The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae)

Abstract

Hybridization and introgression are complex evolutionary mechanisms that can increase species diversity and lead to speciation, but may also lead to species extinction. In this study, we tested the presence and genetic consequences of hybridization between the rare and Ecuadorian endemic O. loxensis van der Werff and the widespread O. infrafoveolata van der Werff (Lauraceae). Phenotypically, some trees are difficult to identify, and we expect that some might in fact be cryptic hybrids. Thus, we developed nuclear microsatellites to assess the existence of hybrids, as well as the patterns of genetic diversity and population structure in allopatric and sympatric populations. The results revealed high levels of genetic diversity, even in the rare O. loxensis, being usually significantly higher in sympatric than in allopatric populations. The Bayesian assignment of individuals into different genetic classes revealed a complex scenario with different hybrid generations occurring in all sympatric populations, but also in allopatric ones. The absence of some backcrossed hybrids suggests the existence of asymmetric gene flow, and that some hybrids might be more fitted than others might. The existence of current and past interspecific gene flow also explains the blurring of species boundaries in these species and could be linked to the high rates of species found in Ocotea.

Full text

Citation: Draper, D.; Riofrío, L.;
Naranjo, C.; Marques, I. The Complex
Genetic Legacy of Hybridization and
Introgression between the Rare
Ocotea loxensis van der Werff and the
Widespread O. infrafoveolata van der
Werff (Lauraceae). Plants 2024,13,
1956. https://doi.org/10.3390/
plants13141956
Academic Editor: Matteo Busconi
Received: 24 June 2024
Revised: 11 July 2024
Accepted: 15 July 2024
Published: 17 July 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
plants
Article
The Complex Genetic Legacy of Hybridization and Introgression
between the Rare Ocotea loxensis van der Werff and the
Widespread O. infrafoveolata van der Werff (Lauraceae)
David Draper 1, * , Lorena Riofrío2, Carlos Naranjo 2and Isabel Marques 3, *
1
Center for Ecology, Evolution, and Environmental Changes & CHANGE—Global Change and Sustainability
Institute, Universidade de Lisboa, 1749-016 Lisboa, Portugal
2Facultad de Ciencias Exactas y Naturales, Universidad Tecnica Particular de Loja (UTPL), Loja 1101608,
Ecuador; mlriofrio@utpl.edu.ec (L.R.); cjnaranjo@utpl.edu.ec (C.N.)
3Forest Research Centre, Associate Laboratory TERRA, School of Agriculture, University of Lisbon,
1349-017 Lisbon, Portugal
*Correspondence: ddmunt@gmail.com (D.D.); isabelmarques@isa.ulisboa.pt (I.M.)
Abstract: Hybridization and introgression are complex evolutionary mechanisms that can increase
species diversity and lead to speciation, but may also lead to species extinction. In this study, we
tested the presence and genetic consequences of hybridization between the rare and Ecuadorian
endemic O. loxensis van der Werff and the widespread O. infrafoveolata van der Werff (Lauraceae).
Phenotypically, some trees are difficult to identify, and we expect that some might in fact be cryptic
hybrids. Thus, we developed nuclear microsatellites to assess the existence of hybrids, as well as the
patterns of genetic diversity and population structure in allopatric and sympatric populations. The
results revealed high levels of genetic diversity, even in the rare O. loxensis, being usually significantly
higher in sympatric than in allopatric populations. The Bayesian assignment of individuals into
different genetic classes revealed a complex scenario with different hybrid generations occurring
in all sympatric populations, but also in allopatric ones. The absence of some backcrossed hybrids
suggests the existence of asymmetric gene flow, and that some hybrids might be more fitted than
others might. The existence of current and past interspecific gene flow also explains the blurring of
species boundaries in these species and could be linked to the high rates of species found in Ocotea.
Keywords: hybridization; Lauraceae; neotropical forests; plant diversity; tropical trees; speciation
1. Introduction
Breeding between species, i.e., interspecific hybridization, has often been coined as a
negative process, leading in the best-case scenario to the blur of discriminant morphological
features, and in the worst case to species extinction [
1
–
4
]. Accumulation of deleterious
alleles, outbreeding depression, gamete waste and genetic swamping are among the detri-
mental consequences of hybridization, especially when involving rare species [
5
,
6
]. Yet,
with the advent of genomic techniques, it became clear that many organisms show evidence
of genetic admixture, and that hybridization could also have positive outcomes with the
potential to foster novel adaptive traits [
7
–
10
]. In fact, despite the negative impacts of
hybridization, a review based on all IUCN Red Data assessments found that it was only
mentioned as a threat in 11 out of the 120,369 species assessed [
11
]. Among many biases, the
idea of hybridization as a threat was found to be quite subjective in most of the assessments
made, since there were no specific guidelines for quantifying the degree of threat deriving
from hybridization [
11
]. In the opposite direction, possible benefits for the conservation of
species deriving from hybridization are usually not considered [
12
,
13
]. Thus, determining
the consequences of hybridization—either positive or negative—is crucial to understand
the impacts that hybridization might have, and to tackle the causes of biodiversity loss.
Plants 2024,13, 1956. https://doi.org/10.3390/plants13141956 https://www.mdpi.com/journal/plants

Plants 2024,13, 1956 2 of 14
Independently of the outcomes, hybridization appears to be a widespread process
in plants, since about 25% of the known species hybridize naturally [
14
]. The number of
reported hybrids is considerably high in well-studied temperate regions [
15
], with many
specific studies detecting the complex consequences of hybridization, introgression, and
hybrid speciation, as well as the challenges beyond hybridization [
13
,
16
–
19
]. Other studies
evaluate the power of the analytic methods to detect the significance of the process itself [
20
].
In contrast, hybridization has received less attention in tropical environments, which has
often led to the idea that the process is rare [21–23].
The Neotropical region is one of the most species-rich areas on Earth, encompassing
many different biomes such as seasonally dry forests, arid zones, high-elevation grasslands,
mountain systems, and extensive rainforests [
24
]. Many factors, such as the wide environ-
mental and climatic heterogeneity, a complex geological history, together with ecological
interactions and human impacts, have shaped the exceptional biodiversity found in the
Neotropical region [
25
,
26
]. What remains less clear, however, is the role that hybridization
might have played in the known Neotropical diversity. In fact, a recent review highlighted
the need for more studies focused on hybridization in the Neotropical region [
27
] to under-
stand the remarkable diversity found, where most species even lack a scientific name [
28
].
This review found only 60 plant studies dealing with hybridization in the Neotropics and
concluded that outcomes due to hybridization had neutral effects in 50% of all cases, 45%
showed positive effects, and only 5% showed negative effects [
27
]. Results of hybridization
in Neotropical plants included rapid diversification events in several Andean groups, e.g.,
Espeletiinae [
29
], Diplostephium [
30
], Polylepis [
31
], Lachemilla [
32
], or Vriesea [
33
], reinforce-
ment of reproductive barriers in Costus [
34
] and Pitcairnia [
35
], and the modification of
morphological features, originating new lineages in Epidendrum [
36
,
37
]. However, out-
comes might also include negative effects such as genetic swamping or the loss of barriers,
which have the potential to reshape species interactions and lead to ecological shifts and
new biotic relationships [
5
,
27
,
37
,
38
]. Thus, understanding the contribution of hybridization
to the biodiversity of the Neotropics, one of the most species-rich areas on Earth, is a funda-
mental issue to understanding patterns of species distribution, richness, and endemism, as
well as the risk of extinction.
In this study, we investigated the presence and degree of interspecific gene flow in two
tropical trees from the Lauraceae family that co-occur in some populations in the South of
Ecuador: Ocotea loxensis van der Werff and O. infrafoveolata van der Werff (Figure 1). Ocotea
loxensis is a rare species, endemic to the South of Ecuador where it has a very restricted
and scattered distribution, while O. infrafoveolata is a widely distributed species occurring
from Colombia to North Peru. Ocotea loxensis can be misidentified as O. infrafoveolata. It
can have smaller leaves (3–6 vs. 6–15 cm), flowers (6–7 vs. 7–10 mm diameter), tepals
(2.5. vs. 3.5 mm), fruits (0.5 vs. 3 cm), and cupules (7–8 vs. 19 mm diameter) than O. in-
frafoveolata, although phenotypically some trees might indeed be hard to identify, especially
in populations where more than one species occurs. Some trees also lack the decurrent
revolute base of the leaves that clearly characterize O. infrafoveolata [
39
]. Given the close
morphological traits and the fact that these species occur in some populations in the South
of Ecuador, we tested the hypothesis that hybridization might occur between them and
that cryptic hybrids might exist in sympatric populations, contributing to the blurring of
morphological traits or genetic erosion. To achieve this aim, we genetically characterized
populations of O. loxensis and O. infrafoveolata developing nuclear microsatellites to (1) un-
derstand the genetic diversity and structure of populations; (2) determine the presence of
genetic admixture between species and if so, (3) the degree of asymmetrical hybridization
events and the possible genetic outcomes. Overall, these findings provide new insights
into the mechanisms and evolution of Ocotea species and contribute to explaining the high
biodiversity of species found in Ecuador.

