Andrographolide sulfonate downregulation of TLR3-TRIF and amelioration of airway inflammation caused by respiratory syncytial virus infection

Abstract

Background
Andrographolide sulfonate (Andro-S), a traditional Chinese medicine, is commonly used to treat pediatric respiratory tract infections in China. However, its therapeutic effects in infections caused by respiratory syncytial virus (RSV) have not been reported. We thus aimed to investigate the therapeutic effects of Andro-S using a mouse model of RSV infection-induced airway inflammation.

Methods
Immunocompromised (cyclophosphamide-treated) BALB/c mice were intranasally infected with RSV and treated with intranasal or intraperitoneal Andro-S once daily for five consecutive days, starting on the day of infection. Histopathological changes in the lung were evaluated using hematoxylin and eosin staining. Total inflammatory cell counts and macrophage, lymphocyte, neutrophil, and eosinophil counts in the bronchoalveolar lavage fluid (BALF) were microscopically determined. Interferon-γ (IFN-γ) levels in the BALF were detected using enzyme-linked immunosorbent assay (ELISA). The messenger RNA levels of RSV nucleoprotein (N) and Toll-like receptors (TLRs) 1–9 in lung tissues were determined with quantitative real-time polymerase chain reaction (qRT-PCR). The protein levels of RSV N, RSV fusion protein (F), TLR2, TLR3, and TIR domain-containing adapter-inducing interferon-β (TRIF) were detected via Western blot analysis.

Results
RSV infection caused lung inflammation, manifesting as bronchiolitis, alveolitis, and perivascular inflammation; increased the number of inflammatory cells; and elevated IFN-γ levels in the BALF. Lung inflammation was positively correlated with pulmonary RSV N levels in infected mice. Intranasal Andro-S significantly downregulated RSV N, RSV F, TLR3, and TRIF protein expression in the lung and ameliorated lung inflammation in infected animals. However, intraperitoneal Andro-S showed no effects on lung inflammation caused by RSV infection.

Conclusions
Intranasal Andro-S inhibits RSV replication and ameliorates RSV infection-induced lung inflammation by downregulating TLR3 and TRIF. Therefore, intranasal administration may be a suitable drug delivery method for treating RSV infection.

Full text

© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
Original Article
Andrographolide sulfonate downregulation of TLR3-TRIF and
amelioration of airway inflammation caused by respiratory
syncytial virus infection
Na Zhou1,2, Siyi Che2, Jiao Liu2, Zhenghong Jiang2, Luo Ren2,3, Yin Liu4, Enmei Liu2,3, Jun Xie2,3
1Department of Pediatrics, Bishan Hospital of Chongqing Medical University, Bishan County, Chongqing, China; 2Pediatric Research Institute,
Children’s Hospital of Chongqing Medical University, Chongqing Key Laboratory of Child Rare Diseases in Infection and Immunity, Chongqing,
China; 3Department of Respiratory Medicine, Children’s Hospital of Chongqing Medical University, National Clinical Research Center for Child
Health and Disorders, Ministry of Education Key Laboratory of Child Development and Disorders, Chongqing Key Laboratory of Pediatrics,
Chongqing, China; 4State Key Laboratory of Innovative Natural Medicine and TCM Injections, Jiangxi Qingfeng Pharmaceutical Co. Ltd.,
Ganzhou, China
Contributions: (I) Conception and design: J Xie, N Zhou; (II) Administrative support: L Ren; (III) Provision of study materials or patients: J Liu, Y
Liu; (IV) Collection and assembly of data: Z Jiang; (V) Data analysis and interpretation: N Zhou, S Che; (VI) Manuscript writing: All authors; (VII)
Final approval of manuscript: All authors.
Correspondence to: Jun Xie, MD. Pediatric Research Institute, Children’s Hospital of Chongqing Medical University, Chongqing Key Laboratory
of Child Rare Diseases in Infection and Immunity, Chongqing, China; Department of Respiratory Medicine, Children’s Hospital of Chongqing
Medical University, National Clinical Research Center for Child Health and Disorders, Ministry of Education Key Laboratory of Child
Development and Disorders, Chongqing Key Laboratory of Pediatrics, 136 Zhongshan Second Road, Yuzhong District, Chongqing 400014, China.
Email: cyxiejun@126.com.
Background: Andrographolide sulfonate (Andro-S), a traditional Chinese medicine, is commonly used to
treat pediatric respiratory tract infections in China. However, its therapeutic effects in infections caused by
respiratory syncytial virus (RSV) have not been reported. We thus aimed to investigate the therapeutic effects
of Andro-S using a mouse model of RSV infection-induced airway inammation.
Methods: Immunocompromised (cyclophosphamide-treated) BALB/c mice were intranasally infected with
RSV and treated with intranasal or intraperitoneal Andro-S once daily for ve consecutive days, starting
on the day of infection. Histopathological changes in the lung were evaluated using hematoxylin and eosin
staining. Total inammatory cell counts and macrophage, lymphocyte, neutrophil, and eosinophil counts in
the bronchoalveolar lavage uid (BALF) were microscopically determined. Interferon-γ (IFN-γ) levels in
the BALF were detected using enzyme-linked immunosorbent assay (ELISA). The messenger RNA levels of
RSV nucleoprotein (N) and Toll-like receptors (TLRs) 1–9 in lung tissues were determined with quantitative
real-time polymerase chain reaction (qRT-PCR). The protein levels of RSV N, RSV fusion protein (F),
TLR2, TLR3, and TIR domain-containing adapter-inducing interferon-β (TRIF) were detected via Western
blot analysis.
Results: RSV infection caused lung inammation, manifesting as bronchiolitis, alveolitis, and perivascular
inflammation; increased the number of inflammatory cells; and elevated IFN-γ levels in the BALF.
Lung inflammation was positively correlated with pulmonary RSV N levels in infected mice. Intranasal
Andro-S signicantly downregulated RSV N, RSV F, TLR3, and TRIF protein expression in the lung and
ameliorated lung inammation in infected animals. However, intraperitoneal Andro-S showed no effects on
lung inammation caused by RSV infection.
Conclusions: Intranasal Andro-S inhibits RSV replication and ameliorates RSV infection-induced lung
inammation by downregulating TLR3 and TRIF. Therefore, intranasal administration may be a suitable
drug delivery method for treating RSV infection.
12

