ArticlePDF Available

Phylogeography of Clarias batrachus (Linnaeus, 1758) Inland Waters of Asia

Authors:
Luvi Syafrida Handayani at Syiah Kuala University
Luvi Syafrida Handayani
Zainal A. Muchlisin at Syiah Kuala University
Zainal A. Muchlisin
Sri Riska Rahayu at Syiah Kuala University
Sri Riska Rahayu
Nanda Muhammad Razi at Syiah Kuala University
Nanda Muhammad Razi
Show all 9 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

Clarias batrachus is native species from the Clarias genus that has significant economic value in the world, including Indonesia. The genetic relationship between C. batrachus populations in Asia has not been intensively studied. This study used the mitochondrial COI gene as a marker to examine the phylogeography pattern of Clarias batrachus in Indonesia and other Asian nations. The samples were extracted, PCR and sequenced using a standard procedure for these purposes. Five C. batrachus samples in total were taken from Banda Aceh, Indonesia. The sequences from Aceh were compared with 39 samples from the Genbank were employed in this analysis. Of these, 10 samples from Thailand, 10 samples from India, 10 samples from Philippines and 9 samples from Java, Indonesia. The results showed that 15 haplotypes were produced from the sequences. All populations have a haplotype diversity (Hd) value of 0.892. With a genetic distance of 0.022, Thailand and the Philippines have the closest population, while Aceh and India have the furthest populations, separated by a genetic distance of 0.113. Within the population, the genetic distance varies between 0-0.005. Therefore, it is concluded that the C. batrachus population of Aceh is closer in genetic distance to the C. batrachus population of Thailand.
Figures - available via license: Creative Commons Attribution 4.0 International
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
IOP Conference Series: Earth and
Environmental Science
PAPER • OPEN ACCESS
Phylogeography of
Clarias batrachus
(Linnaeus,
1758) Inland Waters of Asia
To cite this article: L S Handayani
et al
2024
IOP Conf. Ser.: Earth Environ. Sci.
1356 012098
View the article online for updates and enhancements.
You may also like
Tsunami model of the 2021 Flores
earthquake and its impact on Labuan
Bajo, East Nusa Tenggara
E H Sudjono, F Novico, S Karima et al.
-
Characteristic of Nano-Calcium Bone from
a Different Species of Catfish (Pangasius
hypophthalmus, Clarias batrachus,
Hemibagrus nemurus and Paraplotosus
albilabris)
Sumarto, Desmelati, N I Sari et al.
-
Assessment of Serum Antibody Titers in
Cattles and Buffaloes Post-Haemorrhagic
septicaemia Outbreak in Aceh Singkil
District, Indonesia
S S Prihandani, I W T Wibawan, Safika et
al.
-
This content was downloaded from IP address 206.204.48.71 on 09/07/2024 at 18:09
Content from this work may be used under the terms of the Creative Commons Attribution 4.0 licence. Any further distribution
of this work must maintain attribution to the author(s) and the title of the work, journal citation and DOI.
Published under licence by IOP Publishing Ltd
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
1
Phylogeography of Clarias batrachus (Linnaeus, 1758) Inland
Waters of Asia
L S Handayani1, Z A Muchlisin2*, S R Rahayu1, N M Razi3, K Eriani4, N Fadli2, M
Ramadhaniaty2, A Marini5, R M Lonteng5
1 Graduate School of Mathematics and Applied Science, Universitas Syiah Kuala,
Banda Aceh 23111, Indonesia.
2 Faculty of Marine and Fisheries, Universitas Syiah Kuala, Banda Aceh 23111,
Indonesia.
3 Master Program in Biology, Faculty of Mathematics and Natural Sciences, Universitas
Syiah Kuala, Banda Aceh 23111, Indonesia.
4 Departement of Biology, Faculty of Mathematics and Natural Sciences, Universitas
Syiah Kuala, Banda Aceh, 23111, Indonesia.
5 Laboratory of Genetics and Aquatic Biodiversity, Faculty of Marine and Fisheries,
Universitas Syiah Kuala, Banda Aceh 23111, Indonesia.
*Email: muchlisinza@usk.ac.id
Abstract. Clarias batrachus is native species from the Clarias genus that has significant
economic value in the world, including Indonesia. The genetic relationship between C.
batrachus populations in Asia has not been intensively studied. This study used the
mitochondrial COI gene as a marker to examine the phylogeography pattern of Clarias
batrachus in Indonesia and other Asian nations. The samples were extracted, PCR and
sequenced using a standard procedure for these purposes. Five C. batrachus samples in
total were taken from Banda Aceh, Indonesia. The sequences from Aceh were compared
with 39 samples from the Genbank were employed in this analysis. Of these, 10 samples
from Thailand, 10 samples from India, 10 samples from Philippines and 9 samples from
Java, Indonesia. The results showed that 15 haplotypes were produced from the
sequences. All populations have a haplotype diversity (Hd) value of 0.892. With a
genetic distance of 0.022, Thailand and the Philippines have the closest population,
while Aceh and India have the furthest populations, separated by a genetic distance of
0.113. Within the population, the genetic distance varies between 0-0.005. Therefore, it
is concluded that the C. batrachus population of Aceh is closer in genetic distance to
the C. batrachus population of Thailand.