Plants 2024,13, 1956 3 of 14
Plants 2024, 13, x FOR PEER REVIEW 3 of 15
Figure 1. Topographic map of the study area in Ecuador with elevation displayed. Left: location of
the studied area. Right: detail of the populations sampled, indicating allopatric populations of O.
loxensis (blue circles), allopatric populations of O. infrafoveolata (red rectangles), and sympatric
populations where the two species co-occur (gray triangles). Main roads are indicated by a dashed
line. Main cities are also indicated.
2. Results
2.1. Genetic Diversity of Loci
For each locus, the mean number of alleles varied between 1.385 in Oinf4 and 5.077
in Olox9, while the number of effective alleles varied between 1.201 in Olox3 and 3.732 in
Olox9 (Table 1). Heterozygosity values also varied considerably between loci. For
example, observed heterozygosity varied between 0.160 in Oinf20 and 0.884 in Olox1,
while expected heterozygosity varied between 0.218 in Orot21 and Oinf5. The
Polymorphism Information Content was very high in all loci, varying between 0.782 and
0.905. No null alleles or significant departures from HWE were detected. Pairwise
comparisons between loci showed no significant disequilibrium (p > 0.05), revealing that
all loci were assorted independently at the different loci.
Table 1. Characteristics of the 15 microsatellite markers used to amplify 288 samples of Ocotea
loxensis and O. infrafoveolata. Na: The number of different alleles; Ne: the number of effective alleles;
Ho: observed heterozygosity, He: expected heterozygosity. PIC: Polymorphism Information
Content * indicates microsatellites from [40].
Locus Primers (5′-3′) Ta
(°C)
Repeat
Motif
Size Range
(bp)
Accession
Number Na Ne Ho He PIC
Orot8 F: GTCGGAAACTCTACCAAAGTGA 58 (TC)8 131–140 OP428739 * 3.154 2.635 0.391 0.425 0.782
R: CCATCCCCGTAGAGTCTCG
Orot21 F: CGGGACTATCAGAAGGTACGT 59 (GT)22 180–185 OP428742 * 1.769 1.508 0.385 0.218 0.873
R: TGGGTAAAAGTCTGCTGATCCT
Orot22 F: TCCTCCTACTCCTATCTACGGA 50 (CT)13 148–155 OP428743 * 2.923 2.162 0.490 0.436 0.784
R: ATCGTCTCTGCTATCCCTGC
Olox1 F: TGAGGAGTAGGGAATGTCGG 58 (CTC)4 192–198 PP791920 2.538 2.022 0.884 0.492 0.905
R: GGTACCTCCCGTAAAGTCGA
Olox3 F: GTGGAGGTCTGCTACGCG 60 (TA)10 183–186 PP791921 2.462 1.201 0.065 0.155 0.899
R: AAGTCCCCATAGCGATCCAG
Olox4 F: GCTGCGAGGAGGGATGATC 60 (TTC)8 179–183 PP791922 3.000 2.085 0.326 0.405 0.803
R: CCCGTAGTAGTAGAGTCCCG
Olox8 F: GGTATGAGCGCCCCATCTAG 59 (TATC)6 173–177 PP791923 1.923 1.580 0.186 0.254 0.789
R: TAAACCCGTACATCCGTCCC
Olox9 F: CGGAGTAGAGCAATCCCCTA 59 (GC)15 179–185 PP791924 5.077 3.732 0.873 0.679 0.903
Figure 1. Topographic map of the study area in Ecuador with elevation displayed. Left: location
of the studied area. Right: detail of the populations sampled, indicating allopatric populations of
O. loxensis (blue circles), allopatric populations of O. infrafoveolata (red rectangles), and sympatric
populations where the two species co-occur (gray triangles). Main roads are indicated by a dashed
line. Main cities are also indicated.
2. Results
2.1. Genetic Diversity of Loci
For each locus, the mean number of alleles varied between 1.385 in Oinf4 and 5.077
in Olox9, while the number of effective alleles varied between 1.201 in Olox3 and 3.732
in Olox9 (Table 1). Heterozygosity values also varied considerably between loci. For
example, observed heterozygosity varied between 0.160 in Oinf20 and 0.884 in Olox1, while
expected heterozygosity varied between 0.218 in Orot21 and Oinf5. The Polymorphism
Information Content was very high in all loci, varying between 0.782 and 0.905. No null
alleles or significant departures from HWE were detected. Pairwise comparisons between
loci showed no significant disequilibrium (p> 0.05), revealing that all loci were assorted
independently at the different loci.
Table 1. Characteristics of the 15 microsatellite markers used to amplify 288 samples of Ocotea loxensis
and O. infrafoveolata. Na: The number of different alleles; Ne: the number of effective alleles; Ho:
observed heterozygosity, He: expected heterozygosity. PIC: Polymorphism Information Content *
indicates microsatellites from [40].
Locus Primers (5′-3′)Ta
(◦C)
Repeat
Motif
Size
Range
(bp)
Accession
Number Na Ne Ho He PIC
Orot8 F: GTCGGAAACTCTACCAAAGTGA 58 (TC)8 131–140 OP428739 *
3.154 2.635 0.391 0.425 0.782
R: CCATCCCCGTAGAGTCTCG
Orot21 F: CGGGACTATCAGAAGGTACGT 59 (GT)22 180–185 OP428742 *
1.769 1.508 0.385 0.218 0.873
R: TGGGTAAAAGTCTGCTGATCCT
Orot22 F: TCCTCCTACTCCTATCTACGGA 50 (CT)13 148–155 OP428743 *
2.923 2.162 0.490 0.436 0.784
R: ATCGTCTCTGCTATCCCTGC
Olox1 F: TGAGGAGTAGGGAATGTCGG 58 (CTC)4 192–198 PP791920
2.538 2.022 0.884 0.492 0.905
R: GGTACCTCCCGTAAAGTCGA
Olox3 F: GTGGAGGTCTGCTACGCG 60 (TA)10 183–186 PP791921
2.462 1.201 0.065 0.155 0.899
R: AAGTCCCCATAGCGATCCAG
Olox4 F: GCTGCGAGGAGGGATGATC 60 (TTC)8 179–183 PP791922
3.000 2.085 0.326 0.405 0.803
R: CCCGTAGTAGTAGAGTCCCG
Olox8 F: GGTATGAGCGCCCCATCTAG 59 (TATC)6 173–177 PP791923
1.923 1.580 0.186 0.254 0.789
R: TAAACCCGTACATCCGTCCC

