Alternative DNA Markers to Detect Guam-Specific CRB-G (Clade I) Oryctes rhinoceros (Coleoptera: Scarabaeidae) Indicate That the Beetle Did Not Disperse from Guam to the Solomon Islands or Palau

Abstract

A partial mitochondrial DNA Cytochrome Oxidase subunit I (mtCOI) gene haplotype variant of the coconut rhinoceros beetle (CRB) Oryctes rhinoceros, classed as ‘CRB-G (clade I)’, has been the focus of much research since 2007, with reports of invasions into new Pacific Island locations (e.g., Guam, Hawaii, Solomons Islands). For numerous invasive species, inference of invasion biology via whole genome is superior to assessments via the partial mtCOI gene. Here, we explore CRB draft mitochondrial genomes (mitogenomes) from historical and recent collections, with assessment focused on individuals associated within the CRB-G (clade I) classification. We found that all Guam CRB individuals possessed the same mitogenome across all 13 protein-coding genes and differed from individuals collected elsewhere, including ‘non-Guam’ individuals designated as CRB-G (clade I) by partial mtCOI assessment. Two alternative ATP6 and COIII partial gene primer sets were developed to enable distinction between CRB individuals from Guam that classed within the CRB-G (clade I) haplotype grouping and CRB-G (Clade I) individuals collected elsewhere. Phylogenetic analyses based on concatenated ATP6–COIII genes showed that only Guam CRB-G (clade I) individuals clustered together, and therefore Guam was not the source of the CRB that invaded the other locations in the Pacific assessed in this study. The use of the mtCOI and/or mtCOIII genes for initial molecular diagnosis of CRB remained crucial, and assessment of more native CRB populations will further advance our ability to identify the provenance of CRB invasions being reported within the Pacific and elsewhere.

Full text

Citation: Tay, W.T.; Marshall, S.D.G.;
Popa-Baez, A.D.; Dulla, G.F.J.; Blas,
A.L.; Sambiran, J.W.; Hosang, M.;
Millado, J.B.H.; Melzer, M.; Rane, R.V.;
et al. Alternative DNA Markers to
Detect Guam-Specific CRB-G (Clade I)
Oryctes rhinoceros (Coleoptera:
Scarabaeidae) Indicate That the Beetle
Did Not Disperse from Guam to the
Solomon Islands or Palau. Diversity
2024,16, 634. https://doi.org/
10.3390/d16100634
Academic Editor: Michael Wink
Received: 22 May 2024
Revised: 4 October 2024
Accepted: 4 October 2024
Published: 10 October 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
diversity
Article
Alternative DNA Markers to Detect Guam-Specific CRB-G
(Clade I) Oryctes rhinoceros (Coleoptera: Scarabaeidae) Indicate
That the Beetle Did Not Disperse from Guam to the Solomon
Islands or Palau
Wee Tek Tay 1,* , Sean D. G. Marshall 2, Angel David Popa-Baez 1, Glenn F. J. Dulla 3, Andrea L. Blas 4,
Juniaty W. Sambiran 5, Meldy Hosang 6, Justine Bennette H. Millado 7, Michael Melzer 8, Rahul V. Rane 9,
Tim Hogarty 10, Demi Yi-Chun Cho 1, Jelfina C. Alouw 6,11 , Muhammad Faheem 12
and Benjamin D. Hoffmann 13
1CSIRO Black Mountain Laboratories, Canberra, ACT 2601, Australia; angel.popa@csiro.au (A.D.P.-B.);
demi.cho@csiro.au (D.Y.-C.C.)
2AgResearch Limited, Lincoln 7608, New Zealand; sean.marshall@agresearch.co.nz
3College of Natural and Applied Sciences, Western Pacific Tropical Research Center, University of Guam,
Mangilao 96923, Guam; dullag@triton.uog.edu
4Research Corporation of the University of Guam, Mangilao 96921, Guam; andrea.lg.blas@gmail.com
5Indonesia Agricultural Instrument Standardization Agency, Kotak Pos 1004, Manado 95001, Indonesia;
juni2584@gmail.com
6National Research & Innovation Agency of Indonesia (BRIN), Jakarta 10340, Indonesia;
meldyhosang@yahoo.com (M.H.); jelfina@coconutcommunity.org (J.C.A.)
7Department of Pest Management, Visayas State University, Leyte 6521, Philippines;
justinebennette.millado@vsu.edu.ph
8
Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI 96822, USA;
melzer@hawaii.edu
9CSIRO, Parkville, VIC 3052, Australia; rahul.rane@csiro.au
10 CSIRO Marine Labs, Hobart, TAS 7000, Australia; tim.hogarty@csiro.au
11 International Coconut Community (ICC), Jakarta 10430, Indonesia
12 CAB International Southeast Asia, Serdang 43300, Selangor, Malaysia; m.faheem@cabi.org
13 CSIRO, Tropical Ecosystems Research Centre, Winnellie, NT 0822, Australia; ben.hoffmann@csiro.au
*Correspondence: weetek.tay@csiro.au
Abstract: A partial mitochondrial DNA Cytochrome Oxidase subunit I (mtCOI) gene haplotype variant of
the coconut rhinoceros beetle (CRB) Oryctes rhinoceros, classed as ‘CRB-G (clade I)’, has been the focus of
much research since 2007, with reports of invasions into new Pacific Island locations (e.g., Guam, Hawaii,
Solomons Islands). For numerous invasive species, inference of invasion biology via whole genome is
superior to assessments via the partial mtCOI gene. Here, we explore CRB draft mitochondrial genomes
(mitogenomes) from historical and recent collections, with assessment focused on individuals associated
within the CRB-G (clade I) classification. We found that all Guam CRB individuals possessed the
same mitogenome across all 13 protein-coding genes and differed from individuals collected elsewhere,
including ‘non-Guam’ individuals designated as CRB-G (clade I) by partial mtCOI assessment. Two
alternative ATP6 and COIII partial gene primer sets were developed to enable distinction between CRB
individuals from Guam that classed within the CRB-G (clade I) haplotype grouping and CRB-G (Clade
I) individuals collected elsewhere. Phylogenetic analyses based on concatenated ATP6–COIII genes
showed that only Guam CRB-G (clade I) individuals clustered together, and therefore Guam was not the
source of the CRB that invaded the other locations in the Pacific assessed in this study. The use of the
mtCOI and/or mtCOIII genes for initial molecular diagnosis of CRB remained crucial, and assessment
of more native CRB populations will further advance our ability to identify the provenance of CRB
invasions being reported within the Pacific and elsewhere.
Keywords: DNA barcoding; comparative mitogenome analysis; Asiatic rhinoceros beetle; hitchhiker
plant pest
Diversity 2024,16, 634. https://doi.org/10.3390/d16100634 https://www.mdpi.com/journal/diversity