1. Introduction
One of the most well-liked and extensively dispersed native catfish species in Indonesia is Clarias
batrachus [1, 2]. According to FishBase (2023), there are 183 Clarias species worldwide, with 16 of
these species found in Indonesia [3, 4]. Based on the IUCN Red List, C. batrachus is classified under
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
2
the "least concern" status, leading to a decline in its wild population, indicating the occurrence of
overfishing that can threaten its natural existence (Mohindra et al., 2014; Müller et al., 2020).
The genetic approach was used to examine the phylogeographic distribution of C. batrachus in Asia
using the COI gene marker. Merging phylogenetics with geography, phylogeography examines the
geographical distribution of a species' lineages [5]. Previous reports of studies comparing the
phylogeographic of C. gariepenus in Bangladesh [6], C. batrachus in India [7], C. batrachus in
Sumatran [8].
The link between biogeography and the evolutionary history of species is shown by the study of
phylogeography, which lays the foundation for creating better management techniques [9]. Close
genetic links between species allow them to be included into a unified conservation and management
plan, whereas more marked genetic differences require specific management techniques [10]. This
research aimed to determine how the phylogenetic and geographic linkages between the populations of
C. batrachus in Aceh and other populations in in Asia's inland waters.
2. Materials and methods
2.1. Sample collection
Five C. batrachus specimens from the Aceh population were collected in August 2023 in Aceh Province,
Indonesia. The samples were acquired by cutting about 1 cm from the pectoral fins using sterile scissors.
They were then stored in a 96% ethanol solution and photographed for documentation in accordance
with the procedure of the Fish-BOL partnership [11]. After that, these samples were brought to the lab
for further analysis. Using secondary data from GenBank, a comparative phylogeography study was
conducted using C. batrachus sequences from Thailand, India, Philippines, and Java. Figure 1 and Table
1 provide information on the origins of the collected samples.
2.2. DNA extraction
Cetyltrimethyl Ammonium Bromide (CTAB) in a modified form was used in the DNA extraction
procedure [12, 13]. A 1.5 mL sterile tube containing the finely cut fin tissue was filled with 700 µl of
CTAB and 3 µl of Proteinase K. After 15 seconds of vortexing, the mixture was incubated at 60˚C for
three hours. 700 µl of Chloroform Isoamyl Alcohol (CIA) was added after the incubation, and the
mixture was centrifuged for 15 minutes at 11000 rpm. After centrifugation for 15 minutes at 12000 rpm,
the resultant supernatant was poured into a fresh 1.5 mL tube, 100% ethanol was added, and the tube
was vortexed for 30 more seconds. After discarding the resultant supernatant, 70% ethanol was used to
wash the tube. After tapping the tube, which contained the DNA upside down on a dry tissue, to remove
any leftover ethanol, the tube was allowed to air dry for ten minutes at room temperature. The DNA
sample was then added, and after that, 60 µl of DDH2O. The finished product was then kept for later
use at -20 °C.
2.3. DNA amplification
In vitro, extraction product samples were amplified using forward and reverse primers in Polymerase
Chain Reaction (PCR). Primers Fish F1-5TCAACCAACCACAAAGACATTGGCAC3’ and Fish R1-
5’TAGACTTCTGGGTGGCCAAAGAATCA3’ [14]. A 25 µl DNA template, 8.5 µl ddH2O, 1 µl
forward primer, 1 µl reverse primer, and 12.5 µl red master mix were used in the PCR process. Using a
PCR equipment (Senso Quest Lab cycler), the PCR process was carried out 30 times. Pre-denaturation
at 95 °C for two minutes, denaturation at 94 °C and annealing at 49.7 °C for 45 seconds, extension (60
seconds) and a final extension (10 minutes) at 72 °C for before cooling at 4 °C were all included in each
cycle [15]. The PCR product was electrophoresed in 2% agarose by loading 2 µl of the product into
agarose wells and running the electrophoresis for 30 minutes at 100 volts. A UVITEC FIRERIDER V10
was used to see DNA. First Base Laboratories, Malaysia, picked the unique and brilliant DNA bands
for sequencing.
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
3
Figure 1. The geograpichal map of Clarias batrachus of 5 populations
Table 1. Clarias batrachus sample individuals for primer and secondary data from five populations
No.