Plants 2024,13, 1956 4 of 14
Table 1. Cont.
Locus Primers (5′-3′)Ta
(◦C)
Repeat
Motif
Size
Range
(bp)
Accession
Number Na Ne Ho He PIC
Olox9 F: CGGAGTAGAGCAATCCCCTA 59 (GC)15 179–185 PP791924
5.077 3.732 0.873 0.679 0.903
R: CTGTATCCCCATTCCCCGAA
Oinf2 F: GACTAGGGATCGCTGGGAC 59 (TATA)10 173–183 PP791925
2.462 2.107 0.477 0.357 0.865
R: GTCCCCTAAATCCCGAGTCC
Oinf4 F: GGATGTCCTGACTCGGGG 59 (AT)14 178–192 PP791926
1.385 1.385 0.385 0.192 0.788
R: CCTCCCCAGCTCGCATATC
Oinf5 F: TCGACGCTCCTATGGATAGC 59 (CTT)8 191–200 PP791927
4.615 3.170 0.736 0.682 0.901
R: TCCTCACCTGTCGCACTG
Oinf6 F: CGAGGGACCCGAGAGAGA 59 (TC)10 163–174 PP791928
2.769 1.936 0.229 0.407 0.782
R: AGCTCTCTCTCCCTAAATCGG
Oinf10 F: GTGACGACGCCCATATAATAGG 58 (GTTT)6 178–185 PP791929
2.769 2.117 0.492 0.463 0.885
R: CGAAAAGGCGCGAGGTATC
Oinf14 F: CGGAGCACTATTTTATTTAGCGT 58 (TA)16 163–174 PP791930
4.692 3.061 0.522 0.538 0.823
R: GGGTCTACGTGTGTGTGCAT
Oinf20 F: GGGGATTATAGGCGAGGGAG 59 (CTA)10 153–163 PP791931
3.538 1.908 0.160 0.384 0.886
R: TCCCTCCCCGTCAATCCTAT
2.2. Genetic Diversity and Differentiation in O. loxensis and O. infrafoveolata
In O. loxensis, the mean number of alleles (Na) varied between 3.733 in LOX-SJB
and 4.260 in LOX-CHA, while in O. infrafoveolata, Na varied between 2.067 in INF-CHA
and 4.488 in INF-TIR (Table 2). However, in both species, Na was significantly higher
in sympatric than in allopatric populations, probably as a consequence of interspecific
gene flow. The same pattern was recorded for the number of effective alleles (Ne) and
Shannon’s information index (I). In O. loxensis, observed heterozygosity (Ho) values varied
from 0.487 to 0.741 while the expected heterozygosity (He) varied between 0.518 and 0.692,
respectively, in LOX-SJB and LOX-VIL (Table 2). Heterozygosity values were higher in
O. infrafoveolata than in O. loxensis. However, they were always higher in sympatric than in
allopatric populations. In O. loxensis, Fis values varied between
−
0.002 (LOX-CHA) and
0.0014 (LOX-SJB), while in O. infrafoveolata they varied between
−
0.848 (INF-CHA) and
−
0.030 (INF-TIR). The likely exchange of gene flow between the two species also affected
the percentage of polymorphic loci, which was very high in the two species, but always
higher in sympatric than in allopatric populations (Table 2).
Pairwise genetic differentiation coefficient values (Fst) among all populations ranged
from 0.008 to 0.550 (p< 0.001; Table 3). The highest Fst values were observed between
O. loxensis and O. infrafoveolata populations, especially when considering the two “pure”
reference populations. These populations also showed a high degree of differentiation from
the remaining O. infrafoveolata populations. Within O. loxensis populations, LOX-SJB also
showed the highest level of differentiation when compared to the other populations.
Table 2. Genetic variation in O. loxensis and O. infrafoveolata populations. Na: The number of
different alleles; Ne: the number of effective alleles; I: Shannon’s information index, Ho: observed
heterozygosity; He: expected heterozygosity; Fis: inbreeding coefficient among individuals within
populations; PPL: the percentage of polymorphic loci (%). Different superscript letters indicate
significant differences between populations based on ANOVA followed by the post hoc Tukey’s test
(p< 0.05). * indicates allopatric populations.
Species
Populations
N Na Ne I Ho He Fis PPL
O. loxensis
LOX-SJB * 20
3.733
±
0.384
a,b
2.518
±
0.265
0.968 ±0.125 b0.487 ±0.089 a0.518 ±0.062 b0.014 ±0.133 d93.33 c
LOX-TIR 21 4.231 ±0.271b
2.696
±
0.224
1.115 ±0.076 c0.719 ±0.077 b0.656 ±0.031 c−0.042 ±0.124 c100.00 a
LOX-CAJ 20 4.210 ±0.279 b
2.658
±
0.206
1.112 ±0.074 c0.700 ±0.076 b0.692 ±0.031 c−0.035 ±0.123 c100.00 d
LOX-VIL 21 4.222 ±0.271 b
2.844
±
0.224
1.149 ±0.074 c0.741 ±0.081 b0.619 ±0.030 c−0.033 ±0.134 c100.00 d
LOX-CHA 22 4.260 ±0.279 b
3.045
±
0.231
1.196 ±0.071 c0.730 ±0.082 b0.643 ±0.029 c−0.002 ±0.132 c100.00 d

Plants 2024,13, 1956 5 of 14
Table 2. Cont.
Species
Populations
N Na Ne I Ho He Fis PPL
O. infrafoveolata
INF-TIR 23 4.467 ±0.376 b
3.143
±
0.268
1.232 ±0.084 c0.749 ±0.081 b0.647 ±0.031 c−0.030 ±0.135 c100.00 d
INF-CAJ 21 4.467 ±0.376 b
3.004
±
0.280
1.177 ±0.093 c0.733 ±0.080 b0.623 ±0.037 c−0.202 ±0.129 b100.00 d
INF-VIL 23 4.333 ±0.361 b
2.994
±
0.226
1.193 ±0.075 c0.781 ±0.089 b0.641 ±0.025 c−0.197 ±0.153 b100.00 d
INF-CHA 21 4.333 ±0.374 b
2.977
±
0.228
1.188 ±0.076 c0.749 ±0.081 b0.639 ±0.025 c−0.199 ±0.143 b100.00 d
INF-NUM * 22 4.267 ±0.396 b
3.097
±
0.250
1.206 ±0.084 c0.730 ±0.081 b0.650 ±0.025 c−0.170 ±0.153 b100.00 d
INF-TAM * 24 4.200 ±0.355 b
3.068
±
0.242
1.188 ±0.076 c0.794 ±0.070 b0.650 ±0.023 c−0.268 ±0.136 b100.00 d
INF-CJS * 25 2.467 ±0.413 a
1.894
±
0.164
0.626 ±0.115 b0.501 ±0.114 a0.296 ±0.065 a−0.798 ±0.069 a73.33 b
INF-QUH * 25 2.067 ±0.396 a
1.653
±
0.177
0.454 ±0.123 a0.525 ±0.131 a0.288 ±0.073 a−0.848 ±0.063 a53.33 a
Table 3. Genetic differentiation coefficient Fst (below diagonal) between O. loxensis and O. infrafoveo-
lata populations. Color degree indicates the level of genetic differentiation. Population codes follow
Figure 1. * indicates allopatric populations.
LOX-
SJB *
LOX-
TIR
LOX-
CAJ
LOX-
VIL
LOX-
CHA
INF-
TIR
INF-
CAJ
INF-
VIL
INF-
CHA
INF-
NUM *
INF-
TAM *
INF-
CJS *
INF-
QUH *
0 LOX-SJB *
0.110 0 LOX-TIR
0.108 0.038 0 LOX-CAJ
0.104 0.028 0.043 0 LOX-VIL
0.113 0.046 0.047 0.030 0 LOX-CHA
0.320 0.321 0.334 0.315 0.290 0 INF-TIR
0.342 0.341 0.355 0.334 0.311 0.012 0 INF-CAJ
0.333 0.337 0.351 0.331 0.306 0.009 0.009 0 INF-VIL
0.363 0.36 0.375 0.353 0.329 0.017 0.013 0.010 0 INF-CHA
0.344 0.337 0.352 0.331 0.310 0.013 0.015 0.011 0.008 0 INF-NUM *
0.357 0.354 0.367 0.349 0.327 0.025 0.024 0.021 0.011 0.017 0 INF-TAM *
0.502 0.514 0.531 0.502 0.482 0.204 0.200 0.204 0.199 0.196 0.211 0 INF-CJS *
0.520 0.534 0.550 0.521 0.501 0.273 0.270 0.277 0.276 0.269 0.289 0.302 0 INF-QUH *
The analysis of molecular variance (AMOVA) between all samples found that the
highest level of variation was found within rather than among populations (Table 4). The
fixation index was 0.101. When the AMOVA was performed considering only O. loxensis
samples, 94% of the total variation was found within populations and the remainder was
found among populations. The fixation index was 0.022. Yet, when only O. infrafoveolata
samples were considered, the level of variation within populations dropped to 41% while
the remaining 59% of variation was explained among populations. The fixation index
was 0.063, much higher than that reported for O. loxensis, suggesting a higher genetic
differentiation in O. infrafoveolata.
Table 4. Analysis of molecular variance (AMOVA) for O. loxensis and O. infrafoveolata, considering all
samples, only O. loxensis populations and only O. infrafoveolata populations.
Populations df SS % Variance
All samples
Among populations 12 1147.090 39%
Within populations 275 956.500 61%
O. loxensis
Among populations 4 3.660 6%
Within populations 104 46.500 94%
O. infrafoveolata
Among populations 7 804.600 41%
Within populations 176 1180.796 59%