Diversity 2024,16, 634 2 of 12
1. Introduction
The mitochondrial DNA (mtDNA) genome (mitogenome) is largely maternally inher-
ited and generally consists of 13 protein-coding genes (PCG’s), 22 tRNA genes, 2 rRNA
genes, and an AT-rich region that is low in nucleotide complexity (e.g., [
1
]). Due to the
maternal inheritance nature, the mitogenome in general does not undergo recombination
(e.g., [
2
,
3
]). Hebert et al. [
4
] demonstrated the use of the partial mtDNA cytochrome oxidase
subunit I (mtCOI) gene sequence to aid in species diagnostics, and this system helped
transform understanding of species diversity [
5
–
7
]. Multiple partial mtCOI databases
(e.g., BOLD; GenBank) subsequently provided considerable contributions to disentan-
gling species status (e.g., [
8
,
9
]). However, the use of partial mtCOI is not without its
limitations: association with endosymbionts, effect of selective sweep, and impact of pseu-
dogenes, amongst other factors, can all lead to inaccurate interpretations [
10
,
11
]. Analysis
of population-wide partial mtCOI gene diversity has also found that the 5
′
gene region typ-
ically has low nucleotide diversity (i.e., conserved nucleotide sequence) in some arthropod
groups, such as Hemiptera, Lepidoptera, and Coleoptera (e.g., [
12
–
15
]). Subsequently, an
over-reliance on partial mtCOI gene sequences has resulted in some misidentification of
species status (e.g., [
11
]), and some misunderstandings of population dynamics (e.g., [
16
]
versus [
14
,
17
]; see also review by [
18
]). Examples of confounded interpretations include the
invasion history of Spodoptera frugiperda (Lepidoptera: Noctuidae) [
19
–
21
] and population
expansion patterns of Helicoverpa (Lepidoptera: Noctuidae) species ([22] versus [23]).
As technology advances and costs decrease, it is now easier and cheaper than ever
before to obtain greater genetic data from specimens to provide richer information content
for analysis and interpretation. Combining sequence data from multiple mtDNA genes, full
mitochondrial DNA genomes (mitogenomes) and/or whole genomes are now regularly
being shown to provide an analysis superior to the use of single genes (e.g., partial mtCOI)
alone for all applications. Examples include identifications of species (e.g., [
24
]), sub-species
(e.g., [
25
–
27
]), hybrids (e.g., [
25
,
26
,
28
]), populations [
14
,
17
], patterns like demographic
expansion (e.g., [29,30]), and pest incursion histories (e.g., [31–33]).
Of specific relevance to the current understanding of CRB invasion biology and
reported resistance/increased tolerance of some CRB-G populations to the OrNV biological
control agent (e.g., [
34
–
37
]) are OrNV detection inconsistencies in CRB-G (clade I), as
defined by the partial mtCOI marker (e.g., Palauan CRB populations [
35
]; Solomon Islands
CRB populations [
34
,
37
]), as well as between detected mtCOI signatures of CRB-G (e.g., on
Guam, Taiwan, Palau, Hawaii) versus the presence of Guam-only signatures when analysed
using nuclear markers [
36
]. These inconsistencies emerging in the CRB research bear
significant resemblances to recent examples found in other invasive species, such as Bemisia
tabaci (e.g., [
26
,
38
]), Helicoverpa armigera (e.g., [
25
]), Spodoptera frugiperda (e.g., [
14
,
17
]),
and Tuta absoluta [
32
], that demonstrated mtCOI marker limitations and the benefit of re-
assessment using alternative mitochondrial and/or nuclear genome-based marker systems.
Here, we examine draft-full mitogenomes of the coconut rhinoceros beetle (CRB;
Oryctes rhinoceros), a pest that causes economic yield losses to coconut and oil
palm [39,40]
.
These mitogenomes were generated through whole-genome sequencing (WGS) from multi-
ple geographically distinct locations to develop additional molecular markers for tracking
and monitoring genetically distinct populations of this species. Particular attention is given
to the CRB-G (clade I) group determined using partial mtCOI gene assessment [
35
] because
of the current biosecurity focus on this mitochondrial haplotype variant due to its reported
resistance to some isolates of the Oryctes rhinoceros Nudivirus (OrNV) biological control
agent [
35
], and new incursions of CRB associated with the CRB-G (clade I) grouping across
the Pacific region [
35
,
41
]. Specifically, we test whether or not the Guam CRB-G (clade I)
was the source population for the CRB-G (clade I) populations detected in Solomon Islands
and in Palau, as suggested in some publications (e.g., [
42
,
43
]). We do this by identifying
two partial mitochondrial gene regions that more confidently differentiated CRB (clade I)
individuals that invaded Guam from other CRB individuals, including other individuals
classed as CRB-G (clade I) using the partial mtCOI gene, but which were collected on other

Diversity 2024,16, 634 3 of 12
Pacific islands (e.g., Solomon Islands, Palau). We discuss the benefits of mitogenomes as
resources for developing alternative diagnostic markers and assess efficacies of the par-
tial mtCOI gene as the current preferred standard diagnostic DNA marker to distinguish
CRB populations.
2. Material and Methods
2.1. Samples
CRB samples collected between 2019 and 2022 were sourced from Guam, Palau,
Indonesia, Malaysia, and Philippines (Table 1; Figure S1). The gut of each specimen was
dissected, preserved in 100% ethanol, and stored at
−
20
◦
C until needed for DNA extraction.
Additionally, a historic specimen collected from Guam (04-Or5; circa 2014) was used as
a reference to enable matching of more recently collected CRB individuals from Guam
that classed within the CRB-G (clade I) haplotype grouping sensu Marshall et al. [
35
]. A
related Oryctes nasicornis mitogenome (GenBank OK484312; [
44
]) was included to provide
comparison of inter-specific nucleotide distance with CRB. Nucleotide positions followed
annotation of MT457815 [45].
Table 1. Details of Oryctes rhinoceros (CRB) and Oryctes nasicornis samples used in this study, including
GenBank accession numbers of publicly available, assembled, and annotated mitogenomes and single
nucleotide polymorphisms (SNPs), differentiating CRB-G (clade I) that invaded Guam from other
CRB using the mitochondrial cytochrome oxidase subunit I (mtCOI), ATP synthase membrane subunit 6
(ATP6), and cytochrome oxidase subunit III (COIII).
Sample Code Country
Specimen
Collection
Date
Haplotype Designation
Based on Partial mtCOI
([35])
mtCOI_
G1779A
Designation
Based on Partial
ATP6 and COIII
(This Study)
ATP6_
T4430C
COIII_
C5390T
04-Or5 Guam 2014 CRB-G (clade I) G Guam T C
NZ-20-738 Guam 2020 CRB-G (clade I) G Guam T C
Guam-
01_GDoA Guam 2022 CRB-G (clade I) G Guam T C
Guam-
02_GDoA Guam 2022 CRB-G (clade I) G Guam T C
Guam-
09_GDoA Guam 2022 CRB-G (clade I) G Guam T C
Guam-
13_GDoA Guam 2022 CRB-G (clade I) G Guam T C
Guam-
17_GDoA Guam 2022 CRB-G (clade I) G Guam T C
MT457815 Solomon Is. 2019 CRB-G (clade I) G not Guam C T
MW632131 Taiwan 2002 CRB-G (clade I) G not Guam C T
MY-A-02 Malaysia 2022 CRB-S (clade IV) A not Guam C T
MY-A-04 Malaysia 2022 CRB-S (clade IV) A not Guam C T
MY-A-10 Malaysia 2022 CRB-S (clade III) A not Guam C T
ON764800 Malaysia 2021 CRB-S (clade III) A not Guam C T
OP694176 Malaysia 2021 CRB-S (clade III) A not Guam C T
OP694175 Malaysia 2021 CRB-S (clade IV) A not Guam C T
ON764799 Malaysia 2020 CRB-S (clade II) A not Guam C T
ON764801 Malaysia 2021 CRB-S (clade II) A not Guam C T
PALAU-01 Palau 2022 CRB-S (clade IV) A not Guam C T
PALAU-02 Palau 2022 CRB-S (clade IV) A not Guam C T

