Comprehensive Analysis of Berberis aristata DC. Bark Extracts: In Vitro and In Silico Evaluation of Bioaccessibility and Safety

Abstract

Berberine (BER) is an alkaloid found, together with other protoberberinoids (PROTBERs), in several species used in medicines and food supplements. While some herbal preparations containing BER and PROTBERs, such as Berberis aristata DC. bark extracts, have shown promising potential for human health, their safety has not been fully assessed. Recently, the EFSA issued a call for data to deepen the pharmacokinetic and pharmacodynamic understanding of products containing BER and PROTBERs and to comprehensively assess their safety, especially when used in food supplements. In this context, new data were collected in this work by assessing: (i) the phytochemical profile of 16 different commercial B. aristata dry extracts, which are among the most widely used preparations containing BER and PROTBERs in Europe; (ii) the In Vitro and In Silico investigation of the pharmacokinetic properties of BER and PROTBERs; (iii) the In Vitro cytotoxicity of selected extracts in different human cell lines, including tests on hepatic cells in the presence of CYP450 substrates; (iv) the effects of the extracts on cancer cell migration; and (v) the In Vitro molecular effects of extracts in non-cancer human cells. Results showed that commercial B. aristata extracts contain BER as the main constituent, with jatrorrhizine as main secondary PROTBER. BER and jatrorrhizine were found to have a good bioaccessibility rate, but they interact with P-gp. B. aristata extracts showed limited cytotoxicity and minimal interaction with CYP450 substrates. Furthermore, tested extracts demonstrated inhibition of cancer cell migration and were devoid of any pro-tumoral effects in normal cells. Overall, our work provides a valuable overview to better elucidate important concerns regarding botanicals containing BER and PROTBERs.

Full text

Citation: Rigillo, G.; Cappellucci, G.;
Baini, G.; Vaccaro, F.; Miraldi, E.; Pani,
L.; Tascedda, F.; Bruni, R.; Biagi, M.
Comprehensive Analysis of Berberis
aristata DC. Bark Extracts: In Vitro and
In Silico Evaluation of Bioaccessibility
and Safety. Nutrients 2024,16, 2953.
https://doi.org/10.3390/nu16172953
Academic Editor: Andrew J. Sinclair
Received: 30 July 2024
Revised: 28 August 2024
Accepted: 29 August 2024
Published: 2 September 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
nutrients
Article
Comprehensive Analysis of Berberis aristata DC. Bark Extracts:
In Vitro and In Silico Evaluation of Bioaccessibility and Safety
Giovanna Rigillo 1, 2, * , Giorgio Cappellucci 2,3 , Giulia Baini 2,3, Federica Vaccaro 2,3 , Elisabetta Miraldi 2,3 ,
Luca Pani 1,4 , Fabio Tascedda 5,6 , Renato Bruni 7and Marco Biagi 2,7
1Department of Biomedical, Metabolic and Neural Sciences, University of Modena and Reggio Emilia,
41125 Modena, Italy; luca.pani@unimore.it
2Laboratory of Italian Society of Phytoterapy-SIFITLab, 53100 Siena, Italy; giorgi.cappellucci@unisi.it (G.C.);
giulia.baini2@unisi.it (G.B.); fvaccaro@student.unisi.it (F.V.); elisabetta.miraldi@unisi.it (E.M.);
marco.biagi@unipr.it (M.B.)
3Department of Physical Sciences, Earth and Environment, University of Siena, 53100 Siena, Italy
4Department of Psychiatry and Behavioral Sciences, University of Miami, Miami, FL 33136, USA
5Department of Life Sciences, University of Modena and Reggio Emilia, 41125 Modena, Italy;
fabio.tascedda@unimore.it
6Consorzio Interuniversitario Biotecnologie (CIB), 34148 Trieste, Italy
7Department of Food and Drug, University of Parma, 43124 Parma, Italy; renato.bruni@unipr.it
*Correspondence: giovanna.rigillo@unimore.it
Abstract: Berberine (BER) is an alkaloid found, together with other protoberberinoids (PROTBERs), in
several species used in medicines and food supplements. While some herbal preparations containing
BER and PROTBERs, such as Berberis aristata DC. bark extracts, have shown promising potential
for human health, their safety has not been fully assessed. Recently, the EFSA issued a call for
data to deepen the pharmacokinetic and pharmacodynamic understanding of products containing
BER and PROTBERs and to comprehensively assess their safety, especially when used in food
supplements. In this context, new data were collected in this work by assessing: (i) the phytochemical
profile of 16 different commercial B. aristata dry extracts, which are among the most widely used
preparations containing BER and PROTBERs in Europe; (ii) the In Vitro and In Silico investigation
of the pharmacokinetic properties of BER and PROTBERs; (iii) the In Vitro cytotoxicity of selected
extracts in different human cell lines, including tests on hepatic cells in the presence of CYP450
substrates; (iv) the effects of the extracts on cancer cell migration; and (v) the In Vitro molecular effects
of extracts in non-cancer human cells. Results showed that commercial B. aristata extracts contain BER
as the main constituent, with jatrorrhizine as main secondary PROTBER. BER and jatrorrhizine were
found to have a good bioaccessibility rate, but they interact with P-gp. B. aristata extracts showed
limited cytotoxicity and minimal interaction with CYP450 substrates. Furthermore, tested extracts
demonstrated inhibition of cancer cell migration and were devoid of any pro-tumoral effects in
normal cells. Overall, our work provides a valuable overview to better elucidate important concerns
regarding botanicals containing BER and PROTBERs.
Keywords: berberine; safety; bioaccessibility; cell viability; gene expression
1. Introduction
Berberine (BER) is an isoquinoline alkaloid belonging to the category of protoberber-
ines, including berberrubine, thalifendine, demethyleneberberine, coptisine, jatrorrhizine,
columbamine, palmatine, and epiberberine. These compounds share a common molecular
moiety, characterized by an aromatic quaternary ammonium nitrogen, a bright yellow color,
and water solubility [1] (Figure 1).
Nutrients 2024,16, 2953. https://doi.org/10.3390/nu16172953 https://www.mdpi.com/journal/nutrients