Country/
population
Total
Sample
Total
Haplotype
1
Aceh
5
2
2
Thailand
10
3
3
India
10
3
4
Philippines
10
1
5
Java
9
6
2.4. Analysis of Mithocondrial DNA
To verify of taxonomic status, the sequence data underwent modifications and processing through
MEGA 11 software. The sequences were then compared using the results of the Basic Local Alignment
Search Tool (BLAST), and genetic distance was calculated using MEGA 11's Kimura-2 parameter
(K2P) model [16]. The phylogenetic tree was constructed using the Neighbour Joining (NJ) technique,
which makes use of the K2P model and 10.000x bootstrap. Moreover, DNASP 5.10 was utilized to
examine the haplotype distribution [17]. ARLEQUIN software was used to measure nucleotide diversity
(π), haplotype diversity (Hd), and DNA polymorphism.
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
4
3. Results and discussion
Fifteen haplotypes were identified from 44 sample sequences that were acquired from five groups. The
average fragment length of the samples was 504 bp. Within the Aceh population, 5 samples yielded 2
haplotypes, while 10 samples from Thailand and India produced 3 haplotypes. The Philippines
population, represented by 10 samples, exhibited 1 haplotype, and the Java population, represented by
9 samples, displayed 6 haplotypes. Nucleotide diversity varied from 0 to 0.005, while overall haplotype
diversity ranged from 0 to 0.917 across all groups. With a rating of 0.9, the Java population showed the
highest level of diversity, whereas the Philippines population had the lowest level of diversity, at 0.
Table 2 displays information on nucleotide diversity (π), haplotype diversity (Hd), and total haplotype
(Hn). Table 3 showed that the genetic distance between the closest populations was found to be 0.022
between the populations in Thailand and the Philippines, while the genetic distance between the
populations that were the furthest apart was found to be 0.113 between the populations in Aceh and
India.
Based on the analysis of phylogenetic relationships, it was shown that C. batrachus shared a common
ancestor, with all samples belonging to two main clades. The initial main clade further branched into
two subclades (Figure 3). The first subclade included Thailand and the Philippines, while the second
subclade comprised Aceh and Java. Meanwhile, India was clustered within the second main clade. The
population connectivity is depicted in Figures 2 and 4, revealing the absence of shared haplotypes among
all populations.
Table 2. The genetic diversity of C. batrachus from 5 populations
Species
Population
N
Genetic deversity
Hn
Hd
π
Clarias batrachus
Aceh
5
2
0,600
0,003
Thailand
10
3
0,511
0,001
India
10
3
0,378
0,001
Philippines
10
1
0,000
0,000
Java
9
6
0,917
0,005
Table 3. The genetic distance C. batrachus from 5 populations
No
Population
1
2
3
4
5
1
Aceh
0.003
2
Thailand
0.045
0.001
3
India
0.114
0.113
0.001
4
Philippines
0.047
0.022
0.107
0.000
5
Java
0.048
0.049
0.113
0.052
0.005
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
5
Figure 2. The haplotype networks of C. batrachus from 5 populations
Figure 3. The tree of phylogenetic individual of C. batrachus from 5 populations
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
6
Figure 4. The haplotypes distribution of C. batrachus from 5 population
The research demonstrated that the Java population exhibited the highest haplotype diversity,
registering a value of 0.917, whereas the Philippines population showed the lowest haplotype diversity,
recording a value of 0. According to Nei [18], haplotype diversity falling within the range of 0.1 to 0.4
is considered low, 0.5 to 0.7 is categorized as moderate, and 0.8 to 1.00 is deemed high. Thus, the
haplotype diversity of the Clarias batrachus population in Asia is generally categorized as moderate to
high. Additionally, Hendiari et al. [19] suggested that currents and geographic proximity have an impact
on high genetic diversity, while overexploitation and poor habitat conditions have an impact on low
genetic diversity within a population.
One primary clade that split into two sister clades is produced by reconstructing the phylogenetic
tree using 44 sequences from five populations in Aceh, Thailand, India, the Philippines, and Java. This
suggests that the ancestor was the source of the tight relationship between these populations. The genetic
separation between clades provided support for this phylogenetic tree [20]. The Java population had the
highest genetic distance (interspecific) between populations (0.005), while the populations in the
Philippines had the lowest (value of 0). According to Pilot et al. [21], populations with lower genetic
distance values have closer family ties, while populations with higher genetic distance values have
farther-reaching kinship ties.
By reconstructing the phylogenetic tree using 44 sequences from populations in Aceh, Thailand,
India, the Philippines, and Java, a single primary clade emerged, further dividing into two sister clades.
This suggests a close ancestral relationship among these populations. The phylogenetic tree findings are
corroborated by the genetic distance between the clades, as outlined by Thomas et al. [20]. The greatest
genetic distance within populations (interspecific) was observed in the Java population (0.005), while
the lowest was recorded in the Philippines population, with a value of 0. Pilot et al. [21] elucidate that
populations exhibiting lower genetic distance values signify a closer kinship, whereas a higher genetic
distance indicates a more distant kinship.