Diversity 2024,16, 634 4 of 12
Table 1. Cont.
Sample Code Country
Specimen
Collection
Date
Haplotype Designation
Based on Partial mtCOI
([35])
mtCOI_
G1779A
Designation
Based on Partial
ATP6 and COIII
(This Study)
ATP6_
T4430C
COIII_
C5390T
PALAU-03 Palau 2022 CRB-G (clade I) G not Guam C T
PALAU-04 Palau 2022 CRB-G (clade I) G not Guam C T
Phil-01 Philippines 2022 CRB-G (clade I) G not Guam C T
Phil-02 Philippines 2022 CRB-G (clade I) G not Guam C T
Phil-05 Philippines 2022 CRB-G (clade I) G not Guam C T
Phil-10 Philippines 2022 CRB-G (clade I) G not Guam C T
IND-H01 Indonesia 2021 CRB-S (clade III) A not Guam C T
IND-H02 Indonesia 2021 CRB-S (clade IV) A not Guam C T
IND-H10 Indonesia 2021 CRB-S (clade III) A not Guam C T
IND-J14 Indonesia 2022 CRB-S (clade IV) A not Guam C T
IND-J15 Indonesia 2022 CRB-S (clade IV) A not Guam C T
IND-J20 Indonesia 2022 CRB-S (clade IV) A not Guam C T
OK484312 unspecified unspecified Not applicable TNot applicable T T
Note: Annotation of the mtCOI,ATP6 and COIII genes in the samples used in this study was based on the
published mitochondrial genome (MT457815) from a Solomon Islands individual [
45
] associated within the
CRB-G (clade I) haplotype grouping (based on the mtCOI partial gene characterisation). Additional GenBank
accessions included are: MW632131 [
46
], ON764800, OP694176, OP694175, ON764799, ON764801 [
47
], and
OK484312 [44]; O. nasicornis).
2.2. Whole-Genome Sequencing (WGS)
We used a Qiagen Blood and Tissue DNA extraction kit (Duesseldorf, Germany) and
the manufacturer’s protocol to extract genomic DNA. The extracted DNA was eluted in
200 µL
EB and kept frozen until used for WGS. We assessed the quality of the extracted DNA
using Qubit 2.0 (Life Technologies, Foster City, CA, USA) prior to sequencing. WGS was
carried out by the Australian Genome Resource Facility (AGRF) in Melbourne, Australia,
or by AZENTA Life Sciences in China. The WGS data returned an average of 25x coverage,
150 bp paired-end reads/sample, assuming a genome size of approximately 350 Mbp.
2.3. Mitogenome Assembly and Annotation
We assembled all mitogenomes by importing the raw sequence reads into Geneious
Prime 2022.2.2 (Build 18 August 2022 14:34) (Biomatters Ltd., Auckland, New Zealand)
and used the published mitogenome (MT457815, [
45
]) as the reference sequence. We used
Geneious Mapper with ‘Low Sensitivity/Fastest’ option and selecting no fine tuning (i.e.,
None (fast/read mapping)) during the mitogenome-assembling process. Although we re-
ceived pair-ended reads for all samples, mitogenomes were assembled using forward reads
only due to the high genome coverage for each sample. All assembled mitogenomes were
initially annotated using a MITOS programme and selecting invertebrate mitochondrial
genetic code [
48
]. As a final quality assessment, the annotated CRB mitogenomes were
visually inspected. The mtCOI,ATP6, and COIII genes used in this study, as well as the as-
sembled and annotated mitogenomes, are available from the CSIRO data repository [
49
,
50
].
2.4. Mitogenome Identity Assessment
The non-recombination nature of the mitogenome implies that CRB individuals clas-
sified as CRB-G (clade I) based on the partial mtCOI gene assessment method [
35
] (e.g.,
Solomon Islands MT457815, Taiwan MW632131) would share mitogenome identity with
our reference Guam specimen (i.e., 04-Or5; Table 1) if a single source of invasion entered
into Guam and subsequently spread from to other locations. To assess this, randomly
selected CRB specimens from Guam (i.e., NZ-20-738; Guam-01_GDoA, Guam-02_GDoA,
Guam-09_GDoA, Guam-13_GDoA, Guam-17_GDoA; Table 1) that were collected in more
recent times (2020 and 2021) were compared with the representative historical Guam indi-

Diversity 2024,16, 634 5 of 12
vidual (04-Or5) to visually assess and confirm mitogenome identity. This was then followed
by comparison with all other CRB individuals, including CRB-G-typed individuals col-
lected from elsewhere (Table 1). Individuals were compared based on the partial mtCOI
sequence analysis (described in [
35
]), as well as sequence similarity of other mitochondrial
genes assessed by this work.
2.5. Alternative CRB Marker Development to Identify the Original CRB Population That Invaded Guam
To identify candidate mitochondrial genes as alternative DNA markers specific to
individuals from Guam, all mitogenomes generated from this study, as well as publicly
available CRB mitogenomes from GenBank, were downloaded and aligned within GenBank
using MAFFT V7.490 [
51
,
52
] with default setting options (i.e., algorithm: FFT-NS-2; Scoring
matrix: 200 PAM/k = 2; Gap open penalty: 1.53; Offset value: 0.123). We visually identified
candidate polymorphic sites unique to individuals from Guam (i.e., 04-Or5, NZ-20-738,
Guam-01_GDoA, Guam-02_GDoA, Guam-09_GDoA, Guam-13_GDoA, Guam-17_GDoA)
but absent in all other CRB individuals (Table 1). The SNPs identified were analysed for
potential restriction endonucleases to develop polymerase-chain reaction (PCR) restriction
fragment length polymorphism (RFLP) solutions (PCR–RFLP) for a simple and easy-to-use
approach to confidently differentiate CRB-G (clade I) that invaded Guam from all other
genetically distinct CRB, including CRB from elsewhere, classed as CRB-G (clade I) by
partial COI assessment. Design and analysis of PCR-primers were performed through
the Primer Analysis Software version 7.60 (Molecular Biology Insights, Inc., Cascade, CO,
USA). Primers were optimised for minimal false-primer-annealing sites, minimal primer
dimer and duplex formation, and minimal/no hairpin structure, with a Ta (theoretical
annealing temperature) of
≥
60
◦
C (calculated as Ta = 4(G + C) + 2(A + T)) and an optimal
amplicon length of between 500 and 600 bp to facilitate ease of Sanger sequencing. The
candidate restriction endonuclease was initially selected for a single cut site with in silico
analysis of all different mitochondrial DNA haplotypes in Enzyme X version 3.3 (http:
//nucleobytes.com/enzymex/). We reconfirmed primer efficacies and RFLP conditions
by randomly selecting and analysing DNA from specimens collected from Guam and
elsewhere, as well as by PCR-Sanger sequencing to confirm primer amplification accuracy.
We used the restriction digestion conditions as recommended by the manufacturer of the
BmpI restriction enzyme (New England BioLabs; Ipswich, MA, USA). Visualisation of the
RFLP was on a 1.5% 1x TAE agarose gel.
2.6. Mitogenome Analysis
The mitogenomes from the GenBank database and those generated from this study
were aligned to estimate pairwise nucleotide identity and distances (p-dist) between the
following: (i) full mtCOI gene versus full ATP6 gene and (ii) full mtCOI versus full COIII
genes. The related O. nasicornis mitogenome (0K484312) was included to provide com-
parison of inter-specific nucleotide distance with CRB. We also inferred phylogenies of
the CRB individuals based on the widely used partial mtCOI gene region (676 bp) versus
our proposed alternative mitochondrial ATP6 and COIII partial gene regions (excluding
nucleotides at primer annealing sites, see [
35
]). The APT6 and COIII partial gene sequences
were concatenated before phylogeny inference. We used IQ-Tree [
53
] and selected the
‘Auto’ option for estimating substitution models, and 1000 bootstrap alignments to estimate
branch support using the ultrafast bootstrap approximation (UFBoot) [
54
] algorithm. We
used Dendroscope 3 [
55
] for visualisation and post-analysis editing for both COI and
ATP6 +COIII
phylogenies. The 13 protein-coding genes (PCGs) from the samples’ mito-
chondrial genomes were extracted and concatenated for use in phylogenetic analysis using
IQ-Tree and visualisation using Dendroscope 3 (version 3.5.7, built 30 January 2016) with
procedures as described above.