Nutrients 2024,16, 2953 2 of 24
Nutrients 2024, 16, x FOR PEER REVIEW 2 of 25
Coptis, Phellodendron, Corydalis, and Xanthorhiza genera or in Tinospora sinensis (Lour.)
Merr. and Coscininium fenestratum (Goetgh.) Colebr., but it also occurs in medicinal species
known in American and European Western medicine, such as Hydrastis canadensis L.,
Chelidonium majus L., or Papaver spp., as well as in Siberia (Thalictrum flavum L.) and in
Africa (Jateorhiza palmata (Lam.) Miers and Annickia chlorantha (Oliv.) Seen & Maas) [2].
In herbal preparations obtained from these species, other compounds may contribute to
the biological activity of BER, in particular the alkaloids chemically related to BER, such
as protoberberinoid derivatives (PROTBERs) [3].
Figure 1. Berberine chemical structure in 2D and 3D (PubChem CID: 2353)
(hps://pubchem.ncbi.nlm.nih.gov/compound/Berberine, accessed on 22 August 2024).
To date, in the European Union (EU), an official monograph on the medicinal use of
these species has not been produced by the European Medicines Agency (EMA), while a
Berberis aristata DC. stem monograph was added to the European Pharmacopoeia in 2022,
being the most commonly used BER-containing species used in food supplements [4,5].
BER and BER-containing herbal preparations from B. aristata have displayed a
plethora of biological effects, as witnessed by numerous clinical trials. A high-quality
meta-analysis [3] reports that most clinical trials concern cardiovascular system disorders
(atherosclerosis and lipid profile) [5–8], inflammation [9,10], glycemia [11–14],
gastrointestinal health [15,16], and cancer [17–19]. Evidence indicates that BER shows
beneficial properties in conditions of dysregulation or alteration of physiological
processes, displaying various activities such as lipid and glycemic regulation, anti-
inflammatory, antioxidant and antiproliferative activities, and gut microbiota modulation
[20]. The biological activity of BER has been associated with multiple molecular
mechanisms involving different cell signaling pathways; PKA, p38 MAPK, Wnt/β-catenin,
AMPK, RANK/RANKL/OPG, PI3K/Akt, NFAT, NF-κB, Hedgehog, low-density
lipoprotein (LDL) receptor expression, reactive oxygen species (ROS), and nitric oxide
(NO) production have been described as molecular targets of BER in different conditions
regarding sugars and lipids metabolism, cardiovascular, gastrointestinal,
musculoskeletal, and the central nervous systems, as well as cancer and inflammation [21–
26].
Potential adverse events could be linked to the biological activity of BER and
PROTBERs; therefore, the safety of BER, PROTBERs, and BER-containing herbal
preparations has been carefully considered.
In terms of pharmacokinetics, BER and PROTBERs show different bioavailability:
BER is a substrate for P-glycoprotein (P-gp) and less than 1% of an oral dose was found to
be bioavailable [27]; also, jatrorrhizine is a P-gp substrate and it showed a poor
bioavailability [28,29]. Other PROTBERs have a higher bioavailability, as demonstrated
by in vivo studies for epiberberine [30], palmatine [31], berberubbine [32], coptisine, and
columbamine [33]. Despite the lack of proper knowledge on cellular bioavailability, it is
well known that after intestinal absorption, BER and PROTBERs are rapidly metabolized
Figure 1. Berberine chemical structure in 2D and 3D (PubChem CID: 2353) (https://pubchem.ncbi.
nlm.nih.gov/compound/Berberine, accessed on 22 August 2024).
BER is a characteristic compound with biological activity found in several plant
species with a well-established use in traditional Asian medicine, such as those in Berberis,
Coptis,Phellodendron,Corydalis, and Xanthorhiza genera or in Tinospora sinensis (Lour.) Merr.
and Coscininium fenestratum (Goetgh.) Colebr., but it also occurs in medicinal species
known in American and European Western medicine, such as Hydrastis canadensis L.,
Chelidonium majus L., or Papaver spp., as well as in Siberia (Thalictrum flavum L.) and in
Africa (Jateorhiza palmata (Lam.) Miers and Annickia chlorantha (Oliv.) Setten & Maas) [
2
].
In herbal preparations obtained from these species, other compounds may contribute to
the biological activity of BER, in particular the alkaloids chemically related to BER, such as
protoberberinoid derivatives (PROTBERs) [3].
To date, in the European Union (EU), an official monograph on the medicinal use of
these species has not been produced by the European Medicines Agency (EMA), while a
Berberis aristata DC. stem monograph was added to the European Pharmacopoeia in 2022,
being the most commonly used BER-containing species used in food supplements [4,5].
BER and BER-containing herbal preparations from B. aristata have displayed a plethora
of biological effects, as witnessed by numerous clinical trials. A high-quality meta-analysis [
3
]
reports that most clinical trials concern cardiovascular system disorders (atherosclerosis and
lipid profile) [
5
–
8
], inflammation [
9
,
10
], glycemia [
11
–
14
], gastrointestinal health [
15
,
16
],
and cancer [
17
–
19
]. Evidence indicates that BER shows beneficial properties in conditions
of dysregulation or alteration of physiological processes, displaying various activities
such as lipid and glycemic regulation, anti-inflammatory, antioxidant and antiproliferative
activities, and gut microbiota modulation [
20
]. The biological activity of BER has been
associated with multiple molecular mechanisms involving different cell signaling path-
ways; PKA, p38 MAPK, Wnt/
β
-catenin, AMPK, RANK/RANKL/OPG, PI3K/Akt, NFAT,
NF-
κ
B, Hedgehog, low-density lipoprotein (LDL) receptor expression, reactive oxygen
species (ROS), and nitric oxide (NO) production have been described as molecular targets
of BER in different conditions regarding sugars and lipids metabolism, cardiovascular,
gastrointestinal, musculoskeletal, and the central nervous systems, as well as cancer and
inflammation [21–26].
Potential adverse events could be linked to the biological activity of BER and PROT-
BERs; therefore, the safety of BER, PROTBERs, and BER-containing herbal preparations
has been carefully considered.
In terms of pharmacokinetics, BER and PROTBERs show different bioavailability: BER
is a substrate for P-glycoprotein (P-gp) and less than 1% of an oral dose was found to be
bioavailable [
27
]; also, jatrorrhizine is a P-gp substrate and it showed a poor bioavailabil-
ity [
28
,
29
]. Other PROTBERs have a higher bioavailability, as demonstrated by
in vivo
studies for epiberberine [
30
], palmatine [
31
], berberubbine [
32
], coptisine, and colum-
bamine [
33
]. Despite the lack of proper knowledge on cellular bioavailability, it is well
known that after intestinal absorption, BER and PROTBERs are rapidly metabolized by
hepatic CYP450 enzymes. Many studies have primarily described BER metabolism, report-
ing that the CYP450 1A2, 3A4, 2D6, and 2C9 isoforms are mainly involved [
34
], while few
have studied other PROTBERs and their interaction with different CYP450 isoforms, with

Nutrients 2024,16, 2953 3 of 24
the exception of jatrorrhizine, metabolized by CYP1A2 [
35
], and palmatine by CYP2D6 [
36
].
It is plausible that CYP1A2, CYP3A4, and CYP2D6 have a key role in the metabolism of
many PROTBERs; thus, drug–herbal product interactions should be considered when BER,
PROTBERs, and BER-containing herbal preparations are used.
Given the complexity of the topic and the well-established and growing consumption
of BER-containing herbal preparations, especially in food supplements, in 2023 the Euro-
pean Food Safety Authority (EFSA) opened a “call for data” to obtain relevant updates on
the safety assessment of BER-containing herbal preparations used in food supplements [
37
].
Within this context, this study aims to provide new experimental-based evidence to
fill some pivotal gaps concerning the chemical and pharmacokinetic aspects, and biological
safety of berberine. To accomplish our aim, this research was structured into seven steps:
(1) the phytochemical characterization of sixteen different commercial raw BER-containing
ingredients, used in food supplement formulation, through the development of an
efficient HPLC-DAD method to quantify BER and PROTBERs;
(2) In Vitro evaluation of digestive stability and bioaccessibility, and In Silico investigation
of pharmacokinetic properties of BER and PROTBERs;
(3)
prediction of potential BER-related targets by bioinformatic analysis;
(4)
assessment of cytotoxicity in In Vitro human intestinal (Caco-2), hepatic (HepG2),
gastric (AGS), and kidney (HEK293) cell lines, and of BER’s impact on hepatic cell
viability in the presence of CYP450 substrates;
(5)
evaluation of BER’s effects on cell migration ability of colorectal carcinoma cells
(Caco-2);
(6) investigation of potential oxidative stress of BER in non-tumoral kidney cells (HEK293)
by the dosage of ROS;
(7)
evaluation of the transcriptional effects of BER on the main target genes involved
in the regulation of cell cycle, cell growth, and neoplastic transformation, as well as
on oncogenes.
2. Materials and Methods
2.1. Plant Material
Sixteen different extracts used as raw ingredients in Italy for food supplement prepara-
tions were selected from the international business-to-business market. According to their
declared content, they were divided into two groups: eight B. aristata bark extracts with a
declared content of 97% BER w/wdry basis (db) as BER hydrochloride, and the remnant
with a declared content of 85% BER w/wdb. Samples were kindly supplied by EHPM
(Brussels, Belgium), Viatris (Monza-Brianza, Italy), Giellepi(Seregno, Monza-Brianza, Italy),
and Vivatis (Gallarate, Varese, Italy).
2.2. Phytochemical Analysis
The quantification of BER and PROTBERs in the examined extracts was determined
by analytical techniques and measured by calculating values as BER hydrochloride on
the dry basis (db) of the extract (% w/wdb). All samples were dissolved in ultra-pure
water (1 mg/mL) and analyzed by using an HPLC-DAD Shimadzu Prominence LC 2030
3D instrument. A Bondpak
®
C18 column, 10
µ
m, 125 Å, 3.9 mm
×
300 mm (Waters
Corporation, Milford, MA, USA), was used as the stationary phase. The mobile phase was
composed of water with 0.1% v/vformic acid (A) and acetonitrile with 0.1% v/vformic
acid (B). The following method was used: B from 45% at 0 min and a linear increase to
55% at 9 min, then 45% at 10 min, holding the same percentage until the end, 11 min. Flow
rate was set at 0.900 mL/min; column temperature was 30
◦
C. The chromatogram was
recorded at 346 nm. BER hydrochloride (Merck KGaA, Darmstadt, Germany)
(10–0.01 µg
in column) was used to build the calibration curve. In herbal preparations, BER was
identified and quantified by using the specific external standard, whereas other PROTBERs
were identified according to the literature and their UV–vis spectra [
31
]; PROTBERs were
quantified and expressed as BER hydrochloride.

Nutrients 2024,16, 2953 4 of 24
Given the homogeneous phytochemical profile of the extracts, subsequent bioactivities
were determined using two different B. aristata bark extracts with a declared content of 97%
BER w/w, and two B. aristata bark extracts with a BER content of 85% w/w, namely, A85,
D85, A97, and G97 (Table 3 in Section 3.1).
2.3. In Vitro Bioaccessibility Assessment
The test was conducted according to Governa et al., 2022 [
38
] and the validated
INFOGEST protocol [
39
], with some modifications. In detail, 20 mg of each extract were
added to 20 mL of simulated gastric juice, containing pepsin from porcine gastric mucosa
(300 UI/mL, Merck) and NaCl (10 mg/mL); the pH of the solution was adjusted to 1.7
using HCl. Samples were incubated for 2 h at 37
◦
C with shaking. Then, pancreatin
from porcine pancreas (activity equivalent to 4
×
U.S.P., 10 mg/mL, Merck) and a bile
salt mixture (20 mg/mL, Merck) were added, and the pH was increased to 7.0 by adding
NaHCO
3
(15 mg/mL, Merck) to simulate the intestinal environment. Intestinal digestion
was carried out for 2 h at 37
◦
C with shaking. Samples were then filtered and immediately
used for further analysis, performed according to the HPLC-DAD method described above.
The bioaccessibility rate of each compound was calculated as the % of its recovery after
digestion, compared to the initial amount. Two independent experiments were performed.
2.4. In Silico Pharmacokinetic Analysis and Target Prediction
Computational analysis of pharmacokinetic characteristics of BER and PROTBERs
present in the most common food supplements marketed in the EU was performed using
the SwissADME© web tool, a free platform created and developed by the Molecular
Modeling Group of the SIB, Swiss Institute of Bioinformatics. According to their chemical–
physical characteristics, compound similarities, and provided data, the trained algorithm
estimates compounds for ADME (absorption, distribution, metabolism, and excretion)
properties, physical chemistry, drug likeness, pharmacokinetics, and medicinal chemistry
properties [
40
]. Target prediction was performed by using GeneCards
®
suite, a web tool
developed to obtain results with functionality and relevance scoring, allowing for the
combination of query terms and providing relevant literature, which the match is based
on [
41
]. In this work, SwissTargetPrediction, another web tool of the SIB, was used, as well
as SEA (Similarity Ensemble Approach). SEA predicts the biological targets of a compound
based on its resemblance to ligands annotated in reference databases and relates proteins
by their pharmacology by aggregating chemical similarity among entire sets of ligands;
SEA also scores Tanimoto similarity calculations based on compound annotations derived
from ChEMBL [42].
2.5. In Vitro Cell Culture and Treatment
Human colorectal (Caco-2), hepatic (HepG2), gastric (AGS), and kidney (HEK293)
cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 1%
glutamine, and 1% penicillin/streptomycin antibiotics. Media and material for cell cultures
was supplied by Merck. Cells were maintained under a humidified atmosphere of 5%
CO
2
at 37
◦
C. Cells were treated with two representative samples based on the results
obtained from chemical analysis: one B. aristata bark extract with 97% BER (as berberine
hydrochloride) w/w, composed of two pooled extracts containing BER 97% (B97%) and
one B. aristata bark extracts with 85% BER content w/w, composed of two pooled extracts
containing BER 85% (B85%). The control group received phosphate-buffered saline (PBS).
The treatments were carried out at various time points, as indicated in each section, for
further analysis.
2.6. Cytotoxicity Assay
Caco-2, HepG2, HEK293, and AGS cells were seeded in 96-well plates and cultured
for 24 h. Cells were treated with B97% and B85% extracts at 10, 20, 50, 100, and 200
µ
g/mL
for 4 and 24 h. After the treatment, the medium was removed, and cells were incubated