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
2
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
Introduction
Andrographolide sulfonate (Andro-S), a sulfonation
derivative of andrographolide, is a major active ingredient of
Xiyanping injection, a traditional Chinese medicine (TCM)
commonly used to treat upper respiratory tract infections
and pneumonia in China. Andrographolide is a biologically
active diterpene isolated from Andrographis, an herbaceous
plant native to South Asian countries. Sulfonation improves
the water solubility and bioavailability of a compound (1).
Andro-S exhibits multiple biological functions, including
antioxidant, anti-inflammatory, and antineoplastic
properties (2-5). Our previous study demonstrated that
andrographolide exerts anti-respiratory syncytial virus
(RSV) activity by upregulating HO-1 expression in human
airway epithelial cells (6).
RSV is a common virus that infects children worldwide.
It often causes acute lower respiratory tract infection (ALRI)
in young children, which can progress to pneumonia,
respiratory failure, and even death. In 2019 alone, there were
2.5–4.1 million RSV infection-associated hospitalizations
in children across 58 countries (7), and about 45% of
hospitalizations and in-hospital deaths associated with RSV
infection occur in infants younger than six months (8). After
pneumococcal pneumonia and Haemophilus inuenzae, RSV
is the third-most common cause of childhood death from
ALRI (9). The prophylactic administration of monoclonal
antibodies, including palivizumab and nirsevimab, has
the potential to mitigate RSV infection among high-
risk infants. Nevertheless, this preventive measure offers
only transient protection, and its efficacy hinges on the
timeliness of intervention in relation to the seasonal RSV
surge (10). While the antiviral medication ribavirin can be
utilized to treat RSV infection in pediatric patients, the
management of severe cases predominantly revolves around
supportive measures like oxygen therapy and respiratory
support (11,12). Consequently, novel treatment strategies
are urgently needed to reduce RSV-associated ALRI and
mortality.
Toll-like receptors (TLRs) are key regulators of the
immune response to RSV infection (11,13). In particular,
TLR3-mediated interferon-γ (IFN-γ) response contributes
to pulmonary inflammation during RSV infection (14).
In this study, we evaluated the effects of Andro-S
administered via intranasal and intraperitoneal routes on
the pulmonary inflammation caused by RSV infection in
immunocompromised mice. The underlying mechanisms
associated with TLR3 and IFN-γ were also investigated.
We present this article in accordance with the ARRIVE
reporting checklist (available at https://jtd.amegroups.com/
article/view/10.21037/jtd-24-752/rc).
Methods
Animals
Female BALB/c mice (6–8 weeks old) were purchased
from the Laboratory Animal Center at Chongqing
Medical University (Chongqing, China) (No. SCXK[Yu]
2012-0001). The mice were maintained in separate cages
in a specific-pathogen-free (SPF) facility as described
previously (15). To generate immunocompromised
Highlight box
Key ndings
• Intranasal administration of andrographolide sulfonate (Andro-S)
reduces respiratory syncytial virus (RSV) replication and RSV
infection-induced substance inammation via TLR3-TRIF.
What is known and what is new?
• Intraperitoneal injection of Andro-S did not suppress RSV-induced
inflammation, whereas intranasal administration reduced the
total number of inammatory cells in the bronchoalveolar lavage
uid (BALF) and pathological damage in the lungs. Furthermore,
interferon-γ production was signicantly decreased in the BALF, as
were the N gene and protein expression levels.
• Andro-S aerosol inhalation may be a better treatment for viral
respiratory diseases.
What is the implication, and what should change now?
• Andro-S may help elucidate the underlying pathology of RSV
infection and suggest potential therapeutic targets for the drug
development and prevention of RSV-induced diseases.
Keywords: Andrographolide sulfonate (Andro-S); respiratory syncytial virus (RSV); lung inammation; TLR3;
TIR domain-containing adapter-inducing interferon-β (TRIF)
Submitted May 08, 2024. Accepted for publication Jun 14, 2024. Published online Jul 09, 2024.
doi: 10.21037/jtd-24-752
View this article at: https://dx.doi.org/10.21037/jtd-24-752