Plants 2024,13, 1956 6 of 14
2.3. Genetic Structure of O. loxensis and O. infrafoveolata Populations
The PCoA revealed three differentiated groups where axis 1 separated all individu-
als of O. loxensis from O. infrafoveolata, and axis 2 separated two allopatric populations
of O. infrafoveolata (INF-CJS, INF-QUH) from all remaining populations of this species
(Figure 2). There was also a slight spatial differentiation of the allopatric O. loxensis popula-
tion (LOX-SJB) from the remaining populations of this species. The first two axes of the
PCoA accounted for a high proportion of the total variance (53.26%), with 29.51% explained
by the first axis and 8.70% by the second (Figure 2).
Plants 2024, 13, x FOR PEER REVIEW 6 of 15
Figure 2. Genetic relationships between O. loxensis and O. infrafoveolata samples based on a principal
coordinate analysis (PCoA). Population labels refer to Figure 1. * indicates allopatric populations.
The most likely number of clusters retrieved by STRUCTURE for the entire data set
was K = 3, allocating all individuals of O. loxensis to a single cluster and most O.
infrafoveolata individuals to a second cluster, while the individuals from the allopatric
populations of INF-CJS and INF-QUH were characterized by a third cluster (Figure 3).
Admixture was frequent, especially in the sympatric populations of O. loxensis. By
contrast, evidence of genetic admixture in O. infrafoveolata was very low except in INF-
NUM and INF-TAM populations (Figure 3).
Figure 3. Genetic structure of O. loxensis and O. infrafoveolata samples based on the best assignment
results retrieved by STRUCTURE (K = 3). Each sample is represented by a thin vertical line divided
into K-colored segments that represent the individual’s estimated membership fractions in K
clusters. Population labels refer to Figure 1. * indicates allopatric populations.
2.4. Genetic Composition of Populations
NEWHYBRIDS suggested that 95% of the sampled O. loxensis individuals in the
allopatric population of LOX-SJB were pure while sympatric populations were composed
of pure individuals (76.2%), backcrossed plants towards O. loxensis (19.0%) and F1 hybrids
(4.8%; Figure 4).
Figure 2. Genetic relationships between O. loxensis and O. infrafoveolata samples based on a principal
coordinate analysis (PCoA). Population labels refer to Figure 1. * indicates allopatric populations.
The most likely number of clusters retrieved by STRUCTURE for the entire data set
was K= 3, allocating all individuals of O. loxensis to a single cluster and most O. infrafoveolata
individuals to a second cluster, while the individuals from the allopatric populations of
INF-CJS and INF-QUH were characterized by a third cluster (Figure 3). Admixture was
frequent, especially in the sympatric populations of O. loxensis. By contrast, evidence of
genetic admixture in O. infrafoveolata was very low except in INF-NUM and INF-TAM
populations (Figure 3).
Plants 2024, 13, x FOR PEER REVIEW 6 of 15
Figure 2. Genetic relationships between O. loxensis and O. infrafoveolata samples based on a principal
coordinate analysis (PCoA). Population labels refer to Figure 1. * indicates allopatric populations.
The most likely number of clusters retrieved by STRUCTURE for the entire data set
was K = 3, allocating all individuals of O. loxensis to a single cluster and most O.
infrafoveolata individuals to a second cluster, while the individuals from the allopatric
populations of INF-CJS and INF-QUH were characterized by a third cluster (Figure 3).
Admixture was frequent, especially in the sympatric populations of O. loxensis. By
contrast, evidence of genetic admixture in O. infrafoveolata was very low except in INF-
NUM and INF-TAM populations (Figure 3).
Figure 3. Genetic structure of O. loxensis and O. infrafoveolata samples based on the best assignment
results retrieved by STRUCTURE (K = 3). Each sample is represented by a thin vertical line divided
into K-colored segments that represent the individual’s estimated membership fractions in K
clusters. Population labels refer to Figure 1. * indicates allopatric populations.
2.4. Genetic Composition of Populations
NEWHYBRIDS suggested that 95% of the sampled O. loxensis individuals in the
allopatric population of LOX-SJB were pure while sympatric populations were composed
of pure individuals (76.2%), backcrossed plants towards O. loxensis (19.0%) and F1 hybrids
(4.8%; Figure 4).
Figure 3. Genetic structure of O. loxensis and O. infrafoveolata samples based on the best assignment
results retrieved by STRUCTURE (K = 3). Each sample is represented by a thin vertical line divided
into K-colored segments that represent the individual’s estimated membership fractions in K clusters.
Population labels refer to Figure 1. * indicates allopatric populations.
2.4. Genetic Composition of Populations
NEWHYBRIDS suggested that 95% of the sampled O. loxensis individuals in the
allopatric population of LOX-SJB were pure while sympatric populations were composed

Plants 2024,13, 1956 7 of 14
of pure individuals (76.2%), backcrossed plants towards O. loxensis (19.0%) and F1 hybrids
(4.8%; Figure 4).
In O. infrafoveolata, sympatric populations were mainly composed of pure individuals
and F1 hybrids, although in a minor number (respectively, 90.9% and 9.1%; Figure 4).
However, different results were found in allopatric populations. For instance, INF-NUM
and INF-TAM populations that were characterized by the second K cluster in STRUCTURE
were suggested to be mainly composed of backcrossed individuals towards O. infrafoveolata
(51.0%), pure individuals (44.7%), and F1 hybrid generations (4.3%; Figure 4). The popula-
tions of INF-CJS and INF-QUH populations that were characterized in STRUCTURE by the
third K cluster were suggested to be composed of F2 and late-generation hybrids (Figure 4).
Gene flow (Nm) was estimated to be greater from O. loxensis to O. infrafoveolata (3.230)
than in the opposite direction (1.025).
Plants 2024, 13, x FOR PEER REVIEW 7 of 15
Figure 4. Genetic composition of O. loxensis and O. infrafoveolata samples based on NEWHYBRIDS.
The proportion of color in each bar indicates the assignment probability according to the different
genetic classes (pure parental species, F1, F2, and late-generation hybrids, and the respective back-
crosses). Population labels refer to Figure 1. * indicates allopatric populations.
In O. infrafoveolata, sympatric populations were mainly composed of pure individuals
and F1 hybrids, although in a minor number (respectively, 90.9% and 9.1%; Figure 4).
However, different results were found in allopatric populations. For instance, INF-NUM
and INF-TAM populations that were characterized by the second K cluster in STRUC-
TURE were suggested to be mainly composed of backcrossed individuals towards O. in-
frafoveolata (51.0%), pure individuals (44.7%), and F1 hybrid generations (4.3%; Figure 4).
The populations of INF-CJS and INF-QUH populations that were characterized in
STRUCTURE by the third K cluster were suggested to be composed of F2 and late-gener-
ation hybrids (Figure 4).
Gene flow (Nm) was estimated to be greater from O. loxensis to O. infrafoveolata (3.230)
than in the opposite direction (1.025).
3. Discussion
Comparisons of genetic diversity between rare and widespread related species can
provide valuable information concerning the causes of rarity, and play a critical role in
guiding conservation efforts [41]. Usually, genetic diversity is expected to be lower in a
species that is not widely distributed compared with its widespread congener due to
lower population numbers [42]. This limitation in potential mates could lead to a decrease
in breeding, or breeding between close relatives, which altogether would decrease the
level of genetic diversity [43]. The occurrence of population bolenecks would also cause
a significant reduction in the effective population size, the loss of rare alleles, and hetero-
zygosity in the population [44,45]. Yet, in this study, we found no evidence of lower ge-
netic levels in the rare O. loxensis in comparison with the widespread O. infrafoveolata. For
instance, the number of effective alleles was similar between the two species (Ne = 2.75
and 2.72, respectively in O. loxensis and O. infrafoveolata), as well as the mean heterozy-
gosity values (Ho = 0.67 and 0.69; He = 0.62 and 0.55, respectively in O. loxensis and O.
infrafoveolata; Table 2). Mean inbreeding depression met neutral expectations in O. loxensis
(Fis = −0.01), being positive only in the sympatric population, while negative values were
found in all O. infrafoveolata populations (mean Fis = −0.339), suggesting an excess of het-
erozygotes. The fixation index of O. infrafoveolata was also much higher than the one re-
ported for O. loxensis (0.063 vs. 0.022, respectively) revealing a higher degree of population
differentiation, probably due to genetic structure (Figure 4). In fact, although the parti-
tioning of genetic variation was high within populations in both species, levels were lower
in O. infrafoveolata (41% vs. 94% in O. loxensis; Table 4). The percentage of polymorphic loci
was also very high in both species. Thus, the restricted distribution of O. loxensis, probably
Figure 4. Genetic composition of O. loxensis and O. infrafoveolata samples based on NEWHYBRIDS.
The proportion of color in each bar indicates the assignment probability according to the differ-
ent genetic classes (pure parental species, F1, F2, and late-generation hybrids, and the respective
backcrosses). Population labels refer to Figure 1. * indicates allopatric populations.
3. Discussion
Comparisons of genetic diversity between rare and widespread related species can
provide valuable information concerning the causes of rarity, and play a critical role
in guiding conservation efforts [
41
]. Usually, genetic diversity is expected to be lower
in a species that is not widely distributed compared with its widespread congener due
to lower population numbers [
42
]. This limitation in potential mates could lead to a
decrease in breeding, or breeding between close relatives, which altogether would decrease
the level of genetic diversity [
43
]. The occurrence of population bottlenecks would also
cause a significant reduction in the effective population size, the loss of rare alleles, and
heterozygosity in the population [
44
,
45
]. Yet, in this study, we found no evidence of lower
genetic levels in the rare O. loxensis in comparison with the widespread O. infrafoveolata. For
instance, the number of effective alleles was similar between the two species (Ne = 2.75 and
2.72, respectively in O. loxensis and O. infrafoveolata), as well as the mean heterozygosity
values (Ho = 0.67 and 0.69; He = 0.62 and 0.55, respectively in O. loxensis and O. infrafoveolata;
Table 2). Mean inbreeding depression met neutral expectations in O. loxensis (Fis =
−
0.01),
being positive only in the sympatric population, while negative values were found in all
O. infrafoveolata populations (mean Fis =
−
0.339), suggesting an excess of heterozygotes. The
fixation index of O. infrafoveolata was also much higher than the one reported for O. loxensis
(0.063 vs. 0.022, respectively) revealing a higher degree of population differentiation,
probably due to genetic structure (Figure 4). In fact, although the partitioning of genetic
variation was high within populations in both species, levels were lower in O. infrafoveolata
(41% vs. 94% in O. loxensis; Table 4). The percentage of polymorphic loci was also very high
in both species. Thus, the restricted distribution of O. loxensis, probably due to a historical