Nutrients 2024,16, 2953 5 of 24
with fresh medium in the presence of 10% v/vCCK-8 (Cell Counting Kit, Merck) [
43
,
44
].
The assay is based on the reduction of a water-soluble tetrazolium salt WST-8 operated
by cell dehydrogenases that lead to formazan production, soluble and orange-colored;
the absorbance of the formazan dye is measured at 450 nm with a microplate reader
VICTOR
®
Nivo™3s (Perkin-Elmer, Waltham, MA, USA). Cell viability in treated groups
was compared to untreated cells (control). Two independent tests were performed (n= 8).
2.7. Cytotoxicity Assay in Presence of CYP450 Substrates
Hepatic HepG2 cells were seeded in 96-well plates and cultured for 24 h. Firstly,
cell viability was tested for the CYP450 substrates, specifically phenacetin (CYP1A2),
dextromethorphan (CYP2D6), and triazolam (CYP3A4) at the concentrations of 0.1, 1,
10, and 50
µ
g/mL for 24 h (all drugs were purchased from Merck). After evaluating
non-cytotoxic concentrations, HepG2 cells were seeded in 96-well plates and cultured,
then treated with B97% and B85% at 50 or 100
µ
g/mL in the presence of phenacetin,
dextromethorphan, or triazolam at 20
µ
g/mL for 24 h. Cell viability was assessed by means
of the CCK-8 kit as described above.
2.8. Dosage of Intracellular Reactive Oxygen Species (ROS) Level
ROS production was quantified using 2
′
,7
′
-dichlorodihydrofluorescein diacetate (H2-
DCF-DA, Thermo Fischer Scientific, Waltham, MA, USA) [
45
]. HEK293 cells were seeded in
96-well plates and cultured for 24 h. Cells were treated with B97% and B85% extracts at 10,
20, and 50
µ
g/mL for 24 h. H
2
O
2
, 0.5 mM, was used as a positive control of ROS production.
After the treatment, the medium was removed, and cells were washed twice with PBS, then
incubated with a 50
µ
M H2DCF-DA solution for 45 min at 37
◦
C. In the presence of ROS, the
reagent H2DCF-DA was converted in a fluorescent adduct, dichlorofluorescein (DCF). DCF
fluorescence intensity was measured at an excitation of 485 nm and emission of 535 nm,
using a Multilabel Plate Reader VICTOR
®
Nivo™3s (Perkin-Elmer). Two independent
experiments with four replicates (n= 8) were performed.
2.9. Migration Assay
Caco-2 cells (5
×
10
5
) were seeded into 6-well cell culture plates and allowed to grow
to 70–80% confluence as a monolayer [
43
,
46
,
47
]. The monolayer was gently scratched
across the center of the well with a sterile 1 mL pipette tip. A second scratch was performed
perpendicular to the first, creating a cross in each well. After scratching, the medium was
removed, and the wells were washed twice in PBS solution. Fresh medium containing 5%
v/vof heat-inactivated FBS and B97% or B85% at 10 or 100
µ
g/mL, respectively, were added
to each well. Images were obtained from the same fields immediately after scratching (t
0
)
and after 6, 24, 30, and 48 h using a Leica DMIL microscope, and analyzed using ImageJ
software version v1.54j by manually selecting the wound region and recording the total
area. The experiments were conducted in triplicate, and two fields were analyzed for
each replicate (n= 4). Untreated scratched cells represented the control. The percentage
of scratching gap was calculated using the following formula: [Wound area t)/Wound
area t0]×100.
2.10. Total RNA Extraction, Reverse Transcription, and Real-Time PCR
HEK293 cells were seeded in 6-well plates at the density of 2
×
10
6
cells/well and
cultured for 24 h. Cells were stimulated with B97% and B85% at 10 and 20
µ
g/mL for 24 h.
RNA extraction and DNAse treatment were performed as previously described [
31
,
48
] by
using Ripospin II mini-Kit (#314–150, GeneAll, Seoul, Republic of Korea), according to the
manufacturer’s protocol. For cDNA synthesis, one microgram of RNA was retrotranscribed
with PrimeScript RT Reagent Kit (#RR037A, Takara Bio, Shiga, Japan) and RT-qPCR was
performed by CFX Connect Real-Time PCR machine (Bio-Rad Laboratories, Hercules, CA,
USA), using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories) and
specific forward and reverse primers at a final concentration of 300 nM (Table 1). Cycle

Nutrients 2024,16, 2953 6 of 24
threshold (Cq) value was determined by the CFX maestro software version 2.3 (Bio-Rad
Laboratories), and mRNA expression was calculated by the
∆∆
Ct method and normalized
to the mean of rps18-rpl13a genes as an endogenous control. For gene expression analysis,
endogenous control mRNA levels were not affected among treatments (p> 0.05, one-way
analysis of variance: ANOVA).
Table 1. Transcript and sequence of each primer used in real-time PCR.
Gene NCBI GenBank Sequence
Rplp13a NM_012423.4 fw: GTGCGTCTGAAGCCTACAAG
rv: CGTTCTTCTCGGCCTGTTTC
Rps18 NM_022551.3 fw: TCTAGTGATCCCTGAAAAGT
rv: AACACCACATGAGCATATC
Tp53 NM_000546.6 fw: AGGGATGTTTGGGAGATGTAAG
rv: CCTGGTTAGTACGGTGAAGTG
c-Myc NM_001354870.1 fw: AAGCTGAGGCACACAAAGA
rv: GCTTGGACAGGTTAGGAGTAAA
n-Myc NM_005378.6 fw: TCCAGCAGATGCCACATAAG
rv: ACCTCTCATTACCCAGGATGTA
Met NM_001127500.3 fw: CCTGGGCACCGAAAGATAAA
rv: CTCCTCTGCACCAAGGTAAAC
Mdm2 NM_002392.6 fw: AGGCTGATCTTGAACTCCTAAAC
rv: CAGGTGCCTCACATCTGTAATC
Cdkn1a NM_000389.5 fw: CGGAACAAGGAGTCAGACATT
rv: AGTGCCAGGAAAGACAACTAC
Snai1 NM_005985.4 fw: CAGATGAGGACAGTGGGAAAG
rv: GAGACTGAAGTAGAGGAGAAGGA
Snai2 NM_003068.5 fw: AACTACAGCGAACTGGACAC
rv: GAGGATCTCTGGTTGTGGTATG
Hras NM_005343.4 fw: AAGCAAGGAAGGAAGGAAGG
rv: GTGGCATTTGGGATGTTCAAG
Cdk4 NM_000075.4 fw: GCTCTGCAGCACTCTTATCTAC
rv: CTCAGTGTCCAGAAGGGAAATG
Bax NM_004324 fw: CTCCCCATCTTCAGATCATCAG
rv: GGCAGAAGGCACTAATCAAGTC
Bcl2 NM_000657 fw: GACTGAGTACCTGAACCGGC
rv: CTCAGCCCAGACTCACATCA
2.11. Statistical Analysis
Data were presented as mean
±
standard deviation (SD). Statistical analyses were
performed using the unpaired Student t-test or one-way analysis of variance (ANOVA)
(with p< 0.05 significance level) as appropriate, followed by Dunnet post-hoc tests for
multiple comparison. Analyses and graphs were conducted and composed by using
GraphPad Prism 10.1 (San Diego, CA, USA).
3. Results
3.1. Chemical Analyses of Extracts Containing Berberine and Protoberberinoids
Chemical analysis of sixteen different marketed herbal preparations containing BER
and PROTBERs were performed, specifically extracts from B. aristata, namely B. aristata
bark extracts with a declared content of BER of 97% w/wdb, and B. aristata bark extracts
with a declared content of BER of 85% w/wdb. A new method developed on purpose
was used, providing a robust and reliable performance for the extracts under investigation
containing BER and PROTBERs (Table 2).