Diversity 2024,16, 634 6 of 12
3. Results
3.1. Mitochondrial Genome Analysis
Mitochondrial genomes were assembled and annotated from an average of 1472 frag-
ments (mean standard deviation 997 fragments) per sample. Across all the mitochondrial
COI,ATP6, and COIII gene sequences, nucleotide differences between CRB individuals
were low (<2% difference), suggesting that all were the same species (i.e., O. rhinoceros)
(Table S1)
. The fully assembled and annotated mitogenome from the Guam 04-Or5 speci-
men (collected in 2014) provided evidence that all Guam individuals examined here shared
the same mitogenome (Table 1) that was uniquely identified only in Guam. Nucleotide
differences within the mitochondrial ATP6 and COIII genes were identified in Guam in-
dividuals, but these nucleotide polymorphisms were absent from specimens collected
elsewhere, including those classed as CRB-G (clade I) by partial COI assessment. For the
ATP6_T4430C and COIII_C5390T SNPs identified from the partial ATP6 and COIII genes
(see Table 1), there were, on average, 1876 and 1740 reads at each of these nucleotide sites
to confirm further differentiation of CRB that invaded Guam from other CRB-G (clade I)
members (i.e., equivalent to the diagnostic SNP for ATP6 and COIII being independently
confirmed an average of 1876 and 1740 times, respectively).
Pairwise nucleotide analysis of the complete mtCOI gene sequence versus complete
ATP6 gene sequence, and also the complete mtCOI gene sequence versus the complete COIII
gene sequence, showed that the seven Guam CRB, one Solomon Islands CRB (MT457815),
one Taiwan (MW632131), two Palau CRBs (Palau-03, Palau-04), and four Philippines
CRB (Phil-01, -02, -03, -04) specimens analysed shared 100% identity across the complete
mtCOI gene sequence. However, when the comparison included the full ATP6 and full
COIII gene sequences, only the Guam individuals remained 100% identical to each other.
CRB from Solomon Islands (MT457815), Taiwan (MW632131), Palau (Palau-03, Palau-04),
and Philippines (Phil-01, -02, -03, -04) all had polymorphisms in these two alternative
mitochondrial marker genes (Table 1).
3.2. Alternative Primers to Identify the Original Invasive CRB Population Present in Guam
Two alternative sets of primers were developed (Table 2) to distinguish CRB-G (clade I)
that invaded Guam from other CRB, including those collected elsewhere, classed as CRB-G
(clade 1) by partial COI assessment. One primer amplifies a partial ATP6 gene region of
494 bp length, and the other amplifies a partial COIII gene region of 469 bp length. The
optimal PCR-annealing temperature for both ATP6 and COIII was 52
◦
C, with a 1.0
µ
M
primer concentration for both ATP6 and COIII primer pairs, a 0.5 mM dNTPs concentration,
and 1 unit of DNA polymerase in a 50 µL PCR volume.
Table 2. PCR primer sets for ATP6 (for PCR–RFLP) and COIII were developed to differentiate CRB
that invaded Guam from other CRB (including CRB classed as CRB-G (clade I)) using the partial
mtCOI gene in other locations; sensu [35].
Nucleotide Position
Primer Name: Primer Sequence (5
′
-3
′
)
Restriction Enzyme CRB-G (Clade I) [35] Other CRB
nt4192-4216 CRB-ATP6-F: ATGAATTCAAACTTT-
TAATTGGACC BpmI (CTCCAG) T C
nt4685-4663 CRB-ATP6-R:
GGAGTAAAGAGTTCTAAGGATAG 271 + 223 bp 494 bp
nt5017-5039 CRB-COIII-F:
CTTAGCTCCTACAATCGAATTAG Uncut C T
nt5485-5462 CRB-COIII-R:
TCTACCTCATCAGTAAATGGAAAT 469 bp 469 bp
3.3. Phylogeny
Phylogenetic analysis was carried out using specimens (see Table 1) with available
mitogenome DNA sequence data to allow for comparison using both the 13 PCGs from
the full mitogenomes (Figure S2) and the mitochondrial gene regions from COI,COIII, and

Diversity 2024,16, 634 7 of 12
ATP6. Based on the widely used mtCOI partial gene (Figure 1a), three clades could be recog-
nised. One clade (red branches) included seven Guam specimens, four Philippines (green
circles), two individuals from Palau (yellow circles), one from Taiwan (aqua blue circle),
and one from the Solomon Islands (purple circle). The other two major and minor clades
(blue branches) do not contain any individuals from Guam but included six individuals
from Indonesia (i.e., IND-J14, IND-J15, IND-J20, IND-H01, IND-H02, IND-H10); eight from
Malaysia (i.e., six from the major clade (i.e., OP694174, OP694176, ON764800,MY-A-02, MY-
A-04, MY-A-10; and two from the minor but evolutionary divergent clade (i.e., ON764799,
ON764801)); and two from Palau (i.e., PALAU-01, PALAU-02). The phylogeny from partial
ATP6- and COIII-concatenated sequences (Figure 1b; cladogram) showed different popula-
tion demographic patterns, with all Guam individuals clustering together (red), whereas
Philippines (green), Malaysia (khaki), and Indonesia (pink) largely clustered according to
geography. CRB specimens from Palau (yellow circles) appeared to have multiple origins
involving at least Philippines and Indonesia, whereas Taiwan (aqua blue circle) and the
Solomon Islands (purple circle) appeared to have closer affinity with Philippines CRB
individuals but with low (<50%) bootstrap node support values.
Diversity 2024, 16, x FOR PEER REVIEW 8 of 13
Figure 1. Phylogenetic analysis using (a) partial mtCOI gene sequence (676 bp) and (b) concatenated
partial APT6 (446 bp) and partial COIII (422 bp) gene sequences. A phylogram based on concate-
nated AT P6 –COIII partial gene sequences and the haplotype network are also presented in (c) and
(d), respectively. The Oryctes narsicornis sample (OK484312) was included as an outgroup.
4. Discussion
In this study, we characterised and reanalysed the draft mitogenomes of CRB indi-
viduals from both the native (i.e., Indonesia, Malaysia, Philippines, Taiwan) and exotic
(i.e., Guam, Palau, Solomon Islands) ranges. This is also the first time the mitogenome of
all recently collected Guam CRB individuals analysed in this study were found to share
sequence identity with specimens historically collected from Guam by possessing the
same mitogenome sequence across all 13 protein-coding genes [50], and specifically to the
Figure 1. Phylogenetic analysis using (a) partial mtCOI gene sequence (676 bp) and (b) concatenated
partial APT6 (446 bp) and partial COIII (422 bp) gene sequences. A phylogram based on concatenated
ATP6–COIII partial gene sequences and the haplotype network are also presented in (c) and (d),
respectively. The Oryctes narsicornis sample (OK484312) was included as an outgroup.