Journal of Thoracic Disease, 2024 3
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
mice, the animals received a single dose of 100 mg/kg of
cyclophosphamide (CYP) via intraperitoneal injection. The
mice were randomly assigned to Control group, Andro-S
group, RSV group, RSV + Andro-S group with each group
consisting of more than four mice. The study protocol
was approved by the Ethics Committee of Chongqing
Medical University (No. SYXK[Yu] 2012-0001). All
animal experiments were in compliance with institutional
guidelines for the care and use of animals. A protocol was
prepared before the study without registration.
RSV production and infection
The RSV A2 strain was obtained from the Laboratory of
Medical Virology at Capital Medical University (Beijing,
China). The virus was produced in HEp-2 cells and puried
as described previously (16). For RSV infection, the
immunocompromised animals received 100 μL of intranasal
RSV at a total concentration of 1.0×108 PFU/mL five
days after CYP treatment (17). The control group animals
received 100 μL of PBS.
Andro-S treatment
Mice received intranasal (0.5 mg in 20 μL of normal
saline) or intraperitoneal (10 mg/kg in 100 μL of normal
saline) Andro-S (Xiyanping Injection, Jiangxi Qingfeng
Pharmaceutical Co. Ltd., Ganzhou, China) two hours after
RSV infection (day 0), which was followed by a once-daily
administration for four consecutive days (day 1 to day 4).
Normal saline served as a negative control. All mice were
killed five days after RSV infection. Mice were randomly
allocated to different treatment groups, with at least four
mice in each treatment group as mentioned earlier.
Hematoxylin and eosin (HE) staining
Pathohistological changes in the lung were evaluated using
HE staining. In brief, left lung tissues were fixed in 10%
neutral buffered formalin for at least 24 hours. The fixed
tissues were dehydrated, embedded in parafn, and cut into
4-mm sections. The tissue sections were stained with HE
and subjected to microscopic analysis. Tissue inammation
was scored as described previously (18).
Bronchoalveolar lavage uid collection
On day 5, prior to euthanasia, the mice were anesthetized
with intraperitoneal pentobarbital (90 mg/kg). Lungs were
lavaged six times. With 0.5 mL of phosphate-buffered
saline (PBS) being applied each time. The resulting
bronchoalveolar lavage fluid (BALF) was centrifuged
at 2,500 rpm for five minutes. The supernatants were
stored at −80 ℃ for IFN-γ analysis. The cell pellets
were resuspended in 1 mL of PBS and counted under
a microscope to determine total cell counts. To count
different types of leukocytes, the cell suspensions were
loaded onto microscope slides, air-dried, and stained with
Giemsa. A total of 200 cells per sample were counted
under a microscope to determine macrophage, lymphocyte,
neutrophil, and eosinophil counts.
Enzyme-linked immunosorbent assay (ELISA)
IFN-γ levels in the BALF were determined via ELISA
(Sizhengbai Biotechnology, Beijing, China) following the
manufacturer’s directions.
Quantitative real-time polymerase chain reaction (qRT-
PCR)
Total RNA was extracted from lung tissues using TRIzol
reagent and used for complement DNA (cDNA) synthesis
(Takara Bio, Kusatsu, Japan). RSV nucleoprotein (N)
messenger RNA (mRNA) levels were determined via qRT-
PCR using a hydrolysis probe, as described previously
(19,20). The sequences of the hydrolysis probe and primers
specic for RSV N are listed in Table 1. qRT-PCR was also
used to determine the TLR1–9 mRNA levels. The primer
sequences specic for TLR1–9 are listed in Table 2. Values
were normalized to GAPDH expression levels.
Western blot analysis
Total protein was extracted from lung tissues using a
protein extraction kit (KeyGEN Biotech Co. Ltd., Nanjing,
China). The protein concentrations were determined
using a bicinchoninic acid protein assay kit (BioTeke
Corporation, Beijing, China). Proteins were separated via gel
electrophoresis and transferred onto polyvinylidene diuoride
(PVDF) membranes. Western blotting was performed by
probing the blocked membranes with primary antibodies
specific for RSV N and F (1:1,000; Merck Millipore,
Burlington, MA, USA), TLR2 (1:1,000; ABclonal, Woburn,
MA, USA), TLR3 (1:1,000; ABclonal), TIR domain-
containing adapter-inducing interferon-β (TRIF; 1:1,000;