Plants 2024,13, 1956 8 of 14
range reduction in the past, showed no effect on genetic diversity when compared with
O. infrafoveolata (at least when considering all populations). These high levels of genetic
diversity could be explained by high outcrossing rates between populations, which would
explain the absence of a spatial structure associated with genetic data (Figures 2and 3).
The diversity values reported here were slightly similar to the ones found in O. rotun-
data, a highly fragmented species known only from five fragmented patches, in the South
Ecuadorian provinces of Loja and Zamora-Chinchipe [
40
]. In that study, the mean heterozy-
gosity was reported as Ho = 0.652 and He = 0.76, despite the high number of alleles found,
i.e., 9.84 alleles [
40
]. Nevertheless, the observed heterozygosity values reported in this study
were higher than the ones found in O. odorifera (Vell.) Rohwer (Ho = 0.63), O. catharinensis
Mez (Ho = 0.57), and especially in O. porosa (Nees & Mart.) Barroso (Ho = 0.52), three
species severely threatened by overexploitation [
46
]. The values reported here were also
higher than the heterozygosity values found in other species within the family Lauraceae,
such as Litsea auriculata S.S. Chien & W.C. Cheng (Ho = 0.33 to 0.50; [
47
] or Cinnamomum
balansae Lecomte (Ho = 0.14 to 0.34; [
48
]). These unexpected results demonstrate that even
small populations may maintain adequate genetic diversity.
In our study, the high levels of genetic diversity can be attributed to the occurrence
of hybridization, since genetic diversity was usually higher in sympatric than allopatric
populations (Table 2, except for INF-NUM and INF-TAM). Heterozygosity values, the num-
ber of effective alleles, Shannon’s information index, and the percentage of polymorphic
loci were higher in sympatric than in allopatric populations, probably as a consequence
of gene flow between the two Ocotea species. Indeed, hybridization can leave signatures
in an organism’s genome that persist over time [
49
,
50
]. Despite the high pairwise genetic
differentiation occurring between the two species (Table 3), our data showed that gene flow
occurs between O. loxensis and O. infrafoveolata. Allopatric populations of O. loxensis were
composed of pure individuals, but also F1s and backcrossed hybrids towards O. loxensis.
F1 hybrids were also detected in sympatric populations of O. infrafoveolata, but also in two
allopatric populations, INF-NUM and INF-TAM, which were mainly composed of back-
crossed hybrids towards O. infrafoveolata (Figure 4). Even the two allopatric populations of
O. infrafoveolata, INF-CJS, and INF-QUH, were suggested to be composed by late hybrids.
This complex evolutionary scenario could explain why O. loxensis can be misidentified as
O. infrafoveolata, due to the complexity of accurate diagnostic traits even in populations that
are not mixed. Hybridization and introgression can blur taxonomy and species delimitation
due to the origin of intermediate morphological traits in hybrid organisms that are often
not easy to distinguish from parental species [19,37,41,51].
The presence of allopatric “mosaic” populations consisting mainly of backcrosses
towards O. infrafoveolata (e.g., INF-NUM, INF-TAM) and late-generation hybrids (e.g., INF-
CJS and INF-QUH), as well as the presence of several F1 hybrids raises several hypotheses.
For instance, a recent and recurrent contact between these species would explain the pres-
ence of F1s, especially because species have overlapping flowering periods [
52
–
54
]. Ocotea
species are often pollinated by generalized insects such as thrips that can promote gene flow
between species [
55
]. In addition, because these insects fly at short ranges, the occurrence
of other biotic agents (and the action of wind) has been postulated to occur in Ocotea due
to the presence of gene flow between distant populations [
40
]. Altogether, this would
explain the existence of the current gene flow between O. loxensis and O. infrafoveolata.
The prevalence of F1 hybrids has also been reported in other studies. For instance, hybrid
zones of Populus alba and P. tremula are mainly composed of F1 hybrids, with genomic
studies indicating selection against recombinant genotypes even under the possibility of
introgression upon secondary contact [
56
]. The presence of F1 hybrids was also predomi-
nant and helped to increase the level of genetic differentiation and heterozygosity in mixed
populations of Ulmus rubra and U. pumila [
57
]. Stable F1 hybrid zones were also reported
in Populus ×jrtyschensis (P. nigra ×P. laurifolia) populations [58].
Although accurate data on the age of Ocotea trees have yet to be obtained, several
individuals in these populations are at least 60 years old according to preliminary estimates

Plants 2024,13, 1956 9 of 14
based on their large stems (unpublished results). Therefore, although recent hybridizations
between the two parental species might continuously produce more F1s, at least some
individuals within populations would have existed long enough for post-F1 generations
and backcrossed hybrids to have also been produced, supporting the genetic results found
in our study. The maintenance of backcrossed hybrids and allopatric populations composed
of late hybrid generations in Ocotea can be explained if potential adaptative traits occur in
these generations, allowing them to persist through time while other less fitted hybrids
disappear [
49
,
50
,
59
]. Our genetic data favor this hypothesis since genetic diversity was
higher in sympatric than in allopatric populations. In fact, genetic diversity in allopatric
populations was only lower in INF-NUM and INF-TAM populations, which were mainly
composed of backcrossed hybrids towards O. infrafoveolata. The fitness of hybrids can
be highly variable throughout generations, and the first few generations of back-crossed
hybrids might indeed be less fitted than other hybrid generations, as reported in other
organisms [
60
]. Finally, the outcomes of hybridization are often environment-dependent,
with some hybrid generations being better fitted than their parents in some conditions, and
less fitted in others (e.g., [
61
]). This is even more important in the context of environmental
changes, where hybrids have the potential to adapt faster than parental populations [62].
We cannot exclude the existence of intrinsic reproductive barriers, preventing the
formation of certain hybrid generations, as reported in other organisms [
63
–
65
]. For in-
stance, in this study, hybrids backcrossed towards O. infrafoveolata do not occur in sympatric
populations of O. infrafoveolata (Figure 4). Pre- and postzygotic barriers, which play an
essential role in the formation of hybrids [
66
–
68
], can explain the asymmetric outcomes
of hybridization in Ocotea. In our study, gene flow (Nm) was estimated to be more likely
to occur from O. loxensis to O. infrafoveolata than in the opposite direction. In accordance,
backcross generations towards O. loxensis were overall lower than towards O. infrafoveolata,
suggesting incompatibility differences in the species acting as a maternal donor for the
formation of hybrids. Truly, this hypothesis should be tested through artificially controlled
experiments. It is also likely that backcross hybridizations towards O. infrafoveolata were
excluded by unfavorable genetic–environmental combinations leading to unfit progeny.
Habitat-mediated selection might act, excluding genotypes that are less fitted [
69
]. The
existence of allopatric populations of O. infrafoveolata composed of late-generation hybrids
reveals an important spatial isolation barrier between hybrids and pure parental species,
contributing to the spread and persistence of these hybrids. Further, if hybridization
contributes to boosting fitness in these species, it might also be linked to the high rate of
species described within the tropical trees of Ocotea, a hypothesis that should be tested in
other species.
4. Materials and Methods
4.1. Species and Population Sampling
A total of 13 populations were sampled in this study targeting 288 adult trees: 104 trees
from 5 populations of O. loxensis, and 184 trees from 8 populations of O. infrafoveolata.
Sampling was concentrated in the South of Ecuador, where all known populations of
O. loxensis occur, but sampling of O. infrafoveolata was also performed in other areas
of occurrence to better understand the patterns of gene flow (Figure 1). Sympatric vs.
allopatric populations were collected using adult trees (Figure 1). In accordance with [
46
],
individuals with a DBH higher than 5 cm were considered adult trees. Leaf samples from
20–25 adult trees were collected in each population, brought to the laboratory, and stored
at −80 ◦C until DNA extraction.
4.2. DNA Extraction and nSSR Development
Total genomic DNA was extracted using the DNeasy Plant Minikit (Qiagen, Hilden,
Germany) according to the manufacturer’s instructions and stored at
−
80
◦
C. Samples
were first genotyped using nuclear simple sequence repeats (SSRs) previously developed
for O. rotundata [
40
]. However, only 3 were polymorphic and amplified well in the species