Diversity 2024,16, 634 8 of 12
Phylogenetic analysis based on both partial ATP6 and partial COIII genes (Figure 1b
(cladogram); Figure 1c (phylogram)) and also on concatenation of the 13 PCGs (
Figure S2
)
therefore demonstrated a high level of topology similarity but returned a different population-
clustering pattern from the partial mtCOI gene phylogeny (Figure 1a). Together, the use
of the concatenated sequences of the 13 PCGs, as well as the concatenated partial ATF6
and COIII gene regions, showed that Guam CRB individuals (red branches) clustered by
themselves, whereas the Philippines, Malaysian, and Indonesian individuals clustered
largely according to their geographical distributions. CRBs from Palau (yellow circles)
appeared to have multiple origins, clustering with specimens collected from both the Philip-
pines and Indonesia. However, branch node confidence values for Indonesia
(54–78)
and
Philippines (46–48) were low, suggesting longer sequence lengths from both mitochondrial
and inclusion of nuclear genes, as well as more samples from both native and introduced
populations, are required for confident assessment. Notably, CRB populations in Malaysia
appeared to be consisted of two diverse evolutionary lineages based on both COI and the
concatenated ATP6–COIII partial genes, with the unique ON764799 and ON764801 individ-
uals originating from both coconut palm and oil palm hosts from the state of Johor [
47
]. A
concatenated ATP6–COIII partial gene haplotype network (Figure 1d) is also presented,
showing the limited base substitutions between the haplotypes except between the more
diverse Malaysian individuals separated by seven base substitutions.
4. Discussion
In this study, we characterised and reanalysed the draft mitogenomes of CRB indi-
viduals from both the native (i.e., Indonesia, Malaysia, Philippines, Taiwan) and exotic
(i.e., Guam, Palau, Solomon Islands) ranges. This is also the first time the mitogenome of
all recently collected Guam CRB individuals analysed in this study were found to share
sequence identity with specimens historically collected from Guam by possessing the same
mitogenome sequence across all 13 protein-coding genes [
50
], and specifically to the ATP6
and COIII genes that exhibited nucleotide differences with CRB from other locations, as
also supported by the phylogeny from concatenation all 13 PCG sequences (Figure S2). This
enabled the ATP6 and COIII protein-coding genes to be used as alternative DNA markers
for differentiating Guam-specific CRB-G from the other tested CRB-G (clade I) individuals.
The remaining individuals from elsewhere, however, including those designated as CRB-G
(clade I) (based on the partial mtCOI assessment approach), did not share the same maternal
lineage as the Guam CRB-G individuals. In other words, the multi-gene assessment (albeit
with a limited number of specimens) provided strong supporting evidence that the CRB
invasion into Guam was distinct from the CRB invasions detected in Solomon Islands
and in Palau, and therefore Guam was not the source of the CRB that invaded these other
locations. Increasing sampling of CRB from Guam, Palau, and Solomon Islands is needed
to further increase confidence of the specificity of the ATP6 and COIII alternative markers
to differentiate Guam CRB from other CRB-G (clade I) populations.
For the PCR–RFLP primers focused on the partial ATP6 gene sequence, separation is
based on a BpmI restriction site. Individuals classed as Guam CRB produced two fragments
(i.e., 271 bp and 223 bp), whereas all other CRB remained uncut (i.e., 494 bp) (Table 2).
A second primer set was developed based on the COIII gene that can also differentiate
between Guam CRB-G from other CRB; however, this diagnostic method requires sequence
analysis (such as through Sanger sequencing) to detect the presence of a ‘C’ or a ‘T’ base at
nucleotide position 5390 (see Table 1). These identified SNPs to differentiate Guam CRB
from other CRB-G (clade I) could be further explored for alternative detection methods,
including DNA-sensing CRISPR Cas12a-based diagnostics which are sensitive to single
SNP’s [
56
], and modified Loop-mediated isothermal amplification (LAMP) methods to
detect unique SNPs (e.g., see [
57
] for review). Although these new markers improve the
differentiation between CRB that invaded Guam and other CRB populations, assessment of
more CRB individuals from native populations (e.g., Malaysia, Singapore, Sri Lanka, India,
Bangladesh, Myanmar, Cambodia, Laos, Vietnam, southern China, Indonesia, Philippines,

Diversity 2024,16, 634 9 of 12
Thailand) will be needed to provide a more robust confirmation of CRB invasion histories.
Also, for all work using molecular diagnostics of CRB, use of either the mtCOI or mtCOIII
genes is recommended as an initial approach to first confirm that samples are O. rhinoceros.
For example, while the T4430C SNP site within ATP6 from Guam specimens was a T, it
was also a ‘T’ in O. narsicornis (see Table 1). Therefore, a direct PCR–RFLP without first
confirming the species status could lead to misidentification of O. rhinoceros among other
Oryctes species.
The CRB is a hitchhiker pest [
58
] and is continuing to disperse to new locations, being
recently reported in the Marshall Islands [
59
] and multiple Hawaiian islands [
60
]. Notably,
our results found that Palau CRB appear to have multiple origins (Figure 1b). The node
confidence support estimates in Figure 1b displayed a range of values, with some of the
individuals (e.g., from Palau, Indonesia) appearing low (less than 60), which limited the
power of inference for better understanding the invasion history of this pest across its
distributional ranges. It is likely that future detailed genetic assessments of CRB will
provide the resolving power required to further elucidate CRB invasion histories.
5. Conclusions
Increasingly, WGS and multigene approaches have provided greater analytical power
than partial genome assessments and are therefore rapidly becoming more widely adopted
for the interrogation of demographic history and evolutionary relationships of some of
the world’s most significant transboundary invasive plant pests [
14
,
17
,
25
–
27
,
38
,
61
], in-
cluding CRB [
34
,
36
,
45
]. Given that the WGS/multigene approaches can provide more
comprehensive evidence than single-gene analyses (e.g., partial mtCOI), and we have
found exactly this result with this analysis. We suggest that a detailed study using these
more detailed genetic assessments is needed to further improve the current understanding
of CRB invasion biology.
Supplementary Materials: The following supporting information can be downloaded at: https:
//www.mdpi.com/article/10.3390/d16100634/s1, Figure S1: A map detailing countries (in bold) of
Oryctes rhinoceros samples featured in the Figure 1phylogeny. Country names in grey were provided
as general reference. Map generated using Mapchart.net with editing in Microsoft PowerPoint for
Mac Version 16.87; Figure S2: Phylogeny based on concatenated sequences from the 13 mitogenome
protein coding genes of coconut rhinoceros beetle (CRB) Oryctes rhinoceros samples as detailed
in Table 1. Branch node estimates are shown. Note that the overall topology of the phylogeny
with respect to the clades was the same as shown for the partial mitochondrial ATP6 and COIII
concatenated sequence phylogeny in Figure 1b; Table S1: Pairwise nucleotide comparisons of the full
mitochondrial DNA cytochrome oxidase sub- unit I (mtCOI) gene (lower triangle), with the concatenated
full ATP6 (ATP synthase membrane subunit 6) and full COIII (cytochrome oxidase subunit III) genes (top
triangle, left and right values, respectively) for Oryctes rhinoceros (CRB) individuals.
Author Contributions: Conceptualization, W.T.T., B.D.H. and J.C.A.; methodology, W.T.T., D.Y.-
C.C. and T.H.; formal analysis, W.T.T., S.D.G.M., D.Y.-C.C., T.H., A.D.P.-B. and R.V.R.; investigation,
J.W.S., J.B.H.M., M.H., G.F.J.D., A.L.B., M.M. and M.F.; resources, M.M., G.F.J.D., A.L.B., J.W.S., M.H.,
J.B.H.M. and M.F.; data curation, W.T.T., A.D.P.-B. and R.V.R.; writing—original draft preparation,
W.T.T., S.D.G.M., B.D.H., G.F.J.D., A.L.B. and J.B.H.M.; writing—review and editing, W.T.T., S.D.G.M.,
A.D.P.-B., G.F.J.D., A.L.B., J.W.S., M.H., J.B.H.M., M.M., R.V.R., T.H., D.Y.-C.C., J.C.A., M.F. and B.D.H.;
visualization, W.T.T.; supervision, W.T.T. and B.D.H.; project administration, W.T.T. and B.D.H.;
funding acquisition, W.T.T. and B.D.H. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by the Australian Government Department of Foreign Affairs
and Trade (DFAT) Administered (aid) Simple Grant Agreement grant number 77092.
Data Availability Statement: Data to this study can be downloaded from CSIRO Data Access Portal
as detailed in references [49,50].