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
4
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
Abcam, Cambridge, UK), and β-actin (1:2,000; Proteintech,
Rosemont, IL, USA), respectively. After incubation with
the corresponding secondary antibodies, the protein bands
were detected using enhanced chemiluminescence (Bio-Rad
Laboratories, Hercules, CA, USA).
Statistical analysis
All results are presented as the mean ± standard error of the
mean (SEM). Data analyses were conducted using SPSS v.
19.0 (IBM Corp., Armonk, NY, USA). One-way analysis of
variance (ANOVA) was used to compare the means among
three or more groups. The unpaired Student t-test was
employed to compare the means between two groups. The
Pearson method was used for correlation analysis. A P value
of less than 0.05 was considered statistically signicant.
Results
Intranasal but not intraperitoneal Andro-S ameliorated
lung inammation in RSV-infected mice
Healthy BALB/c mice are not susceptible to RSV infection;
however, those whose immune system has been weakened
by CYP are vulnerable to RSV infection (21). In this
study, BALB/c mice received a single dose of 100 mg/kg
of CYP via intraperitoneal injection five days before they
were infected intranasally with RSV. In response to RSV
infection, the airway epithelium generates chemokines to
recruit immune cells to the site of infection to kill virus-
infected cells (22). The infiltrating immune cells secret
inammatory cytokines that cause damage to the lung (23).
In this study, RSV infection induced massive infiltration of
macrophages, lymphocytes, neutrophils, and eosinophils
into the lung, as indicated by the drastically increased
counts of these inflammatory cells in the BALF five days
after infection (Figure 1A). Similar to our previous ndings,
elevated IFN-γ levels were detected in the BALF of RSV-
infected lungs (Figure 1B). HE staining revealed severe
bronchiolitis, alveolitis, and perivascular inflammation in
the lung five days after RSV infection (Figure 1C), which
was reflected in the elevated pathohistological scores of
the lungs (Figure 1D). These results were in alignment
with previous findings of immunocompromised BALB/
c mice developing severe lung inflammation five days
after RSV infection. Treatment with intranasal Andro-S
Table 1 Sequences of the hydrolysis probe and primers specic for RSV N
Name Primer
Forward primer (5'-3') AGATCAACTTCTGTCATCCAGCAA
Reverse primer (5'-3') TTCTGCACATCATAATTAGGAGTATCAAT
Probe FAM-5’-CACCATCCAACGGAGCACAGGAGAT-3’-BHQ1
RSV N, respiratory syncytial virus nucleoprotein.
Table 2 Primer sequences specic for TLR1–9
No. Gene Forward primer (5'-3') Reverse primer (5'-3')
1TLR1 GGTAGCAAGAGAAGTGGTGGAG CGATGGTGACAGTCAGCAGAAC
2TLR2 ACAGCAAGGTCTTCCTGGTTCC GCTCCCTTACAGGCTGAGTTCT
3TLR3 GTCTTCTGCACGAACCTGACAG TGGAGGTTCTCCAGTTGGACCC
4TLR4 AGCTTCTCCAATTTTTCAGAACTTC TGAGAGGTGGTGTAAGCCATGC
5TLR5 TCCTGACCAGAGCACATTTGCC CCTTCAGTGTCCCAAACAGTCG
6TLR6 TGAGCCAAGACAGAAAACCCA GGGACATGAGTAAGGTTCCTGTT
7TLR7 ATGTGGACACGGAAGAGACAA GGTAAGGGTAAGATTGGTGGTG
8TLR8 AAGTGCTGGACCTGAGCCACAA CCTCTGTGAGGGTGTAAATGCC
9TLR9 GCTGTCAATGGCTCTCAGTTCC CCTGCAACTGTGGTAGCTCACT
TLR, Toll-like receptor.

Journal of Thoracic Disease, 2024 5
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
***
***
***
***
******
***
***
***
***
***
***
***
*** *** *** *** ***
*** *** ***
2.5
2.0
1.5
1.0
0.5
0.0
Histological scores of pulmonary
30
20
10
0
Cells in BALF, 105/mL
2000
1500
1000
500
0
IFN-γ in BALF , pg/mL
Control Andro-S
RSV + Andro-S (10-ip)
Control Andro-S RSV
Peribronchiolitis Perivasculitis Alveolitis
Total cell number
Macrophage
Lymphocyte
Neutrophil
Eosinophil
a
100×
400×
bcd e
RSV + Andro-S
(10-ip)
RSV + Andro-S
(100-ip)
Control Andro-S
RSV + Andro-S (10-ip)
Control Andro-S
RSV + Andro-S (10-ip)
RSV
RSV + Andro-S (100-ip)
RSV
RSV + Andro-S (100-ip)
RSV
RSV + Andro-S (100-ip)
A B
C
D
Figure 1 Effects of intraperitoneal Andro-S on pulmonary inflammation in immunocompromised BALB/c mice five days after RSV
infection. (A) Inammatory cell counts in the BALF. (B) IFN-γ levels in the BALF measured via ELISA. (C) Representative images of lung
tissues with HE staining showing pathohistological changes in the lung (upper panel: 100×; lower panel: 400×). (a) The control group,
(b) the Andro-s group, (c) the RSV group, (d) the RSV mice received intraperitoneal 10 mg/kg of Andro-S, (e) the RSV mice received
intraperitoneal 100 mg/kg of Andro-S. (D) Pathohistological scores showing the severity of pulmonary inammation. n≥4; ***, P<0.001 vs.
PBS + saline. RSV, respiratory syncytial virus; Andro-S, andrographolide sulfonate; IFN-γ, interferon-γ; BALF, bronchoalveolar lavage uid;
ELISA, enzyme-linked immunosorbent assay; HE, hematoxylin and eosin; PBS, phosphate-buffered saline.

