
Chromosomal Localization and Diversity Analysis of 5S and 18S
Ribosomal DNA in 13 Species from the Genus Ipomoea
Jingyu Wu 1,† , Tao Lang 1,†, Cong Zhang 1, Fan Yang 1, Feiyang Yang 1, Huijuan Qu 1, Zhigang Pu 2,*
and Junyan Feng 1, *
1Biotechnology and Nuclear Technology Research Institute, Sichuan Academy of Agricultural Sciences,
Chengdu 610066, China
2Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
*Correspondence: zhigangpu@126.com (Z.P.); junyanfeng@live.cn (J.F.)
†These authors contributed equally to this work.
Abstract: Background: Sweet potato (Ipomoea batatas (L.) Lam.), a key global root crop, faces chal-
lenges due to its narrow genetic background. This issue can be addressed by utilizing the diverse
genetic resources of sweet potato’s wild relatives, which are invaluable for its genetic improvement.
Methods: The morphological differences in leaves, stems, and roots among 13 Ipomoea species were
observed and compared. Chromosome numbers were determined by examining metaphase cells
from root tips. Fluorescence in situ hybridization (FISH) was used to identify the number of 5S and
18S rDNA sites in these species. PCR amplification was performed for both 5S and 18S rDNA, and
phylogenetic relationships among the species were analyzed based on the sequences of 18S rDNA.
Results: Three species were found to have enlarged roots among the 13 Ipomoea species. Chromosome
analysis revealed that I. batatas had 90 chromosomes, Ipomoea pes-tigridis had 28 chromosomes, while
the remaining species possessed 30 chromosomes. Detection of rDNA sites in the 13 species showed
two distinct 5S rDNA site patterns and six 18S rDNA site patterns in the 12 diploid species. These
rDNA sites occurred in pairs, except for the seven 18S rDNA sites observed in Ipomoea digitata. PCR
amplification of 5S rDNA identified four distinct patterns, while 18S rDNA showed only a single
pattern across the species. Phylogenetic analysis divided the 13 species into two primary clades,
with the closest relationships found between I. batatas and Ipomoea trifida, as well as between Ipomoea
platensis and I. digitata.Conclusions: These results enhance our understanding of the diversity
among Ipomoea species and provide valuable insights for breeders using these species to generate
improved varieties.
Keywords: 5S rDNA; 18S rDNA; fluorescence in situ hybridization; phylogenetic analysis;
Ipomoea genus
1. Introduction
Sweet potato (Ipomoea batatas (L.) Lam.), which is one of the most important root crops,
is cultivated worldwide because of its high starch content and abundance of vitamins
and other nutrients. It is grown as a source of food, feed, fuel, and starch [
1
]. Sweet
potato varieties that are resistant to diseases and pests and have high yields and nutritional
value are crucial for satisfying the growing demand for high-quality food and industrial
raw materials [
2
]. However, the narrow genetic background of sweet potato results in
low genetic diversity, thereby hindering varietal improvement [
3
]. Thus, wild relatives
of sweet potato are important genetic resources for enhancing sweet potato cultivars [
1
].
Accordingly, clarifying the relationships between sweet potato and its wild relatives is
important for optimizing the genetic improvement of sweet potato through breeding.
Ribosomal DNA (rDNA) is a highly conserved genomic segment in eukaryotes that
is widely used for chromosomal localization and phylogenetic analyses. It consists of 45S
Genes 2024,15, 1340. https://doi.org/10.3390/genes15101340 https://www.mdpi.com/journal/genes
Genes 2024,15, 1340 2 of 14
and 5S rDNA, with 45S rDNA comprising repeating units of 18S, 5.8S, and 26S rDNA, as
well as tandem arrays of transcribed and non-transcribed spacer regions [
4
]. The number
and distribution of rDNA have been analyzed in many species [
5
]. In the genus Ipomoea, 5S
and 18S rDNA have been used to provide evidence of the origin of sweet potato [
6
].
Additionally, 5S rDNA has been used to analyze the karyotypes of I. batatas and its
wild relatives [7].
Over the past decade, oligonucleotide fluorescence in situ hybridization (oligo-FISH)
has become an important technique for analyzing chromosomes [
8
]. In terms of its utility
for cell biology and genetics research, oligo-FISH can accurately locate DNA sequences on
chromosomes and chromatin [
9
], but it is also widely used to identify chromosomes [
10
]
and analyze karyotypes [
11
] as well as phylogenetic relationships [
12
,
13
] among plants and
microbes. Furthermore, using rDNA oligonucleotide probes to visualize rDNA chromoso-
mal sites can clarify the variability in 5S and 18S rDNA.
Plastome sequences, ITS (internal transcribed spacer), and rDNA sequences have
often been used as reliable molecular evidence of phylogenetic relationships. For exam-
ple, Chen et al. elucidated the phylogenetic relationships of 40 species from the family
Convolvulaceae using complete plastome sequences [
14
]. The analysis of ITS sequences in
I. batatas and its wild relatives by Chen et al. and Xu et al. clarified the genetic relationships
among these species [
15
,
16
]. 18S rDNA sequences and 5S rDNA molecular markers have
commonly been employed in phylogenetic analyses [
17
]. However, there are relatively few
reports describing phylogenetic relationships among Ipomoea species determined on the
basis of 18S rDNA sequences and 5S rDNA molecular markers.
In this study, we examined 13 species from the genus Ipomoea in terms of their mor-
phological characteristics, number and distribution of 18S and 5S rDNA sites, and polymor-
phisms among 18S rDNA sequences and 5S rDNA molecular markers. This study’s results
will be useful for exploiting these species for the genetic improvement of sweet potato.
2. Materials and Methods
2.1. Plant Materials
The seeds of 12 Ipomoea species, including Ipomoea muelleri,Ipomoea murucoides,Ipomoea
trifida,Ipomoea triloba,Ipomoea nil,Ipomoea setosa,Ipomoea platensis,Ipomoea quamoclit,Ipo-
moea obscura,Ipomoea pes-tigridis,Ipomoea pes-caprae, and Ipomoea digitata, and seedlings of
I. batatas were used in this study. All germplasms were supplied by the Biotechnology
and Nuclear Technology Research Institute of Sichuan Academy of Agricultural Sciences,
China. The sweet potato cultivar Xushu 18 was bred by the Xuzhou Institute of Agricul-
tural Sciences, China. All the seeds were placed in a moist box. After germination, three
well-sprouted seeds from each species were selected and transferred into pots filled with
soil. The pots were placed in a greenhouse in Chengdu, China. The greenhouse was main-
tained at 28
◦
C with 70% relative humidity. Plants were exposed to light from 8:00 a.m. to
10:00 p.m. The examination of phenotypic traits for all species was based on Descriptors for
Sweet Potato [18].
2.2. Chromosome Preparation
Two months after planting, root tips were collected and treated using a published
method [
19
]. Briefly, all root tips were exposed to nitrous oxide for 2 h to inhibit spindle
formation, thereby allowing for the observation of more metaphase cells. Then, they were
placed in 90% acetic acid for 10 min to fix the cells and stored in 70% ethanol solution. After
being thoroughly washed using ddH
2
O, the root tips were placed in a solution comprising
1% pectinase and 2% cellulase (Yakult Pharmaceutical Industry Co., Ltd., Tokyo, Japan)
and incubated in a 37
◦
C water bath for 1 h to digest the cell walls. Following this, the
root tips were washed using 70% ethanol and squashed in acetic acid. Finally, 10
µ
L of the
solution was dropped onto each slide and air-dried in a moist box for at least 5 min.
Genes 2024,15, 1340 3 of 14
2.3. Fluorescence In Situ Hybridization
18S rDNA probe multiplexes were developed and 5S rDNA probes were synthesized
as described by Yu et al. [
20
]. The sequences of the 18S rDNA probe multiplexes and 5S
rDNA probes are listed in Table 1.
Table 1. Sequences of 18S rDNA probe multiplexes and 5S rDNA probe used in this study.