Nutrients 2024,16, 2953 7 of 24
Table 2. Parameters of HPLC-DAD method employed.
Parameter Value
R20.99
Equation y = 4317.80 −98.57
Linearity range 0.04–7.5 µg in column
Recovery of spiked standard >90% and <105%
Limit of quantification 0.03 µg in column
Intra- and inter-day variation <3%
The method allowed us to perfectly identify and quantify BER (as BER hydrochloride)
in all samples analyzed at the retention time (RT) of 5.7 min (Table 3).
Table 3. Quantification of berberine in 16 different marketed herbal preparations containing berberine
and protoberberinoids by means of HPLC-DAD. Quantification was made on dry basis (db) of the
extracts, and values are expressed as berberine hydrochloride. Values are expressed as % w/w
of a triplicate analysis performed on eight B. aristata extracts with a declared content of 97% of
berberine hydrochloride db and on eight extracts of B. aristata with a declared content of 85% of
berberine hydrochloride.
Sample Berberine
%w/wdb Sample Berberine
%w/wdb
A85 86.26 A97 97.41
B85 86.74 B97 91.94
C85 91.93 C97 96.50
D85 88.87 D97 97.16
E85 89.63 E97 97.49
F85 90.66 F97 97.21
G85 80.07 G97 97.29
J85 87.88 J97 97.80
mean ±SD 87.76 ±3.64 mean ±SD 96.60 ±1.91
We also identified jatrorrhizine in all the samples (RT = 5.0 min), as well as palma-
tine (RT = 5.3 min), in agreement with previously published works [
49
] and with the
characteristic UV–vis spectra. A partial overlapping of palmatine with another minor
PROTBERs was noted, and thanks to the collaboration of external labs and by using a mass
spectrometer, we identified this PROTBER as berberrubine. In many samples, we found
other secondary PROTBERs through their maximum absorbance at 344–347 nm, but the
sum of these compounds expressed as BER hydrochloride was confirmed to be under the
limit of quantification (LOQ) (Figure 2).
Summarizing, in all samples, we found BER as a major compound, followed by
jatrorrhizine, always present, and palmatine at low concentrations, often accompanied by
berberrubine (Table 4). The overall qualitative and quantitative data proved the extracts
were true to the label for both the 97% and 85% groups, with a maximum discordance of
+8.2% for C85 and
−
5.8% for G85. The higher variability in BER content in samples labeled
with BER 85% compared to those labeled with BER 97% was noted; the reason for this
are not known to date, but we could generally attribute it to differences in the method of
extract preparation.

Nutrients 2024,16, 2953 8 of 24
Nutrients 2024, 16, x FOR PEER REVIEW 8 of 25
Figure 2. HPLC chromatogram of a representative Berberis aristata DC. bark extract recorded at 346
nm. The main peak (retention time 5.7 min) is related to berberine (BER); at 5.0 min, there is jatror-
rhizine (JTR). Among these two molecules, at 5.3 min, two partially overlapped peaks are present,
aributed to berberrubine (BBR) and palmatine (PLM).
Summarizing, in all samples, we found BER as a major compound, followed by jatror-
rhizine, always present, and palmatine at low concentrations, often accompanied by ber-
berrubine (Table 4). The overall qualitative and quantitative data proved the extracts were
true to the label for both the 97% and 85% groups, with a maximum discordance of +8.2%
for C85 and −5.8% for G85. The higher variability in BER content in samples labeled with
BER 85% compared to those labeled with BER 97% was noted; the reason for this are not
known to date, but we could generally aribute it to differences in the method of extract
preparation.
Table 4. Quantification of protoberberinoids in B. aristata bark extracts. Samples are labeled accord-
ing to the declared content of berberine expressed as berberine hydrochloride. Quantification was
made on dry basis (db) of the extracts and all compounds are expressed as berberine hydrochloride.
Values are expressed as % w/w of a triplicate analysis performed on eight B. aristata extracts with a
declared content of 97% of berberine hydrochloride db and on eight extracts of B. aristata with a
declared content of 85% of berberine hydrochloride. The quantification of palmatine and berberru-
bine was performed by repeating chromatographic runs of high amounts of injected samples in
order to reach the limit of quantification.
Samples Jatrorrhizine
% w/w db
Berberrubine + Palmatine
% w/w db
A85 2.39 0.25
B85 1.88 0.24
C85 2.10 0.23
D85 3.07 0.26
E85 2.54 0.28
F85 2.85 0.24
G85 2.59 0.20
J85 3.12 0.25
mean ± SD 2.57 ± 0.44 0.24 ± 0.02
A97 2.25 0.24
B97 1.49 0.08
C97 2.98 0.11
D97 2.57 0.23
E97 2.04 0.13
F97 2.04 0.14
G97 2.05 0.28
J97 1.71 0.13
mean ± SD 2.14 ± 0.46 0.17 ± 0.07
Figure 2. HPLC chromatogram of a representative Berberis aristata DC. bark extract recorded at
346 nm. The main peak (retention time 5.7 min) is related to berberine (BER); at 5.0 min, there is
jatrorrhizine (JTR). Among these two molecules, at 5.3 min, two partially overlapped peaks are
present, attributed to berberrubine (BBR) and palmatine (PLM).
Table 4. Quantification of protoberberinoids in B. aristata bark extracts. Samples are labeled according
to the declared content of berberine expressed as berberine hydrochloride. Quantification was made
on dry basis (db) of the extracts and all compounds are expressed as berberine hydrochloride. Values
are expressed as % w/wof a triplicate analysis performed on eight B. aristata extracts with a declared
content of 97% of berberine hydrochloride db and on eight extracts of B. aristata with a declared
content of 85% of berberine hydrochloride. The quantification of palmatine and berberrubine was
performed by repeating chromatographic runs of high amounts of injected samples in order to reach
the limit of quantification.
Samples Jatrorrhizine
%w/wdb
Berberrubine + Palmatine
%w/wdb
A85 2.39 0.25
B85 1.88 0.24
C85 2.10 0.23
D85 3.07 0.26
E85 2.54 0.28
F85 2.85 0.24
G85 2.59 0.20
J85 3.12 0.25
mean ±SD 2.57 ±0.44 0.24 ±0.02
A97 2.25 0.24
B97 1.49 0.08
C97 2.98 0.11
D97 2.57 0.23
E97 2.04 0.13
F97 2.04 0.14
G97 2.05 0.28
J97 1.71 0.13
mean ±SD 2.14 ±0.46 0.17 ±0.07
Contrarily to what emerged for other botanicals, the quality of B. aristata extracts
available in the raw ingredients marketplace is reliable [
50
]. This evidence, however, is
seemingly in contrast with recent investigations in which only 56% of 18 Berberis-derived
food supplements were true-to-the-label [
27
]. It must be specified in this regard that our
samples were crude extracts available in the business-to-business ingredients market rather
than retail, formulated food supplements.

Nutrients 2024,16, 2953 9 of 24
Given the homogeneous phytochemical profile, for subsequent tests, two B. aristata
extracts with a declared content of 97% of berberine hydrochloride db and two extracts of
B. aristata with a declared content of 85% of berberine hydrochloride were chosen randomly
(A85, D85, A97, G97) and pooled to obtain the samples B85 and B97, whose chemical
composition is reported in Table 5.
Table 5. Chemical composition of pooled A85 and D85 (mixed 1:1, B85) and pooled A97 and G97 (1:1,
B97) expressed as mean of composition of single extracts.
Samples Berberine
%w/wdb
Jatrorrhizine
%w/wdb
Berberrubine + Palmatine
%w/wdb
B. aristata 85% (B85) 87.57 ±1.85 2.83 ±0.48 0.26 ±0.01
B. aristata 97% (B97) 97.35 ±0.08 2.15 ±0.14 0.26 ±0.02
3.2. In Vitro Bioaccessibility Assessment of Berberine and Protoberberinoids
The assessment of simulated digestion on the different B. aristata extracts examined
allowed us to recover BER and jatrorrhizine in all samples (Table 6). The post-digestive
presence of bile salts and enzymes partly hid the minority part of berberrubine and palma-
tine in some replicates; thus, we decided not to report these PROTBERs in the assessment
of bioaccessibility. We could verify that isoquinolinic alkaloids underwent minimal degra-
dation; indeed, the post-digestive bioaccessibility rate was >95% for BER and 84–88% for
jatrorrhizine, with low differences in different samples (Table 6). BER was adequately solu-
ble in hydrophilic gastrointestinal digestive fluids, and it was not affected by the activity
of digestive enzymes. Figure 3A,B shows the stability obtained from the analysis of a
representative extract before and after simulated digestion.
Nutrients 2024, 16, x FOR PEER REVIEW 10 of 25
(A)
(B)
Figure 3. Representative HPLC chromatogram of Berberis aristata DC. bark extract con-
taining 85% of berberine hydrochloride dry basis before (A) and after (B) simulated di-
gestion, recorded at 346 nm.
3.3. In Silico Pharmacokinetic Analysis and Target Prediction of Berberine and
Protoberberine Derivatives
After testing the bioaccessibility of BER and PROTBERs, we intended to study other
pharmacokinetic features of BER, jatrorrhizine, berberrubine, and palmatine that are sta-
ble and present at detectable levels in the most used herbal preparations containing BER
and PROTBERs.
By means of SwissADME
®
tools, we verified that BER (both in neutral and in hydro-
chloride forms) has good potential to be absorbed by intestinal epithelium, but being a P-
gp substrate explains data referring to its poor bioavailability [30,51]. Moreover, the com-
putational prediction confirmed that BER is a substrate for the following CYP450
isoforms: 1A2, 3A4, and 2D6 (Figure 4).
Figure 3. Representative HPLC chromatogram of Berberis aristata DC. bark extract containing 85% of
berberine hydrochloride dry basis before (A) and after (B) simulated digestion, recorded at 346 nm.