Diversity 2024,16, 634 10 of 12
Acknowledgments: Indonesian CRB samples were provided under Republic of Indonesia Ministry of
Agriculture Agricultural Quarantine Agency Permit numbers 2021.1.2005.0.K13.E.00003 No. 4299301
and 2022.1.2005.0.K12.E.00002 No. 5896762. CRB samples from the Philippines were gathered under
the Gratuitous Permit DENR8-GP No. 2022-02 (10 January 2022) provided by the Department of
Environment and Natural Resources 8 of the Republic of the Philippines and conducted under the
VSU-IP 2021-10 (BIO-CAMP) and VSU-IP 2022-2 (CRB) projects. All other CRB individuals sourced
for this study did not require collection/export permits.
Conflicts of Interest: The authors declare no conflicts of interest.
References
1.
Crozier, R.H. From population genetics to phylogeny: Uses and limits of mitochondrial DNA. Syst. Bot. 1990,3, 111–124.
[CrossRef]
2.
Leducq, J.B.; Henault, M.; Charron, G.; Nielly-Thibault, L.; Terrat, Y.; Fiumera, H.L.; Shapiro, B.J.; Landry, C.R. Mitochondrial
Recombination and Introgression during Speciation by Hybridization. Mol. Biol. Evol. 2017,34, 1947–1959. [CrossRef] [PubMed]
3.
Saville, B.J.; Kohli, Y.; Anderson, J.B. mtDNA recombination in a natural population. Proc. Natl. Acad. Sci. USA 1998,95,
1331–1335. [CrossRef] [PubMed]
4.
Hebert, P.D.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003,270,
313–321. [CrossRef]
5.
Hebert, P.D.; Penton, E.H.; Burns, J.M.; Janzen, D.H.; Hallwachs, W. Ten species in one: DNA barcoding reveals cryptic species in
the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. USA 2004,101, 14812–14817. [CrossRef]
6.
Rugman-Jones, P.F.; Hoddle, C.D.; Hoddle, M.S.; Stouthamer, R. The lesser of two weevils: Molecular-genetics of pest palm
weevil populations confirm Rhynchophorus vulneratus (Panzer 1798) as a valid species distinct from R. ferrugineus (Olivier 1790),
and reveal the global extent of both. PLoS ONE 2013,8, e78379. [CrossRef]
7.
Tay, W.T.; Beckett, S.J.; De Barro, P.J. Phosphine resistance in Australian Cryptolestes species (Coleoptera: Laemophloeidae):
Perspectives from mitochondrial DNA cytochrome oxidase I analysis. Pest Manag. Sci. 2016,72, 1250–1259. [CrossRef]
8.
Behere, G.T.; Tay, W.T.; Russell, D.A.; Heckel, D.G.; Appleton, B.R.; Kranthi, K.R.; Batterham, P. Mitochondrial DNA analysis of
field populations of Helicoverpa armigera (Lepidoptera: Noctuidae) and of its relationship to H. zea.BMC Evol. Biol. 2007,7, 117.
[CrossRef]
9.
De Barro, P.J.; Liu, S.S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: A statement of species status. Annu. Rev. Entomol. 2011,56,
1–19. [CrossRef] [PubMed]
10.
Hurst, G.D.; Jiggins, F.M. Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic
studies: The effects of inherited symbionts. Proc. Biol. Sci. 2005,272, 1525–1534. [CrossRef]
11.
Tay, W.T.; Elfekih, S.; Court, L.N.; Gordon, K.H.J.; Delatte, H.; De Barro, P.J. The Trouble with MEAM2: Implications of
Pseudogenes on Species Delimitation in the Globally Invasive Bemisia tabaci (Hemiptera: Aleyrodidae) Cryptic Species Complex.
Genome Biol. Evol. 2017,9, 2732–2738. [CrossRef]
12.
Chen, L.; Huang, J.R.; Dai, J.; Guo, Y.F.; Sun, J.T.; Hong, X.Y. Intraspecific mitochondrial genome comparison identified CYTB as a
high-resolution population marker in a new pest Athetis lepigone.Genom. 2019,111, 744–752. [CrossRef]
13.
Roe, A.D.; Sperling, F.A. Patterns of evolution of mitochondrial cytochrome c oxidase I and II DNA and implications for DNA
barcoding. Mol. Phylogenet. Evol. 2007,44, 325–345. [CrossRef] [PubMed]
14.
Tay, W.T.; Rane, R.V.; Padovan, A.; Walsh, T.K.; Elfekih, S.; Downes, S.; Nam, K.; d’Alencon, E.; Zhang, J.; Wu, Y.; et al. Global
population genomic signature of Spodoptera frugiperda (fall armyworm) supports complex introduction events across the Old
World. Commun. Biol. 2022,5, 297. [CrossRef] [PubMed]
15.
Vyskocilova, S.; Tay, W.T.; van Brunschot, S.; Seal, S.; Colvin, J. An integrative approach to discovering cryptic species within the
Bemisia tabaci whitefly species complex. Sci. Rep. 2018,8, 10886. [CrossRef]
16.
Goergen, G.; Kumar, P.L.; Sankung, S.B.; Togola, A.; Tamo, M. First Report of Outbreaks of the Fall Armyworm Spodoptera
frugiperda (J E Smith) (Lepidoptera, Noctuidae), a New Alien Invasive Pest in West and Central Africa. PLoS ONE 2016,11,
e0165632. [CrossRef]
17.
Rane, R.; Walsh, T.K.; Lenancker, P.; Gock, A.; Dao, T.H.; Nguyen, V.L.; Khin, T.N.; Amalin, D.; Chittarath, K.; Faheem, M.; et al.
Complex multiple introductions drive fall armyworm invasions into Asia and Australia. Sci. Rep. 2023,13, 660. [CrossRef]
18.
Tay, W.T.; Meagher, R.L., Jr.; Czepak, C.; Groot, A.T. Spodoptera frugiperda: Ecology, Evolution, and Management Options of an
Invasive Species. Annu. Rev. Entomol. 2023,68, 299–317. [CrossRef] [PubMed]
19.
Cock, M.J.W.; Beseh, P.K.; Buddie, A.G.; Cafa, G.; Crozier, J. Molecular methods to detect Spodoptera frugiperda in Ghana, and
implications for monitoring the spread of invasive species in developing countries. Sci. Rep. 2017,7, 4103. [CrossRef]
20.
Nagoshi, R.N.; Dhanani, I.; Asokan, R.; Mahadevaswamy, H.M.; Kalleshwaraswamy, C.M.; Sharanabasappa; Meagher, R.L.
Genetic characterization of fall armyworm infesting South Africa and India indicate recent introduction from a common source
population. PLoS ONE 2019,14, e0217755. [CrossRef]
21.
Nagoshi, R.N.; Goergen, G.; Tounou, K.A.; Agboka, K.; Koffi, D.; Meagher, R.L. Analysis of strain distribution, migratory potential,
and invasion history of fall armyworm populations in northern Sub-Saharan Africa. Sci. Rep. 2018,8, 3710. [CrossRef]