Probe Sequence Length (bp)
18S-1 TTTGATGGTACCTACTACTCGGATAACCGTAGT 33
18S-2 GGTAGGATAGTGGCCTACCATGGTGGTGACGGGTG 35
18S-3 TCGAGTCTGGTAATTGGAATGAGTACAATCTAA 33
18S-4 AAAGCAAGCCTACGCTCTGTATACATTAGCATGG 34
18S-5 AGATACCGTCCTAGTCTCAACCATAAACGATGCC 34
18S-6 CTCAACACGGGGAAACTTACCAGGTCCAGACATAG 35
18S-7 GGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACG 35
18S-8 TTGTACACACCGCCCGTCGCTCCTACCGATTGAAT 35
5S TCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC 41
Note: 18S rDNA probe multiplexes were composed of 18S-1 to 18S-8 and were developed in the present study.
A droplet of a solution comprising both 18S and 5S rDNA probes was placed on
individual slides, which were then covered for 1 h hybridization at 42
◦
C. After removing
the cover glass using 2
×
SSC (saline–sodium citrate), the samples were air-dried and
stained with 4
′
,6-diamidino-2-phenylindole. FISH images were captured using a Leica
DM2500 microscope (Leica Microsystems, Wetzlar, Germany). The resulting photos were
processed using Adobe Photoshop 2020 (Adobe Systems Software Ltd., Dublin, Ireland).
At least 10 metaphase plates were examined for each species.
2.4. DNA Extraction and PCR Amplification of 5S and 18S rDNA
DNA was extracted according to the CTAB method [
21
]. The primers used for the PCR
amplification of 18S rDNA were 18S-forward (5
′
-CAACCTGGTTGATCCTGCCAGT-3
′
)
and 18S-reverse (5
′
-CTGATCCTTCTGCAGGTTCACCTAC-3
′
) [
22
], whereas 5S-forward
(5
′
-GGATCCCATCAGAACTCC-3
′
) and 5S-reverse (5
′
-GGTGCTTTAGTGCTGGTAT-3
′
)
were the primers used for the PCR amplification of 5S rDNA [
23
]. Both PCR amplifications
were performed in 20
µ
L reaction mixtures containing 10
µ
L 2
×
Taq PCR Master Mix (Bio
Basic Inc., New York, NY, USA), 2
µ
L DNA template, 0.2
µ
L forward and reverse primers
(10
µ
M), and 7.6
µ
L ddH
2
O. The PCR cycling conditions were as follows: initial denatu-
ration at 94
◦
C for 5 min; 35 cycles of denaturation at 94
◦
C for 30 s, primer annealing at
58
◦
C for 30 s, and primer extension at 72
◦
C for 2 min and 20 s; and a final extension at 72
◦
C
for 7 min. Amplified products were visualized via 1.5% (w/v) agarose gel electrophoresis.
2.5. 18S rDNA Sequence Analysis
Amplified fragments were purified from the agarose gel using Universal DNA Pu-
rification Kit (Tiangen, Beijing, China). Then, the purification products were sequenced
using Sanger sequencing method by Tsingke Biotechnology Co., Ltd. (Beijing, China).
DNA sequences were aligned using the MUSCLE algorithm, which was widely used in
sequences analysis for its high accuracy and reliability. A phylogenetic tree was constructed
according to the neighbor-joining method with 1000 bootstrap replicates using MEGA 11.
tvBOT (https://www.chiplot.online/circleTree.html, accessed on 31 August 2023) [
24
], a
tool to customize the layout and font style, was employed to visualize the phylogenetic
tree. Genetic distances were calculated on the basis of the Kimura 2-parameter model.
3. Results
3.1. Phenotypic Analysis of 13 Ipomoea Species
The root, stem, and leaf phenotypes of 13 Ipomoea species were analyzed
(Figures 1, S1 and S2).
Genes 2024,15, 1340 4 of 14
Genes 2024, 15, x FOR PEER REVIEW 4 of 14
tool to customize the layout and font style, was employed to visualize the phylogenetic
tree. Genetic distances were calculated on the basis of the Kimura 2-parameter model.
3. Results
3.1. Phenotypic Analysis of 13 Ipomoea Species
The root, stem, and leaf phenotypes of 13 Ipomoea species were analyzed (Figures 1,
S1 and S2).
Figure 1. Comparison of root morphology among 13 species of the genus Ipomoea. (a): Ipomoea triloba
a; (b): Ipomoea nil; (c): Ipomoea quamoclit; (d): Ipomoea platensis; (e): Ipomoea pes-tigridis; (f): Ipomoea pes-
caprae; (g): Ipomoea trifida; (h): Ipomoea setosa; (i): Ipomoea obscura; (j): Ipomoea muelleri; (k): Ipomoea
murucoides; (l): Ipomoea batatas; (m): Ipomoea digitata. Scale bars, 5 cm.
The leaves of all species varied in terms of shape, size, and color. Notably, leaves with
downy hair were detected exclusively on I. nil and I. pes-tigridis plants. Pinnately lobed
leaves were detected only on I. quamoclit plants. I. nil, I. pes-tigridis and I. setosa all had
palmately lobed leaves. However, I. nil and I. setosa had moderate lobed leaves, while I.
pes-tigridis had deep lobed leaves. Interestingly, I. platensis and I. digitata had both very
deep lobed and very slight lobed leaves. Although all species had green leaves, they dif-
fered in leaf vein and petiole colors. Specifically, the leaf veins of I. trifida, I. setosa, I. pes-
caprae, and I. batatas exhibited anthocyanin pigmentation. Additionally, the petioles of
these four species, along with I. triloba, I. nil, and I. obscura, also showed anthocyanin pig-
mentation.
The stems differed in terms of shape and thickness. I. murucoides had erect stems, but
all other species had twining stems. Furthermore, downy hair was detected on the stems
of I. nil, I. setosa, and I. pes-tigridis. In addition to being the only species with an erect stem,
I. murucoides also had the thickest stem (approximately 14 mm in diameter). I. muelleri and
I. obscura had the thinnest stems (approximately 1 mm in diameter). For all other species,
stem thickness ranged from 2.5 to 5 mm.
Figure 1. Comparison of root morphology among 13 species of the genus Ipomoea. (a): Ipomoea triloba;
(b): Ipomoea nil; (c): Ipomoea quamoclit; (d): Ipomoea platensis; (e): Ipomoea pes-tigridis; (f): Ipomoea
pes-caprae; (g): Ipomoea trifida; (h): Ipomoea setosa; (i): Ipomoea obscura; (j): Ipomoea muelleri; (k): Ipomoea
murucoides; (l): Ipomoea batatas; (m): Ipomoea digitata. Scale bars, 5 cm.
The leaves of all species varied in terms of shape, size, and color. Notably, leaves with
downy hair were detected exclusively on I. nil and I. pes-tigridis plants. Pinnately lobed
leaves were detected only on I. quamoclit plants. I. nil,I. pes-tigridis and I. setosa all had
palmately lobed leaves. However, I. nil and I. setosa had moderate lobed leaves, while
I. pes-tigridis had deep lobed leaves. Interestingly, I. platensis and I. digitata had both
very deep lobed and very slight lobed leaves. Although all species had green leaves,
they differed in leaf vein and petiole colors. Specifically, the leaf veins of I.trifida,I. setosa,
I. pes-caprae, and I. batatas exhibited anthocyanin pigmentation. Additionally, the petioles of these
four species, along with I. triloba,I. nil, and I. obscura, also showed anthocyanin pigmentation.
The stems differed in terms of shape and thickness. I. murucoides had erect stems, but
all other species had twining stems. Furthermore, downy hair was detected on the stems of
I. nil,I. setosa, and I. pes-tigridis. In addition to being the only species with an erect stem,
I. murucoides also had the thickest stem (approximately 14 mm in diameter). I.muelleri and
I. obscura had the thinnest stems (approximately 1 mm in diameter). For all other species,
stem thickness ranged from 2.5 to 5 mm.
There were significant root morphological differences. The roots of three species
clearly expanded, whereas the roots of the other ten species did not. Both I. platensis and
I. digitata had only one long irregular storage root, while I. batatas produced multiple long
elliptic storage roots. Moreover, the storage roots of I. platensis and I. digitata were both
developed from the swelling of the primary root. In contrast, the storage roots of I. batatas
were developed from multiple lateral roots. Among the examined species, only I. batatas
had red skin on its storage roots.
