Mitochondrial DNA and Y chromosome reveal the genetic structure of the native Polish Konik horse population

Abstract

Polish Konik remains one of the most important horse breeds in Poland. The primitive, native horses with a stocky body and mouse-like coat color are protected by a conservation program, while their Polish population consists of about 3,480 individuals, representing 16 dam and six sire lines. To define the population's genetic structure, mitochondrial DNA and Y chromosome sequence variables were identified. The mtDNA whole hypervariable region analysis was carried out using the Sanger sequencing method on 233 Polish Koniks belonging to all dam lines, while the Y chromosome analysis was performed with the competitive allele-specific PCR genotyping method on 36 horses belonging to all sire lines. The analysis of the mtDNA hypervariable region detected 47 SNPs, which assigned all tested horses to 43 haplotypes. Most dam lines presented more than one haplotype; however, five dam lines were represented by only one haplotype. The haplotypes were classified into six (A, B, E, J, G, R) recognized mtDNA haplogroups, with most horses belonging to haplogroup A, common among Asian horse populations. Y chromosome analysis allocated Polish Koniks in the Crown group, condensing all modern horse breeds, and divided them into three haplotypes clustering with coldblood breeds (28 horses), warmblood breeds (two horses), and Duelmener Pony (six horses). The clustering of all Wicek sire line stallions with Duelmener horses may suggest a historical relationship between the breeds. Additionally, both mtDNA and Y chromosome sequence variability results indicate crossbreeding before the studbooks closure or irregularities in the pedigrees occurred before the DNA testing introduction.

Full text

Mitochondrial DNA and Y chromosome
reveal the genetic structure of the native
Polish Konik horse population
Adrianna Dominika Musiał
1
, Lara Radović
2,3
, Monika Stefaniuk-
Szmukier
1
, Agnieszka Bieniek
1
, Barbara Wallner
2
and
Katarzyna Ropka-Molik
1
1Department of Animal Molecular Biology, National Research Institute of Animal Production,
Balice, Poland
2Institute of Animal Breeding and Genetics, University of Veterinary Medicine Vienna, Vienna,
Austria
3Vienna Graduate School of Population Genetics, University of Veterinary Medicine Vienna,
Vienna, Austria
ABSTRACT
Polish Konik remains one of the most important horse breeds in Poland.
The primitive, native horses with a stocky body and mouse-like coat color are
protected by a conservation program, while their Polish population consists of about
3,480 individuals, representing 16 dam and six sire lines. To define the population’s
genetic structure, mitochondrial DNA and Y chromosome sequence variables were
identified. The mtDNA whole hypervariable region analysis was carried out using the
Sanger sequencing method on 233 Polish Koniks belonging to all dam lines, while the
Y chromosome analysis was performed with the competitive allele-specific PCR
genotyping method on 36 horses belonging to all sire lines. The analysis of the
mtDNA hypervariable region detected 47 SNPs, which assigned all tested horses to
43 haplotypes. Most dam lines presented more than one haplotype; however, five
dam lines were represented by only one haplotype. The haplotypes were classified
into six (A, B, E, J, G, R) recognized mtDNA haplogroups, with most horses
belonging to haplogroup A, common among Asian horse populations. Y
chromosome analysis allocated Polish Koniks in the Crown group, condensing all
modern horse breeds, and divided them into three haplotypes clustering with
coldblood breeds (28 horses), warmblood breeds (two horses), and Duelmener Pony
(six horses). The clustering of all Wicek sire line stallions with Duelmener horses may
suggest a historical relationship between the breeds. Additionally, both mtDNA and
Y chromosome sequence variability results indicate crossbreeding before the
studbooks closure or irregularities in the pedigrees occurred before the DNA testing
introduction.
Subjects Biodiversity, Conservation Biology, Genetics, Molecular Biology, Population Biology
Keywords Polish Konik, mtDNA, Y chromosome, SNPs, Diversity, Horse breeding, Primitive horse
breed, Hypervariable region, MSY region
How to cite this article MusiałAD, RadovićL, Stefaniuk-Szmukier M, Bieniek A, Wallner B, Ropka-Molik K. 2024. Mitochondrial DNA
and Y chromosome reveal the genetic structure of the native Polish Konik horse population. PeerJ 12:e17549 DOI 10.7717/peerj.17549
Submitted 28 December 2023
Accepted 20 May 2024
Published 20 June 2024
Corresponding author
Adrianna Dominika Musiał,
adrianna.musial@iz.edu.pl
Academic editor
Syed Ahmad
Additional Information and
Declarations can be found on
page 18
DOI 10.7717/peerj.17549
Copyright
2024 Musiałet al.
Distributed under
Creative Commons CC-BY 4.0

INTRODUCTION
Polish Konik (Polish Primitive Horse; Fig. 1) is one of the most important native horse
breeds of Poland. The Polish Konik horse, like many other primitive breeds, presents traits
such as good health and high fertility, resilience, and adaptability to life in forest conditions
(Hendricks, 2007;Doboszewski et al., 2017). Its body is strong and stocky, with a primitive
mouse-grey coat color and characteristic black stripe along the back (Janczarek, Pluta &
Paszkowska, 2017). The Polish Koniks are good working horses and are especially valued
in gardening farms (Hendricks, 2007), where the beneficial effects of grazing have been
proven for plants and rare bird populations (Doboszewski et al., 2017). They also take a
part in nature conservation being used for rewilding processes and habitat protection
(Reke, Zarina & Vinogradovs, 2019). On the other hand, due to its gentleness and docility,
this breed is also used for riding (Hendricks, 2007). Thanks to its advantages, Polish Konik
studs can be found not only in Poland but also abroad, under stable and reserve
management or used as recreational mounts in countries such as the Netherlands,
Germany, Latvia, Belgium, and the UK (Gorecka-Bruzda et al., 2020).
Polish Konik horses are bred in traditional studs and semi-feral/free-roaming groups
like in the forest sanctuary of Popielno Research Station (Poland) and are considered a
valuable genomic resource (Gorecka-Bruzda et al., 2020;Wolc & Bali
nska, 2010). Although
the population has increased in recent years, it is still limited. Due to their low census
population size, genetic resource conservation programs are established to maintain
population size, genetic diversity, and preserve this endangered breed (Jaworski &
Tomczyk-Wrona, 2019;Pasicka, 2013).
Despite the importance of this native breed, the origin of the Polish Konik has not been
clearly explained so far. The most common theory assumes that Polish Koniks are the
direct descendent of the European wild horse—the Tarpan, a species that inhabited the
forests of Europe and became extinct in the 19th century (Pasicka, 2013). However, in
recent years, the direct descent of the Polish Konik from the Tarpan has been highly
debated. Lovasz, Fages & Amrhein (2021) suggest that it is a manmade myth that hinders
effective breed conservation management. Recent advances in the field of ancient DNA
analysis showed that the Tarpan, referred to as the last wild horse, was also a representative
of a cluster of domestic horses that spread from 2,200 BC onwards to the second
millennium BC, and were a source of modern horses. The results shattered the common
hypothesis of Tarpans as the wild ancestors of modern horses or hybrids with Przewalski
horses (Librado et al., 2021), making the uncovering of Polish Konik origin an important
and difficult challenge to solve.
Although a century has passed since the Polish Konik began to be the object of interest
of researchers, there is still no clear information about the origin of the breed. The first
research conducted on the Polish Koniks was carried out in 1914 and suggested the
presence of primitive horses, resembling Tarpans, near the city of Biłgoraj (Lublin
Voivodeship, Poland). In the 1920s, the name “Polish Konik”was introduced into
literature by Prof. Tadeusz Vetulani, who played an outstanding role in starting the stud
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 2/22