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
6
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
(0.5 mg) postinfection once daily for five consecutive days
signicantly reduced inammatory cell inltration, lowered
IFN-γ levels, and attenuated inflammation-associated
pathohistological changes in the lung (Figure 1A-1D).
However, treatment with intraperitoneal Andro-S (10 mg/kg)
once daily for five consecutive days demonstrated no
significant effects on pulmonary inflammation in infected
animals (Figure 2A-2D).
Intranasal Andro-S reduced RSV N and F levels in RSV-
infected lungs
As part of the viral ribonucleoprotein complex, RSV N is
essential for viral RNA replication, mRNA transcription,
and virus assembly and encapsulation (24). Therefore, RSV
N is commonly used as a marker of viral load during RSV
infection. In this study, RSV N mRNA and protein levels
in the lung were detected via qRT-PCR and Western blot
analysis, respectively. As shown in Figure 3A,3B, RSV N was
detected in infected but not in uninfected lungs. We also
detected a positive correlation between total inammatory
cell count and RSV N mRNA (P=0.01; r=0.99) and
between IFN-γ and RSV N mRNA (P=0.01; r=0.99).
These results indicated that higher viral load induced more
intense immune response. Intranasal Andro-S signicantly
reduced RSV N mRNA and protein levels in infected lungs
(Figure 3A,3B), suggesting that Andro-S protected against
RSV infection at least partially by inhibiting viral RNA
replication and encapsulation, thereby reducing viral load.
The RSV fusion protein (F) mediates the fusion of viral
and host cell membranes to facilitate virus entry (24). In
this study, Andro-S also reduced RSV F protein levels in
infected lungs (Figure 3B), suggesting that Andro-S also
could have reduced viral load by blocking virus entry.
Intranasal Andro-S downregulated TLR3 and TRIF in
RSV-infected lungs
To investigate the role of TLRs as possible mediators of
Andro-S, we evaluated the mRNA expression of TLR1–9
in lung tissues using qRT-PCR (Figure 4). We found that
RSV infection induced TLR1, TLR2, TLR3, and TLR9
mRNA expression (Figure 4A-4C,4I) but downregulated
TLR5 expression (Figure 4E). Intranasal Andro-S reduced
TLR2 and TLR3 mRNA expression in RSV-infected lungs
(Figure 4B,4C), but showed no signicant effects on TLR1,
TLR5, or TLR9 (Figure 4A,4E,4I). Neither RSV infection
nor Andro-S significantly changed the mRNA expression
of TLR4, TLR6, TLR7, or TLR8 (Figure 4D,4F-4H).
Next, we evaluated the protein expression of TLR2,
TLR3, and TRIF, a critical adaptor for TLR3, in lung
tissues using Western blot analysis. We found that RSV
infection did not cause signicant changes in TLR2 protein
expression but did increase the protein expression of TLR3
and TRIF in the lung (Figure 5A-5E). Intranasal Andro-S
demonstrated no effects on TLR2 protein expression but
did downregulate both TLR3 and TRIF protein expression
in RSV-infected lungs (Figure 5A-5E). These findings
suggested that intranasal Andro-S ameliorated inammation
in RSV-infected lungs by downregulating TLR3 and TRIF
protein expression in the lung.
Discussion
RSV infection in infants remains a global public health
concern, necessitating the development of novel therapies.
In this study, we found that intranasal administration
of Andro-S ameliorated RSV infection-associated lung
inflammation in immunocompromised BALB/c mice. In
terms of mechanism, intranasal Andro-S reduced viral load
and downregulated TLR3 and its adaptor TRIF in infected
lungs.
RSV infection triggers an initial innate immune
response, primarily involving airway epithelial cells and
tissue-resident dendritic cells and macrophages. These cells
activate the recruitment of lymphocytes and granulocytes
to the site of infection, which then begin to eliminate the
virus and mediate further recruitment of adaptive immune
cells (25). These innate and adaptive immune responses
cause airway inflammation and damage. In this study, we
detected severe bronchiolitis, alveolitis, and pulmonary
perivascular inflammation accompanied by inflammatory
cell infiltration five days after RSV infection. Daily
intranasal Andro-S administration for ve consecutive days,
starting two hours after the infection, effectively reduced
inammatory cell inltration and attenuated inammation-
associated pathohistological changes in the lung. Given
that early intervention and viral clearance are important
factors in determining the prognosis of viral infections,
the findings from this study demonstrate that intranasal
administration of Andro-S may hold promise as an effective
early intervention after RSV infection in controlling airway
inammation and improving patient outcomes.
Compared with other drug delivery routes, intranasal

Journal of Thoracic Disease, 2024 7
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
PBS + Saline PBS+ Andro-S RSV + Saline RSV + Andro-S
400×
100×
a b cd
C
***
***
*** ***
**
###
###
##
3
2
1
0
Histological scores of
pulmonary injury
Peribronchiolitis Perivasculitis Alveolitis
D
****
****
****
***
**
####
####
25
20
15
10
5
0
Cell number, 105/mL
Total cell number Macrophage Neutrophil Lymphocyte Eosinophil
PBS + Saline
PBS + Andro-S
RSV + Saline
RSV + Andro-S
A
****
*
##
1500
1000
500
0
IFN-γ in BALF , pg/mL
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
PBS + Andro-S
RSV + Saline
RSV + Andro-S
B
Figure 2 Effects of intranasal Andro-S on pulmonary inammation in immunocompromised BALB/c mice ve days after RSV infection.
(A) Inammatory cell counts in the BALF. (B) IFN-γ levels in the BALF measured via ELISA. (C) Representative images of lung tissues with
HE staining showing pathohistological changes in the lung (upper panel: 100×; lower panel: 400×). (a) the PBS + saline group, (b) the PBS +
Andro-S group, (c) the RSV + saline group, (d) the RSV mice received intranasal Andro-S. (D) Pathohistological scores showing the severity
of pulmonary inammation. n≥4. *, P<0.05; **, P<0.01; ***, P<0.001, ****, P<0.0001 vs. PBS + saline; ##, P<0.01; ###, P<0.001; ####, P<0.0001.
RSV, respiratory syncytial virus; Andro-S, andrographolide sulfonate; IFN-γ, interferon-γ; BALF, bronchoalveolar lavage fluid; ELISA,
enzyme-linked immunosorbent assay; HE, hematoxylin and eosin; PBS, phosphate-buffered saline.