Genes 2024,15, 1340 5 of 14
3.2. Number and Length of Chromosomes
With the exception of I. batatas, which was revealed to be a hexaploid with 90 chromo-
somes, the remaining species were diploids with 30 chromosomes, except for I. pes-tigridis,
which had 28 chromosomes (Table 2, Figure 2).
Table 2. Chromosome and rDNA site numbers of different Ipomoea species.
Species Chromosome Number
Number of rDNA
5S rDNA 18S rDNA
Ipomoea muelleri 2n= 2x = 30 2 6
Ipomoea murucoides 2n= 2x = 30 2 4
Ipomoea trifida 2n= 2x = 30 2 6
Ipomoea triloba 2n= 2x = 30 2 8
Ipomoea nil 2n= 2x = 30 2 14
Ipomoea setosa 2n= 2x = 30 2 4
Ipomoea platensis 2n= 2x = 30 2 8
Ipomoea quamoclit 2n= 2x = 30 2 12
Ipomoea obscura 2n= 2x = 30 2 4
Ipomoea pes-tigridis 2n= 2x = 28 2 6
Ipomoea pes-caprae 2n= 2x = 30 2 4
Ipomoea digitata 2n= 2x = 30 4 7
Ipomoea batatas 2n= 6x = 90 6 16
Genes 2024, 15, x FOR PEER REVIEW 5 of 14
There were significant root morphological differences. The roots of three species
clearly expanded, whereas the roots of the other ten species did not. Both I. platensis and
I. digitata had only one long irregular storage root, while I. batatas produced multiple long
elliptic storage roots. Moreover, the storage roots of I. platensis and I. digitata were both
developed from the swelling of the primary root. In contrast, the storage roots of I. batatas
were developed from multiple lateral roots. Among the examined species, only I. batatas
had red skin on its storage roots.
3.2. Number and Length of Chromosomes
With the exception of I. batatas, which was revealed to be a hexaploid with 90 chro-
mosomes, the remaining species were diploids with 30 chromosomes, except for I. pes-
tigridis, which had 28 chromosomes (Table 2, Figure 2).
Figure 2. Chromosomes and rDNA sites in 13 species of the genus Ipomoea. 5S rDNA is green, and
18S rDNA is red. (a): Ipomoea obscura; (b): Ipomoea quamoclit; (c): Ipomoea setosa; (d): Ipomoea trifida;
(e): Ipomoea murucoides; (f): Ipomoea pes-caprae; (g): Ipomoea batatas; (h): Ipomoea pes-tigridis; (i): Ipomoea
nil; (j): Ipomoea muelleri; (k): Ipomoea digitata; (l): Ipomoea platensis; (m): Ipomoea triloba. Scale bars, 10
µm.
Table 2. Chromosome and rDNA site numbers of different Ipomoea species.
Species Chromosome Number
Number of rDNA
5S rDNA 18S rDNA
Ipomoea muelleri 2n = 2x = 30 2 6
Ipomoea murucoides 2n = 2x = 30 2 4
Ipomoea trifida 2n = 2x = 30 2 6
Ipomoea triloba 2n = 2x = 30 2 8
Ipomoea nil 2n = 2x = 30 2 14
Ipomoea setosa 2n = 2x = 30 2 4
Ipomoea platensis 2n = 2x = 30 2 8
Ipomoea quamoclit 2n = 2x = 30 2 12
Ipomoea obscura 2n = 2x = 30 2 4
Ipomoea pes-tigridis 2n = 2x = 28 2 6
Ipomoea pes-caprae 2n = 2x = 30 2 4
Ipomoea digitata 2n = 2x = 30 4 7
Figure 2. Chromosomes and rDNA sites in 13 species of the genus Ipomoea. 5S rDNA is green, and
18S rDNA is red. (a): Ipomoea obscura; (b): Ipomoea quamoclit; (c): Ipomoea setosa; (d): Ipomoea trifida;
(e): Ipomoea murucoides; (f): Ipomoea pes-caprae; (g): Ipomoea batatas; (h): Ipomoea pes-tigridis; (i): Ipomoea
nil; (j): Ipomoea muelleri; (k): Ipomoea digitata; (l): Ipomoea platensis; (m): Ipomoea triloba. Scale bars,
10 µm.
A comparison of chromosome lengths (Table 3) indicated I. batatas had the shortest
chromosomes (average length of 0.52
µ
m; the longest chromosome was 2.795 times longer
than the shortest chromosome). I. digitata had the longest chromosomes (average length of
1.07
µ
m). The smallest difference in chromosome length was detected in I. platensis (the
longest chromosome was only 1.444 times longer than the shortest chromosome).
Genes 2024,15, 1340 6 of 14
Table 3. Chromosome length of 13 Ipomoea species.
Species Chromosome Length (nm)
Maximum Minimum Average
Ipomoea muelleri 0.965 0.555 0.744
Ipomoea murucoides 0.943 0.369 0.707
Ipomoea trifida 1.226 0.667 0.955
Ipomoea triloba 1.120 0.534 0.871
Ipomoea nil 1.025 0.542 0.817
Ipomoea setosa 1.185 0.673 0.839
Ipomoea platensis 1.188 0.822 0.994
Ipomoea quamoclit 0.934 0.500 0.680
Ipomoea obscura 0.911 0.562 0.724
Ipomoea pes-tigridis 0.847 0.453 0.663
Ipomoea pes-caprae 1.072 0.634 0.807
Ipomoea digitata 1.448 0.752 1.072
Ipomoea batatas 0.917 0.328 0.569
3.3. 5S rDNA FISH Signal Sites and Amplified Fragment Polymorphisms
In the metaphase chromosomes of the 13 Ipomoea species, 5S rDNA signals were
detected in pairs (Figure 3).
Genes 2024, 15, x FOR PEER REVIEW 6 of 14
Ipomoea batatas 2n = 6x = 90 6 16
A comparison of chromosome lengths (Table 3) indicated I. batatas had the shortest
chromosomes (average length of 0.52 µm; the longest chromosome was 2.795 times longer
than the shortest chromosome). I. digitata had the longest chromosomes (average length
of 1.07 µm). The smallest difference in chromosome length was detected in I. platensis (the
longest chromosome was only 1.444 times longer than the shortest chromosome).
Table 3. Chromosome length of 13 Ipomoea species.
Species Chromosome Length (nm)
Maximum Minimum Average
Ipomoea muelleri 0.965 0.555 0.744
Ipomoea murucoides 0.943 0.369 0.707
Ipomoea trifida 1.226 0.667 0.955
Ipomoea triloba 1.120 0.534 0.871
Ipomoea nil 1.025 0.542 0.817
Ipomoea setosa 1.185 0.673 0.839
Ipomoea platensis 1.188 0.822 0.994
Ipomoea quamoclit 0.934 0.500 0.680
Ipomoea obscura 0.911 0.562 0.724
Ipomoea pes-tigridis 0.847 0.453 0.663
Ipomoea pes-caprae 1.072 0.634 0.807
Ipomoea digitata 1.448 0.752 1.072
Ipomoea batatas 0.917 0.328 0.569
3.3. 5S rDNA FISH Signal Sites and Amplified Fragment Polymorphisms
In the metaphase chromosomes of the 13 Ipomoea species, 5S rDNA signals were de-
tected in pairs (Figure 3).
Figure 3. 5S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa;
(c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e1,e2): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea
Figure 3. 5S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa;
(c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e
1
,e
2
): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea
platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l): Ipomoea
quamoclit; (m1,m2,m3): Ipomoea batatas.
There were six and four 5S rDNA signals in I. batatas and I. digitata, respectively, which
was more than the two 5S rDNA signals in the other species. The different signal pairs
in I. batatas and I. digitata differed in terms of intensity. One pair of signals in I. digitata
was significantly weaker than the other signal pairs. In I. batatas, one pair of signals was
obviously stronger than the other signal pairs. However, any two signals on homologous
chromosomes had essentially the same intensity.
5S rDNA molecular markers were used to detect polymorphisms in 13 Ipomoea species
(Figure 4).
Genes 2024,15, 1340 7 of 14
Genes 2024, 15, x FOR PEER REVIEW 7 of 14
platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l): Ipomoea
quamoclit; (m1,m2,m3): Ipomoea batatas.