Diversity 2024,16, 634 11 of 12
22.
Leite, N.A.; Alves-Pereira, A.; Correa, A.S.; Zucchi, M.I.; Omoto, C. Demographics and genetic variability of the new world
bollworm (Helicoverpa zea) and the old world bollworm (Helicoverpa armigera) in Brazil. PLoS ONE 2014,9, e113286. [CrossRef]
[PubMed]
23.
Arnemann, J.A.; Roxburgh, S.; Walsh, T.; Guedes, J.; Gordon, K.; Smagghe, G.; Tay, W.T. Multiple incursion pathways for
Helicoverpa armigera in Brazil show its genetic diversity spreading in a connected world. Sci. Rep. 2019,9, 19380. [CrossRef]
24.
Walsh, T.K.; Perera, O.; Anderson, C.; Gordon, K.; Czepak, C.; McGaughran, A.; Zwick, A.; Hackett, D.; Tay, W.T. Mitochondrial
DNA genomes of five major Helicoverpa pest species from the Old and New Worlds (Lepidoptera: Noctuidae). Ecol. Evol. 2019,9,
2933–2944. [CrossRef]
25.
Anderson, C.J.; Tay, W.T.; McGaughran, A.; Gordon, K.; Walsh, T.K. Population structure and gene flow in the global pest,
Helicoverpa armigera.Mol. Ecol. 2016,25, 5296–5311. [CrossRef]
26.
Elfekih, S.; Tay, W.T.; Polaszek, A.; Gordon, K.H.J.; Kunz, D.; Macfadyen, S.; Walsh, T.K.; Vyskocilova, S.; Colvin, J.; De Barro, P.J.
On species delimitation, hybridization and population structure of cassava whitefly in Africa. Sci. Rep. 2021,11, 7923. [CrossRef]
27.
Zhang, J.; Zhang, F.; Tay, W.T.; Robin, C.; Shi, Y.; Guan, F.; Yang, Y.; Wu, Y. Population genomics provides insights into lineage
divergence and local adaptation within the cotton bollworm. Mol. Ecol. Resour. 2022,22, 1875–1891. [CrossRef] [PubMed]
28.
Valencia-Montoya, W.A.; Elfekih, S.; North, H.L.; Meier, J.I.; Warren, I.A.; Tay, W.T.; Gordon, K.H.J.; Specht, A.; Paula-Moraes, S.V.;
Rane, R.; et al. Adaptive Introgression across Semipermeable Species Boundaries between Local Helicoverpa zea and Invasive
Helicoverpa armigera Moths. Mol. Biol. Evol. 2020,37, 2568–2583. [CrossRef] [PubMed]
29.
Iannucci, A.; Benazzo, A.; Natali, C.; Arida, E.A.; Zein, M.S.A.; Jessop, T.S.; Bertorelle, G.; Ciofi, C. Population structure, genomic
diversity and demographic history of Komodo dragons inferred from whole-genome sequencing. Mol. Ecol. 2021,30, 6309–6324.
[CrossRef]
30.
Pearce, S.L.; Clarke, D.F.; East, P.D.; Elfekih, S.; Gordon, K.H.J.; Jermiin, L.S.; McGaughran, A.; Oakeshott, J.G.; Papanicolaou, A.;
Perera, O.P.; et al. Genomic innovations, transcriptional plasticity and gene loss underlying the evolution and divergence of two
highly polyphagous and invasive Helicoverpa pest species. BMC Biol. 2017,15, 63. [CrossRef]
31.
Benelli, G.; Lucchi, A.; Anfora, G.; Bagnoli, B.; Botton, M.; Campos-Herrera, R.; Carlos, C.; Daugherty, M.P.; Gemeno, C.; Harari,
A.R.; et al. European grapevine moth, Lobesia botrana. Part I: Biology and ecology. Entomol. Gen. 2023,43, 261–280. [CrossRef]
32.
Li, X.W.; Fu, K.Y.; Guo, W.C.; Wang, T.Z.; Lu, Y.B. The complete mitochondrial genome of Tuta absoluta (Lepidoptera: Gelechiidae)
and genetic variation in two newly invaded populations in China. J. Asia-Pac. Entomol. 2022,25, 101988. [CrossRef]
33.
Otim, M.H.; Tay, W.T.; Walsh, T.K.; Kanyesigye, D.; Adumo, S.; Abongosi, J.; Ochen, S.; Sserumaga, J.; Alibu, S.; Abalo, G.; et al.
Detection of sister-species in invasive populations of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) from
Uganda. PLoS ONE 2018,13, e0194571. [CrossRef]
34.
Etebari, K.; Hereward, J.; Sailo, A.; Ahoafi, E.M.; Tautua, R.; Tsatsia, H.; Jackson, G.V.; Furlong, M.J. Examination of population
genetics of the Coconut Rhinoceros Beetle (Oryctes rhinoceros) and the incidence of its biocontrol agent (Oryctes rhinoceros nudivirus)
in the South Pacific Islands. Curr. Res. Insect Sci. 2021,1, 100015. [CrossRef]
35.
Marshall, S.D.G.; Moore, A.; Vaqalo, M.; Noble, A.; Jackson, T.A. A new haplotype of the coconut rhinoceros beetle, Oryctes
rhinoceros, has escaped biological control by Oryctes rhinoceros nudivirus and is invading Pacific Islands. J. Invertebr. Pathol. 2017,
149, 127–134. [CrossRef] [PubMed]
36.
Reil, J.B.; Doorenweerd, C.; San Jose, M.; Sim, S.B.; Geib, S.M.; Rubinoff, D. Transpacific coalescent pathways of coconut rhinoceros
beetle biotypes: Resistance to biological control catalyses resurgence of an old pest. Mol. Ecol. 2018,27, 4459–4474. [CrossRef]
37.
Tanaka, S.; Harrison, R.L.; Arai, H.; Katayama, Y.; Mizutani, T.; Inoue, M.N.; Miles, J.; Marshall, S.D.G.; Kitalong, C.; Nakai,
M. Confirmation of Oryctes rhinoceros nudivirus infections in G-haplotype coconut rhinoceros beetles (Oryctes rhinoceros) from
Palauan PCR-positive populations. Sci. Rep. 2021,11, 18820. [CrossRef]
38.
Elfekih, S.; Etter, P.; Tay, W.T.; Fumagalli, M.; Gordon, K.; Johnson, E.; De Barro, P. Genome-wide analyses of the Bemisia tabaci
species complex reveal contrasting patterns of admixture and complex demographic histories. PLoS ONE 2018,13, e0190555.
[CrossRef]
39. Bedford, G.O. Biology, Ecology, and Control of Palm Rhinoceros Beetles. Annu. Rev. Entomol. 1980,25, 309–339. [CrossRef]
40.
Indriyanti, D.R.; Utami, Z.T.; Setiati, N.; Soesilowati, E.; Slamet, M. Identification of insect pests that attack the coconut plants in
Jepara regency. J. Phys. Conf. Ser. 2019,1321, 032030. [CrossRef]
41.
Paudel, S.; Mansfield, S.; Villamizar, L.F.; Jackson, T.A.; Marshall, S.D.G. Can Biological Control Overcome the Threat From
Newly Invasive Coconut Rhinoceros Beetle Populations (Coleoptera: Scarabaeidae)? A Review. Ann. Entomol. Soc. Am. 2021,114,
538–539. [CrossRef] [PubMed]
42.
Caasi, J.A.S.; Guerrero, A.L.; Yoon, K.; Aquino, L.J.C.; Moore, A.; Oh, H.; Rychtar, J.; Taylor, D. A mathematical model of invasion
and control of coconut rhinoceros beetle Oryctes rhinoceros (L.) in Guam. J. Theor. Biol. 2023,570, 111525. [CrossRef] [PubMed]
43.
Datt, N.; Gosai, R.C.; Ravuiwasa, K.; Timote, V. Key transboundary plant pests of Coconut [Cocos nucifera] in the Pacific Island
countries—A biosecurity perspective. Plant Pathol. Quar. 2020,10, 152–171. [CrossRef]
44.
Ayivi, S.P.G.; Tong, Y.; Storey, K.B.; Yu, D.N.; Zhang, J.Y. The Mitochondrial Genomes of 18 New Pleurosticti (Coleoptera:
Scarabaeidae) Exhibit a Novel trnQ-NCR-trnI-trnM Gene Rearrangement and Clarify Phylogenetic Relationships of Subfamilies
within Scarabaeidae. Insects 2021,12, 1025. [CrossRef]
45.
Filipovic, I.; Hereward, J.P.; Rasic, G.; Devine, G.J.; Furlong, M.J.; Etebari, K. The complete mitochondrial genome sequence of
Oryctes rhinoceros (Coleoptera: Scarabaeidae) based on long-read nanopore sequencing. PeerJ 2021,9, e10552. [CrossRef]