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
8
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
****
****
#
8
6
4
2
0
Log10 copy number of RSV-A N RNA
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
95
75
55
43
F
N
β-actin
34
A B
Figure 3 Effects of intranasal Andro-S on RSV N and F expression in the lungs of immunocompromised BALB/c mice ve days after RSV
infection. (A) Relative copy number of RSV-A N mRNA as determined via qRT-PCR. n≥4. ****, P<0.0001 vs. PBS + saline; #, P<0.05. (B)
Representative Western blotting gel images showing RSV N and F protein expression. RSV, respiratory syncytial virus; PBS, phosphate-
buffered saline; Andro-S, andrographolide sulfonate; qRT-PCR, quantitative real-time polymerase chain reaction.
administration directly delivers the drug to the airway
with reduced systemic exposure. Thus, it is a preferred
method for the administration of lung-targeting drugs
such as those for the treatment of respiratory diseases. For
example, intranasal administration of a long-acting ACE2
protein showed superior performance over intraperitoneal
injection of the same therapeutic protein in the k18-hACE2
mouse model of severe acute respiratory syndrome-related
coronavirus 2 (SARS-CoV-2) infection (26). In this study,
RSV infection-induced lung inflammation was reduced
by intranasal but not intraperitoneal administration of
Andro-S, indicating that intranasal administration is a
suitable drug delivery method for the treatment of RSV
infection and associated airway conditions. In recent years,
a growing number of TCMs have been reformulated as
aerosol (spray) drugs and have shown clinical efficacy
and safety (27). For example, oral inhalation of the TCM
Kaihoujian aerosol signicantly reduced acute laryngitis in
adults and alleviated vocal cord leukoplakia (28). Similarly,
Andro-S may be reformulated in the future for inhalation in
the treatment of RSV infection.
In this study, intranasal Andro-S reduced the protein
levels of RSV N and F in infected lungs, suggesting that it
reduced viral load by inhibiting virus entry and replication.
The mechanisms by which Andro-S downregulates these
viral proteins are not clear and require further investigation.
Functioning as pattern recognition receptors (PRRs) for
RSV-derived pathogen-associated molecular patterns
(PAMPs), TLRs play an important role in initiating immune
response to RSV infection (11). In particular, TLR3-
mediated IFN-γ response has been shown to contribute to
pulmonary inammation during RSV infection (17,28). Of
note, TLR3-mediated type II IFN response is considered to
be a critical contributor to antiviral innate immunity (29). In
this study, RSV-infected lungs exhibited increased protein
expression of TLR3 and its adaptor TRIF, as well as elevated
IFN-γ levels in the BALF, which is in line with our previous
research (17). A study has shown that andrographolide
can inhibit TRIF-dependent TLR signaling by targeting
TANK binding kinase 1 (TBK1) (30). In this study,
intranasal Andro-S downregulated TLR3 and TRIF in
infected lungs and reduced IFN-γ levels in the BALF,
suggesting that Andro-S ameliorated lung inflammation
caused by RSV infection by downregulating the TLR3-
TRIF–IFN-γ axis. Previous studies have also reported that
Andro-S can protect against inflammatory cell injury by
antagonizing nuclear factor-κB (NF-κB) and activating
Nrf2 antioxidant response (31,32). In addition, Andro-S
was found to alleviate poly (I:C)-induced pneumonia in
mice by downregulating NF-κb (33). Hypothetically,

Journal of Thoracic Disease, 2024 9
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
***
**
**
**
**
*
*
*
3
2
1
0
Relative expression of
TLR1 to β-actin
3
2
1
0
Relative expression of
TLR7 to β-actin
5
4
3
2
1
0
Relative expression of
TLR2 to β-actin
5
4
3
2
1
0
Relative expression of
TLR3 to β-actin
1.5
1.0
0.5
0.0
Relative expression of
TLR4 to β-actin
1.5
1.0
0.5
0.0
Relative expression of
TLR5 to β-actin
2.0
1.5
1.0
0.5
0.0
Relative expression of
TLR8 to β-actin
10
8
6
4
2
0
Relative expression of
TLR9 to β-actin
1.5
1.0
0.5
0.0
Relative expression of
TLR6 to β-actin
*
*
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
A B C
D E F
G H I
Figure 4 Effects of intranasal Andro-S on TLR1–9 mRNA expression in the lungs of immunocompromised BALB/c mice ve days after
RSV infection. Relative mRNA levels of TLR1 (A), TLR2 (B), TLR3 (C), TLR4 (D), TLR5 (E), TLR6 (F), TLR7 (G), TLR8 (H), and
TLR9 (I) in lung tissues as determined by qRT-PCR. n≥4. *, P<0.05; **, P<0.01; ***, P<0.001 vs. PBS + saline. TLR, Toll-like receptor;
RSV, respiratory syncytial virus; PBS, phosphate-buffered saline; Andro-S, andrographolide sulfonate; qRT-PCR, quantitative real-time
polymerase chain reaction.
these anti-NF-κB and antioxidant properties of Andro-S
may also mediate its protective effects against airway
inflammation caused by RSV infection. Future in vitro
and/or in vivo experiments are required to investigate this
hypothesis.
Conclusions
Intranasal but not intraperitoneal administration of
Andro-S ameliorated the lung inammation caused by RSV
infection in mice by suppressing the TLR3-TRIF–IFN-γ
axis. Andro-S inhalation aerosol may be used to treat RSV