There were six and four 5S rDNA signals in I. batatas and I. digitata, respectively,
which was more than the two 5S rDNA signals in the other species. The different signal
pairs in I. batatas and I. digitata differed in terms of intensity. One pair of signals in I. digi-
tata was significantly weaker than the other signal pairs. In I. batatas, one pair of signals
was obviously stronger than the other signal pairs. However, any two signals on homol-
ogous chromosomes had essentially the same intensity.
5S rDNA molecular markers were used to detect polymorphisms in 13 Ipomoea spe-
cies (Figure 4).
Figure 4. Electrophoresis results of 5S rDNA amplification products in 13 species of the genus Ipo-
moea. 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6:
Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11:
Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas; M: Marker.
There were four paerns of 5S rDNA amplification products. The first paern, which
included two major amplification products (detected as approximately 220 and 450 bp
bands), was obtained for I. murucoides, I. nil, I. setosa, and I. obscura. The second paern,
which consisted of two major bands at approximately 270 and 520 bp, was detected for I.
trifida, I. triloba, I. pes-caprae, and I. batatas. The third paern, which was obtained for I.
muelleri, I. platensis, and I. digitata, comprised two major bands (approximately 230 and
290 bp). The final amplification paern consisted of only one major band (approximately
300 bp) and was detected for I. quamoclit and I. pes-tigridis.
3.4. 18S rDNA Sites and Sequence Polymorphisms
The number of 18S rDNA signals among the 13 selected species could be divided into
seven paerns. All 18S rDNA signals were detected as pairs, except in I. digitata, which
had seven 18S rDNA signals. The only hexaploid species (I. batatas) had 16 18S rDNA
signals. In the diploid species, four signals were detected in I. murucoides, I. setosa, I. ob-
scura, and I. pes-caprae; six signals were detected in I. muelleri, I. trifida, and I. pes-tigridis;
and eight signals were detected in I. triloba and I. platensis. In I. digitata, I. quamoclit, and I.
nil, 7, 12, and 14 18S rDNA signals were detected, respectively (Table 2, Figure 5).
Figure 4. Electrophoresis results of 5S rDNA amplification products in 13 species of the genus Ipomoea.
1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6: Ipomoea
setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11: Ipomoea
pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas; M: Marker.
There were four patterns of 5S rDNA amplification products. The first pattern, which
included two major amplification products (detected as approximately 220 and 450 bp
bands), was obtained for I. murucoides,I. nil,I. setosa, and I. obscura. The second pattern,
which consisted of two major bands at approximately 270 and 520 bp, was detected for
I. trifida,I. triloba,I. pes-caprae, and I. batatas. The third pattern, which was obtained for
I. muelleri,I. platensis, and I. digitata, comprised two major bands (approximately 230 and
290 bp). The final amplification pattern consisted of only one major band (approximately
300 bp) and was detected for I. quamoclit and I. pes-tigridis.
3.4. 18S rDNA Sites and Sequence Polymorphisms
The number of 18S rDNA signals among the 13 selected species could be divided into
seven patterns. All 18S rDNA signals were detected as pairs, except in I. digitata, which
had seven 18S rDNA signals. The only hexaploid species (I. batatas) had 16 18S rDNA
signals. In the diploid species, four signals were detected in I. murucoides,I. setosa,I. obscura,
and I. pes-caprae; six signals were detected in I. muelleri,I. trifida, and I. pes-tigridis; and
eight signals were detected in I. triloba and I. platensis. In I. digitata,I. quamoclit, and I. nil,
7, 12, and 14 18S rDNA signals were detected, respectively (Table 2, Figure 5).
Genes 2024, 15, x FOR PEER REVIEW 7 of 14
platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l): Ipomoea
quamoclit; (m1,m2,m3): Ipomoea batatas.
There were six and four 5S rDNA signals in I. batatas and I. digitata, respectively,
which was more than the two 5S rDNA signals in the other species. The different signal
pairs in I. batatas and I. digitata differed in terms of intensity. One pair of signals in I. digi-
tata was significantly weaker than the other signal pairs. In I. batatas, one pair of signals
was obviously stronger than the other signal pairs. However, any two signals on homol-
ogous chromosomes had essentially the same intensity.
5S rDNA molecular markers were used to detect polymorphisms in 13 Ipomoea spe-
cies (Figure 4).
Figure 4. Electrophoresis results of 5S rDNA amplification products in 13 species of the genus Ipo-
moea. 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6:
Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11:
Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas; M: Marker.
There were four paerns of 5S rDNA amplification products. The first paern, which
included two major amplification products (detected as approximately 220 and 450 bp
bands), was obtained for I. murucoides, I. nil, I. setosa, and I. obscura. The second paern,
which consisted of two major bands at approximately 270 and 520 bp, was detected for I.
trifida, I. triloba, I. pes-caprae, and I. batatas. The third paern, which was obtained for I.
muelleri, I. platensis, and I. digitata, comprised two major bands (approximately 230 and
290 bp). The final amplification paern consisted of only one major band (approximately
300 bp) and was detected for I. quamoclit and I. pes-tigridis.
3.4. 18S rDNA Sites and Sequence Polymorphisms
The number of 18S rDNA signals among the 13 selected species could be divided into
seven paerns. All 18S rDNA signals were detected as pairs, except in I. digitata, which
had seven 18S rDNA signals. The only hexaploid species (I. batatas) had 16 18S rDNA
signals. In the diploid species, four signals were detected in I. murucoides, I. setosa, I. ob-
scura, and I. pes-caprae; six signals were detected in I. muelleri, I. trifida, and I. pes-tigridis;
and eight signals were detected in I. triloba and I. platensis. In I. digitata, I. quamoclit, and I.
nil, 7, 12, and 14 18S rDNA signals were detected, respectively (Table 2, Figure 5).
Figure 5. 18S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipo-
moea setosa; (c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e): Ipomoea digitata; (f): Ipomoea triloba;
(g): Ipomoea platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri;
(l1,l2): Ipomoea quamoclit; (m1,m2,m3): Ipomoea batatas.
All of the 18S rDNA FISH signals in I. setosa,I. triloba, and I. trifida had almost the
same intensity, whereas there were obvious differences in the signal intensities in the other
10 species. In addition, the PCR amplification of 18S rDNA generated only one product
(approximately 1700 bp) in all 13 species (Figure S3).
Genes 2024,15, 1340 8 of 14
3.5. Polymorphisms in 18S rDNA Sequences
To further analyze 18S rDNA polymorphisms, we sequenced the amplification prod-
ucts for all 13 species. According to the results, the 18S rDNA sequence lengths for the
13 species ranged from 1682 bp (I. murucoides and I. pes-caprae) to 1722 bp (I. quamoclit).
When all 18S rDNA sequences were included, the average length was 1688 bp. Further
aligning and splicing of the 18S rDNA sequences (1908 bp) revealed 652 variable sites
and 636 parsimony-informative sites, accounting for 34.2% and 33.3% of the sequences,
respectively. There were also 16 singleton sites, accounting for 0.8% of the sequences.
Moreover, there was relatively little difference in the GC content among species, with an
average of 50.7%.
On the basis of the 18S rDNA sequences in the 13 species, a neighbor-joining phyloge-
netic tree was constructed (1000 bootstrap replicates) using MEGA 11. The 13 species were
divided into two main clades (Figure 6).
Genes 2024, 15, x FOR PEER REVIEW 8 of 14
Figure 5. 18S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa;
(c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea
platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l1,l2): Ipomoea
quamoclit; (m1,m2,m3): Ipomoea batatas.
All of the 18S rDNA FISH signals in I. setosa, I. triloba, and I. trifida had almost the
same intensity, whereas there were obvious differences in the signal intensities in the
other 10 species. In addition, the PCR amplification of 18S rDNA generated only one prod-
uct (approximately 1700 bp) in all 13 species (Figure S3).
3.5. Polymorphisms in 18S rDNA Sequences
To further analyze 18S rDNA polymorphisms, we sequenced the amplification prod-
ucts for all 13 species. According to the results, the 18S rDNA sequence lengths for the 13
species ranged from 1682 bp (I. murucoides and I. pes-caprae) to 1722 bp (I. quamoclit). When
all 18S rDNA sequences were included, the average length was 1688 bp. Further aligning
and splicing of the 18S rDNA sequences (1908 bp) revealed 652 variable sites and 636 par-
simony-informative sites, accounting for 34.2% and 33.3% of the sequences, respectively.