The examination of population connectivity revealed the absence of shared haplotypes among all
populations. As Saleky and Dailami [22] point out, population connectivity typically arises from shared
geographical locations and consistent current patterns. Nevertheless, in this case, there is no shared
haplotype observed between the Aceh population and other populations in Asian waters.
4. Conclusions
The genetic diversity of the Clarias batrachus population in Aceh is higher than Thailand, India, and
Philippines where the highest genetic diversity is found in the Java population. The fish population of
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
7
C. batrachus from Aceh still has a moderate level of genetic diversity. The C. batrachus fish population
found in Asia's inland waters does not share between all the populations.
Acknowledgments
Under contract number 583/UN11.2.1/PT.01.03/DRPM/2023, the PMDSU research scheme year
2023 provided funding for this study. For this reason, the authors are grateful to the Republic of
Indonesia's Minister of Education, Culture, Research, and Technology for providing funding for this
study.
References
[1] Muchlisin Z 2013 Potency of freshwater fishes in Aceh waters as a basis for aquaculture
development program Jurnal Iktiologi Indonesia 13 91-6
[2] Dewantoro G W and Rachmatika I 2020 Jenis ikan introduksi dan invasif asing di Indonesia
[3] Majhi S K, Kumar S, Maurya P K, Mohindra V and Lal K K 2020 Non-invasive method for
collection of Clarias magur (Hamilton, 1822) spermatozoa: A novel approach for catfish
domestication, aquaculture and conservation Aquaculture 519 734737
[4] Hamid N H, Daud H M, Kayansamruaj P, Hassim H A, Yusoff M S M, Bakar S N A and
Srisapoome P 2021 Short-and long-term probiotic effects of Enterococcus hirae isolated from
fermented vegetable wastes on the growth, immune responses, and disease resistance of hybrid
catfish (Clarias gariepinus× Clarias macrocephalus) Fish & Shellfish Immunology 114 1-19
[5] Mustikasari D, Nuryanto A and Suryaningsih S 2022 Phylogeography of Aplocheilus panchax
in Indonesia, with special focus on the Bangka Island population Biodiversitas 23
[6] Parvez I, Rumi R A, Ray P R, Hassan M M, Sultana S, Pervin R, Suwanno S and Pradit S 2022
Invasion of African Clarias gariepinus Drives Genetic Erosion of the Indigenous C. batrachus
in Bangladesh Biology 11 252
[7] Khedkar G D, Tiknaik A, Kalyankar A D, Khedkar C D, Ron T B and Haymer D 2016 Genetic
structure of populations and conservation issues relating to an endangered catfish, Clarias
batrachus, in India Mitochondrial DNA Part A 27 1181-7
[8] Hardianti C F, Tjong D H and Roesma D I 2022 Phylogenetic of Sumatran Clarias batrachus
based COI Gene Malaysian Journal of Science and Advanced Technology 212-5
[9] Avise J C 2009 Phylogeography: retrospect and prospect Journal of biogeography 36 3-15
[10] Ovenden J R, Berry O, Welch D J, Buckworth R C and Dichmont C M 2015 Ocean's eleven: a
critical evaluation of the role of population, evolutionary and molecular genetics in the
management of wild fisheries Fish and Fisheries 16 125-59
[11] Steinke D and Hanner R 2011 The FISH-BOL Collaborators' Protocol Mitochondrial DNA 22
10-4
[12] Grewe P M, Krueger C C, Aquadro C F, Bermingham E, Kincaid H L and May B 1993
Mitochondrial DNA Variation among Lake Trout (Salvelinus namaycush) Strains Stocked into
Lake Ontario Can. J. Fish. Aquat. Sci. 50 2397-403
[13] Bakar A A, Adamson E A S, Juliana L H, Nor Mohd S A, Wei-Jen C, Man A and Md D N 2018
DNA Barcoding of Malaysian Commercial Snapper Reveals an Unrecognized Species of The
Yellow-Lined Lutjanus (Pisces:Lutjanidae) PLoS One 13 1-12
[14] Ward R D, Zemlak T S, Innes B H, Last P R and Hebert P D 2005 DNA Barcoding Australia's
Fish Species Philos. Trans. R. Soc. B,: Biol. Sci. 360 1847-57
[15] Muchlisin Z A, Thomy Z, Fadli N, Sarong M A and Siti-Azizah M N 2013 DNA Barcoding of
Freshwater Fishes from Lake Laut Tawar, Aceh Province, Indonesia Acta Ichthyol. Pisc. 43 21-
9
[16] Tamura K, Stecher G, Peterson D, Filipski A and Kumar S 2013 MEGA6: molecular
evolutionary genetics analysis version 6.0 Mol. Biol. Evol. 30 2725-9
[17] Librado P and Rozas J 2009 DnaSP v5 : A Software for Comprehensive Analysis of DNA
Polymorphism Data Bioinformatics 25 1451-2
13TH-AIC-ELS
IOP Conf. Series: Earth and Environmental Science 1356 (2024) 012098
IOP Publishing
doi:10.1088/1755-1315/1356/1/012098
8
[18] Nei M 1987 Molecular evolutionary genetics (New York: Columbia University Press)
[19] Hendiari I G A D, Sartimbul A, Arthana I W and Kartika G R A 2020 Keragaman genetik ikan
lemuru (Sardinella lemuru) di wilayah perairan Indonesia Acta Aquat.: Aquat. Sci. J. 7 28-36
[20] Thomas S K, Liu X, Du Z Y, Dong Y, Cummings A, Pokorny L, Xiang Q Y and Leebens‐Mack
J H 2021 Comprehending Cornales: phylogenetic reconstruction of the order using the
Angiosperms353 probe set Am. J. Bot. 108 1112-21
[21] Pilot M, Dahlheim M E and Hoelzel A R 2010 Social cohesion among kin, gene flow without
dispersal and the evolution of population genetic structure in the killer whale (Orcinus orca) J.