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
10
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
###
##
***
***
0.15
0.10
0.05
0.00
Relative expression of
TLR2 to β-actin
2.5
2.0
1.5
1.0
0.5
0.0
Relative expression of
TRIF to β-actin
3
2
1
0
Relative expression of
TLR3 to β-actin
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
TLR2
TLR3
β-actin
TRIF
β-actin
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
PBS + Saline
RSV + Saline
RSV + Andro-S
PBS + Andro-S
A B C
D E
Figure 5 Effects of intranasal Andro-S on TLR2, TLR3, and TRIF protein expression in the lungs of immunocompromised BALB/c mice
ve days after RSV infection. (A) Representative Western blotting gel images showing TLR2 and TLR3 protein expression in the lung.
(B,C) Relative protein levels of TLR2 (B) and TLR3 (C) in the lung. (D) Representative Western blotting gel images showing TRIF protein
expression in the lung. (E) Relative protein levels of TRIF in the lung. n≥4. ***, P<0.001 vs. PBS + saline; ##, P<0.01; ###, P<0.001. RSV,
respiratory syncytial virus; PBS, phosphate-buffered saline; Andro-S, andrographolide sulfonate; TRIF, TIR domain-containing adapter-
inducing interferon-β.
infection–associated airway conditions and reduce mortality.
Acknowledgments
Funding: This work was funded by the Chongqing Natural
Science Foundation Project (No. CSTB2022NSCQ-
MSX0129) and the Open Project of the State Key
Laboratory of Innovative Natural Medicine and TCM
Injections (No. QFSKL2020020).
Footnote
Reporting Checklist: The authors have completed the
ARRIVE reporting checklist. Available at https://jtd.
amegroups.com/article/view/10.21037/jtd-24-752/rc
Data Sharing Statement: Available at https://jtd.amegroups.
com/article/view/10.21037/jtd-24-752/dss
Peer Review File: Available at https://jtd.amegroups.com/
article/view/10.21037/jtd-24-752/prf
Conicts of Interest: All authors have completed the ICMJE
uniform disclosure form (available at https://jtd.amegroups.
com/article/view/10.21037/jtd-24-752/coif). Y.L. is
employed by Jiangxi Qingfeng Pharmaceutical Co., Ltd.
(Jiangxi, China). The other authors have no conflicts of
interest to declare.
Ethical Statement: The authors are accountable for all
aspects of the work in ensuring that questions related
to the accuracy or integrity of any part of the work are
appropriately investigated and resolved. The study protocol
was approved by the Ethics Committee of Chongqing
Medical University (No. SYXK[Yu] 2012-0001). All
animal experiments were in compliance with institutional
guidelines for the care and use of animals.

Journal of Thoracic Disease, 2024 11
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
Open Access Statement: This is an Open Access article
distributed in accordance with the Creative Commons
Attribution-NonCommercial-NoDerivs 4.0 International
License (CC BY-NC-ND 4.0), which permits the non-
commercial replication and distribution of the article with
the strict proviso that no changes or edits are made and the
original work is properly cited (including links to both the
formal publication through the relevant DOI and the license).
See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
1. Zheng D, Shao J, Chen W, et al. In vitro Metabolism
of Sodium 9-dehydro-17-hydro-andrographolide-19-yl
Sulfate in Rat Liver S9 by Liquid Chromatography-Mass
Spectrometry Method. Pharmacogn Mag 2016;12:S102-8.
2. Burgos RA, Alarcón P, Quiroga J, et al. Andrographolide,
an Anti-Inammatory Multitarget Drug: All Roads Lead
to Cellular Metabolism. Molecules 2020;26:5.
3. Lin FL, Wu SJ, Lee SC, et al. Antioxidant, antioedema
and analgesic activities of Andrographis paniculata extracts
and their active constituent andrographolide. Phytother
Res 2009;23:958-64.
4. Mussard E, Jousselin S, Cesaro A, et al. Andrographis
Paniculata and Its Bioactive Diterpenoids Protect Dermal
Fibroblasts Against Inammation and Oxidative Stress.
Antioxidants (Basel) 2020;9:432.
5. Kumar RA, Sridevi K, Kumar NV, et al. Anticancer and
immunostimulatory compounds from Andrographis
paniculata. J Ethnopharmacol 2004;92:291-5.
6. Che S, Zhou N, Liu Y, et al. Andrographolide exerts anti-
respiratory syncytial virus activity by up-regulating heme
oxygenase-1 independent of interferon responses in human
airway epithelial cells. Mol Biol Rep 2023;50:4261-72.
7. Li Y, Johnson EK, Shi T, et al. National burden estimates
of hospitalisations for acute lower respiratory infections
due to respiratory syncytial virus in young children in 2019
among 58 countries: a modelling study. Lancet Respir Med
2021;9:175-85.
8. Shi T, McAllister DA, O'Brien KL, et al. Global, regional,
and national disease burden estimates of acute lower
respiratory infections due to respiratory syncytial virus in
young children in 2015: a systematic review and modelling
study. Lancet 2017;390:946-58.
9. Nair H, Nokes DJ, Gessner BD, et al. Global burden
of acute lower respiratory infections due to respiratory
syncytial virus in young children: a systematic review and
meta-analysis. Lancet 2010;375:1545-55.
10. Li Y, Hodgson D, Wang X, et al. Respiratory syncytial
virus seasonality and prevention strategy planning for
passive immunisation of infants in low-income and middle-
income countries: a modelling study. Lancet Infect Dis
2021;21:1303-12.
11. Klein Klouwenberg P, Tan L, Werkman W, et al. The role
of Toll-like receptors in regulating the immune response
against respiratory syncytial virus. Crit Rev Immunol
2009;29:531-50.
12. Malik S, Ahmad T, Muhammad K, et al. Respiratory
Syncytial Virus Infection: Treatments and Clinical
Management. Vaccines (Basel) 2023;11:491.
13. Moin AT, Ullah MA, Patil RB, et al. A computational
approach to design a polyvalent vaccine against human
respiratory syncytial virus. Sci Rep 2023;13:9702.
14. Boukhvalova MS, Sotomayor TB, Point RC, et al.
Activation of interferon response through toll-like receptor
3 impacts viral pathogenesis and pulmonary toll-like
receptor expression during respiratory syncytial virus and
inuenza infections in the cotton rat Sigmodon hispidus
model. J Interferon Cytokine Res 2010;30:229-42.
15. Xie J, Long X, Gao L, et al. Respiratory Syncytial Virus
Nonstructural Protein 1 Blocks Glucocorticoid Receptor
Nuclear Translocation by Targeting IPO13 and May
Account for Glucocorticoid Insensitivity. J Infect Dis
2017;217:35-46.
16. Zang N, Li S, Li W, et al. Resveratrol suppresses persistent
airway inammation and hyperresponsivess might partially
via nerve growth factor in respiratory syncytial virus-
infected mice. Int Immunopharmacol 2015;28:121-8.
17. Zang N, Xie X, Deng Y, et al. Resveratrol-mediated
gamma interferon reduction prevents airway inammation
and airway hyperresponsiveness in respiratory syncytial
virus-infected immunocompromised mice. J Virol
2011;85:13061-8.
18. Peebles RS Jr, Sheller JR, Collins RD, et al. Respiratory
syncytial virus infection does not increase allergen-
induced type 2 cytokine production, yet increases airway
hyperresponsiveness in mice. J Med Virol 2001;63:178-88.
19. Zhou N, Li W, Ren L, et al. An Interaction of LPS and
RSV Infection in Augmenting the AHR and Airway
Inammation in Mice. Inammation 2017;40:1643-53.
20. Chen S, Yu G, Xie J, et al. High-mobility group box-1
protein from CC10+ club cells promotes type 2 response in
the later stage of respiratory syncytial virus infection. Am J
Physiol Lung Cell Mol Physiol 2019;316:L280-L290.
21. Kong X, Hellermann GR, Patton G, et al. An
immunocompromised BALB/c mouse model for