There were also 16 singleton sites, accounting for 0.8% of the sequences. Moreover, there
was relatively lile difference in the GC content among species, with an average of 50.7%.
On the basis of the 18S rDNA sequences in the 13 species, a neighbor-joining phylo-
genetic tree was constructed (1000 bootstrap replicates) using MEGA 11. The 13 species
were divided into two main clades (Figure 6).
Figure 6. Phylogenetic tree of 13 Ipomoea species based on 18S rDNA sequence. The bootstrap anal-
ysis was replicated 1000 times. The number shown in each branch indicates the bootstrap value
percentage (%).
Clade I consisted of I. trifida, I. batatas, I. platensis, I. digitata, I. setosa, I. obscura, and I.
nil, among which I. trifida and I. batatas, as well as I. platensis and I. digitata, were clustered
Figure 6. Phylogenetic tree of 13 Ipomoea species based on 18S rDNA sequence. The bootstrap
analysis was replicated 1000 times. The number shown in each branch indicates the bootstrap value
percentage (%).
Clade I consisted of I. trifida,I. batatas,I. platensis,I. digitata,I. setosa,I. obscura, and
I. nil, among which I. trifida and I. batatas, as well as I. platensis and I. digitata, were clustered
together. Clade II included I. muelleri,I. triloba,I. murucoides,I. quamoclit,I. pes-tigridis, and
I. pes-caprae, of which I. pes-tigridis and I. pes-caprae were clustered together.
The 18S rDNA sequences and MEGA 11 were used to calculate genetic distances
(Table 4).
Genes 2024,15, 1340 9 of 14
Table 4. Genetic distances among 13 Ipomoea species.
Species 1 2 3 4 5 6 7 8 9 10 11 12 13
1 0.000
2 0.003 0.000
3 0.658 0.658 0.000
4 0.003 0.001 0.658 0.000
5 0.657 0.657 0.002 0.657 0.000
6 0.659 0.659 0.002 0.659 0.003 0.000
7 0.657 0.657 0.001 0.657 0.003 0.003 0.000
8 0.003 0.003 0.660 0.002 0.659 0.661 0.659 0.000
9 0.659 0.659 0.003 0.659 0.003 0.003 0.003 0.661 0.000
10 0.006 0.004 0.660 0.005 0.660 0.661 0.660 0.005 0.661 0.000
11 0.003 0.003 0.661 0.004 0.661 0.663 0.661 0.004 0.663 0.005 0.000
12 0.657 0.657 0.001 0.657 0.003 0.003 0.000 0.659 0.003 0.660 0.661 0.000
13 0.658 0.658 0.000 0.658 0.002 0.002 0.001 0.660 0.003 0.660 0.661 0.001
0.000
Note: 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil;
6: Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis;
11: Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas.
The genetic distance between any two species in clade I ranged from 0.000 to 0.003.
Notably, the genetic distance between I. batatas and I. trifida, as well as between I. platensis
and I. digitata, was 0.000. A comparison of the 18S rDNA sequences in I. batatas and I. trifida
detected only three differences. Additionally, the 18S rDNA sequences of I. platensis and
I. digitata were identical. In clade II, the genetic distance between any two species ranged
from 0.001 to 0.006. Moreover, the genetic distance between any two species from different
main clades ranged from 0.657 to 0.663.
4. Discussion
To date, the limited genetic diversity of sweet potato has limited varietal improve-
ment [
1
,
3
]. Hence, the introduction of more germplasm resources with substantial genetic
diversity is essential for sweet potato breeding. In addition to being genetically diverse,
the wild relatives of sweet potato possess desirable characteristics (e.g., disease resistance
and high starch content) [
25
], making them potentially useful for broadening the genetic
background of sweet potato [
26
]. However, there are few reports describing the utility
of these wild relatives, except for I. trifida, for sweet potato breeding. In this study, we
compared the phenotypes of 13 Ipomoea species, which revealed considerable differences in
the leaves, stems, and roots. For example, I. murucoides had a thick and erect stem. Notably,
besides sweet potato (I. batatas), I. platensis and I. digitata had expanded roots. These results
are relevant to future studies and the application of these germplasm.
Root expansion, which is a key trait of sweet potato, is affected and regulated by
many factors [
27
], including environmental conditions [
28
], endogenous hormones [
29
],
transcription factors, and genes [
30
–
32
]. In particular, genes related to the synthesis and
metabolism of hormones, lignin, and starch play an important role [
33
,
34
]. In recent
years, the hypothesis that the formation of sweet potato storage roots may be triggered by
Agrobacterium rhizogenes derived from species related to sweet potato via hybridization or
infection has been proposed [
35
,
36
]. Because of the polyploidy and high heterozygosity of
sweet potato, the key genes and molecular mechanisms regulating root expansion have not
been fully characterized. The two diploid (2n= 30) Ipomoea species with expanded roots in
this study may be useful materials for research on sweet potato root expansion.
Considering the basic chromosome number for the genus Ipomoea (n = 15), diploid
species should contain 2n= 30 chromosomes. Earlier research indicated that I. trifida,
I. triloba,I. setosa,I. nil,I. pes-caprae, and I. obscura have 30 chromosomes [
6
,
37
–
39
], which
is consistent with our findings. Previous studies on I. pes-tigridis revealed the following
number of chromosomes: 2n= 2x = 26, 2n= 2x = 30, and 2n=4x=60[
40
–
42
]. However,
the number of chromosomes reported by Sampathkumar et al. (2n= 2x = 28) was in
Genes 2024,15, 1340 10 of 14
accordance with our results [
39
]. Similar studies have also found chromosomal aneuploidy
in many Ipomoea species [
13
,
43
,
44
]. A few studies suggest that chromosomal aneuploidy
affects transcript dosage, ultimately leading to phenotypic variations [
45
]. The effects of
the number of chromosomal mutations remain unknown. The variations in the number of
I. pes-tigridis chromosomes will need to be investigated further.
rDNA, which is highly repetitive and conserved across various species, has been
commonly used as a reliable and stable marker for cytological studies. Analyses of the
number and distribution of rDNA sites using FISH probes can help elucidate chromoso-
mal behavior. In the present study, we analyzed 18S/5S rDNA distribution patterns in
13 Ipomoea species and found that the number of 18S and 5S rDNA sites in I. trifida,I. nil,
and I. setosa was consistent with the results of earlier studies [6,46].
Except for I. digitata, which had four 5S rDNA sites, all diploid species possessed two
5S rDNA sites, representing exactly one-third of the number of 5S rDNA sites found in
hexaploid species. In contrast, there were seven patterns for the number of 18S rDNA sig-
nals. Eight and sixteen signals were detected for I. triloba and I. batatas, respectively.
However, Srisuwan et al. reported that I. triloba has 6 18S rDNA sites, while sweet
potato (I. batatas) from various regions differs regarding the number of 18S rDNA sites
(e.g., 12, 16, and 18) [
6
]. The intraspecific variation in the number of 18S rDNA sites, which
is common among plants [
47
–
50
], is related to unequal crossing over and transposition
events, chromosomal structure fracture and rearrangement, and polyploidization-related
process changes to varying degrees [
13
]. Interestingly, the number of 5S rDNA sites is
relatively stable in I. batatas. In this study, as well as in some earlier studies [
6
,
13
,
23
],
six 5S rDNA sites were detected, with a few exceptions. Moreover, seven 18S rDNA sites
(i.e., not paired) were detected in I. digitata. The loss of rDNA sites has been reported for
Citrullus species [
51
] and sweet potato [
13
]. This loss is caused by chromosomal deletion,
duplication, and unequal exchange [
52
]. Furthermore, different signal sizes and intensities
for 18S and 5S rDNA sites were observed in this study, which is consistent with the findings
of other studies [
53
–
55
]. This diversity is mainly related to differences in the copy number
among rDNA sites [13].