Evol. Biol. 23 20-31
[22] Saleky D and Dailami M 2021 Konservasi genetik ikan kakap putih (Lates calcarifer, Bloch,
1790) melalui pendekatan DNA barcoding dan analisis filogenetik di sungai Kumbe Merauke
Papua Jurnal Kelautan Tropis 24 141-50
ResearchGate has not been able to resolve any citations for this publication.
Phylogenetic of Sumatran Clarias batrachus based COI Gene
Article
Full-text available
  • Dec 2022
Clarias batrachus is a species of fish that can be found in Sundaland. The separation of Sundaland resulted in the separation of the islands, one of which was the island of Sumatra. The island of Sumatra is divided into west and east sides by the Bukit Barisan mountains. So, it is necessary to study the phylogenetic of C. batrachus. The CO1 gene is one of the mtDNA genes that can be used for phylogenetic studies. This study was conducted to determine the geographical relationship to the phylogenetic relationship of C. batrachus populations in Sumatra and other populations in Southeast Asia using the CO1 gene and the relationship between geographic isolation in the eastern and western watersheds of Sumatra. Based on 504 bp of C. batrachus CO1 gene sequence and 19 comparison sequences, three sub-clusters with two subspecies were formed.
View
Phylogeography of Aplocheilus panchax in Indonesia, with special focus on the Bangka Island population
Article
Full-text available
  • Apr 2022
Mustikasari D, Nuryanto A, Suryaningsih S. 2022. Phylogeography of Aplocheilus panchax in Indonesia, with special focus on the Bangka Island population. Biodiversitas 23: 2035-2046. Previous studies divided Blue panchax, Aplocheilus panchax into three different clades, namely West (W), Central (C), and East (E) clades. Blue panchax populations from Indonesia belong to the Central and East clades. However, that study did not include blue panchax samples from pits with harsh conditions in Bangka Island, Indonesia. Therefore, this study aimed to assess the phylogeography of blue panchax in Indonesia with a special focus on the Bangka Island population using the cytochrome c oxidase 1 (COI) gene. The results showed that genetic distance within Bangka Island population was less than 2%, while genetic distances between Bangka population and other populations were ranged from 103.87% to 122.10%. There was also a clear genetic gap between the Bangka and other populations, with the minimum gap was 101.94%. Furthermore, the seventy-nine sequences analyzed resulted 28 haplotypes with genetic variability of 0.221 for nucleotide diversity (p), 0.923 for Haplotype diversity (Hd), 68.028 for Fu’s Fs-test, 2.00 (P < 0.02) for Fu and Li’s D-test, and 2.365 (P < 0.02) for Fu and Li’s F-test; and 1.927 for Tajima's D test (0.10 > P > 0.05). The Bangka population of Aplocheilus panchax established a distinct clade from the Western (W), Eastern (E), and Central (C) clades. Molecular data established that the population on Bangka Island is a novel clade for Indonesia and a global blue panchax phylogeographic.