Plants 2024,13, 1956 10 of 14
studied here (Orot8,Orot21, and Orot22, [
40
]. Due to this small number of markers, we
used the extracted DNA of O. loxensis and O. infrafoveolata to develop new nuclear SSRs,
using two small, inserted libraries digested with HaeII and RsaI and enriched with (CT)n
sequences. Following [
40
], DNA fragments of each species were ligated into a p-GEM-T
Easy Vector, as these were the plasmids transformed using Escherichia coli cells (Promega,
Madison, WI, USA). In total, we obtained 60 clones in O. loxensis (22 from HaeII and 38 from
RsaI) and 41 in O. infrafoveolata (20 from HaeII and 21 from RsaI), from which 48 showed
a positive hybridization signal in O. loxensis and 36 in O. infrafoveolata. Positive clones
were sequenced with the M13 primers under the following conditions: 3 min at 94
◦
C,
followed by 48 cycles at 94
◦
C for 1 min, annealing at 53
◦
C for 1 min, 2 min at 72
◦
C,
and 5 min at 72
◦
C. DNA sequencing was performed in both directions in a 3730 DNA
Analyzer (Applied Biosystems, Foster, CA, USA). In total, 32 and 22 clones of O. loxensis
and O. infrafoveolata, respectively, had readable sequences.
We used Primer 3 [
70
] to develop the new primers, which were first tested using
2 individuals per population of each species. SSR amplifications were performed in 15
µ
L
reactions containing 1.25 U MyTaq DNA polymerase and 1
×
MyTaq Reaction Buffer (Merid-
ian Bioscience, London, UK), 0.4
µ
M Primer F-FAM and R, and 100 ng of genomic DNA
carried and amplified as described in [
40
]. Multiplexed PCR products were genotyped on
an Applied Biosystems 3130XL Genetic Analyzer using 2
µ
L of amplified DNA, 12
µ
L of
Hi-Di formamide, and 0.4
µ
L of GeneScan-600 (LIZ) size standard (Applied Biosystems,
Waltham, MA, USA). Genotyping of microsatellite fragments was conducted on an AB
3500 Genetic Analyzer (Life Technologies Inc., New York, NY, USA). Allele sizes were
determined using GeneMarker 3.1. (Softgenetics, State College, PA, USA). In the end, we
selected 15 new nSSRs (Table 1) that amplified well in the two species, were polymorphic,
and did not show any evidence of null alleles using MICRO-CHECKER v.2.2.3 [
71
]. These
markers were used to sequence the 288 samples included in this study (Table 1). For each
microsatellite locus, genetic diversity was assessed by calculating the mean number of
alleles (Na), the mean number of effective alleles (Ne), the Polymorphism Information
Content (PIC), Shannon’s information index (I), the mean expected heterozygosity (He),
and the mean observed heterozygosity (Ho) using GenAlEx v6.51 [
72
]. We also tested devi-
ation from Hardy–Weinberg Equilibrium (HWE) using the same program. In all analyses,
significant values were corrected for multiple comparisons by Bonferroni correction [73].
4.3. Genetic Diversity and Differentiation between O. loxensis and O. infrafoveolata
The genetic diversity was assessed by calculating the total number of alleles (Ta),
mean number of alleles per locus (Na), Shannon’s information index (I), mean expected
heterozygosity (He), mean observed heterozygosity (Ho), inbreeding coefficient (Fis),
and the percentage of polymorphic loci (PPL) using GenAlEx 6.51 [
72
]. We analyzed
significant differences between populations and species using an ANOVA followed by a
post hoc Tukey’s test (p< 0.05). To calculate genetic differentiation coefficient values (Fst)
between populations we used ARLEQUIN (version 3.5), and also to perform the analysis of
molecular variance (AMOVA) [
74
]. The significance of AMOVA components was analyzed
by 1000 permutations.
4.4. Genetic Structure of Populations
To visualize the degree of the genetic structure of populations, a principal component
analysis (PCoA) based on Nei’s genetic distance was constructed using GenAlEx 6.51 [
72
].
To understand the genetic composition of populations, STRUCTURE v.2.3.4 [
75
] was run
from K = 1 to K = 15 to identify the best K (genetic group) value using all samples from
the two species. Models were run assuming ancestral admixture and correlated allele
frequencies using run lengths of 300,000 steps for each K after a burn-in of 50,000, and using
10 repetitions per K. The optimum K was determined using STRUCTURE HARVESTER [
76
],
which identifies the optimal K based on both the posterior probability of the data for a
given K and the ∆K.

Plants 2024,13, 1956 11 of 14
4.5. Genetic Composition of Hybrids
The genetic composition of hybrids was tested using the Bayesian clustering method
implemented in NEWHYBRIDS version 1.1.beta3 [
77
], which assigns individuals to 6 dif-
ferent classes: 2 pure parental species (O. loxensis and O. infrafoveolata), F1, F2, and late-
generation hybrids, and 2 backcrosses with each parental species [
77
], using allopatric
populations as the reference for the pure individuals (Figure 1). Because these are long-
lived trees and the power of detection of late hybrid generations is limited, we treated
F2s as a single group of late hybrids [
78
]. NEWHYBRIDS analyses were based on the
same computational parameters as those conducted in STRUCTURE using a threshold of
q = 0.90. Similarity coefficients between STRUCTURE and NEWHYBRIDS runs and the
average matrix of ancestry membership was calculated using CLUMPP version 1.1 [
79
]
and visualized using DISTRUCT [
80
]. Finally, to estimate the level of gene flow between
species we used the coalescent-based program IMa2 [
81
], assuming a mutation rate of
10−4substitutions/site/year [82]. The average generation time was set to 15 years.
5. Conclusions and Prospects
This study revealed the existence of past and current gene flow between O. loxensis
and O. infrafoveolata, and a complex scenario ranging from the presence of F1s, backcrossed
hybrids (mostly towards O. infrafoveolata), as well as F2s and late-generation hybrids,
even in allopatric populations where only one species currently occurs. Habitat-mediated
selection as well as the continuous existence of gene flow due to repeated hybridizations
between these species are likely to maintain these hybrids, which seem to have adaptive
potential.
Genetic diversity was usually higher in sympatric than in allopatric populations,
providing a larger pool of raw genetic material for adaptive evolution in Ocotea. However,
we should also take into consideration that long-lived species such as trees may need
centuries to record both positive and negative effects. Thus, despite these high levels of
genetic diversity, the very low number of populations of Ocotea in Ecuador, especially in the
endemic O. loxensis, should be a sign of concern in a habitat that is undergoing increasing
amounts of disturbance. In this context, management plans for the Ecuadorian forests
should concentrate on in and ex situ conservation actions to maintain the genetic diversity
of Ocotea populations and the connectivity between populations.
Author Contributions: Conceptualization, I.M. and D.D.; methodology, I.M. and L.R.; formal analysis,
I.M., D.D., L.R. and C.N.; investigation, I.M., D.D., L.R. and C.N.; project administration: I.M.; funding
acquisition: I.M.; writing—original draft preparation, I.M. and D.D. All authors have read and agreed
to the published version of the manuscript.
Funding: This research received national funds through the FCT—Fundação para a Ciência e
a Tecnologia, I.P., Portugal through the research unit UIDB/00329/2020 (CE3C) and DOI iden-
tifier 10.54499/UIDB/00329/2020, by project reference UIDB/00239/2020 of the Forest Research
Centre and DOI identifier 10.54499/UIDB/00239/2020, and LA/P/0092/2020 of Associate Labora-
tory TERRA, DOI 10.54499/LA/P/0092/2020, and under the Scientific Employment Stimulus—
Individual Call (CEEC Individual)—2021.01107.CEECIND/CP1689/CT0001 and DOI identifier
10.54499/2021.01107.CEECIND/CP1689/CT0001 (IM).
Data Availability Statement: Data will be made available on request.
Conflicts of Interest: The funders had no role in the design of the study; in the collection, analyses,
or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
References
1.
Ellstrand, N.C.; Schierenbeck, K.A. Hybridization as a stimulus for the evolution of invasiveness in plants? Proc. Natl. Acad. Sci.
USA 2006,148, 35–46. [CrossRef]
2. Rhymer, J.M.; Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 1996,27, 83–109. [CrossRef]
3.
Muhlfeld, C.C.; Kalinowski, S.T.; McMahon, T.E.; Taper, M.L.; Painter, S.; Leary, R.F.; Allendorf, F.W. Hybridization rapidly
reduces fitness of a native trout in the wild. Biol. Lett. 2009,5, 328–331. [CrossRef]