In eukaryotes, rDNA sequences are highly conserved. Many studies that amplified
rDNA sequences revealed patterns that were similar to those in the current study, in
which only one 18S rDNA sequence [
22
,
56
] and multiple 5S rDNA sequences [
57
–
59
] were
amplified. These results confirmed that 18S rDNA is more conserved than 5S rDNA. 5S
rDNA multigene family members consist of a highly conserved coding sequence (120 bp)
and a variable non-transcribed spacer (NTS), forming hundreds to thousands of tandem
repeats [
60
]. The different 5S rDNA amplification patterns are probably due to how freely
NTS can mutate [
61
]. Using the same primers as us, Choi et al. amplified two 5S rDNA
sequences in three different sweet potato cultivars (250 and 340 bp) [23].
The origin of sweet potato remains unclear [
62
], necessitating further research regard-
ing the phylogenetic relationships among its wild relatives. Of the Ipomoea species we
selected, I. batatas,I. trifida, and I. triloba had similar 5S rDNA amplification patterns. In
addition, the genetic distance between I. trifida and I. batatas was 0.00 according to the
18S rDNA sequences, which was almost consistent with the findings of a previous related
study that examined ITS sequences (0.01) [
16
]. However, I. triloba and I. batatas were clearly
separated in the phylogenetic tree, with a genetic distance of 0.658. According to previous
investigations, I. trifida [
6
,
62
,
63
] and I. triloba [
16
,
64
] are both the progenitors of cultivated
sweet potato, but our results indicate that I. trifida is more likely to be the progenitor of
cultivated sweet potato than I. triloba.
In our phylogenetic tree, species located on different main clades showed significant
genetic distances. However, species within the same clade exhibit extremely close ge-
netic distances. These results demonstrated that the phylogenetic tree construct by 18S
rDNA could be used to effectively distinguish species within the Ipomoea genus based on
sequences accumulated variations during evolution. Interestingly, the three species that
produced enlarged roots were all on clade I, while only the species on clade II displayed
Genes 2024,15, 1340 11 of 14
the fourth amplification pattern of 5S rDNA. However, the number of 18S rDNA sites and
the amplification pattern of 5S rDNA on the two main clades both have multiple patterns,
indicating that the polymorphism of rDNA site number and amplification results should
be related to genome complexity or polyploidy but not to the variation of the sequence
itself. Moreover, I. platensis and I. digitata were closely related to sweet potato, sharing
identical 18S rDNA sequences and similar morphological features (e.g., expanded roots).
These characteristics further reflect the importance of these species for future theoretical
research and genetic improvement of sweet potato.
Considering the size of the genus Ipomoea, our study involved relatively few species.
Nevertheless, we detected significant variability in the morphology, number of chromo-
somes, location of 5S/18S rDNA sites, and 18S rDNA sequences among the selected species.
These findings have deepened our understanding of the genus Ipomoea and serve as useful
information for future investigations. To explore and exploit more wild relatives of sweet
potato, additional research involving more species is needed.
5. Conclusions
In this study, we clarified the phenotypic diversity among thirteen Ipomoea species,
with three species, including sweet potato, found to produce expanded roots. Except for
sweet potato, which was a hexaploid, all other species were diploid. Furthermore, the
number of 18S rDNA sites showed more polymorphisms than that of 5S rDNA. All sites
were paired, except for the 18S rDNA sites in I. digitata. The amplification patterns of 5S
rDNA were found to be more variable, while those of 18S rDNA were more conserved.
Thirteen Ipomoea species were divided into two main clades based on the analysis of
18S rDNA sequences, and greater genetic distances were observed between the clades.
Three species with enlarged roots were all on clade I, and the closest relationships were
found between sweet potato and I. trifida. These results provide comprehensive information
regarding the morphological, molecular, and cytological characteristics of 13 Ipomoea species.
This information should provide breeders with helpful clues regarding how to optimize
the use of these germplasms in breeding programs.
Supplementary Materials: The following supporting information can be downloaded at
https://www.mdpi.com/article/10.3390/genes15101340/s1, Figure S1: Comparison of stem mor-
phology among 13 species of the genus Ipomoea. Figure S2: Comparison of leaf morphology among 13
species of the genus Ipomoea. Figure S3: Electrophoresis results of 18S rDNA amplification products in
13 species of the genus Ipomoea.
Author Contributions: Conceptualization, J.F.; Data curation, C.Z.; Formal analysis, T.L. and C.Z.;
Investigation, J.W.; Methodology, T.L., Z.P. and F.Y. (Fan Yang); Software, T.L.; Validation, J.W. and
F.Y. (Feiyang Yang); Writing—original draft, J.W., T.L. and F.Y. (Feiyang Yang); Writing—review
and editing, H.Q., Z.P. and J.F. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was supported by the Financial Self-directed Innovation Project of Sichuan
Province (2022YXLW003, 2022ZZCX041); Strategic Scientist Studio of Sichuan Academy of Agri-
cultural Sciences, the Accurate Identification Project of Crop Germplasm from Sichuan Provincial
Finance Department, 1 + 3ZYGG001; the 1 + 9 open competition project of Sichuan Academy of
Agricultural Sciences to select the best candidates (1 + 9KJGG001); and the Sichuan Science and
Technology Program (2021YFY0027).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The original contributions presented in the study are included in the
article and Supplementary Material, further inquiries can be directed to the corresponding author.
Conflicts of Interest: The authors declare no conflict of interest.
Genes 2024,15, 1340 12 of 14
References
1.
Khoury, C.K.; Heider, B.; Castañeda-Álvarez, N.P.; Achicanoy, H.A.; Sosa, C.C.; Miller, R.E.; Scotland, R.W.; Wood, J.R.I.; Rossel,
G.; Eserman, L.A.; et al. Distributions, ex situ conservation priorities, and genetic resource potential of crop wild relatives of
sweetpotato [Ipomoea batatas (L.) Lam., I. series Batatas]. Front. Plant Sci. 2015,6, 251. [CrossRef] [PubMed]
2.
Yan, M.X.; Nie, H.Z.; Wang, Y.Z.; Wang, X.Y.; Jarret, R.; Zhao, J.M.; Wang, H.X.; Yang, J. Exploring and exploiting genetics and
genomics for sweetpotato improvement: Status and perspectives. Plant Commun. 2022,3, 100332. [CrossRef]
3.
Liu, D.G.; Zhao, N.; Zhai, H.; Yu, X.X.; Jie, Q.; Wang, L.J.; He, S.Z.; Liu, Q.C. AFLP Fingerprinting and Genetic Diversity of Main
Sweetpotato Varieties in China. J. Integr. Agric. 2012,11, 1424–1433. [CrossRef]
4.
Heslop-Harrison, J.S. Comparative Genome Organization in Plants: From Sequence and Markers to Chromatin and Chromosomes.
Plant Cell 2000,12, 617–635. [CrossRef] [PubMed]
5.
Niu, K.; Chen, C.B.; Liu, H.J.; Gu, Y.; Wang, C.G.; Sun, D.L.; Song, W.Q. Localization of rDNA Sequences in a Variety of Vegetable
& Fruit Plants on Chromosome. Acta Sci. Nat. Univ. Nankaiensis 2017,50, 67–75.
6.
Srisuwan, S.; Sihachakr, D.; Siljak-Yakovlev, S. The origin and evolution of sweet potato (Ipomoea batatas Lam.) and its wild
relatives through the cytogenetic approaches. Plant Sci. 2006,171, 424–433. [CrossRef] [PubMed]
7.
An, T.T.; Tang, J.L.; Sun, J.Y.; Cao, Q.H.; Ma, D.F.; Li, Z.Y. rDNA-FISH Analysis and DAPI-kayotype of Ipomoea batatas cv. and
Ipomoea hederacea Jacq. Acta Bot. Boreali-Occident. Sin. 2012,32, 682–687.
8.
He, J.; Lin, S.S.; Yu, Z.Y.; Song, A.P.; Guan, Z.Y.; Fang, W.M.; Chen, S.M.; Zhang, F.; Jiang, J.F.; Chen, F.D.; et al. Identification of 5S
and 45S rDNA sites in Chrysanthemum species by using oligonucleotide fluorescence in situ hybridization (Oligo-FISH). Mol. Biol.
Rep. 2021,48, 21–31. [CrossRef]
9.
Liu, Y.L.; Liu, L.J.; Peng, R.H. Development of FISH and Its Application in Plant Genome Research. Mol. Plant Breed. 2018,16,
5696–5703.