breeding of horses. The history of breeding dates back to 1923, when Polish Koniks were
placed in the Janów Podlaski stud, and the following years saw the opening of several new
studs. Unfortunately, the progress in breeding was interrupted by World War II, when
most of the Polish Koniks were taken to Germany or were lost (Tomczyk-Wrona, 2022).
After the end of the war, plenty of efforts were made to restore the population of Polish
Koniks and resume their breeding; however, most of the horses did not have documented
origins. The supervision of the Polish Koniks breeding led to the publication of the first
“Studbook of Polish Koniks”in 1962, and in 1984 the studbooks became closed, which
eliminated the possibility of crossing with individuals of other horse breeds, and breeding
is conducted in a pure breed (Mackowski et al., 2015;Tomczyk-Wrona, 2022).
The current population of the Polish Konik registered in the studbook (data for 2022)
consists of ~3,480 individuals: ~1,760 mares, 183 stallions, and ~1,540 foals. Over the last
15 years, the number of stallions has not changed significantly; a slight increase in their
numbers was noted at the beginning of the 21
st
century. In the case of Polish Konik mares,
the number of horses has doubled since 2010 and has almost quadrupled since 2005 due to
the breeding approach and subsidies granted mainly for breeding mares (Polish Horse
Breeders Association, 2022). All Polish Koniks come from 35 female lines, of which 19
became extinct and only 16 are currently active: Liliputka I (1920), Karolka (1933), Zaza
(1933), Urszulka (1934), Tarpanka I (1937), Traszka (unknown), Tunguska (1949),
Figure 1 Polish Konik in Roztocza
nski National Park, Poland (photo credit: Adrianna Musiał).
Full-size

DOI: 10.7717/peerj.17549/fig-1
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 3/22

Tygryska (1928), Popielica (1937), Wola (1943), Białka (1944), Ponętna (1946),
Misia II (1948), Dzina I (unknown), Bona (1954), and Geneza (1965); (Jaworski, 1997).
The first seven lines showed a clear progression in the last years, while the remaining
lines show only slight progression or stagnation. Horses belonging to the three most
numerous dam lines (Traszka, Tarpanka I, and Zaza) make up more than half of all the
individuals. Due to the persistent state of stagnation, the lines originating from the
mares Bona, Ponętna, Misia II, Geneza, and Białka are threatened with extinction. The
Polish Konik males are distinguished into six lines, which were founded by the
stallions: Chochlik (1940), Goraj (1935), Glejt I (1944), Wicek (<1930), Liliput (1918),
and Myszak (1937), of which the Liliput and Glejt I lines are the least numerous
(Tomczyk-Wrona, 2022).
Recently, mitochondrial DNA and Y chromosome diversity studies using Single
Nucleotide Polymorphism (SNP) have started to play an increasing role in population
genetics including horse genetics. The genetic information is transmitted as a single
haplotype (HT) block, which mirrors dam and sire line history. Thus, we can easily detect
pedigree incongruences since all individuals from a certain line (sire or dam) should have
the same haplotype (Hutchison et al., 1974;Liu, 2010).
The polymorphisms present in the mitochondrial DNA D-loop sequence made it
possible to distinguish the dam lines and identify the genetic diversity, as well as maternal
ancestry and relationships, in many different horse breeds, like Arabian horses (Khanshour
& Cothran, 2013), Thoroughbreds (Yoon et al., 2018), Cleveland Bay horses (Dell et al.,
2020), Tibetan horses (Yang et al., 2018), Holstein horses (Engel et al., 2021), Polish Draft
horses (Myćka et al., 2022), or Hucul horses (Czerneková, Kott & Majzlík, 2013). The part
of the mitochondrial DNA used in most diversity research is hypervariable region 1
(HVR1), localized in the D-loop. Since the early 2000s, single individuals of Polish Konik
have started to be included in multi-breed studies of mtDNA variation (Cothran, Juras &
Macijauskiene, 2005;Kusza et al., 2013;Cieślak et al., 2017). However, a complete analysis
of all present Polish Konik dam lines has not been performed so far.
Regarding paternal ancestry, the researchers focus on the Y chromosome male-specific
region (MSY), which is inherited without recombination from fathers to sons (Jobling &
Tyler-Smith, 2017) and allows tracing the sire lines (Felkel et al., 2019;Radovic et al., 2021).
Previous efforts established the possibility of exploiting the variation present in the MSY
region to identify the diversity of sire lines as well as illustrate male lineages’demographic
history (e.g., Remer et al., 2022). Currently, MSY variation (>3,000 variants) groups
modern domesticated stallions tested so far into one 1,500-year-old haplogroup–the
Crown (daC). Only a handful of remote horse breeds carry haplotypes beyond the Crown
(Bozlak et al., 2023;Felkel et al., 2018), classified as Non Crown.
Here, we investigate the current genetic diversity of Polish Konik maternal and paternal
lines using uniparental markers. The aim of this research was the investigation of the
Polish Konik population structure in terms of dam and sire lines, based on the analysis of
the mtDNA whole D-loop sequence as well as the analysis of selected Y chromosomal
markers.
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 4/22

MATERIALS AND METHODS
Founder lines sampling
The variability of mitochondrial DNA D-loop sequence was examined in 233 Polish
Koniks belonging to all 16 dam founding lines: Białka (nine individuals), Dzina I (14),
Geneza (six), Karolka (17), Liliputka I (19), Misia II (six), Ponętna (10), Popielica (11),
Tarpanka I (20), Traszka (44), Tunguska (13), Tygryska (seven), Urszulka (22), Wola (11),
Zaza (21), and Bona (three). The number of analysed horses constituted approximately
7.3% of the total active Polish Konik population, and the share of individual dam lines
included in the research was also proportional to the total number of horses belonging to
each dam line. MSY variability was analysed in 36 stallions selected from the individuals
above and belonged to all six sire founding lines: Goraj (six individuals), Liliput (six),
Wicek (six), Glejt I (six), Chochlik (six), and Myszak (six). The lines were assigned to the
horses based on pedigree data, and all analysed animals were available in the pedigree
database of the Polish Horse Breeders Association. The material used in this study were
hair follicles and blood samples that came from a genetic material bank of the National
Research Institute of Animal Production, Poland.
DNA isolation
The DNA extraction was made using the Sherlock AX kit (A&A Biotechnology, Gda
nsk,
Poland) according to the manufacturer’s protocol, and DNA quality was determined by
checking concentration and purity on the NanoDrop 2000 spectrophotometer (Thermo
Fisher Scientific, Waltham, MA, USA). DNA samples with concentration >40 ng/µl and
purity (A260/A280) between 1.8–2.0 were qualified for the next steps and stored at −20 C.
Mitochondrial DNA analysis
For the amplification of the mitochondrial DNA D-loop hypervariable region 1 and
hypervariable region 2, three pairs of primers were designed based on the GenBank Equus
caballus reference sequence: NC_001640 (Table 1). PCR products covered a total region of
1,062 bp. Amplification was performed on all 233 individuals using the Phanta Ready Mix
(Vazyme Biotech, Nanjing, China) according to the instructions. To check the specificity of
the obtained products, the separation on the 3% agarose gel with the ethidium bromide
addition, along with a DNA length marker–Marker1 100–1,000 bp (A&A Biotechnology,
Gda
nsk, Poland), was performed (120 V, 30 min.). PCR products were cleaned from
primers and free nucleotides with the enzymatic method using the EPPiC Fast reagent
(A&A Biotechnology, Gda
nsk, Poland) and used as a template for sequencing by the
Sanger method. The PCR for the sequencing reaction was performed on 233 individuals
for each amplicon (699 samples in total) with the BigDye Terminator v3.1 Cycle
Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the
instructions, and the products were repurified with the BigDye XTerminator Purification
Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the protocol. The
capillary electrophoresis was performed on 3500xL Genetic Analyzer (Thermo Fisher
Scientific, Applied Biosystems, Foster City, CA, USA) using POP-7TM Polymer for 3500/
3500xL (Thermo Fisher Scientific, Applied Biosystems, Foster City, CA, USA). The results
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 5/22