Plants 2024,13, 1956 12 of 14
4.
Arnold, M.L.; Ballerini, E.S.; Brothers, A.N. Hybrid fitness, adaptation and evolutionary diversification: Lessons learned from
Louisiana Irises. Heredity 2012,108, 159–166. [CrossRef] [PubMed]
5.
Carney, S.E.; Gardner, K.A.; Rieseberg, L.H. Evolutionary changes over the fifty-year history of a hybrid population of sunflowers
(Helianthus). Evolution 2000,54, 462–474. [CrossRef] [PubMed]
6. Adavoudi, R.; Pilot, M. Consequences of hybridization in mammals: A systematic review. Genes 2022,13, 50. [CrossRef]
7.
Tomasello, S.; Oberprieler, C. Reticulate Evolution in the Western Mediterranean Mountain Ranges: The Case of the Leucanthemop-
sis Polyploid Complex. Front. Plant Sci. 2022,13, 842842. [CrossRef]
8.
López de Heredia, U.; Mora-Márquez, F.; Goicoechea, P.G.; Guillardín-Calvo, L.; Simeone, M.C.; Soto, A. ddRAD Sequencing-
Based Identification of Genomic Boundaries and Permeability in Quercus ilex and Q. suber Hybrids. Front. Plant Sci. 2020,11, 1330.
[CrossRef]
9.
Pinheiro, F.; de Melo e Gouveia, T.M.Z.; Cozzolino, S.; Cafasso, D.; Cardoso-Gustavson, P.; Suzuki, R.M.; Palma-Silva, C. Strong
but permeable barriers to gene exchange between sister species of Epidendrum.Am. J. Bot. 2016,103, 1472–1482. [CrossRef]
10.
Isabel, N.; Holliday, J.A.; Aitken, S.N. Forest genomics: Advancing climate adaptation, forest health, productivity, and conserva-
tion. Evol. Appl. 2020,13, 3–10. [CrossRef]
11.
Draper, D.; Laguna, E.; Marques, I. Demystifying Negative Connotations of Hybridization for Less Biased Conservation Policies.
Front. Ecol. Evol. 2021,9, 268. [CrossRef]
12.
Chan, W.Y.; Hoffmann, A.A.; van Oppen, M.J.H. Hybridization as a conservation management tool. Conserv. Lett. 2019,12, e12652.
[CrossRef]
13.
Cozzolino, S.; Nardella, A.M.; Impagliazzo, S.; Widmer, A.; Lexer, C. Hybridization and conservation of Mediterranean orchids:
Should we protect the orchid hybrids or the orchid hybrid zones? Biol. Conserv. 2006,129, 14–23. [CrossRef]
14. Mallet, J. Hybrid speciation. Nature 2007,446, 279–283. [CrossRef]
15.
Marques, I.; Loureiro, J.; Draper, D.; Castro, M.; Castro, S. How much do we know about the frequency of hybridisation and
polyploidy in the Mediterranean region? Plant Biol. 2018,20, 21–37. [CrossRef]
16.
Abbott, R.J.; Barton, N.H.; Good, J.M. Genomics of hybridization and its evolutionary consequences. Mol. Ecol. 2016,25,
2325–2332. [CrossRef] [PubMed]
17.
Marques, I.; Feliner, G.N.; Draper Munt, D.; Martins-Loução, M.A.; Aguilar, J.F. Unraveling cryptic reticulate relationships and
the origin of orphan hybrid disjunct populations in Narcissus.Evolution 2010,64, 2353–2368. [PubMed]
18.
Nieto Feliner, G.; Álvarez, I.; Fuertes-Aguilar, J.; Heuertz, M.; Marques, I.; Moharrek, F.; Piñeiro, R.; Riina, R.; Rosselló, J.A.; Soltis,
P.S.; et al. Is homoploid hybrid speciation that rare? An empiricist’s view. Heredity 2017,118, 513–516. [CrossRef] [PubMed]
19.
Beirinckx, L.; Vanschoenwinkel, B.; Triest, L. Hidden Hybridization and Habitat Differentiation in a Mediterranean Macrophyte,
the Euryhaline Genus Ruppia.Front. Plant Sci. 2020,11, 516856. [CrossRef]
20.
Payseur, B.A.; Rieseberg, L.H. A genomic perspective on hybridization and speciation. Mol. Ecol. 2016,25, 2337–2360. [CrossRef]
21. Ehrendorfer, F. Evolutionary patterns and strategies in seed plants. Taxon 1970,19, 185–195. [CrossRef]
22.
Gentry, A.H. Neotropical floristic diversity: Phytogeographical connections between Central and South America, Pleistocene
climatic fluctuations, or an accident of the Andean orogeny? Ann. Mo. Bot. Gard. 1982,69, 557–593. [CrossRef]
23.
Pinheiro, F.; De Barros, F.; Palma-Silva, C.; Meyer, D.; Fay, M.F.; Suzuki, R.M.; Lexer, C.; Cozzolino, S. Hybridization and
introgression across different ploidy levels in the Neotropical orchids Epidendrum fulgens and E. puniceoluteum (Orchidaceae). Mol.
Ecol. 2010,19, 3981–3994. [CrossRef] [PubMed]
24. Antonelli, A. The rise and fall of Neotropical biodiversity. Bot. J. Linn. Soc. 2022,199, 8–24. [CrossRef]
25. Rull, V. Neotropical biodiversity: Timing and potential drivers. Trends Ecol. Evol. 2011,26, 508–513. [CrossRef]
26. Antonelli, A.; Sanmartín, I. Why are there so many plant species in the Neotropics? Taxon 2011,60, 403–414. [CrossRef]
27.
Schley, R.J.; Twyford, A.D.; Pennington, R.T. Hybridization: A “double-edged sword” for Neotropical plant diversity. Bot. J. Linn.
Soc. 2022,199, 331–356. [CrossRef]
28.
Dick, C.W.; Kress, W.J. Dissecting tropical plant diversity with forest plots and a molecular toolkit. Bioscience 2009,59, 745–755.
[CrossRef]
29. Pouchon, C.; Fernández, A.; Nassar, J.M.; Boyer, F.; Aubert, S.; Lavergne, S.; Mavárez, J. Phylogenomic analysis of the explosive
adaptive radiation of the Espeletia complex (Asteraceae) in the tropical Andes. Syst. Biol. 2018,67, 1041–1060. [CrossRef]
30.
Vargas, O.M.; Ortiz, E.M.; Simpson, B.B. Conflicting phylogenomic signals reveal a pattern of reticulate evolution in a recent
high-Andean diversification (Asteraceae: Astereae: Diplostephium). New Phytol. 2017,214, 1736–1750. [CrossRef]
31.
Schmidt-Lebuhn, A.N.; Kessler, M.; Kumar, M. Promiscuity in the Andes: Species relationships in Polylepis (Rosaceae, Sanguisor-
beae) based on AFLP and morphology. Syst. Bot. 2006,31, 547–559. [CrossRef]
32.
Morales-Briones, D.F.; Liston, A.; Tank, D.C. Phylogenomic analyses reveal a deep history of hybridization and polyploidy in the
Neotropical genus Lachemilla (Rosaceae). New Phytol. 2018,218, 1668–1684. [CrossRef] [PubMed]
33.
Loiseau, O.; Mota Machado, T.; Paris, M.; Koubínová, D.; Dexter, K.G.; Versieux, L.M.; Lexer, C.; Salamin, N. Genome Skimming
Reveals Widespread Hybridization in a Neotropical Flowering Plant Radiation. Front. Ecol. Evol. 2021,9, 322. [CrossRef]
34.
Kay, K.M.; Schemske, D.W. Natural selection reinforces speciation in a radiation of neotropical rainforest plants. Evolution 2008,
62, 2628–2642. [CrossRef] [PubMed]
35.
Mota, M.R.; Pinheiro, F.; Leal, B.S.S.; Wendt, T.; Palma-Silva, C. The role of hybridization and introgression in maintaining species
integrity and cohesion in naturally isolated inselberg bromeliad populations. Plant Biol. 2019,21, 122–132. [CrossRef] [PubMed]