View
Invasion of African Clarias gariepinus Drives Genetic Erosion of the Indigenous C. batrachus in Bangladesh
Article
Full-text available
  • Feb 2022
Simple Summary Bangladesh has substantially increased aquaculture production over the last few decades, and the exotic species share a significant portion of the total fish production. Although exotic species are contributing to aquaculture production, a few of them are causing biodiversity loss and genetic erosion of native species. The African catfish Clarias gariepinus is a highly carnivorous species and predates small indigenous freshwater fishes when escaping into natural water bodies. In addition, the hybridization of C. batrachus and C. gariepinus is considered a threat to the indigenous population. Although the government of Bangladesh has banned the farming of C. gariepinus, this species has been identified in local markets, and evidence of hybridization between C. gariepinus and C. batrachus has been found. This study revealed genetic erosion of native C. batrachus by the gene sequences of cytochrome c oxidase subunit I and cytochrome b. The phylogenetic tree confirmed the occurrences of hybridization between C. gariepinus and C. batrachus. Genetic erosion in the native catfish population is alarming for aquaculture sustainability and biodiversity conservation in Bangladesh. Abstract The African catfish Clarias gariepinus has been introduced for aquaculture in Bangladesh due to the scarcity of indigenous C. batrachus fingerlings. However, the government of Bangladesh has banned the farming of C. gariepinus due to the carnivorous nature of this species. Recently C. gariepinus has been reported by fish farmers and consumers in Bangladesh, and unplanned hybridization between native and exotic species has been suspected. This study attempts to know the purity of C. batrachus by analyzing mitochondrial genes. Both directly sequenced and retrieved Cytochrome C Oxidase subunit I (COI) and cytochrome b (Cytb) genes from C. gareipinus and C. batrachus were analyzed by MEGA software. The morphologically dissimilar C. batrachus showed the least genetic distance (0.295) from C. gariepinus, which provided evidence of hybridization between the two species. Maximum likelihood (ML) phylogenetic trees showed that C. batrachus from Bangladesh did not cluster with C. batrachus of other countries, instead C. batrachus clustered with the exotic C. gariepinus. The suspected hybrid formed sister taxa with the exotic C. gariepinus. The study corroborates the genetic deterioration of C. batrachus by unplanned hybridization with the invasive C. gariepinus. Unplanned hybridization has deleterious consequences; therefore, immediate action is necessary for aquaculture sustainability and biodiversity conservation in Bangladesh.
View
Comprehending Cornales: phylogenetic reconstruction of the order using the Angiosperms353 probe set
Article
Full-text available
  • Jul 2021
Premise: Cornales is an order of flowering plants containing ecologically and horticulturally important families, including Cornaceae (dogwoods) and Hydrangeaceae (hydrangeas), among others. While many relationships in Cornales are strongly supported by previous studies, some uncertainty remains with regards to the placement of Hydrostachyaceae and to relationships among families in Cornales and within Cornaceae. Here we analyzed hundreds of nuclear loci to test published phylogenetic hypotheses and estimated a robust species tree for Cornales. Methods: Using the Angiosperms353 probe set and existing data sets, we generated phylogenomic data for 158 samples, representing all families in the Cornales, with intensive sampling in the Cornaceae. Results: We curated an average of 312 genes per sample, constructed maximum likelihood gene trees, and inferred a species tree using the summary approach implemented in ASTRAL-III, a method statistically consistent with the multispecies coalescent model. Conclusions: The species tree we constructed generally shows high support values and a high degree of concordance among individual nuclear gene trees. Relationships among families are largely congruent with previous molecular studies, except for the placement of the nyssoids and the Grubbiaceae-Curtisiaceae clades. Furthermore, we were able to place Hydrostachyaceae within Cornales, and within Cornaceae, the monophyly of known morphogroups was well supported. However, patterns of gene tree discordance suggest potential ancient reticulation, gene flow, and/or ILS in the Hydrostachyaceae lineage and the early diversification of Cornus. Our findings reveal new insights into the diversification process across Cornales and demonstrate the utility of the Angiosperms353 probe set.
View
Konservasi Genetik Ikan Kakap Putih (Lates calcarifer, Bloch, 1790) Melalui Pendekatan DNA Barcoding dan Analisis Filogenetik di Sungai Kumbe Merauke Papua
Article
Full-text available
  • May 2021
Genetic data is very important as the basis for fisheries management and conservation related to connectivity between regions and population structure. White snapper Fish is one of the fish that has high economic value which is utilized either by its meat or by its swim bladder. This research was aimed to identify the species of white snapper fish were collected from the Kumbe River, Merauke Regency, Papua using the Cytochrome Oxidase I gene. The results shows that this sample is a species of Lates calcarifer, Bloch, 1790 with 100% similarity. The haplotype of white snapper fish from Merauke has similarities with the haplotype from Australia, Malaysia and China, this indicating that there is gene flow and connectivity among those locations. The phylogenetic tree explains the grouping of species based on genetic distance and the level of DNA Sequences similarities. Molecular approach can be used in the management and conservation of fish with high economic value.