in the form of chromatograms were analysed using BLAST (Altschul et al., 1990), FinchTV
1.3.0 (Geospiza, Inc., Seattle, WA, USA), DnaSP 5.10.01 (Librado & Rozas, 2009), and
Variant Analysis application (Thermo Fisher Scientific Cloud, Waltham, MA, USA) and
compared with a GenBank reference sequence NC_001640.
The SNPs made it possible to identify individual haplotypes and all the sequences were
subjected to phylogenetic analysis. The phylogenetic tree illustrating the variability of
analysed mitochondrial DNA fragments was constructed using Mega 11.0.13 software
(Tamura, Stecher & Kumar, 2021) and iTOL 6.8.1 (Letunic & Bork, 2021) with the
neighbor-joining method (Saitou & Nei, 1987), including 1,000 bootstrap replications.
To visualize the connections between all mtDNA HTs of Polish Koniks, the
median-joining network (Bandelt, Forster & Röhl, 1999) was constructed in the PopART
phylogenetic software (https://popart.maths.otago.ac.nz/, accessed September 2023).
Haplotypes found within the studied Polish Konik population were compared with
sequences stored in the GenBank database using BLAST (Altschul et al., 1990), and the
similarities between Polish Konik population HTs with other breeds have been described.
The sequences representing haplogroups published by Achilli et al. (2012) were found
among the BLAST results. The sequence with the highest similarity percentage was
selected, and its haplogroup was checked to categorize the identified Polish Konik
haplotypes into the haplogroups.
Y chromosome analysis
Y chromosomal haplotypes were determined for 36 Polish Koniks, representing all six
founding sire lines. For haplotyping, a downscaled haplotype structure of the most recent
horse Y phylogeny was constructed (Bozlak et al., 2023) based on 114 selected variants (92
in the Crown and 22 Non-Crown, see Table S1) that determine 115 HTs. In a hierarchical
manner (as described by Remer et al. (2022)), allelic states of variants in the downscaled
haplotype structure were determined via the competitive allele-specific PCR (KASPTM,
www.lgcgroup.com) genotyping method under the standard KASP
TM
genotyping protocol
(lgcgroup.com). The analysis was performed on a CFX96 Touch
Ò
BioRad Real-Time PCR
machine. In addition to Polish Konik samples, each reaction included two positive controls
with known allelic states and two negative controls, including female DNA and water.
In two individuals, the tetranucleotide microsatellite fBVB (GATA14/GATA15) was
screened following Felkel et al. (2019) and Remer et al. (2022).
Table 1 Primer sequences and length of the amplicons.
Primer Sequences (5′→3′) Length (bp)
amp1 F: AACGTTTCCTCCCAAGGACT
R: GTAGTTGGGAGGGTTGCTGA
397
amp2 F: ACCCCATCCAAGTCAAATCA
R: CAGGTGCACTTGTTTCCTATG
462
amp3 F: ACCTACCCGCGCAGTAAGCAA
R: ACGGGGGAAGAAGGGTTGACA
306
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 6/22

Raw data were analysed with Bio-Rad CFX Manager 3.1
Ò
software (BioRad). The allelic
states of all tested variants were catenated, while the allelic states of variants that were not
tested were imputed according to the published HT structure (Bozlak et al., 2023, see
Table S2). For visualization, a median-joining haplotype network was constructed with the
program Network 10.2 (Bandelt, Forster & Röhl, 1999), and the output was redrawn as a
haplotype frequency plot with Canva Pro (Canva, https://www.canva.com/pro/, accessed
August 2023).
RESULTS
Mitochondrial DNA variability
The whole mitochondrial DNA hypervariable region 1 and hypervariable region 2
sequences were determined in 233 Polish Konik horses using Sanger sequencing of three
PCR products (Table S3). The alignment of three Sanger sequencing products revealed the
entire mitochondrial DNA hypervariable region for each horse, allowing comparison with
a publicly available reference sequence (NC_001640) and between all samples. Cutting the
obtained sequences from the location of the first identified SNP (15,542 bp) to the last one
(16,611 bp) led to the receiving of 1,070 bp fragments, whose analysis detected 47 variable
sites. The analysis in DnaSP indicated a nucleotide diversity result of 0.010, and the average
number of nucleotide differences of 11.104. The 43 mtDNA HTs were defined in Polish
Konik samples and reported to the GenBank database, where received accession numbers
OR827103–OR827145 (Table 2). The haplotype diversity amounted to 0.96.
Among the considered dam lines, 11 of 16 lines presented more than one HT (Table 2).
The exceptions were Białka, Bona, Dzina I, Popielica, and Tunguska maternal lines, in
which all examined individuals presented the same, unique haplotype. On the other hand,
in both Traszka and Zaza lines, there were six different HTs. Some of the haplotypes were
recognized in two different lines: HT9 in Karolka and Ponętna lines, HT33 in Tygryska
and Zaza, HT6 in Karolka and Liliputka I, HT20 in Tarpanka I and Zaza, and HT19 in
Tarpanka I and Popielica. Compared to the reference sequence, the most nucleotide
differences were found in HT18 (Ponętna) and HT39 (Wola) HTs–22 SNPs. Only one
nucleotide difference from the reference sequence was found in HT22 (Tarpanka) and
HT30 (Tunguska) HTs. Out of 47 detected SNP positions, there was one insertion position
(g.16557_16558insC), one transversion position (g.16543 T > A), one position with both
transversion and transition (g.15776 T > C, T > G; Fig. 2), and transitions in the other 44
positions.
The obtained Polish Konik HTs were compared with sequences available in GenBank
showing that none of them presents 100% coverage. The similarity to Polish Konik HTs of
at least 99% has been presented by a whole range of different horse breeds, such as Arabian
horses (KU575096.1), Polish Draft horses (ON052712.1), Akhal Teke horses (JN398385),
Thoroughbred horses (KC202956.1), Selle Francais horses (OR909772.1), East Asian
horses (JQ340108.1), Chinese Native horses (JQ710930.1), and also Przewalski horses
(ON393916.1).
To construct the neighbor-joining tree (Fig. 3), supported by bootstrap percentages (BP)
computed with 1,000 replicates, we used 233 sequences representing all 16 Polish Konik
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 7/22