Plants 2024,13, 1956 13 of 14
36.
Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Multiple hybridization events, polyploidy and low postmating isolation entangle
the evolution of neotropical species of Epidendrum (Orchidaceae). BMC Evol. Biol. 2014,14, 20. [CrossRef] [PubMed]
37.
Vega, Y.; Marques, I.; Castro, S.; Loureiro, J. Outcomes of extensive hybridization and introgression in Epidendrum (orchidaceae):
Can we rely on species boundaries? PLoS ONE 2013,8, 80662. [CrossRef]
38.
Mesgarana, M.B.; Lewisb, M.A.; Adesc, P.K.; Donohued, K.; Ohadia, S.; Lia, C.; Cousensa, R.D. Hybridization can facilitate species
invasions, even without enhancing local adaptation. Proc. Natl. Acad. Sci. USA 2016,113, 10210–10214. [CrossRef] [PubMed]
39.
Van Der Werff, H. Studies in andean Ocotea (Lauraceae) II. Species with hermaphrodite flowers and densely pubescent lower leaf
surfaces, occurring above 1000 meters in altitude. Novon 2013,22, 336–370. [CrossRef]
40.
Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Early Signs of the Effects of Forest Fragmentation on the Genetic Diversity and
Structure of the Threatened Ecuadorian Tree Ocotea rotundata (Lauraceae). Forests 2022,13, 1940. [CrossRef]
41.
Sobierajska, K.; Wachowiak, W.; Zaborowska, J.; Łabiszak, B.; Wójkiewicz, B.; S ˛ekiewicz, M.; Jasi ´nska, A.K.; S˛ekiewicz, K.;
Boraty ´nska, K.; Marcysiak, K.; et al. Genetic Consequences of Hybridization in Relict Isolated Trees Pinus sylvestris and the Pinus
mugo Complex. Forests 2020,11, 1086. [CrossRef]
42.
Boyd, J.N.; Anderson, J.T.; Brzyski, J.; Baskauf, C.; Cruse-Sanders, J. Eco-evolutionary causes and consequences of rarity in plants:
A meta-analysis. New Phytol. 2022,235, 1272–1286. [CrossRef] [PubMed]
43.
Broadhurst, L.; Coates, D. Genetic diversity within and divergence between rare and geographically widespread taxa of the
Acacia acuminata Benth. (Mimosaceae) complex. Heredity 2002,88, 250–257. [CrossRef] [PubMed]
44.
Ellstrand, N.C.; Elam, D.R. Population genetic consequences of small population size: Implications for plant conservation. Annu.
Rev. Ecol. Syst. 1993,24, 217–242. [CrossRef]
45.
Swatdipong, A.; Primmer, C.R.; Vasemägi, A. Historical and recent genetic bottlenecks in European grayling, Thymallus thymallus.
Conserv. Genet. 2010,11, 279–292. [CrossRef]
46.
Martins, E.M.; Lamont, R.W.; Martinelli, G.; Lira-Medeiros, C.F.; Quinet, A.; Shapcott, A. Genetic diversity and population genetic
structure in three threatened Ocotea species (Lauraceae) from Brazil’s Atlantic Rainforest and implications for their conservation.
Conserv. Genet. 2015,16, 1–14. [CrossRef]
47.
Geng, Q.; Sun, L.; Zhang, P.; Wang, Z.; Qiu, Y.; Liu, H.; Lian, C. Understanding population structure and historical demography
of Litsea auriculata (Lauraceae), an endangered species in east China. Sci. Rep. 2017,7, 17343. [CrossRef] [PubMed]
48.
Cui, B.; Vu, D.D.; Vu, D.G.; Bui, T.T.X.; Rahman, S.U.; Pham, M.P.; Nguyen, M.T.; Nguyen, V.S.; Shah, S.N.M.; Tran, V.H. Genetic
diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites. Open Life Sci. 2022,17, 323–332.
[CrossRef] [PubMed]
49.
Rieseberg, L.H.; Archer, M.A.; Wayne, R.K. Transgressive segregation, adaptation and speciation. Heredity 1999,83, 363–372.
[CrossRef] [PubMed]
50.
Abbott, R.J. Plant speciation across environmental gradients and the occurrence and nature of hybrid zones. J. Syst. Evol. 2017,55,
238–258. [CrossRef]
51.
Baiakhmetov, E.; Ryzhakova, D.; Gudkova, P.D.; Nobis, M. Evidence for extensive hybridisation and past introgression events in
feather grasses using genome-wide SNP genotyping. BMC Plant Biol. 2021,21, 505. [CrossRef]
52.
Kenzo, T.; Kamiya, K.; Ngo, K.M.; Faizu, N.; Lum, S.K.Y.; Igarashi, S.; Norichika, Y.; Ichie, T. Overlapping flowering periods
among Shorea species and high growth performance of hybrid seedlings promote hybridization and introgression in a tropical
rainforest of Singapore. For. Ecol. Manag. 2019,435, 38–44. [CrossRef]
53.
Dell’Olivo, A.; Hoballah, M.E.; Gübitz, T.; Kuhlemeier, C. Isolation barriers between petunia axillaris and petunia integrifolia
(solanaceae). Evolution 2011,65, 1979–1991. [CrossRef] [PubMed]
54.
Marques, I.; Rosselló-Graell, A.; Draper, D.; Iriondo, J.M. Pollination patterns limit hybridization between two sympatric species
of Narcissus (Amaryllidaceae). Am. J. Bot. 2007,94, 1352–1359. [CrossRef]
55.
Danieli-Silva, A.; Varassin, I. Breeding system and thrips (Thysanoptera) pollination in the endangered tree Ocotea porosa
(Lauraceae): Implications for conservation. Plant Species Biol. 2013,28, 31–40. [CrossRef]
56.
Christe, C.; Stölting, K.N.; Bresadola, L.; Fussi, B.; Heinze, B.; Wegmann, D.; Lexer, C. Selection against recombinant hybrids
maintains reproductive isolation in hybridizing Populus species despite F1 fertility and recurrent gene flow. Mol. Ecol. 2016,25,
2482–2498. [CrossRef]
57.
Zalapa, J.E.; Brunet, J.; Guries, R.P. The extent of hybridization and its impact on the genetic diversity and population structure of
an invasive tree, Ulmus pumila (Ulmaceae). Evol. Appl. 2010,3, 157. [CrossRef]
58.
Jiang, D.; Feng, J.; Dong, M.; Wu, G.; Mao, K.; Liu, J. Genetic origin and composition of a natural hybrid poplar Populus
×
jr-
tyschensis from two distantly related species. BMC Plant Biol. 2016,16, 89. [CrossRef] [PubMed]
59.
Gao, Y.; Harris, A.J.; Li, H.; Gao, X. Hybrid Speciation and Introgression Both Underlie the Genetic Structures and Evolutionary
Relationships of Three Morphologically Distinct Species of Lilium (Liliaceae) Forming a Hybrid Zone Along an Elevational
Gradient. Front. Plant Sci. 2020,11, 576407. [CrossRef]
60.
Hauser, T.P.; Jørgensen, R.B.; østergård, H. Fitness of backcross and F2 hybrids between weedy Brassica rapa and oilseed rape
(B. napus). Heredity 1998,81, 436–443. [CrossRef]
61.
Wang, H.; Mcarthur, E.D.; Sanderson, S.C.; Graham, J.H.; Freeman, D.C. Narrow hybrid zone between two subspecies of big
sagebrush (Artemisia tridentata: Asteraceae). IV. Reciprocal transplant experiments. Evolution 1997,51, 95–102. [CrossRef]
[PubMed]

Plants 2024,13, 1956 14 of 14
62.
Kulmuni, J.; Wiley, B.; Otto, S.P. On the fast track: Hybrids adapt more rapidly than parental populations in a novel environment.
Evol. Lett. 2024,8, 128–136. [CrossRef] [PubMed]
63.
Zhang, W.; Declerck, S.A.J. Intrinsic postzygotic barriers constrain cross-fertilisation between two hybridising sibling rotifer
species of the Brachionus calyciflorus species complex. Freshw. Biol. 2022,67, 240–249. [CrossRef]
64.
Marques, I.; Nieto Feliner, G.; Martins-Loução, M.A.; Fuertes Aguilar, J. Fitness in Narcissus hybrids: Low fertility is overcome by
early hybrid vigour, absence of exogenous selection and high bulb propagation. J. Ecol. 2011,99, 1508–1519. [CrossRef]
65.
Silva-Pereira, V.; De Camargo Smidt, E.; Leite Borba, E. Isolation mechanisms between two sympatric Sophronitis (Orchidaceae)
species endemic to Northeastern Brazil. Plant Syst. Evol. 2007,269, 171–182. [CrossRef]
66.
Johnson, M.A.; Price, D.K.; Price, J.P.; Stacy, E.A. Postzygotic barriers isolate sympatric species of Cyrtandra (Gesneriaceae) in
Hawaiian montane forest understories. Am. J. Bot. 2015,102, 1870–1882. [CrossRef] [PubMed]
67.
Broyles, S.B. Hybrid bridges to gene flow: A case study in milkweeds (Asclepias). Evolution 2002,56, 1943–1953. [CrossRef]
[PubMed]
68.
Jacquemyn, H.; Brys, R.; Honnay, O.; Roldán-Ruiz, I. Asymmetric gene introgression in two closely related Orchis species:
Evidence from morphometric and genetic analyses. BMC Evol. Biol. 2012,12, 178. [CrossRef]
69.
Milne, R.I.; Terzioglu, S.; Abbott, R.J. A hybrid zone dominated by fertile F1s: Maintenance of species barriers in Rhododendron.
Mol. Ecol. 2003,12, 2719–2729. [CrossRef]
70.
Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new capabilities and interfaces.
Nucleic Acids Res. 2012,40, e115. [CrossRef]
71.
Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting
genotyping errors in microsatellite data. Mol. Ecol. Notes 2004,4, 535–538. [CrossRef]
72.
Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update.
Bioinform. Appl. 2012,28, 2537–2539. [CrossRef] [PubMed]
73. Rice, W.R. Analyzing Tables of Statistical Tests. Evolution 1989,43, 223. [CrossRef] [PubMed]
74.
Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under
Linux and Windows. Mol. Ecol. Resour. 2010,10, 564–567. [CrossRef] [PubMed]
75.
Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000,155,
945–959. [CrossRef] [PubMed]
76.
Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and
implementing the Evanno method. Conserv. Genet. Resour. 2012,4, 359–361. [CrossRef]
77.
Anderson, E.C.; Thompson, E.A. A model-based method for identifying species hybrids using multilocus genetic data. Genetics
2002,160, 1217–1229. [CrossRef] [PubMed]
78.
Burgarella, C.; Lorenzo, Z.; Jabbour-Zahab, R.; Lumaret, R.; Guichoux, E.; Petit, R.J.; Soto, Á.; Gil, L. Detection of hybrids in
nature: Application to oaks (Quercus suber and Q. ilex). Heredity 2009,102, 442–452. [CrossRef] [PubMed]
79.
Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and
multimodality in analysis of population structure. Bioinformatics 2007,23, 1801–1806. [CrossRef] [PubMed]
80.
Rosenberg, N.A. DISTRUCT: A program for the graphical display of population structure. Mol. Ecol. Notes 2004,4, 137–138.
[CrossRef]
81.
Nielsen, R.; Wakeley, J. Distinguishing migration from isolation: A Markov chain Monte Carlo approach. Genetics 2001,158, 885.
[CrossRef] [PubMed]
82.
Petit, R.J.; Hampe, A. Some evolutionary consequences of being a tree. Annu. Rev. Ecol. Evol. Syst. 2006,37, 187–214. [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.