10.
Wang, L.J.; Sheng, M.Y.; Ren, X.L. Chromosomal Localization of 5S and 18S rDNA in Eight Nicotiana Species and the Implications
for Genome Evolution of Genus Nicotiana.Cytologia 2021,86, 149–154. [CrossRef]
11.
Xin, H.Y.; Zhang, T.; Wu, Y.F.; Zhang, W.L.; Zhang, P.D.; Xi, M.L.; Jiang, J.M. An extraordinarily stable karyotype of the woody
Populus species revealed by chromosome painting. Plant J. 2019,101, 253–264. [CrossRef] [PubMed]
12.
Zhou, Y.P.; Wang, Z.X.; Du, Y.P.; Li, J.W.; He, H.B.; Jia, G.X. Fluorescence in situ hybridization of 35S rDNA sites and karyotype
of wild Lilium (Liliaceae) species from China: Taxonomic and phylogenetic implications. Genet. Resour. Crop Evol. 2020,67,
10011–11017. [CrossRef]
13.
Su, D.; Chen, L.; Sun, J.Y.; Zhang, L.Y.; Gao, R.F.; Li, Q.; Han, Y.H.; Li, Z.Y. Comparative Chromosomal Localization of 45S and 5S
rDNA Sites in 76 Purple-Fleshed Sweet Potato Cultivars. Plants 2020,9, 865–876. [CrossRef]
14.
Chen, L.Q.; Zhang, Z.R.; Yang, J.B.; Li, D.Z.; Yu, W.B. Plastid phylogenomic insights into the phylogeny of Convolvulaceae.
Guihaia 2021,42, 1740–1749.
15. Liu, Z.; Zhang, H.Y. ITS Sequence Analysis of Convolvulaceae Plants. J. West China For. Sci. 2012,41, 70–74.
16.
Yu, L.X.; Liu, M.Y.; Cao, Q.H.; Yu, Y.C.; Xie, Y.P.; Luo, Y.H.; Han, Y.H.; Li, Z.Y. Analysis of nrDNA ITS Sequences in Ipomoea batatas
and its Relative Wild Species. Plant Sci. J. 2014,32, 40–49.
17.
Chelomina, G.N.; Rozhkovan, K.V.; Voronova, A.N.; Burundukova, O.L.; Muzarok, T.I.; Zhuravlev, Y.N. Variation in the number
of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng
(Panax ginseng Meyer). J. Ginseng Res. 2016,40, 176–184. [CrossRef]
18. Huamén, Z. Descriptors for Sweet Potato; International Board for Plant Genetic Resources: Rome, Italy, 1991.
19.
Zhang, J.; Jiang, Y.; Wang, Y.; Guo, Y.L.; Long, H.; Deng, G.B.; Chen, Q.; Xuan, P. Molecular markers and cytogenetics
to characterize a wheat-Dasypyrum villosum 3V (3D) substitution line conferring resistance to stripe rust. PLoS ONE 2018,
13, e0202033. [CrossRef] [PubMed]
20.
Yu, Z.H.; Wang, H.J.; Xu, Y.F.; Li, Y.S.; Lang, T.; Yang, Z.J.; Li, G.R. Characterization of Chromosomal Rearrangement in New
Wheat—Thinopyrum intermedium Addition Lines Carrying Thinopyrum—Specific Grain Hardness Genes. Agronomy 2019,9, 18.
[CrossRef]
21.
Zheng, L.Y.; Jia, D.H.; Fei, X.F.; Luo, X.; Yang, Z.R. An assessment of the genetic diversity within Ganoderma strains with AFLP
and ITS PCR-RFLP. Microbiol. Res. 2009,164, 312–321. [CrossRef]
22.
Jiang, F.Y.; Huang, H.; Yang, N.; Ma, J. Cloning and Sequence Analysis of 18s rRNA Genes of Several Large Green Algae in
Hainan Province. Chin. J. Trop. Agric. 2017,37, 49–54.
23.
Choi, E.Y.; Seo, J.H.; Seo, B.B. Sequence Polymorphism and Chromosomal Localization of 5S rDNA of Three Cultivated Varieties
of Sweetpotato (Ipomoea batatas (L.) Lam.). Genes Genom. 2009,31, 325–332. [CrossRef]
24.
Xie, J.M.; Chen, Y.R.; Cai, G.J.; Cai, R.L.; Hu, Z.; Wang, H. Tree Visualization by One Table (tvBOT): A web application for
visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023,51, W587–W592. [CrossRef] [PubMed]
25.
Acosta-Gallegos, J.A.; Kelly, J.D.; Gepts, P. Prebreeding in Common Bean and Use of Genetic Diversity from Wild Germplasm.
Crop Science 2007,47, S44–S59. [CrossRef]
26. Feuillet, C.; Langridge, P.; Waugh, R. Cereal breeding takes a walk on the wild side. Trends Genet. 2008,24, 24–32. [CrossRef]
27.
Song, W.H.; Hou, M.; Zhang, Y.G.; Li, Q. Research Advance on Mechanism of Expansion in Sweetpotato Storage Roots. Mol. Plant
Breed. 2024,22, 6796–6804.
Genes 2024,15, 1340 13 of 14
28.
Wang, L.P.; Qin, K.J.; Zhao, L.C.; Yan, Z.G.; Huang, Z.Q.; Tu, D.P. Research progress of plant root expansion. Hubei Agric. Sci.
2020,59, 5–9.
29.
Wang, Q.M.; Zhang, L.M.; Wang, Z.L. Formation and Thickening of Tuberous Roots in Relation to the Endogenous Hormone
Concentrations in Sweetpotato. Sci. Agric. Sin. 2005,38, 2414–2420.
30.
Tanaka, M.; Takahata, Y.; Nakatani, M. Analysis of genes developmentally regulated during storage root formation of sweet
potato. J. Plant Physiol. 2005,162, 91–102. [CrossRef]
31.
Tanaka, M.; Kato, N.; Nakayama, H.; Nakatani, M.; Takahata, Y. Expression of class I knotted1-like homeobox genes in the storage
roots of sweetpotato (Ipomoea batatas). J. Plant Physiol. 2008,165, 1726–1735. [CrossRef]
32.
Eserman, L.A.; Jarret, R.L.; Leebens-Mack, J.H. Parallel evolution of storage roots in morning glories (Convolvulaceae). BMC
Plant Biol. 2018,18, 95. [CrossRef] [PubMed]
33.
Ravi, V.; Chakrabarti, S.K.; Makeshkumar, T.; Saravanan, R. Molecular Regulation of Storage Root Formation and Development
in Sweet Potato. Hortic. Rev. 2014,42, 157–208.
34.
Wang, H.X.; Yang, J.; Zhang, M.; Fan, W.J.; Firon, N.; Pattanaik, S.; Yuan, L.; Zhang, P. Altered Phenylpropanoid Metabolism in
the Maize Lc-Expressed Sweet Potato (Ipomoea batatas) Affects Storage Root Development. Sci. Rep. 2016,6, 18645. [CrossRef]
[PubMed]
35.
Zhang, W.; Zuo, Z.D.; Zhu, Y.X.; Feng, Y.X.; Wang, Y.; Zhao, H.Q.; Zhao, N.; Zhang, H.; He, S.Z.; Liu, Q.C.; et al. Fast track to
obtain heritable transgenic sweet potato inspired by its evolutionary history as a naturally transgenic plant. Plant Biotechnol. J.
2023,21, 671–673. [CrossRef]
36.
Kyndt, T.; Quispe, D.; Zhai, H.; Jarret, R.; Ghislain, M.; Liu, Q.H.; Gheysen, G.; Kreuze, J.F. The genome of cultivated sweet potato
contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc. Natl. Acad. Sci. USA
2015,112, 5844–5849. [CrossRef]
37.
Hoshino, A.; Jayakumar, V.; Nitasaka, E.; Toyoda, A.; Noguchi, H.; Itoh, T.; Shin-I, T.; Minakuchi, Y.; Koda, Y.; Nagano, A.J.; et al.
Genome sequence and analysis of the Japanese morning glory Ipomoea nil.Nat. Commun. 2016,7, 13295. [CrossRef]
38.