Table 2 Mitochondrial DNA variants located between positions 15,542 and 16,611 detected in all Polish Konik haplotype sequences compared to the reference
sequence NC_001640.The number of horses belonging to each haplotype is included. The HTs presented by more than one dam line are underlined. All obtained HTs
were deposited in the GenBank database and received accession numbers OR827103–OR827145.
Dam line/HT GenBank
acc. no.
HG*
No. of horses
15542
15585
15597
15598
15601
15602
15604
15615
15616
15617
15635
15650
15659
15666
15667
15672
15703
15762
15766
15769
15770
15771
15775
15776
15777
15806
15807
15810
15811
15826
15827
15868
15870
15871
15956
15974
15995
15996
16007
16022
16540
16543
16546
16551
16557_16558insC
16559
16611
Ref: NC_001640 CGATT CGAAT CATGAGTGCTCCCTACC ACAAT CCACATT TC TT G- CA
Białka HT1 OR827103 E 9T.G..T.....G.A..................T.GT...........
Bona HT2 OR827104 R 3...C.T.GG...C...C...T.TC.T....G...GT.C..TA.....
Dzina I HT3 OR827105 A 14.A..CT.......................G...........AC..T.
Geneza HT4 OR827106 E 5T.G..T.....G.A.......T..........T.GT...........
Geneza HT5 OR827107 A/B1T.G..T.....G.A...............G.................
Karolka HT6 OR827108 A 10.............................G..............C..
Karolka HT7 OR827109 A 2.A..CT...........ATCT.TG..T.T.G.T.G.G.CC.AC..T.
Karolka HT8 OR827110 G 2T.G..T....TG.A.AC............G.................
Karolka HT9 OR827111 G 2T.G..T....TG.A.AC...............TT.............
Karolka HT10 OR827112 A 1.A...T..........C............G...........A.....
Liliputka I HT11 OR827113 B 13.A.........G.A.............G.G.................
Liliputka I HT6 OR827108 A 3.............................G..............C..
Liliputka I HT12 OR827114 A/B3.........C.G.A...............G.................
Misia II HT13 OR827115 A 3.A...T...............T....T...G.TT.............
Misia II HT14 OR827116 R 2...C.T.GG.......C...T.T..T....G..TGT.C..TA.....
Misia II HT15 OR827117 A 1...C.T.GG.......C.............G..T.....CTA.....
Ponętna HT16 OR827118 A 4.A...TA.........C............G...........A..C..
Ponętna HT17 OR827119 A 3.A...TA.........C...............T........A..C..
Ponętna HT18 OR827120 A 2.A...TA.........CATCT.TG..T.T.GCT.G.G.CC.A..C.G
Ponętna HT9 OR827111 G 1T.G..T....TG.A.AC...............T..............
Popielica HT19 OR827121 J 11.A...T...............T....T...G.TT.............
Tarpanka I HT20 OR827122 A 9.A...TA.........C............G...........A.....
Tarpanka I HT21 OR827123 A 6.A..CT.......................G...........AC..T.
Tarpanka I HT22 OR827124 A 3.............................G.................
Tarpanka I HT19 OR827121 J 1.A...T...............T....T...G.TT.............
Tarpanka I HT23 OR827125 A/B1T.G..T.....G.A...............G...........A.....
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 8/22

Table 2 (continued)
Dam line/HT GenBank
acc. no.
HG*
No. of horses
15542
15585
15597
15598
15601
15602
15604
15615
15616
15617
15635
15650
15659
15666
15667
15672
15703
15762
15766
15769
15770
15771
15775
15776
15777
15806
15807
15810
15811
15826
15827
15868
15870
15871
15956
15974
15995
15996
16007
16022
16540
16543
16546
16551
16557_16558insC
16559
16611
Ref: NC_001640 CGATT CGAAT CATGAGTGCTCCCTACC ACAAT CCACATT TC TT G- CA
Traszka HT24 OR827126 A 26.....T...C..C................G...........AC..T.
Traszka HT25 OR827127 A 9.....T...C..C............................AC..T.
Traszka HT26 OR827128 A 3.....T...C..C....ATCT.TG..T.T.GCT.G.G.CC.AC..T.
Traszka HT27 OR827129 G 3T.G..T....TG.A.AC............G...........AC..T.
Traszka HT28 OR827130 A 2.....T...C..C........T....T.....T........AC..T.
Traszka HT29 OR827131 A 1.A...TA.........C.........T....C......CC.A.....
Tunguska HT30 OR827132 A 13.............................G.................
Tygryska HT31 OR827133 A/B5.........C.G.A...............G.................
Tygryska HT32 OR827134 A 1.A...TA.........CAT.T.T...T.T.G.T.G.G....A.....
Tygryska HT33 OR827135 A 1.A...TA.........CATCT.TG..T.T.GCT.G.G.CC.A.....
Urszulka HT34 OR827136 A/B10T.G..T.....G.A.AC............G.................
Urszulka HT35 OR827137 G 9T.G..T....TG.A.AC...............TT.............
Urszulka HT36 OR827138 A 2..G..T.....G.A.AC...............T..............
Urszulka HT37 OR827139 A/B1.A.........G.A...ATCT.TG....T.GCT...G.CC.......
Wola HT38 OR827140 A 6..G..TA.......G.C............G...........A..C..
Wola HT39 OR827141 A 5..G..TA.......G.CATCT.TG..T.T.GCT.G.G.CC.A..C..
Zaza HT20 OR827122 A 7.A...TA.........C............G...........A.....
Zaza HT33 OR827135 A 5.A...TA.........CATCT.TG..T.T.GCT.G.G.CC.A.....
Zaza HT40 OR827142 G 4TAG..T.G..TG.A..C...............T...........C..
Zaza HT41 OR827143 A 3.A...TA.........CA.C...G.......C......CC.A.....
Zaza HT42 OR827144 A 1.A.........G.A.......T..G...T.....G......A.....
Zaza HT43 OR827145 A 1.A...TA.........C....T..G...T.....G......A.A...
Note:
*
Achilli et al. (2012)
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 9/22

dam lines and the Equus caballus (NC_001640) sequence as the root. The NJ tree presents
the clustering of the analysed horses in separate groups with varied horse numbers
(Table 2). Although most of the lines form clear clusters, some different sequences can be
found in them; for example, the Tarpanka I_19 horse is embedded within the Popielica
cluster. This finding suggests that the official Polish Konik pedigree data does not agree
with the mtDNA HTs revealed from genetic analysis.
The median-joining network was constructed using all Polish Konik sequences to
demonstrate the genetic distance between the obtained haplotypes (Fig. 4). The network
indicated clusters’separation based on the number of polymorphic sites. Several dam lines
Figure 2 Chromatograms showing three Polish Konik mtDNA HTs with marked 15,776 variable site
position (FinchTV software). The transition g.15776T>C was observed in HT3, the transversion
g.15776T>G in HT7, and nucleotide T (in accordance with the reference sequence) in HT1.
Full-size

DOI: 10.7717/peerj.17549/fig-2
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 10/22

formed HTs separated by a single polymorphism, which points out that their haplotypes
are very similar. However, in some dam lines (including Karolka and Traszka lines), we
observed several different, only distantly related HTs. The overview of both the NJ tree and
Figure 3 The neighbor-joining tree of the 233 Polish Konik mtDNA sequences with Equus caballus reference sequence (NC_001640) used as a
root. Each colour represents one of sixteen dam lines. Full-size

DOI: 10.7717/peerj.17549/fig-3
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 11/22

Figure 4 The median-joining network of the identified Polish Konik haplotypes (Table 2) with each dam line represented by circles coloured
according to the dam line info from the pedigree. The size of the nodes corresponds to the number of samples and the strokes on the branches
correspond to the number of polymorphisms. Full-size

DOI: 10.7717/peerj.17549/fig-4
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 12/22