Nutrients 2024,16, 2953 10 of 24
Table 6. Bioaccessibility rate of berberine and jatrorrhizine investigated in two extracts of Berberis
aristata DC. bark containing 97% or 85% of berberine hydrochloride dry basis, respectively. Berberine
showed high stability in response to pH change and digestive enzyme activity; jatrorrhizine was also
recovered in high percentage.
Bioaccessibility Rate %
Samples Berberine Jatrorrhizine
B. aristata 97% >95 83.57 ±3.33
B. aristata 85% >95 87.81 ±3.69
3.3. In Silico Pharmacokinetic Analysis and Target Prediction of Berberine and
Protoberberine Derivatives
After testing the bioaccessibility of BER and PROTBERs, we intended to study other
pharmacokinetic features of BER, jatrorrhizine, berberrubine, and palmatine that are stable
and present at detectable levels in the most used herbal preparations containing BER
and PROTBERs.
By means of SwissADME
®
tools, we verified that BER (both in neutral and in hy-
drochloride forms) has good potential to be absorbed by intestinal epithelium, but being
a P-gp substrate explains data referring to its poor bioavailability [
30
,
51
]. Moreover, the
computational prediction confirmed that BER is a substrate for the following CYP450
isoforms: 1A2, 3A4, and 2D6 (Figure 4).
Nutrients 2024, 16, x FOR PEER REVIEW 11 of 25
Figure 4. Computational analysis of berberine pharmacokinetic properties by means of SwissADME
tool (hp://www.swissadme.ch/, accessed on 20 January 2024).
Jatrorrhizine and berberrubine were shown to share almost all pharmacokinetic char-
acteristics with BER (Supplementary Figure S1A,B). As observed for BER, jatrorrhizine,
berberrubine, and palmatine resulted in a P-gp, CYP2D6, and CYP3A4 substrate, but not
CYP1A2; moreover, palmatine was the least soluble PROTBER among those examined
(Supplementary Figure S1C).
We used the GeneCards tool to collect known targets for BER and the other PROT-
BERs investigated here, and we found a total of 371 targets for BER, 6 for jatrorrhizine, 11
for berberrubine, and 16 for palmatine. Interestingly, the overlapping of targets found for
the 4 compounds produced 373 results, thereby demonstrating that almost all targets
known for BER are shared with other major PROTBERs of Berberis spp. (Figure 5).
We observed that the main targets identified by GeneCards were related to low-den-
sity lipoprotein receptor (LDLR) and antiproliferative activity, for which BER activity is
known [52–55]. Other targets were related to CYP450 interaction (CYP2D6) and anti-neu-
roinflammatory activity (BDNF, NFE2), as already reported in pre-clinical studies [56]
(Figure 5).
Figure 4. Computational analysis of berberine pharmacokinetic properties by means of SwissADME
tool (http://www.swissadme.ch/, accessed on 20 January 2024).
Jatrorrhizine and berberrubine were shown to share almost all pharmacokinetic char-
acteristics with BER (Supplementary Figure S1A,B). As observed for BER, jatrorrhizine,
berberrubine, and palmatine resulted in a P-gp, CYP2D6, and CYP3A4 substrate, but not
CYP1A2; moreover, palmatine was the least soluble PROTBER among those examined
(Supplementary Figure S1C).
We used the GeneCards tool to collect known targets for BER and the other PROTBERs
investigated here, and we found a total of 371 targets for BER, 6 for jatrorrhizine, 11 for
berberrubine, and 16 for palmatine. Interestingly, the overlapping of targets found for the

Nutrients 2024,16, 2953 11 of 24
4 compounds produced 373 results, thereby demonstrating that almost all targets known
for BER are shared with other major PROTBERs of Berberis spp. (Figure 5).
Nutrients 2024, 16, x FOR PEER REVIEW 12 of 25
Figure 5. The best score for analysis of target prediction for berberine, as predicted by GeneCards
tool (hps://www.genecards.org/, accessed on 23 January 2024). Predicted targets are very hetero-
geneous but mainly refer to the most studied biological activities of berberine.
The interaction between BER and jatrorrhizine mainly underlined the activity to-
wards neuroprotective-related targets (BDNF and acetylcholinesterase, ACHE) and on
cell cycle regulatory factors (Supplementary Figure S2A).
Differently, the analysis of the interaction between BER and berberrubine highlighted
the anti-inflammatory activity of berberrubine [57] (Supplementary Figure S2B).
As regards the combination BER with palmatine, we found that for some newly
emerged targets, such as those related to cell cycle regulation and antiproliferative activ-
ity, corroborative data emerged from an In Vitro study on cancer cells [58–61]; moreover,
BDNF and cholinesterase (BCHE) emerged as neuro-targets, and some important antiox-
idant targets such as catalase (CAT) and superoxide dismutase (SOD) were shared by BER
and palmatine, as well as the xenobiotic toxicity modulator aryl-hydrocarbon receptor
(ARH) [62]. CYP1A(1-2) resulted to be modulated by BER and palmatine (Supplementary
Figure S2C).
Swiss and SEA target prediction, set as free search, without organ or signaling re-
strictions, confirmed that BER has a strong probability to interact with CYP2D6, as already
described, but also with CYP1B1 and CYP1A2 (predicted by STP and SEA, respectively)
(Supplementary Figure S3A). Both prediction tools also indicated acetylcholineesterase
and cholinesterases (ACHE, BCHE) as targets, and the interaction with Ras-related C3
botulinum toxin substrate 1 (RAC1), a member of Rho GTPase (Supplementary Figure
S3A). These predictions, only in part already known, may explain why BER is currently
considered in the field of neurodegenerative disorders [63], vascular system [64], and me-
tabolism regulation [24].
Regarding jatrorrhizine, the tools predicted affinity with medium or low scores, but
ACHE was the most plausible target for this PROTBER. STP and SEA shared the predic-
tion of RAC1, involved in metabolism, and cell division control protein 42 homolog
(CDC42), a regulator of the cell cycle (Supplementary Figure S3B).
Prediction scores for berberrubine were the worst, being weak only for humans; STP
predicted with a medium or low score some targets already considered for BER, such as
RAC1 and CDC42 (Supplementary Figure S3C).
As observed for BER, palmatine interacted with ACHE, as the data experimentally
confirmed [65]. Other targets such as 5-HTRB2, BCHE, ADRA2, CHRM1, SIGMAR1, and
CYP2D6 were predicted with a medium score by SwissTarget, and RAC1 by SEA with a
low score (Supplementary Figure S3D).
Figure 5. The best score for analysis of target prediction for berberine, as predicted by GeneCards
tool (https://www.genecards.org/, accessed on 23 January 2024). Predicted targets are very hetero-
geneous but mainly refer to the most studied biological activities of berberine.
We observed that the main targets identified by GeneCards were related to low-
density lipoprotein receptor (LDLR) and antiproliferative activity, for which BER activity
is known [
52
–
55
]. Other targets were related to CYP450 interaction (CYP2D6) and anti-
neuroinflammatory activity (BDNF, NFE2), as already reported in pre-clinical studies [
56
]
(Figure 5).
The interaction between BER and jatrorrhizine mainly underlined the activity towards
neuroprotective-related targets (BDNF and acetylcholinesterase, ACHE) and on cell cycle
regulatory factors (Supplementary Figure S2A).
Differently, the analysis of the interaction between BER and berberrubine highlighted
the anti-inflammatory activity of berberrubine [57] (Supplementary Figure S2B).
As regards the combination BER with palmatine, we found that for some newly
emerged targets, such as those related to cell cycle regulation and antiproliferative activity,
corroborative data emerged from an In Vitro study on cancer cells [
58
–
61
]; moreover, BDNF
and cholinesterase (BCHE) emerged as neuro-targets, and some important antioxidant
targets such as catalase (CAT) and superoxide dismutase (SOD) were shared by BER
and palmatine, as well as the xenobiotic toxicity modulator aryl-hydrocarbon receptor
(ARH) [
62
]. CYP1A(1-2) resulted to be modulated by BER and palmatine (Supplementary
Figure S2C).
Swiss and SEA target prediction, set as free search, without organ or signaling restric-
tions, confirmed that BER has a strong probability to interact with CYP2D6, as already
described, but also with CYP1B1 and CYP1A2 (predicted by STP and SEA, respectively)
(Supplementary Figure S3A). Both prediction tools also indicated acetylcholineesterase
and cholinesterases (ACHE, BCHE) as targets, and the interaction with Ras-related C3
botulinum toxin substrate 1 (RAC1), a member of Rho GTPase (Supplementary Figure S3A).
These predictions, only in part already known, may explain why BER is currently consid-
ered in the field of neurodegenerative disorders [
63
], vascular system [
64
], and metabolism
regulation [24].
Regarding jatrorrhizine, the tools predicted affinity with medium or low scores, but
ACHE was the most plausible target for this PROTBER. STP and SEA shared the prediction
of RAC1, involved in metabolism, and cell division control protein 42 homolog (CDC42), a
regulator of the cell cycle (Supplementary Figure S3B).