Huo, K.S.; Zhao, D.L.; Chen, Y.L.; Zhou, Z.L.; Wang, Y.; Tang, J.; Zhu, G.P.; Cao, Q.H. Analysis of Genome Size and Characteristics
of Salt-tolerant Plant Ipomoea pes-caprae (L.) R. Br. J. Plant Genet. Resour. 2019,20, 728–735.
39. Sampathkumar, R. Karyomorphological Studies in Some South Indian Convolvulaceae. Cytologia 1979,44, 275–286. [CrossRef]
40.
Sampathkumar, R. On the chromosome numbers of some Convolvulaceae from South India. In Proceedings of the 55th Indian
Science Congress, Calcutta, India, 3 January 1968; pp. 361–362.
41.
Bir, S.S.; Sidhu, M. Evolutionary status of weed flora of cultivated lands in Punjab, India. In Current Approaches in Cytogenetics;
Sinha, R.R., Sinha, U., Eds.; Spectrum Publishing House: Delhi, India, 1983; pp. 135–144.
42.
Kaur, K.; Ramanpreet; Gupta, R.C.; Kumari, S. Cyto-Morphological Studies of Some Dicot Plants from Rajasthan (India). Cytologia
2015,80, 353–362. [CrossRef]
43.
Ibiapino, A.; García, M.A.; Amorim, B.; Baez, M.; Costea, M.; Stefanovi´c, S.; Pedrosa-Harand, A. The Evolution of Cytogenetic
Traits in Cuscuta (Convolvulaceae), the Genus with the Most Diverse Chromosomes in Angiosperms. Front. Plant Sci. 2022,
13, 842260. [CrossRef]
44.
Lekhak, M.M.; Patil, S.D.; Kattee, A.V.; Yadav, P.B.; Ghane, S.G.; Gavade, S.K.; Shimpale, V.B.; Yadav, S.R. Cytopalynological
studies in some Convolvulaceae members from northern Western Ghats, India. Caryologia 2018,71, 263–271. [CrossRef]
45.
Wu, S.; Lau, K.H.; Cao, Q.H.; Hamilton, J.P.; Sun, H.H.; Zhou, C.X.; Eserman, L.; Gemenet, D.C.; Olukolu, B.A.; Wang, H.Y.; et al.
Genome sequences of two diploid wild relatives of cultivated sweetpotato reveal targets for genetic improvement. Nat. Commun.
2018,9, 4580. [CrossRef] [PubMed]
46.
Chen, L.; Su, D.; Sun, J.Y.; Li, Z.Y.; Han, Y.H. Development of a set of chromosome-specific oligonucleotide markers and karyotype
analysis in the Japanese morning glory Ipomoea nil.Sci. Hortic. 2020,273, 109633. [CrossRef]
47.
Pedrosa-Harand, A.; de Almeida, C.C.S.; Mosiolek, M.; Blair, M.W.; Schweizer, D.; Guerra, M. Extensive ribosomal DNA
amplification during Andean common bean (Phaseolus vulgaris L.) evolution. Theor. Appl. Genet. 2006,112, 924–933. [CrossRef]
48.
Shishido, R.; Sano, Y.; Fukui, K. Ribosomal DNAs: An exception to the conservation of gene order in rice genomes. Mol. Gen.
Genet. 2000,263, 586–591. [CrossRef]
49.
Hayasaki, M.; Morikawa, T.; Leggett, J.M. Intraspecific variation of 18S-5.8S-26S rDNA sites vevealed by FISH and RFLP in wild
oat, Avena agadiriana.Genes Genet. Syst. 2001,76, 9–14. [CrossRef]
50.
Raskina, O.; Belyayev, A.; Nevo, E. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability
in natural populations. Proc. Natl. Acad. Sci. USA 2004,101, 14818–14823. [CrossRef] [PubMed]
51.
Li, K.P.; Wu, Y.X.; Zhao, H.; Wang, Y.; Lü, X.M.; Wang, J.M.; Xu, Y.; Li, Z.Y.; Han, Y.H. Cytogenetic relationships among Citrullus
species in comparison with some genera of the tribe Benincaseae (Cucurbitaceae) as inferred from rDNA distribution patterns.
BMC Evol. Biol. 2016,16, 85–93. [CrossRef]
52.
Bass, H.W.; Marshall, W.F.; Sedat, J.W.; Agard, D.A.; Cande, W.Z. Telomeres Cluster De Novo before the Initiation of Synapsis:
A Three-dimensional Spatial Analysis of Telomere Positions before and during Meiotic Prophase. J. Cell Biol. 1997,137, 5–18.
[CrossRef]
53.
Widarmi, W.D.; Kikuchi, S.; Sassa, H.; Koba, T. Physical localization of rDNAs and microsatellite sequences on the chromosomes
of Lactuca saligna using fluorescence in situ hybridization. Chromosome Sci. 2020,22, 13–18.
Genes 2024,15, 1340 14 of 14
54.
Xie, J.H.; Zhao, Y.; Yu, L.Q.; Liu, R.J.; Dou, Q.W. Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonu-
cleotide fluorescence in situ hybridization (FISH) probes. PLoS ONE 2020,15, e0227208. [CrossRef] [PubMed]
55.
Luo, X.M.; Liu, J.C. Fluorescence In Situ Hybridization (FISH) Analysis of the Locations of the Oligonucleotides 5S rDNA,
(AGGGTTT)3, and (TTG)6 in Three Genera of Oleaceae and Their Phylogenetic Framework. Genes 2019,10, 375–388. [CrossRef]
[PubMed]
56.
Hu, J.; Xie, J.R.; Wang, S.M. Cloning and sequence analysis of 18s rRNA gene fragment from succulent xerophyte Zygophyllum
xanthoxylum.Pratacult. Sci. 2012,29, 1369–1373.
57.
He, W.G.; Qin, Q.B.; Liu, S.J.; Li, T.L.; Wang, J.; Xiao, J.; Xie, L.H.; Zhang, C.; Liu, Y. Organization and Variation Analysis of 5S
rDNA in Different Ploidy-level Hybrids of Red Crucian Carp ×Topmouth Culter. PLoS ONE 2012,7, e38976. [CrossRef]
58.
Pinhal, D.; Gadig, O.B.; Wasko, A.P.; Oliveira, C.; Ron, E.; Foresti, F.; Martins, C. Discrimination of Shark species by simple PCR of
5S rDNA repeats. Genet. Mol. Biol. 2008,31, 361–365. [CrossRef]
59.
Messias, L.H.V.; Ferreira, D.C.; Wasko, A.P.; Oliveira, C.; Foresti, F.; Martins, C. Brief report 5S rDNA organization in the fish
Synbranchus marmoratus (Synbranchidae, Synbranchiformes). Hereditas 2003,139, 228–231. [CrossRef]
60.
Fujiwara, M.; Inafuku, J.; Takeda, A.; Watanabe, A.; Fujiwara, A.; Kohno, S.; Kubota, S. Molecular organization of 5S rDNA in
bitterlings (Cyprinidae). Genetica 2008,135, 355–365. [CrossRef]
61.
Campo, D.; Machado-Schiaffino, G.; Horreo, J.L.; Garcia-Vazquez, E. Molecular Organization and Evolution of 5S rDNA in the
Genus Merluccius and Their Phylogenetic Implications. J. Mol. Evol. 2009,68, 208–216. [CrossRef]
62.
Roullier, C.; Duputié, A.; Wennekes, P.; Benoit, L.; Bringas, V.M.F.; Rossel, G.; Tay, D.; McKey, D.; Lebot, V. Disentangling the
origins of cultivated sweet potato (Ipomoea batatas (L.) Lam.). PLoS ONE 2017,8, e62707.
63.
Muñoz-Rodríguez, P.; Carruthers, T.; Wood, J.R.I.; Williams, B.R.M.; Weitemier, K.; Kronmiller, B.; Ellis, D.; Anglin, N.L.; Longway,
L.; Harris, S.A.; et al. Reconciling Conflicting Phylogenies in the Origin of Sweet Potato and Dispersal to Polynesia. Curr. Biol.
2018,28, 1246–1256. [CrossRef]
64. Austin, D.F. The Ipomoea batatas Complex-I. Taxonomy. Bull. Torrey Bot. Club 1978,105, 114–129. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