Figure 5 The median-joining network of the identified Polish Konik haplotypes (Table 2) with their belonging to the generally known
haplogroups described by Achilli et al. (2012).The size of the nodes corresponds to the number of samples. Six haplogroups are detected
among the Polish Konik population: A, B, E, G, J, and R. The percentage share of detected haplogroups is presented in a pie chart.
Full-size

DOI: 10.7717/peerj.17549/fig-5
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 13/22

median-joining network highlights the wide range of variability among different mtDNA
haplotypes in Polish Koniks.
The median-joining network above was also constructed in a way to presents all
recognized haplotypes and their belonging to the generally known haplogroups described
by Achilli et al. (2012);(Fig. 5). Among the Polish Konik population were six haplogroups
detected: A, B, E, G, J, and R. Similarly to the research conducted by Cieślak et al. (2017)
haplogroup L, which is the most frequent in Europe and the Middle East, was not found.
The haplogroup A observed as common among Asian horse populations (Achilli et al.,
2012), turned out to be the most frequent within the population including 63–72% of all
analysed horses. The presence of the other haplogroups ranged from several to a dozen
percent. It should be noted that 9% of horses could not be clearly assigned to a specific
Figure 6 Magnified view on the MSY HTs in Polish Konik sire lines. The simplified haplotype structure based on 114 (92 Crown) variants (see
variant details in Table S2), according to the published MSY topology (Bozlak et al., 2023). Variant names are placed on each branch, in red when
tested in the sample set and in gray if their allelic states were imputed. Genotyping results from 36 males are shown as pies, sized according to
frequency and colored with regard to the sire line. Undetected HTs are shown in gray and collapsed, and ‘*HTs’are placed on the respective
branching points. Previously reported horse breeds that carry the same HTs as Polish Konik males are denoted in proximity in black, while
gray-colored breeds indicate horse breeds reported in neighboring HTs (Wallner et al., 2017;Felkel et al., 2019;Remer et al., 2022;Radovic et al., 2022;
Bozlak et al., 2023). Full-size

DOI: 10.7717/peerj.17549/fig-6
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 14/22

haplogroup because of sharing the same similarity to the haplogroup A and haplogroup B.
It is the result of a smaller number of nucleotides used in our study than analysed in studies
by Achilli et al. (2012).
Y chromosome variability
We investigated the MSY HTs in 36 Polish Konik males, representing all six sire lines.
All samples were allocated to the Crown haplogroup (daC), where 4 HTs were
distinguished. Notably, eight analysed males carried previously defined HTs (daC_Tb-
oB1*and daC Ao-aA1D1), whereas 28 males were placed at internal nodes of the backbone
topology (daC_Ad-h*and daC_Ad-hA1*; see Fig. 6 and Table S2), and their private HTs
are not yet definitely defined in the genotyping backbone. The HT name of a sample that
clustered internally was marked with an asterisk (*), e.g., “daC_Ad-h*”(Fig. 6).
The most abundant HT was daC_Ad-h*, detected in 16 horses. It was noted, that all
representatives of the Chochlik and Myszak sire lines clustered into daC_Ad-h*, while four
individuals from the Glejt I stallion line carried this HT. A subsequent daC_Ad-hA1*HT
was carried by twelve individuals, accounting for all analysed males of Liliput and Goraj
sire lines. Interestingly, daC_Ad-h*and daC_Ad-hA1*HTs were most frequently reported
in Coldbloods (Felkel et al., 2019;Remer et al., 2022;Bozlak et al., 2023). The remaining
part of the dataset (22%) carried daC_Ao-a1D1 (six samples from the Wicek sire line) and
daC_Tb-oB1*(two samples from the Gejt I sire line) HTs, respectively. Previously, HT
daC_Ao-a1D1 was reported only in Duelmener Ponies (Remer et al., 2022). In contrast,
daC_Tb-oB1*HT was characterized in Thoroughbreds (via Byerley Turk, 1680. founder),
Arabians, Akhal Teke, Barbs, and many other horse breeds (Wallner et al., 2017;Felkel
et al., 2019;Remer et al., 2022;Radovic et al., 2022;Bozlak et al., 2023).
DISCUSSION
The analysis of population structure in unique, native horse breeds such as Polish Konik is
extremely important because it allows the attempt to increase their genetic diversity and
keeps all lines large enough to prevent them from extinction. Currently, in a situation
where more than half of the Polish Konik lines are already extinct and several subsequent
lines are threatened with extinction, an especially important task is to control the
population structure and stop the regression of the least numerous lines in the population.
Tools used for this purpose are mitochondrial DNA and Y chromosome sequence analysis.
The variability of mtDNA in modern horse breeds is generally high. For the first time,
the mtDNA variation within the Polish Konik maternal lines was examined in 2017
(Cieślak et al., 2017). The research was conducted on 173 horses and included 510 bp,
containing hypervariable region 1. The 33 variable sites were used to segregate Polish
Koniks in the form of 19 haplotypes. In our study, the number of polymorphic sites used
was 14 sites greater (47 SNPs), and this resulted in more than twice the number of detected
haplotypes (43). This comparison may indicate that applying the entire hypervariable
region gives us more detailed results than using only hypervariable region 1. Moreover,
Cieślak et al. (2017), for the first time, suggested that mtDNA results do not fully
correspond to the official pedigree data. Another study focused on assessing the genetic
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 15/22

diversity and structure of the Polish Konik breed based on 17 microsatellite markers
(Fornal et al., 2021), and this presented no signs of inbreeding and the assignment of the
horses using Structure software into (most likely) three clusters. However, the study
conducted by Mackowski et al. (2015) found 8.6% of inbreeding. The above studies showed
the diversity of the Polish Konik population in terms of STR variability.
The occurrence of a small number of differentiating sites between HTs observed within
a dam line may be the result of spontaneous mutations naturally occurring in the sequence
over the years. On the other hand, the presence of clearly different haplotypes in one dam
line can be the consequence of migration between different Polish Konik populations
before the establishment of the studbooks or the presence of errors in the pedigrees.
Further, both the neighbor-joining tree and the median-joining network demonstrated
moderate variability among different mitochondrial DNA sequences and overall diverse
variability of mitochondrial DNA sequence in Polish Konik dam lines.
The median-joining network constructed in the way to present the Polish Konik
haplotypes belonging to the generally known haplogroups (Achilli et al., 2012) revealed the
presence of six haplogroups (A, B, E, G, J, and R) among the Polish Koniks, which indicates
multiple origins of dam lines. The most numerous haplogroup A including 63–72% of
analysed horses was observed as most common among Asian horse populations. Taking
into consideration the geographical attribution of the haplogroups, the A, E, G, and J
haplogroups were the ones the most common in Asia, including 83–92% of tested Polish
Koniks. The remaining two haplogroups B and R were most common for the North
American and European populations (Achilli et al., 2012), respectively, and included
6–15%, and 2% of horses. These results, with an outstanding percentage predominance of
haplogroups most common in Asia, may shed light on the unexplored importance of Asian
horses in the development of the Polish Konik breed.
Another interesting observation noticed also by Cieślak et al. (2017) is that almost all of
the dam lines represented by more than one haplotype belonged to (at least) two distinct
haplogroups, which strengthens the assumptions regarding the possible presence of errors
in the Polish Konik pedigrees.
In the case of paternal inheritance, 17 autosomal microsatellite loci were previously
investigated among Polish Konik sire lines (Fornal et al., 2020). The microsatellite analysis
showed low genetic diversity and vague population structure among sire lines, where the
Polish Konik population can be described with only two clusters. The diversity of Y
chromosome in modern horses is also very low, however, recent advances in horse MSY
phylogeny (Felkel et al., 2019;Bozlak et al., 2023) enabled investigation and fine-scaled
insights into the horse patrilines. Numerous studies used the stable structure of MSY
phylogeny and investigated genetic variation (e.g., Wallner et al., 2017), population history
(e.g., Remer et al., 2022), and breeding practices development (e.g., Castaneda et al., 2019)
of diverse horse breeds. Thus, the investigation of Y chromosomal markers is crucial to
understanding the history and genetic patterns of Polish Konik patrilines.
Here, the MSY HT spectrum in Polish Koniks was investigated, and all sire lines were
reported within the Crown group, which reflects the very recent breeding history (last
1,500 years) of the population (Bozlak et al., 2023). Among all analysed stallions, four
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 16/22