Zhou et al. Andr-S downregulates TLR3-TRIF caused by RSV
12
© Journal of Thoracic Disease. All rights reserved. J Thorac Dis 2024 | https://dx.doi.org/10.21037/jtd-24-752
respiratory syncytial virus infection. Virol J 2005;2:3.
22. Guo-Parke H, Canning P, Douglas I, et al. Relative
respiratory syncytial virus cytopathogenesis in upper and
lower respiratory tract epithelium. Am J Respir Crit Care
Med 2013;188:842-51.
23. Moreno-Solís G, Torres-Borrego J, de la Torre-Aguilar
MJ, et al. Analysis of the local and systemic inammatory
response in hospitalized infants with respiratory syncitial
virus bronchiolitis. Allergol Immunopathol (Madr)
2015;43:264-71.
24. Collins PL, Fearns R, Graham BS. Respiratory syncytial
virus: virology, reverse genetics, and pathogenesis of
disease. Curr Top Microbiol Immunol 2013;372:3-38.
25. Grifths C, Drews SJ, Marchant DJ. Respiratory
Syncytial Virus: Infection, Detection, and New Options
for Prevention and Treatment. Clin Microbiol Rev
2017;30:277-319.
26. Hassler L, Wysocki J, Ahrendsen JT, et al. Intranasal
soluble ACE2 improves survival and prevents brain SARS-
CoV-2 infection. Life Sci Alliance 2023;6:e202301969.
27. Xie W, Zhang Y, Tang J, et al. Efcacy and Safety of
Traditional Chinese Medicines as a Complementary
Therapy Combined With Chemotherapy in the
Treatment of Gastric Cancer: An Overview of Systematic
Reviews and Meta-Analyses. Integr Cancer Ther
2024;23:15347354231225961.
28. Feng W, Chen H, Lu Y, et al. Comparing the efcacy
and safety of atomization of traditional Chinese medicine
Kai Hou Jian and budesonide suspension in adult acute
laryngitis: a randomized control trial. Ann Transl Med
2022;10:1019.
29. Negishi H, Osawa T, Ogami K, et al. A critical link
between Toll-like receptor 3 and type II interferon
signaling pathways in antiviral innate immunity. Proc Natl
Acad Sci U S A 2008;105:20446-51.
30. Kim AY, Shim HJ, Shin HM, et al. Andrographolide
suppresses TRIF-dependent signaling of toll-like
receptors by targeting TBK1. Int Immunopharmacol
2018;57:172-80.
31. Xu Y, Tang D, Wang J, et al. Neuroprotection
of Andrographolide Against Microglia-Mediated
Inammatory Injury and Oxidative Damage in PC12
Neurons. Neurochem Res 2019;44:2619-30.
32. Fu K, Chen H, Wang Z, et al. Andrographolide attenuates
inammatory response induced by LPS via activating Nrf2
signaling pathway in bovine endometrial epithelial cells.
Res Vet Sci 2021;134:36-41.
33. Cui J, Gao J, Li Y, et al. Andrographolide sulfate inhibited
NF-κB activation and alleviated pneumonia induced by
poly I:C in mice. J Pharmacol Sci 2020;144:189-96.
Cite this article as: Zhou N, Che S, Liu J, Jiang Z, Ren L, Liu
Y, Liu E, Xie J. Andrographolide sulfonate downregulation of
TLR3-TRIF and amelioration of airway inammation caused
by respiratory syncytial virus infection. J Thorac Dis 2024. doi:
10.21037/jtd-24-752