Nutrients 2024,16, 2953 12 of 24
Prediction scores for berberrubine were the worst, being weak only for humans; STP
predicted with a medium or low score some targets already considered for BER, such as
RAC1 and CDC42 (Supplementary Figure S3C).
As observed for BER, palmatine interacted with ACHE, as the data experimentally
confirmed [
65
]. Other targets such as 5-HTRB2, BCHE, ADRA2, CHRM1, SIGMAR1, and
CYP2D6 were predicted with a medium score by SwissTarget, and RAC1 by SEA with a
low score (Supplementary Figure S3D).
3.4. In Vitro Cytotoxicity Evaluation of Berberis aristata Bark Extracts
To assess the biological safety of BER and PROTBER alkaloids, we investigated the
biological impact of both extracts (B97% and B85%) examined so far. Specifically, we
evaluated the possible cytotoxic effects of BER- and PROTBERs-containing preparations by
performing a cell viability assay on an In Vitro model of different human cell lines: intestinal
(Caco-2), hepatic (HepG2), gastric (AGS), and renal (HEK293). Cells were treated with B97%
and B85% at different concentrations (10, 20, 50, 100, and 200
µ
g/mL) at two time points,
a short- (4 h) and a long-term (24 h), to simulate the exposure time of different organism
systems (stomach, intestine, liver, and kidney) and cell types to BER and PROTBERs. The
results obtained by the cell viability assay allowed us to determine the IC
50
(half-maximal
inhibitory concentration) value for each cell line at both time points of treatment. After
4 h of treatment, in all cell lines, the IC
50
values were over 100
µ
g/mL; specifically, for the
hepatic (HepG2) and gastric (AGS) cells, the IC
50
values exceeded 200
µ
g/mL (Table 7).
Similarly, after 24 h of treatment, the IC
50
values were still higher than 100
µ
g/mL despite
the increasing time of treatment. Of note, differences in the extracts tested were very
low, demonstrating a similar cell impact of the different B. aristata extracts studied here.
Differences in cell viability were observed in the various cell line models, but they could
be considered non-significant given the high IC
50
value obtained (Table 7). These data
suggested a negligible cytotoxic impact of BER-containing herbal preparations, providing
important outcomes on the safety of the use of BER and PROTBERs contained in the most
common marketed food supplements.
Table 7. IC50 values calculated for the extracts of B. aristata bark containing berberine hydrochloride
97% (B97) and 85% (B85) by means cell viability assay performed on intestinal (Caco-2), gastric (AGS),
hepatic (HepG2), and kidney (HEK293) cells after 4 h and 24 h of treatment.
IC50 (µg/mL)
Sample Treatment (h) AGS Caco-2 HepG2 HEK293
B97% 4 >200 166.93 ±8.44 >200 142.65 ±12.01
B85% 4 >200 169.14 ±9.25 >200 181.93 ±24.50
B97% 24 >200 105.59 ±11.21 198.85 ±8.50 127.16 ±25.18
B85% 24 >200 107.34 ±9.68 186.41 ±8.42 143.43 ±29.80
Data are expressed in µg/mL as mean ±standard deviation (SD).
3.5. In Vitro Cytotoxicity Evaluation of Berberis aristata Bark Extracts in Presence of
CYP450 Substrates
Considering the hepatic metabolism of BER and PROTBERs mediated by CYP450, our
investigation included the possible toxicological interactions with other drugs known to be
substrates of CYP450 isoforms.
To address this aspect, we performed a cell viability assay on HepG2 cells treated with
both B97% and B85% extracts at the highest concentrations of 50 and 100
µ
g/mL in the
presence of three main CYP450 substrates, like phenacetin (P), dextromethorphan (D), and
triazolam (T).
The selection of concentrations derived from the cytotoxicity tests described in 3.4
were intended to create a stress condition that could better assess the possible effects
of interaction with other drugs at the cytotoxic level. Firstly, to identify the non-toxic
concentration of P, D, and T to use in the co-treatment, we tested HepG2 cell viability

Nutrients 2024,16, 2953 13 of 24
treated with different concentrations of P, D, and T (0.1, 1, 10, and 50
µ
g/mL) for 24 h.
Statistical analysis revealed that all three drugs showed no impact on cell viability up to
10
µ
g/mL compared to the control group (Figure 6A–C). At the dose of 50
µ
g/mL, P, D,
and T differently affected the viability of hepatic cells: P and D reduced cell viability by
about 10% and 20%, respectively (one-way ANOVA: P = p< 0.05; D = p< 0.001 vs. CTRL),
while T showed the most significant impact by reducing cell viability of about 90% with
respect to controls (p< 0.0001 vs. CTRL) (Figure 6C). Based on these data, we carried out
following analysis by treating hepatic cells with 20
µ
g/mL of P, D or T in association with
B97% or B85% at 50 or 100
µ
g/mL, respectively. The results showed a non-significant effect
of B97% at 50
µ
g/mL on HepG2 cell viability; the association with P and T at 20
µ
g/mL
did not cause changes in cell viability when compared to the control group, while the effect
of BER was slightly worsened by the presence of D, resulting in a reduction in cell viability
of up to 30% (one way ANOVA: p< 0.0001 vs. CTRL) (Figure 6D). The treatment with
B97% at 100
µ
g/mL significantly affected cell viability compared to controls (p< 0.001 vs.
CTRL), but it was not significantly altered by the co-presence of the three drugs (Figure 6D).
Regarding B85%, the exposure of HepG2 cells to the sample alone slightly reduced the cell
viability (
−
17% compared to control) that did not undergo alterations in the presence of P,
D, or T when compared to the control cells (Figure 6E). The 24 h treatment of hepatic cells
with B85% at 100
µ
g/mL significantly reduced the cell viability by about 30% with respect
to the controls (p< 0.0001 vs. CTRL). Also, in this case, the association with all drugs did
not change the effect of BER (Figure 6E); indeed, the co-presence of P seemed to improve
the impact of B85% on cell viability (p< 0.05 vs. B85% at 100 µg/mL).
Nutrients 2024, 16, x FOR PEER REVIEW 14 of 25
analysis by treating hepatic cells with 20 µg/mL of P, D or T in association with B97% or
B85% at 50 or 100 µg/mL, respectively. The results showed a non-significant effect of B97%
at 50 µg/mL on HepG2 cell viability; the association with P and T at 20 µg/mL did not
cause changes in cell viability when compared to the control group, while the effect of
BER was slightly worsened by the presence of D, resulting in a reduction in cell viability
of up to 30% (one way ANOVA: p < 0.0001 vs. CTRL) (Figure 6D). The treatment with
B97% at 100 µg/mL significantly affected cell viability compared to controls (p < 0.001 vs.
CTRL), but it was not significantly altered by the co-presence of the three drugs (Figure
6D). Regarding B85%, the exposure of HepG2 cells to the sample alone slightly reduced
the cell viability (−17% compared to control) that did not undergo alterations in the pres-
ence of P, D, or T when compared to the control cells (Figure 6E). The 24 h treatment of
hepatic cells with B85% at 100 µg/mL significantly reduced the cell viability by about 30%
with respect to the controls (p < 0.0001 vs. CTRL). Also, in this case, the association with
all drugs did not change the effect of BER (Figure 6E); indeed, the co-presence of P seemed
to improve the impact of B85% on cell viability (p < 0.05 vs. B85% at 100 µg/mL).
These results showed that, in association with P, D, or T, the low cytotoxicity of the
most common BER-containing extracts remained unchanged. Overall, these findings pro-
vided preliminary data on toxicological aspects related to the interaction of B97% and
B85% extracts with drugs known to be CYP450 substrates.
Figure 6. Cell viability assay on HepG2 cells after 24 h of treatment with different concentrations of
(A) phenacetin, (B) dextromethorphan, and (C) triazolam. Then, HepG2 cells were co-treated for 24
h with phenacetin, dextromethorphan, or triazolam at 20 µg/mL and B97% at 50 and 100 µg/mL (D)
or B85% at 50 µg/mL (light colour) and 100 µg/mL (dark colour)(E), respectively. The column with
the striped paern represents the treatment with only the extract. Each column represents mean ±
SEM. Data were analyzed by one-way analysis of variance followed by Dunnet post-hoc: *** p <
0.001 and **** p < 0.0001 vs. CTRL; **** p < 0.0001 vs. B85% 50 µg/mL; * p< 0.05 vs. B85% 100 µg/mL;
n = 4.
Figure 6. Cell viability assay on HepG2 cells after 24 h of treatment with different concentrations of
(A) phenacetin, (B) dextromethorphan, and (C) triazolam. Then, HepG2 cells were co-treated for 24 h
with phenacetin, dextromethorphan, or triazolam at 20
µ
g/mL and B97% at 50 and 100
µ
g/mL (D) or
B85% at 50
µ
g/mL (light colour) and 100
µ
g/mL (dark colour)(E), respectively. The column with the
striped pattern represents the treatment with only the extract. Each column represents mean
±
SEM.
Data were analyzed by one-way analysis of variance followed by Dunnet post-hoc: *** p< 0.001 and
**** p< 0.0001 vs. CTRL; **** p< 0.0001 vs. B85% 50 µg/mL; * p< 0.05 vs. B85% 100 µg/mL; n= 4.