different haplotypes were noted, which exhibit a greater resolution of patriline
differentiation than observed with microsatellite loci (Fornal et al., 2020). Interestingly,
members of five out of six sire lines carried haplotypes across the daC_A clade (daC_Ao-
a1D, daC_Ad-h*, and daC_Ad-hA1*). Among those, all Wicek line stallions carried
daC_Ao-a1D1, previously described in Duelmener horses. This finding sheds new light on
the close kinship between the breeds. Right after the end of World War II, Polish Konik
stallions were used to eliminate Duelmener ponies’domesticated traits. A notable example
was the stallion Nugat XII, who covered Duelmener mares in the years 1957–1963 (Opora,
2006). The haplotypes of Chochlik, Myszak, and Glejt I line in daC_Ad-h*, as well as the
joint allocation of Goraj and Liliput males to daC_Ad-hA1*, indicated private, not yet
resolved HTs in these lines. Previous research traced these HTs in Coldbloods (e.g., Felkel
et al., 2019;Remer et al., 2022), which is in line with the Polish Koniks’breeding history,
phenotypic characteristics, and horse type itself since the breed is considered a ‘light draft
breed’(Hendricks, 2007). It is also noteworthy that a few males in the Glejt I lineage carried
the daC_Tb-oB1*haplotype (Fig. 6), previously described in various lighter breeds.
daC_Tb-oB1*was primarily attributed to the Thoroughbred founder Byerley Turk (1680)
(Felkel et al., 2019) but later also detected in Arabians’, Kuhailan Afas’, and Latif’sires
(Remer et al., 2022), as well as three patrilines in North African horses (Radovic et al.,
2022). The MSY patterns and narrative on the vast use of Thoroughbred and Arabian
stallions for the improvement of local stocks (Hendricks, 2007) could indicate
undocumented crossbreeding, probably to expand the degree of genetic variability of the
Polish Konik breed.
The described mitochondrial DNA and the Y chromosome genetic diversity also
indicated a certain probability of pedigree errors in the Polish Konik due to the unique
parental inheritance mechanism of mtDNA and the Y chromosome. Mitochondrial DNA
analysis allowed us to highlight individuals whose haplotype fits perfectly into haplotypes
occurring more frequently in a different dam line. In addition, MSY analysis emphasized
the accuracy and information content of sire line tracking in the Wicek line. In contrast, we
also observed two very distinct HTs in the Glejt I patriline (two males in daC_Tb-oB1*and
four in daC_Ad-h*). This finding cannot be explained by de novo mutations but rather
shows a clear sign of two different sire lines among analysed individuals from this line.
CONCLUSIONS
Genetic analysis of Polish Konik dam and sire lines has revealed their diversity in the form
of the identified haplotype number. The identification of mtDNA haplotypes among
individual dam lines showed that in some of them only one single haplotype was
presented, but several showed a wide range of haplotypes within the line. The haplotypes
were also classified into six (A, B, E, J, G, R) haplogroups, with an outstanding percentage
predominance of haplogroups most common in Asian horse populations. Y chromosome
analysis revealed that most of the Polish Konik sire lines share their haplotype with
Coldblood breeds, but also uncovered intriguing historical relationships and potential
crossbreeding events. The possibility of errors in the Polish Konik pedigrees was also
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 17/22

reported. The findings emphasize the importance of genetic monitoring to maintain and
control the genetic diversity of Polish Koniks and ensure their long-term survival.
ADDITIONAL INFORMATION AND DECLARATIONS
Funding
This research was funded by ‘Diamentowy Grant’no. 0211/DIA/2019/48–Ministry of
Science and Higher Education, Poland. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manuscript.
Grant Disclosures
The following grant information was disclosed by the authors:
Diamentowy: 0211/DIA/2019/48.
Ministry of Science and Higher Education, Poland.
Competing Interests
The authors declare that they have no competing interests.
Author Contributions
.Adrianna Dominika Musiałconceived and designed the experiments, performed the
experiments, analyzed the data, prepared figures and/or tables, authored or reviewed
drafts of the article, funding acquisition, and approved the final draft.
.Lara Radovićconceived and designed the experiments, performed the experiments,
analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the
article, and approved the final draft.
.Monika Stefaniuk-Szmukier conceived and designed the experiments, authored or
reviewed drafts of the article, and approved the final draft.
.Agnieszka Bieniek conceived and designed the experiments, authored or reviewed drafts
of the article, material collection, and approved the final draft.
.Barbara Wallner conceived and designed the experiments, analyzed the data, authored or
reviewed drafts of the article, and approved the final draft.
.Katarzyna Ropka-Molik conceived and designed the experiments, performed the
experiments, analyzed the data, authored or reviewed drafts of the article, and approved
the final draft.
Data Availability
The following information was supplied regarding data availability:
All obtained mitochondrial DNA haplotypes are available at GenBank:
OR827103–OR827145.
Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/10.7717/
peerj.17549#supplemental-information.
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 18/22