Diversity 2024,16, 634 12 of 12
46.
Cheng, C.T.; Jeng, M.L.; Tsai, J.F.; Li, C.L.; Wu, L.W. Two mitochondrial genomes of Taiwanese rhinoceros beetles, Oryctes
rhinoceros and Eophileurus chinensis (Coleoptera: Scarabaeidae). Mitochondrial DNA B Resour. 2021,6, 2260–2262. [CrossRef]
47.
Anggraini, E.; Vadamalai, G.; Kong, L.L.; Mat, M.; Lau, W.H. Variants in the mitochondrial genome sequence of Oryctes rhinoceros
(Coleoptera: Scarabaeidae) infected with Oryctes rhinoceros nudivirus in oil palm and coconut plantations. Sci. Rep. 2023,13,
16850. [CrossRef]
48.
Bernt, M.; Donath, A.; Juhling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Putz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved
de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013,69, 313–319. [CrossRef]
49.
Tay, W.T.; Popa-Baez, A.; Dulla, G.; Blas, A.; Sundalangi, J.; Meldy, H.; Bennette Millado, J.; Melzer, M.; Rane, R.; Hogarty, T.; et al.
Mitochondrial COI, ATP6, and COIII Complete Sequence Database for Coconut Rhinoceros Beetles (Oryctes rhinoceros) from Native and
Introduced Ranges; CSIRO: Canberra, Australia, 2024; Volume 1. [CrossRef]
50.
Tay, W.T.; Popa-Baez, A.; Dulla, G.; Blas, A.; Sundalangi, J.; Meldy, H.; Bennette Millado, J.; Melzer, M.; Rane, R.; Hogarty, T.; et al.
Draft Mitochondrial Genome Protein Coding Genes of the Coconut Rhinoceros Beetles (Oryctes rhinoceros) from Native and Introduced
Ranges; CSIRO: Canberra, Australia, 2024; Volume 1. [CrossRef]
51.
Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier
transform. Nucleic Acids Res. 2002,30, 3059–3066. [CrossRef]
52.
Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability.
Mol. Biol. Evol. 2013,30, 772–780. [CrossRef]
53.
Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood
analysis. Nucleic Acids Res. 2016,44, W232–W235. [CrossRef] [PubMed]
54.
Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation.
Mol. Biol. Evol. 2018,35, 518–522. [CrossRef] [PubMed]
55.
Huson, D.H.; Richter, D.C.; Rausch, C.; Dezulian, T.; Franz, M.; Rupp, R. Dendroscope: An interactive viewer for large
phylogenetic trees. BMC Bioinform. 2007,8, 460. [CrossRef]
56.
Kaminski, M.M.; Abudayyeh, O.O.; Gootenberg, J.S.; Zhang, F.; Collins, J.J. CRISPR-based diagnostics. Nat. Biomed. Eng. 2021,5,
643–656. [CrossRef]
57.
Gill, P.; Hadian Amree, A. AS-LAMP: A New and Alternative Method for Genotyping. Avicenna J. Med. Biotechnol. 2020,12, 2–8.
[PubMed]
58.
Hoffmann, B.D.; Tay, W.T.; Blas, A.L. Biosecurity interceptions of Coconut Rhinoceros Beetle Oryctes rhinoceros.Manag. Biol.
Invasions 2024,15, 437–443. [CrossRef]
59.
Annon. Rhino beetle takes root. Marshall Isl. J. 2023. Available online: https://marshallislandsjournal.com/rhino-beetle-takes-
root/ (accessed on 17 March 2024).
60.
HDOA (Hawaii Department of Agriculture). Coconut Rhinoceros Beetle Information. Available online: https://hdoa.hawaii.
gov/pi/main/crb/ (accessed on 10 April 2024).
61. Anderson, C.J.; Oakeshott, J.G.; Tay, W.T.; Gordon, K.H.J.; Zwick, A.; Walsh, T.K. Hybridization and gene flow in the mega-pest
lineage of moth, Helicoverpa.Proc. Natl. Acad. Sci. USA 2018,115, 5034–5039. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.