Nutrients 2024,16, 2953 14 of 24
These results showed that, in association with P, D, or T, the low cytotoxicity of
the most common BER-containing extracts remained unchanged. Overall, these findings
provided preliminary data on toxicological aspects related to the interaction of B97% and
B85% extracts with drugs known to be CYP450 substrates.
3.6. Effect of Berberis aristata Bark Extracts on Cell Migration
In addition to assessing the effects on cell viability, the investigation of the safety of
herbal preparations containing BER and PROTBERs proceeded by analyzing cell migratory
movement by means of the wound-healing assay. This is a commonly used method to
determine the effects of compounds on changes in 2D cell migration properties, relating in
particular to cancer cells.
With this purpose, we explored the migratory activity of human colorectal cancer cells
(Caco-2) following treatment with B97% and B85% at both low concentration (10
µ
g/mL)
and high concentration (100
µ
g/mL) for 48 h. The relative scratch gap was monitored over
time and measured. Data showed a statistically significant effect of both B97% and B85% at
the dose of 100
µ
g/mL in decreasing the migration ability of Caco-2 cells (about 40% B97%
and 33% B85%) at the end of the treatment compared to control cells (one-way ANOVA:
** p< 0.01 vs. CTRL) (Figure 7). These results suggested a functional activity of tested
extracts at 100 µg/mL in decreasing the cell migration of intestinal tumor cells.
Nutrients 2024, 16, x FOR PEER REVIEW 15 of 25
3.6. Effect of Berberis aristata Bark Extracts on Cell Migration
In addition to assessing the effects on cell viability, the investigation of the safety of
herbal preparations containing BER and PROTBERs proceeded by analyzing cell migra-
tory movement by means of the wound-healing assay. This is a commonly used method
to determine the effects of compounds on changes in 2D cell migration properties, relating
in particular to cancer cells.
With this purpose, we explored the migratory activity of human colorectal cancer
cells (Caco-2) following treatment with B97% and B85% at both low concentration (10
µg/mL) and high concentration (100 µg/mL) for 48 h. The relative scratch gap was moni-
tored over time and measured. Data showed a statistically significant effect of both B97%
and B85% at the dose of 100 µg/mL in decreasing the migration ability of Caco-2 cells
(about 40% B97% and 33% B85%) at the end of the treatment compared to control cells
(one-way ANOVA: ** p < 0.01 vs. CTRL) (Figure 7). These results suggested a functional
activity of tested extracts at 100 µg/mL in decreasing the cell migration of intestinal tumor
cells.
Figure 7. Wound-healing assay on Caco-2 cells treated with B97% and B85% (10 and 100 µg/mL) for
48 h or untreated (CTRL). Dashed line represent the 100% of wound area. Each column represents
mean ± SEM. Data were analyzed by one-way analysis of variance: ** p < 0.01 vs. CTRL; n = 4.
3.7. In Vitro Evaluation of ROS Production in Normal Kidney Cells Treated with Berberis
aristata Bark Extracts
The assessment of the safety of herbal preparations containing BER and PROTBERs
also took into consideration the possible effects of oxidative stress of both B97% and B85%
extracts in non-tumoral human cells. For this reason, ROS production was evaluated in
normal renal cells (HEK293) treated for 24 h with B97% and B85% extracts at different
concentrations (10, 20, and 50 µg/mL); H
2
O
2
was used as a positive control.
The results showed no statistical effects of either B97% or B85% on any of the concen-
trations tested compared to the control cells; in contrast, treatment with H
2
O
2
was able to
induce ROS production by 1.45-fold with respect to untreated cells (one-way ANOVA: p
< 0.0001 vs. CTRL) (Figure 8).
Figure 7. Wound-healing assay on Caco-2 cells treated with B97% and B85% (10 and 100
µ
g/mL) for
48 h or untreated (CTRL). Dashed line represent the 100% of wound area. Each column represents
mean ±SEM. Data were analyzed by one-way analysis of variance: ** p< 0.01 vs. CTRL; n= 4.
3.7. In Vitro Evaluation of ROS Production in Normal Kidney Cells Treated with Berberis aristata
Bark Extracts
The assessment of the safety of herbal preparations containing BER and PROTBERs
also took into consideration the possible effects of oxidative stress of both B97% and B85%
extracts in non-tumoral human cells. For this reason, ROS production was evaluated in
normal renal cells (HEK293) treated for 24 h with B97% and B85% extracts at different
concentrations (10, 20, and 50 µg/mL); H2O2was used as a positive control.
The results showed no statistical effects of either B97% or B85% on any of the concen-
trations tested compared to the control cells; in contrast, treatment with H
2
O
2
was able
to induce ROS production by 1.45-fold with respect to untreated cells (one-way ANOVA:
p< 0.0001 vs. CTRL) (Figure 8).

Nutrients 2024,16, 2953 15 of 24
Nutrients 2024, 16, x FOR PEER REVIEW 16 of 25
Figure 8. Dosage of intracellular ROS in HEK293 cells treated with B97% and B85% at the concen-
trations of 10, 20, and 50 µg/mL for 24 h. H
2
O
2
(500 µM) was used as positive control (CTRL+). Each
column represents mean ± SEM. Data were analyzed by one-way analysis of variance: * p < 0.05 and
**** p < 0.0001 vs CTRL; n = 8.
These data revealed no effects of BER or PROTBERs in inducing oxidative stress
through ROS production.
3.8. Transcriptional Effects of Berberis aristata Bark Extracts on Target Genes Involved in Cell
Cycle Control and Neoplastic Transformation
With the purpose of deepening the study on the safety and biological activity of BER,
we investigated the molecular effects of BER- and PROTBERs-containing herbal prepara-
tions in an In Vitro model of human normal kidney cells, HEK293.
We focused on the transcriptional effects on the main target genes involved in the
control of cell cycle , cell growth, neoplastic transformation, and oncogenes by exposing
HEK293 cells for 24 h to the two examined extracts, B97% and B85%, at the concentrations
of 10 and 20 µg/mL. First, we analyzed through RT-qPCR the gene expression of the tumor
protein p53 (TP53), the oncogene MDM2, and the proto-oncogenes c-MYC, n-MYC, HRAS,
and MET.
Our results showed that TP53, MDM2, and n-MYC mRNA levels were markedly
downregulated in cells treated with B97% and B85% at both 10 and 20 µg/mL compared
to the control counterpart [one-way ANOVA: TP53: F (4, 18) = 12.04, p < 0.001; MDM2: F
(4, 18) = 7.773, p = 0.0008; n-MYC: F (4, 18) = 8.198, p = 0.0006] (Figure 9A–C). On the con-
trary, no differences were observed in c-MYC gene expression with respect to untreated
cells with the exception of cells exposed to B97% at 20 µg/mL where a significant increase
(2-fold) in c-MYC mRNA levels, compared to the control, was observed [F (4, 18) = 7.375;
p = 0.0011] (Figure 9D). Regarding the mRNA levels of HRAS and MET, we found no sig-
nificant effects of either BER extracts, at either concentration, in kidney cells following 24
h of treatment (Figure 9E,F). These results revealed the impact of both B. aristata extracts
in downregulating the gene transcription of TP53, MDM2, and n-MYC at both the concen-
trations tested in normal cells.
Then, our molecular analysis focused on p21 (CDKN1A) and CDK4 targets, two es-
sential factors in regulating cell cycle. The results revealed no statistically significant ef-
fects of the B97% extract on modulating CDKN1A gene transcription that was
Figure 8. Dosage of intracellular ROS in HEK293 cells treated with B97% and B85% at the concentra-
tions of 10, 20, and 50
µ
g/mL for 24 h. H
2
O
2
(500
µ
M) was used as positive control (CTRL+). Each
column represents mean
±
SEM. Data were analyzed by one-way analysis of variance: * p< 0.05 and
**** p< 0.0001 vs CTRL; n= 8.
These data revealed no effects of BER or PROTBERs in inducing oxidative stress
through ROS production.
3.8. Transcriptional Effects of Berberis aristata Bark Extracts on Target Genes Involved in Cell
Cycle Control and Neoplastic Transformation
With the purpose of deepening the study on the safety and biological activity of
BER, we investigated the molecular effects of BER- and PROTBERs-containing herbal
preparations in an In Vitro model of human normal kidney cells, HEK293.
We focused on the transcriptional effects on the main target genes involved in the
control of cell cycle, cell growth, neoplastic transformation, and oncogenes by exposing
HEK293 cells for 24 h to the two examined extracts, B97% and B85%, at the concentrations
of 10 and 20
µ
g/mL. First, we analyzed through RT-qPCR the gene expression of the tumor
protein p53 (TP53), the oncogene MDM2, and the proto-oncogenes c-MYC,n-MYC,HRAS,
and MET.
Our results showed that TP53,MDM2, and n-MYC mRNA levels were markedly
downregulated in cells treated with B97% and B85% at both 10 and 20
µ
g/mL compared to
the control counterpart [one-way ANOVA: TP53: F (4, 18) = 12.04, p< 0.001; MDM2: F (4,
18) = 7.773, p= 0.0008; n-MYC: F (4, 18) = 8.198, p= 0.0006] (Figure 9A–C). On the contrary,
no differences were observed in c-MYC gene expression with respect to untreated cells with
the exception of cells exposed to B97% at 20
µ
g/mL where a significant increase (2-fold) in
c-MYC mRNA levels, compared to the control, was observed [F (4, 18) = 7.375; p= 0.0011]
(Figure 9D). Regarding the mRNA levels of HRAS and MET, we found no significant effects
of either BER extracts, at either concentration, in kidney cells following 24 h of treatment
(Figure 9E,F). These results revealed the impact of both B. aristata extracts in downregulating
the gene transcription of TP53,MDM2, and n-MYC at both the concentrations tested in
normal cells.