REFERENCES
Achilli A, Olivieri A, Soares P, Lancioni H, Kashani BH, Perego UA, Nergadze SG, Carossa V,
Santagostino M, Capomaccio S, Felicetti M, Al-Achkar W, Penedo MCT, Verini-Supplizi A,
Houshmand M, Woodward SR, Semino O, Silvestrelli M, Giulotto E, Pereira L, Bandelt H-J,
Torroni A. 2012. Mitochondrial genomes from modern horses reveal the major haplogroups
that underwent domestication. Proceedings of the National Academy of Sciences of the United
States of America 109(7):2449–2454 DOI 10.1073/pnas.1111637109.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool.
Journal of Molecular Biology 215(3):403–410 DOI 10.1016/S0022-2836(05)80360-2.
Bandelt H-J, Forster P, Röhl A. 1999. Median-joining networks for inferring intraspecific
phylogenies. Molecular Biology and Evolution 16(1):37–48
DOI 10.1093/oxfordjournals.molbev.a026036.
Bozlak E, Radovic L, Remer V, Rigler D, Allen L, Brem G, Stalder G, Castaneda C, Cothran G,
Raudsepp T, Okuda Y, Moe KK, Moe HH, Kounnavongsa B, Keonouchanh S, Van NH,
Vu VH, Shah MK, Nishibori M, Kazymbet P, Bakhtin M, Zhunushov A, Paul RC,
Dashnyam B, Nozawa K, Almarzook S, Brockmann GA, Reissmann M, Antczak DF,
Miller DC, Sadeghi R, von Butler-Wemken I, Kostaras N, Han H, Manglai D,
Abdurasulov A, Sukhbaatar B, Ropka-Molik K, Stefaniuk-Szmukier M, Lopes MS, da
Câmara Machado A, Kalashnikov VV, Kalinkova L, Zaitev AM, Novoa-Bravo M,
Lindgren G, Brooks S, Rosa LP, Orlando L, Juras R, Kunieda T, Wallner B. 2023. Refining the
evolutionary tree of the horse Y chromosome. Scientific Reports 13:8954
DOI 10.1038/s41598-023-35539-0.
Castaneda C, Juras R, Khanshour A, Randlaht I, Wallner B, Rigler D, Lindgren G, Raudsepp T,
Cothran EG. 2019. Population genetic analysis of the estonian native horse suggests diverse and
distinct genetics, ancient origin and contribution from unique patrilines. Genes 10(8):629
DOI 10.3390/genes10080629.
Cieślak J, Wodas L, Borowska A, Cothran EG, Khanshour AM, Mackowski M. 2017.
Characterization of the Polish Primitive Horse (Konik) maternal lines using mitochondrial
D-loop sequence variation. PeerJ 5(4):e3714 DOI 10.7717/peerj.3714.
Cothran EG, Juras R, Macijauskiene V. 2005. Mitochondrial DNA D-loop sequence variation
among 5 maternal lines of the Zemaitukai horse breed. Genetics and Molecular Biology
28(4):677–681 DOI 10.1590/S1415-47572005000500006.
Czerneková V, Kott T, Majzlík I. 2013. Mitochondrial D-loop sequence variation among Hucul
horse. Czech Journal of Animal Science 58(10):437–442 DOI 10.17221/6992-CJAS.
Dell AC, Curry MC, Yarnell KM, Starbuck GR, Wilson PB, Rogers C. 2020. Mitochondrial
D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse. PLOS
ONE 15(12):e0243247 DOI 10.1371/journal.pone.0243247.
Doboszewski P, Doktor D, Jaworski Z, Kalski R, Kulakowska G, Lojek J, Plachocki D, Rys A,
Tylkowska A. 2017. Konik polski horses as a mean of biodiversity maintenance in
post-agricultural and forest areas: an overview of Polish experiences. Animal Science Papers and
Reports 35:333–347.
Engel L, Becker D, Nissen T, Russ I, Thaller G, Krattenmacher N. 2021. Exploring the origin and
relatedness of maternal lineages through analysis of mitochondrial DNA in the holstein horse.
Frontiers in Genetics 12:632500 DOI 10.3389/fgene.2021.632500.
Felkel S, Vogl C, Rigler D, Dobretsberger V, Chowdhary BP, Distl O, Fries R, Jagannathan V,
Janečka JE, Leeb T, Lindgren G, McCue M, Metzger J, Neuditschko M, Rattei T, Raudsepp T,
Rieder S, Rubin C-J, Schaefer R, Schlötterer C, Thaller G, Tetens J, Velie B, Brem G,
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 19/22

Wallner B. 2019. The horse Y chromosome as an informative marker for tracing sire lines.
Scientific Reports 9(1):6095 DOI 10.1038/s41598-019-42640-w.
Felkel S, Vogl C, Rigler D, Jagannathan V, Leeb T, Fries R, Neuditschko M, Rieder S, Velie B,
Lindgren G, Rubin C-J, Schlötterer C, Rattei T, Brem G, Wallner B. 2018. Asian horses
deepen the MSY phylogeny. Animal Genetics 49(1):90–93 DOI 10.1111/age.12635.
Fornal A, Kowalska K, Ząbek T, Piestrzynska-Kajtoch A, MusiałAD, Ropka-Molik K. 2020.
Genetic diversity and population structure of polish konik horse based on individuals from all
the male founder lines and microsatellite markers. Animals 10(9):1569
DOI 10.3390/ani10091569.
Fornal A, Kowalska K, Ząbek T, Piestrzynska-Kajtoch A, MusiałAD, Ropka-Molik K. 2021.
Genetic variability and population structure of polish konik horse maternal lines based on
microsatellite markers. Genes 12(4):546 DOI 10.3390/genes12040546.
Gorecka-Bruzda A, Jaworski Z, Jaworska J, Siemieniuch M. 2020. Welfare of free-roaming
horses: 70 years of experience with Konik Polski breeding in Poland. Animals 10(6):1094
DOI 10.3390/ani10061094.
Hendricks BL. 2007. International Encyclopedia of Horse Breeds. Norman, OK, USA: University of
Oklahoma Press.
Hutchison CA, Newbold JE, Potter SS, Edgell MH. 1974. Maternal inheritance of mammalian
mitochondrial DNA. Nature 251(5475):536–538 DOI 10.1038/251536a0.
Janczarek I, Pluta M, Paszkowska A. 2017. Pochodzenie, hodowla i użytkowanie koników
polskich. Przegląd hodowlany nr 4/2017. Available at http://ph.ptz.icm.edu.pl/wp-content/
uploads/2017/07/2-Janczarek.pdf.
Jaworski Z. 1997. Genealogical tables of the polish primitive horse. Popielno, Poland: Polish
Academy of Sciences, Research Station for Ecological Agriculture and Preserve Animal
Breeding.
Jaworski Z, Tomczyk-Wrona I. 2019. Program ochrony zasobów genetycznych koni rasy konik
polski. Program Hodowli Koni rasy Konik Polski, Warszawa; Załącznik nr 2 do Zarządzenia Nr
70/09 z dn. 30.12.2009. Available at https://www.pzhk.pl/wp-content/uploads/pr-hodow-kn-
2019-04-01.pdf.
Jobling MA, Tyler-Smith C. 2017. Human Y-chromosome variation in the genome-sequencing
era. Nature Reviews Genetics 18(8):485–497 DOI 10.1038/nrg.2017.36.
Khanshour AM, Cothran E. 2013. Maternal phylogenetic relationships and genetic variation
among Arabian horse populations using whole mitochondrial DNA D-loop sequencing. BMC
Genetics 14(1):83 DOI 10.1186/1471-2156-14-83.
Kusza S, Priskin K, Ivankovic A, Jędrzejewska B, Podgorski T, Jávor A, Mihók S. 2013. Genetic
characterization and population bottleneck in the Hucul horse based on microsatellite and
mitochondrial data. Biological Journal of the Linnean Society 109(1):54–65
DOI 10.1111/bij.12023.
Letunic I, Bork P. 2021. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree
display and annotation. Nucleic Acids Research 49:W293–W296 DOI 10.1093/nar/gkab301.
Librado P, Khan N, Fages A, Kusliy MA, Suchan T, Tonasso-Calvière L, Schiavinato S,
Alioglu D, Fromentier A, Perdereau A, Aury J-M, Gaunitz C, Chauvey L, Seguin-Orlando A,
Der Sarkissian C, Southon J, Shapiro B, Tishkin AA, Kovalev AA, Alquraishi S,
Alfarhan AH, Al-Rasheid KAS, Seregély T, Klassen L, Iversen R, Bignon-Lau O, Bodu P,
Olive M, Castel J-C, Boudadi-Maligne M, Alvarez N, Germonpré M, Moskal-del Hoyo M,
Wilczy
nski J, Pospu1a S, Lasota-KuśA, Tunia K, Nowak M, Rannamäe E, Saarma U,
Boeskorov G, Lōugas L, Kyselý R, Peške L, Bălăşescu A, Dumitraşcu V, Dobrescu R,
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 20/22