View
Keragaman genetik ikan lemuru (Sardinella lemuru) di wilayah perairan Indonesia
Article
Full-text available
  • Apr 2020
Ikan Lemuru (Sardinella lemuru) merupakan komoditas perikanan pelagis yang sangat bernilai ekonomis dikalangan masyarakat Indonesia. Ikan Lemuru memiliki kelebihan yaitu keberadaannya yang berlimpah di perairan lau Indonesia, harganya yang sangat murah serta kandungan omega-3 yang sangat baik untuk tubuh. Kebutuhan akan ikan lemuru (Sardinella lemuru) yang tinggi menyebabkan tingginya angka penangkapan komoditas ini di perairain, sehingga dapat menyebabkan resiko penurunan jumlah populasi dialam. Pengelolaan yang tepat pada komoditas ini tentunya diperlukan akan dapat meminimalisir resiko yang dapat terjadi. Pengelolaan akan dapat terlaksana dengan tepat apabila berdasarkan atas data informasi yang memadai, salah satunya adalah informasi mengenai keragaman genetiknya. Kajian ini mengumpulkan pustaka dari penelitian terdahulu mengenai keragaman genetik ikan lemuru (Sardinella lemuru) di Wilayah Perairan Indonesia untuk dapat memberikan gambaran mengenai keragaman Ikan Lemuru dari segi genetiknya. Nilai keragaman genetik dilihat dari nilai keragaman haplotipe (Hd) karena keduanya memiliki kolerasi yang positif untuk menggambarkan keragaman genetik dari suatu komoditas. Hasil kajian memperlihatkan nilai keragaman genetik ikan lemuru (Sardinella lemuru) di Wilayah Perairan Indonesia memiliki nilai yang termasuk kategori tinggi. Hasil ini menggambarkan bahwa ditengah tingginya kegiatan penangkapan, ikan lemuru (Sardinella lemuru) secara genetik masih memiliki keragaman yang tinggi sehingga dimungkinkan komoditas Ikan Lemuru memiliki adaptasi yang tinggi terhadap kondisi lingkungan. Kata kunci: Sardinella lemuru, keragaman genetik, keragaman haplotipe Sardinella lemuru is pelagic commodities that have economic values for the Indonesian. S. lemuru has some of the major advantages, such as much population on Indonesian marine, low price, and has Omega-3 for the human body. The high demands of Lemuru Fish cause a high rate of cached, that can cause the risk of population degradation. Proper management of these commodities are needed to decrease the risk impact, that can be done rightly based on the equal value of information, and one of them is genetic diversity. This research compiles the recent researches about the genetic diversity of the Sardinella lemuru in Indonesian to get the explanation about Lemuru Fish diversity. The value of genetic diversity observed is based on the diversity value of Haplotype (Hd), because these two values have a positive correlation to make a whole representation from a commodity. The results of this review show that the genetic diversity of Lemuru Fish on Indonesian marine territorial has the high-value category. These results explain that in the high activities of fishing, Lemuru Fish genetically still have a high diversity that leads to the conclusion Lemuru Fish commodities has a high-level ability to adapt from environmental conditions. Keywords: Sardinella lemuru; genetic diversity; haplotype diversity
View
DNA barcoding of Malaysian commercial snapper reveals an unrecognized species of the yellow-lined Lutjanus (Pisces:Lutjanidae)
Article
Full-text available
Management of wild fisheries resources requires accurate knowledge on which species are being routinely exploited, but it can be hard to identify fishes to species level, especially in speciose fish groups where colour patterns vary with age. Snappers of the genus Lutjanus represent one such group, where fishes can be hard to identify and as a result fisheries statistics fail to capture species-level taxonomic information. This study employs traditional morphological and DNA barcoding approaches to identify adult and juvenile Lutjanus species harvested in Malaysian waters. Our results reveal a suite of species that differs markedly from those that have previously been considered important in the Malaysian wild-capture fishery and show that official fisheries statistics do not relate to exploitation at the species level. Furthermore, DNA barcoding uncovered two divergent groups of bigeye snapper (‘Lutjanus lutjanus’) distributed on either side of the Malay Peninsula, displaying a biogeographical pattern similar to distributions observed for many co-occurring reef-distributed fish groups. One of these bigeye snapper groups almost certainly represents an unrecognized species in need of taxonomic description. The study demonstrates the utility of DNA barcoding in uncovering overlooked diversity and for assessing species catch composition in a complicated but economically important taxonomic group.
View
Genetic structure of populations and conservation issues relating to an endangered catfish, Clarias batrachus, in India
Article
Full-text available
  • Jul 2014
  • MITOCHONDR DNA
The Asian catfish, Clarias batrachus (Linnaeus, 1758), is a highly valued species endemic to India that is currently in drastic decline in most of its natural habitat. The present study was undertaken to document the genetic structure of populations of this species using mitochondrial DNA markers, specifically from the cytochrome B and D-loop regions. Specimens from eight wild populations were collected and analyzed from different regions in India. The genetic variation within and among populations was evaluated using a range of descriptive statistics. The analysis described here provides a broad and consistent view of population structure and demographic history of populations of C. batrachus. Although there was some genetic structuring consistent with regional differences, all eight populations examined here showed relatively low levels of genetic variation in terms of both haplotype and nucleotide diversities in the different analyses used. However, a number of private haplotypes were discovered, and this may provide valuable information for future selective breeding program and conservation management. The results may aid in the design and implementation of strategies for the future management of this endangered catfish C. batrachus in India.