Nutrients 2024,16, 2953 16 of 24
Nutrients 2024, 16, x. hps://doi.org/10.3390/xxxxx www.mdpi.com/journal/nutrients
Figure 9. RT-qPCR analysis of TP53 (A), MDM2 (B), n-MYC (C), c-MYC (D), HRAS (E), and MET
(F) transcripts in HEK293 cells following treatment with B97% and B85% at 10 or 20
µ
g/mL. Each
column represents mean
±
SEM. Data were analyzed by one-way analysis of variance followed by
Dunnet post-hoc: * p< 0.05, ** p< 0.01, *** p< 0.001, and **** p< 0.0001 vs. CTRL (n= 4).
Then, our molecular analysis focused on p21 (CDKN1A) and CDK4 targets, two essen-
tial factors in regulating cell cycle. The results revealed no statistically significant effects
of the B97% extract on modulating CDKN1A gene transcription that was downregulated
instead by B85% at both concentrations [F (4, 18) = 4.273, p= 0.0132]. Regarding CDK4,
treatment with both BER extracts induced a decrease in gene expression unrelated to the
dose [F (4, 18) = 3.036, p= 0.0446] (Figure 10A,B).
In evaluating the effects of BER in regulating cell death processes, such as apoptosis,
we also analyzed the transcriptional levels of the Bcl-2 family members, key factors in the
early stages of apoptotic process: the pro-apoptotic gene BAX and the anti-apoptotic gene
BCL-2 [66–68].
Statistical analysis showed a significant and similar effect of both B. aristata extracts in
downregulating the expression of the pro-apoptotic gene BAX in HEK293 cells compared
to controls [one-way ANOVA: F (4, 9) = 8.688, p= 0.0037], whereas no changes in BCL-2
mRNA levels were observed (Figure 11A,B).

Nutrients 2024,16, 2953 17 of 24
Nutrients 2024, 16, x FOR PEER REVIEW 18 of 25
column represents mean ± SEM. Data were analyzed by one-way analysis of variance followed by
Dunnet post-hoc: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 vs. CTRL (n = 4).
Figure 10. RT-qPCR analysis of CDKN1A (A) and CDK4 (B) transcripts in HEK293 cells following
treatment with B97% and B85% at 10 or 20 µg/mL. Each column represents mean ± SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p < 0.05 and ** p < 0.01 vs.
CTRL (n = 4).
Figure 11. RT-qPCR analysis of BAX (A) and BCL-2 (B) transcripts in HEK293 cells following treat-
ment with B97% and B85% at 10 or 20 µg/mL. Each column represents mean ± SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p < 0.05 and ** p < 0.01 vs.
CTRL (n = 4).
4. Discussion
Herbal preparations containing berberine (BER) and other minor protoberberinoids
(PROTBERs) have been extensively used in traditional Asian medicine, in modern con-
ventional phytotherapy, and in food supplements supporting physiological activities.
BER has garnered aention for its purported effects on glucose and lipid metabolism, gas-
trointestinal health, and even for potential anticancer properties [11,15–17,75,76]. How-
ever, as the popularity of herbal preparations containing BER and PROTBERs increase,
concerns about their biological safety are emerging, especially regarding the safe exposure
for general consumers and special population, as highlighted by some national authorities
and EFSA in the EU [37]. The authorities have clearly claimed the need for analytical,
pharmacokinetic, and biological insights into herbal preparations containing BER and
Figure 10. RT-qPCR analysis of CDKN1A (A) and CDK4 (B) transcripts in HEK293 cells following
treatment with B97% and B85% at 10 or 20
µ
g/mL. Each column represents mean
±
SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p< 0.05 and ** p< 0.01 vs.
CTRL (n= 4).
Nutrients 2024, 16, x FOR PEER REVIEW 18 of 25
column represents mean ± SEM. Data were analyzed by one-way analysis of variance followed by
Dunnet post-hoc: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 vs. CTRL (n = 4).
Figure 10. RT-qPCR analysis of CDKN1A (A) and CDK4 (B) transcripts in HEK293 cells following
treatment with B97% and B85% at 10 or 20 µg/mL. Each column represents mean ± SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p < 0.05 and ** p < 0.01 vs.
CTRL (n = 4).
Figure 11. RT-qPCR analysis of BAX (A) and BCL-2 (B) transcripts in HEK293 cells following treat-
ment with B97% and B85% at 10 or 20 µg/mL. Each column represents mean ± SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p < 0.05 and ** p < 0.01 vs.
CTRL (n = 4).
4. Discussion
Herbal preparations containing berberine (BER) and other minor protoberberinoids
(PROTBERs) have been extensively used in traditional Asian medicine, in modern con-
ventional phytotherapy, and in food supplements supporting physiological activities.
BER has garnered aention for its purported effects on glucose and lipid metabolism, gas-
trointestinal health, and even for potential anticancer properties [11,15–17,75,76]. How-
ever, as the popularity of herbal preparations containing BER and PROTBERs increase,
concerns about their biological safety are emerging, especially regarding the safe exposure
for general consumers and special population, as highlighted by some national authorities
and EFSA in the EU [37]. The authorities have clearly claimed the need for analytical,
pharmacokinetic, and biological insights into herbal preparations containing BER and
Figure 11. RT-qPCR analysis of BAX (A) and BCL-2 (B) transcripts in HEK293 cells following
treatment with B97% and B85% at 10 or 20
µ
g/mL. Each column represents mean
±
SEM. Data were
analyzed by one-way analysis of variance followed by Dunnet post-hoc: * p< 0.05 and ** p< 0.01 vs.
CTRL (n= 4).
Accumulating evidence has revealed that BER exerts potential pro-apoptotic effects
by modulating BAX/BCL2 (pro-/anti-apoptotic) expression in multiple cancers, including
breast, lung, liver, gastric, colorectal, pancreatic, and ovarian
cancers [12,60,69–74].
Our
results in normal cells counteracted this evidence and highlighted a BAX transcriptional
inhibition.
Overall, our data showed that both B. aristata extracts examined did not affect or
downregulated the transcription of several gene targets involved in the regulation of cell
cycle or with oncogenic functions, suggesting an inhibitory activity of BER in cell cycle,
proliferation, and division processes in normal cells.
4. Discussion
Herbal preparations containing berberine (BER) and other minor protoberberinoids
(PROTBERs) have been extensively used in traditional Asian medicine, in modern conven-
tional phytotherapy, and in food supplements supporting physiological activities. BER has
garnered attention for its purported effects on glucose and lipid metabolism, gastrointesti-

Nutrients 2024,16, 2953 18 of 24
nal health, and even for potential anticancer properties [
11
,
15
–
17
,
75
,
76
]. However, as the
popularity of herbal preparations containing BER and PROTBERs increase, concerns about
their biological safety are emerging, especially regarding the safe exposure for general
consumers and special population, as highlighted by some national authorities and EFSA in
the EU [
37
]. The authorities have clearly claimed the need for analytical, pharmacokinetic,
and biological insights into herbal preparations containing BER and PROTBERs used as
food supplements. This study aimed to investigate these important concerns to provide
valuable knowledge to the authorities, the scientific community, and companies producing
BER-based preparations.
The chemical characterization of B. aristata crude extracts available in the market
(the most used preparations containing BER and PROTBERs used in food supplements)
allowed to confirm the declared content of BER and the identification of jatrorrhizine as the
main secondary PROTBER, and palmatine and berberrubine as other minority PROTBERs
present in the extracts.
These findings showed that herbal preparations containing BER and PROTBERs are
more homogeneous than expected within the EU, being basically referred to as B. aristata dry
extracts; moreover, BER represents more than 90% of total alkaloids in the most common
extracts available in the market.
Pivotal evidence about the pharmacokinetic properties of BER have emerged from In
Vitro assays and In Silico predictions; BER and PROTBERs are only minimally degraded
before intestinal absorption, but being a P-gp substrate and metabolized by cytochrome
P450 (CYP450), with particular regard to the CYP2D6, CYP1A2, and CYP3A4 isoforms, a
low bioavailability is expected in particular for BER [
35
,
52
,
61
]. Computational predictions
were confirmed experimentally for BER, and in part for palmatine, whereas a mainly
structural-homology-based prediction could be obtained for jatrorrhizine and berberrubine.
Besides LDLR, well known to be peculiar target of BER [
77
], all computational tools
confirmed the activity of BER and PROTBERs towards neuroprotective [
55
,
62
,
64
,
78
,
79
] and
antiproliferative targets [59–61,80,81].
These data allowed us to move towards a rational and deeper In Vitro safety as-
sessment of the plausible concentrations of BER and PROTBERs that are able to reach
different organism districts after oral administration. Noticeably, the target prediction
and cell and molecular analysis addressed in this study were focused on human models,
recognizing the limitations and misleading interpretations in extrapolating findings from
animal studies to human safety [
71
]. Therefore, given the homogenous phytochemical
profile available, we evaluated the effects of two representative B. aristata bark dry extracts
on gastric (AGS), intestinal (Caco-2), hepatic (HepG2), and renal (HEK293) cells, following
short- or a long-term exposure (4 and 24 h). The results for both exposures showed a very
limited impact of BER-enriched extracts on cell viability, with an IC
50
always exceeding
100
µ
g/mL in all cell lines examined. We considered cell viability only as a preliminary but
fundamental test to assess the safe concentrations of samples under investigation, allowing
us to quickly move towards the investigation of the interaction effects between BER and
PROTBERs and CYP1A2 -2D6 and -3A4 substrates on hepatic cell viability. Interestingly,
even at 5