Gerber D, Kiss V, Szécsényi-Nagy A, Mende BG, Gallina Z, Somogyi K, Kulcsár G, Gál E,
Bendrey R, Allentoft ME, Sirbu G, Dergachev V, Shephard H, Tomadini N, Grouard S,
Kasparov A, Basilyan AE, Anisimov MA, Nikolskiy PA, Pavlova EY, Pitulko V, Brem G,
Wallner B, Schwall C, Keller M, Kitagawa K, Bessudnov AN, Bessudnov A, Taylor W,
Magail J, Gantulga J-O, Bayarsaikhan J, Erdenebaatar D, Tabaldiev K, Mijiddorj E,
Boldgiv B, Tsagaan T, Pruvost M, Olsen S, Makarewicz CA, Valenzuela Lamas S, Albizuri
Canadell S, Nieto Espinet A, Iborra MP, Lira Garrido J, Rodríguez González E, Celestino S,
Olària C, Arsuaga JL, Kotova N, Pryor A, Crabtree P, Zhumatayev R, Toleubaev A,
Morgunova NL, Kuznetsova T, Lordkipanize D, Marzullo M, Prato O, Bagnasco Gianni G,
Tecchiati U, Clavel B, Lepetz S, Davoudi H, Mashkour M, Berezina NY, Stockhammer PW,
Krause J, Haak W, Morales-Muñiz A, Benecke N, Hofreiter M, Ludwig A, Graphodatsky AS,
Peters J, Kiryushin KY, Iderkhangai T-O, Bokovenko NA, Vasiliev SK, Seregin NN,
Chugunov KV, Plasteeva NA, Baryshnikov GF, Petrova E, Sablin M, Ananyevskaya E,
Logvin A, Shevnina I, Logvin V, Kalieva S, Loman V, Kukushkin I, Merz I, Merz V,
Sakenov S, Varfolomeyev V, Usmanova E, Zaibert V, Arbuckle B, Belinskiy AB,
Kalmykov A, Reinhold S, Hansen S, Yudin AI, Vybornov AA, Epimakhov A, Berezina NS,
Roslyakova N, Kosintsev PA, Kuznetsov PF, Anthony D, Kroonen GJ, Kristiansen K,
Wincker P, Outram A, Orlando L. 2021. The origins and spread of domestic horses from the
Western Eurasian steppes. Nature 598:1–7DOI 10.1038/s41586-021-04018-9.
Librado P, Rozas J. 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism
data. Bioinformatics 25(11):1451–1452 DOI 10.1093/bioinformatics/btp187.
Liu W. 2010. Comparative genomics of the Y chromosome and male fertility. In: Reproductive
Genomics in Domestic Animals. Ames, IA, USA: Blackwell Publishing, 129–155.
Lovasz L, Fages A, Amrhein V. 2021. Konik, Tarpan, European wild horse: an origin story with
conservation implications. Global Ecology and Conservation 32(3):e01911
DOI 10.1016/j.gecco.2021.e01911.
Mackowski M, Mucha S, Cholewinski G, Cieslak J. 2015. Genetic diversity in Hucul and Polish
primitive horse breeds. Archives Animal Breeding 58(1):23–31 DOI 10.5194/aab-58-23-2015.
Myćka G, Klecel W, Stefaniuk-Szmukier M, Jaworska J, MusiałAD, Ropka-Molik K. 2022.
Mitochondrial whole D-loop variability in polish draft horses of sztumski subtype. Animals
12(15):1870 DOI 10.3390/ani12151870.
Opora J. 2006. Die Wildbahngestüte Westfalens. Geschichte, Entwicklung und Zukunf. Berlin,
Bristol, Niederlassung Deutschland: TENEA Verlag Ltd.
Pasicka E. 2013. Polish konik horse—characteristics and historical background of native
descendants of tarpan. Acta Scientiarum Polonorum. Medicina Veterinaria 12:25–38.
Polish Horse Breeders Association. 2022. Breeding Statistics. (accessed on 19 September 2023).
Available at https://en.pzhk.pl/breeding/breeding-statistics/.
Radovic L, Remer V, Krcal C, Rigler D, Brem G, Rayane A, Driss K, Benamar M,
Machmoum M, Piro M, Krischke D, von Butler-Wemken I, Wallner B. 2022. Y chromosome
haplotypes enlighten origin, influence, and breeding history of North African barb horses.
Animals 12(19):2579 DOI 10.3390/ani12192579.
Radovic L, Remer V, Reiter S, Bozlak E, Felkel S, Grilz-Seger G, Brem G, Wallner B. 2021. 38 Y
chromosome genetic variation and deep genealogies provide new insights on Lipizzan sire lines.
Journal of Equine Veterinary Science 100:103501 DOI 10.1016/j.jevs.2021.103501.
Reke A, Zarina A, Vinogradovs I. 2019. Management of semi-wild large herbivores’Grazing Sites
in Latvia. In: Proceedings of the 12th International Scientific and Practical Conference, Vol. 1,
Rezekene, Latvia, 20–22 June 2019, 241–244.
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 21/22

Remer V, Bozlak E, Felkel S, Radovic L, Rigler D, Grilz-Seger G, Stefaniuk-Szmukier M, Bugno-
Poniewierska M, Brooks S, Miller DC, Antczak DF, Sadeghi R, Cothran G, Juras R,
Khanshour AM, Rieder S, Penedo MC, Waiditschka G, Kalinkova L, Kalashnikov VV,
Zaitsev AM, Almarzook S, Reißmann M, Brockmann GA, Brem G, Wallner B. 2022. Y-
chromosomal insights into breeding history and sire line genealogies of Arabian horses. Genes
13(2):229 DOI 10.3390/genes13020229.
Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4(4):406–425
DOI 10.1093/oxfordjournals.molbev.a040454.
Tamura K, Stecher G, Kumar S. 2021. MEGA11: molecular evolutionary genetics analysis version
11. Molecular Biology and Evolution 38(7):3022–3027 DOI 10.1093/molbev/msab120.
Tomczyk-Wrona I. 2022. Program ochrony zasobów genetycznych koni rasy konik polski. Kraków,
Poland: Instytut Zootechniki–PIB w Krakowie, 1–15.
Wallner B, Palmieri N, Vogl C, Rigler D, Bozlak E, Druml T, Jagannathan V, Leeb T, Fries R,
Tetens J, Thaller G, Metzger J, Distl O, Lindgren G, Rubin C-J, Andersson L, Schaefer R,
McCue M, Neuditschko M, Rieder S, Schlötterer C, Brem G. 2017. Y chromosome uncovers
the recent oriental origin of modern stallions. Current Biology 27(13):2029–2035.e5
DOI 10.1016/j.cub.2017.05.086.
Wolc A, Bali
nska K. 2010. Inbreeding effects on exterior traits in Polish konik horses. Archiv
Tierzucht 53:1–8 0003-9438 DOI 10.5194/aab-53-1-2010.
Yang L, Kong X, Yang S, Dong X, Yang J, Gou X, Zhang H. 2018. Haplotype diversity in
mitochondrial DNA reveals the multiple origins of Tibetan horse. PLOS ONE 13(7):e0201564
DOI 10.1371/journal.pone.0201564.
Yoon SH, Lee W, Ahn H, Caetano-Anolles K, Park KD, Kim H. 2018. Origin and spread of
Thoroughbred racehorses inferred from complete mitochondrial genome sequences:
phylogenomic and Bayesian coalescent perspectives. PLOS ONE 13(9):e0203917
DOI 10.1371/journal.pone.0203917.
Musiałet al. (2024), PeerJ, DOI 10.7717/peerj.17549 22/22