View
Short- and Long-term Probiotic Effects of Enterococcus hirae Isolated from Fermented Vegetable Wastes on the Growth, Immune Responses, and Disease Resistance of Hybrid Catfish (Clarias gariepinus × Clarias macrocephalus)
Article
  • Apr 2021
  • FISH SHELLFISH IMMUN
This study evaluated the short- and long-term effects of dietary supplementation with Enterococcus hirae strain UPM02 on the growth performance, immunity, and disease resistance of hybrid catfish (Clarias gariepinus × Clarias macrocephalus) against Aeromonas hydrophila infection. In the long-term trial, fingerling fish were fed diets containing 0 (control), 2×10⁵, or 2×10⁷ CFU/g E. hirae UPM02 for 120 days. Administration of E. hirae UPM02 had significant effects on the specific growth rate (SGR), feed utilization efficiency, body indices (P<0.05), and gut villus physiology of the catfish. E. hirae UPM02 application also significantly increased the complete blood cell counts, phagocytic activity, respiratory burst, lysozyme activity, and alternative complement pathway hemolytic (ACH50) activity in tested catfish throughout the experimental periods (P<0.05). Dietary E. hirae UPM02 at both concentrations significantly increased the expression levels of the alpha-2-macroglobulin (α2M), CC chemokines, CXC chemokines, lysozyme c (LYZC), myeloperoxidase (MYE), NF-kappa-B1 p105 subunit (NF-K), and bactericidal permeability-increasing protein (BPIP) genes in the head kidney, liver, and spleen (P<0.05) at days 80, 100 and 120 after application. However, heat shock protein 70 (HSP70) gene expression was slightly downregulated in these organs. Interestingly, fish fed the diets containing 2×10⁵ and 2×10⁷ CFU/g E. hirae UPM02 exhibited a significantly lower (P<0.05) postchallenge mortality rates (32% and 30%, respectively) after 14 days of A. hydrophila challenge than the control fish (58%). In short-term (28 days) application to juvenile catfish, the two concentrations of E. hirae did not affect all growth parameters. Nevertheless, these concentrations markedly elevated all tested immune parameters, similarly to long-term application. Immune-related gene expression was significantly upregulated at day 28 in the head kidney, at day 14 in the liver, and at day 7 in the spleen in fish treated with the two concentrations of the probiotics (P<0.05). Mortality at 14 days after challenge with A. hydrophila in the groups receiving the two concentrations of the probiotic was significantly lower than that in the control group, at 28, 24, and 48%, respectively (P<0.05). These results collectively suggest that dietary supplementation with E. hirae UPM02 at 2×10⁵ and 2×10⁷ CFU/g effectively influenced immune responses, enhanced disease protection, and stimulated immunity-related gene expression in hybrid catfish under both short- and long-term application. However, growth enhancement was significantly evidenced with long-term application only.
View
Non-invasive method for collection of Clarias magur (Hamilton, 1822) spermatozoa: A novel approach for catfish domestication, aquaculture and conservation
Article
  • Nov 2019
  • AQUACULTURE
The current practice of captive breeding of Clarias magur involves killing male fish to obtain sperm for fertilisation. The sperm cannot be obtained by hand stripping because of the extremely low volume of seminal fluid in the testis. This sacrificial method of seed production has been applied to most catfish species. In this study, we reported an alternative approach that allowed harvesting of C. magur spermatozoa for artificial fertilisation without sacrificing male fish. Sexually mature C. magur males were anaesthetised and placed on the surgery table. A midline incision of 2.5 cm was made on the abdomen, and the testicular lobes were carefully lifted from the coelomic cavity. Using sterilised scissors and forceps, the testicular tissue was partially harvested, weighed to nearest 0.01 g, and macerated using a mortar and pestle in physiological saline. The abdominal incision was stitched using a surgical thread and topically treated with antimycotic ointment; subsequently, the fish were resuscitated in clean oxygenated water. Using the surgical technique, we harvested a maximum of 283 mg of testicular tissue, which corresponded to a count of 9.0 × 10⁸ spermatozoa/mL, from a male fish weighing 210 g. By using the sacrificial approach, a maximum of 500 mg of testicular tissue, corresponding to a count of 16.0 × 10⁸ spermatozoa/mL, was recovered from a male fish weighing 220 g. The surgically obtained spermatozoa were used to inseminate C. magur eggs; the cross resulted in healthy spawn with a fertilisation rate of 80%–98%. The results were similar to those obtained using the conventional sacrificial approach, which indicated the viability of partial surgical harvest of testicular tissue in seed production in C. magur for aquaculture without sacrificing male fish.
View