Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: Sun, Q.; Pang, Y.; Qin, Y.;
Dong, Z.; Ma, Y.; Zhao, Y.; Zhang, Z.;
Liu, J.; Mao, B.; Yin, B. Transcriptomic
Revealed That Selenium-Rich
Lactobacillus plantarum Alleviated
Cadmium-Induced Immune
Responses in Bulatmai
barbel Luciobarbus capito Kidneys.
Fishes 2024,9, 230. https://doi.org/
10.3390/fishes9060230
Academic Editor: Dariel
Tovar-Ramírez
Received: 28 April 2024
Revised: 9 June 2024
Accepted: 14 June 2024
Published: 16 June 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
fishes
Article
Transcriptomic Revealed That Selenium-Rich Lactobacillus
plantarum Alleviated Cadmium-Induced Immune Responses in
Bulatmai barbel Luciobarbus capito Kidneys
Qingsong Sun 1,2, Yuran Pang 1,2, Yuhan Qin 2, Ziting Dong 2, Yanling Ma 2, Yuan Zhao 1,2, Zhanning Zhang 2,
Jinmei Liu 1,2, Binghui Mao 1,2 and Baishuang Yin 1,2 ,*
1Key Lab of Preventive Veterinary Medicine in Jilin Province, Jilin 132101, China;
sunqingsong@jlnku.edu.cn (Q.S.)
2College of Animal Science and Technology, Jilin Agricultural Science and Technology University,
Jilin 132101, China
*Correspondence: yinbaishuang@jlnku.edu.cn
Abstract: Cadmium (Cd) is a common environmental pollutant that accumulates mainly in the
kidneys and thus endangers the physiological health of aquatic animals. Selenium (Se) is a natural
antidote to heavy metals that antagonises heavy metal toxicity and enhances the antioxidant capacity
of organisms. Lactobacillus plantarum (L. plantarum) can reduce the toxicity of heavy metals through
adsorption, reduction and metabolism. Studies have confirmed that the biological synthesis of Se
nanoparticles (Bio-SeNPs) using bacterial microorganisms is simple, safe and less toxic than the
synthesis of inorganic and organic Se, but the effect on Cd-induced immunosuppression is un-known.
One hundred and eighty Bulatmai barbel (Luciobarbus capito: L. capito) plants were randomly divided
into control (C), Cd and Cd + Se-enriched L. plantarum groups (S1L1-Cd) and fed for 28 days. The
analysis methods included histopathology, test kits, transcriptomics and real-time quantitative PCR.
The addition of selenium-enriched L. plantarum significantly attenuated cadmium-induced pathologi-
cal changes such as glomerular atrophy, detachment of renal tubular epithelial cells, mild swelling,
and interstitial inflammatory cell infiltration. Cd stress can lead to significant decreases in RBC,
HCT, WBC, LZM, C3, and IgM levels, and the addition of Se-enriched L. plantarum can significantly
reverse the changes in these indicators. Transcriptomic analysis revealed 488 DEGs in the Cd groups,
301 of which were upregulated and 187 of which were downregulated. There were 1474 DEGs in
the S1L1-Cd group, of which 720 were upregulated and 754 were downregulated. In addition, GO
enrichment analysis revealed that the biological regulation of the most differentially expressed genes
involved metal ion binding, ATP binding and nucleotide inclusion. KEGG enrichment analysis re-
vealed six of the most enriched pathways: oxidative phosphorylation, Huntington disease, retrograde
endocannabinoid signalling, natural killer cell-mediated cyto-toxicity, the IL-17 signalling pathway,
and leukocyte transient migration. Moreover, we selected 12 DEGs for qRT-PCR, which showed that
the qRT-PCR results were consistent with our RNA-Seq results. Our results suggest that Se-enriched
L. plantarum can enhance immunity and alleviate Cd exposure-mediated immunosuppression in
L. capito.
Keywords: selenium; Lactobacillus plantarum; cadmium; immunity; kidney
Key Contribution: Our results suggest that Se-enriched L. plantarum can enhance immunity and
alleviate Cd exposure-mediated immunosuppression in L. capito.
1. Introduction
The main sources of Cd pollution include polyvinyl chloride (PVC) products, colour
pigments, industrial corrosive reagents, and phosphate fertilisers [
1
]. Bulatmai barbel be-
longs to Cypriniformes, Cyprinidae, and Barbinae, and is mainly found in the inland rivers
Fishes 2024,9, 230. https://doi.org/10.3390/fishes9060230 https://www.mdpi.com/journal/fishes
Fishes 2024,9, 230 2 of 14
of the southern Caspian Sea and the Aral Sea system, Uzbekistan, Iran and Turkey
[2,3]
.
Heavy metal contamination of water bodies has led to heavy metal stress in Bulatmai barbel,
severely affecting growth and development [
3
–
6
]. In addition, environmental Cd leakage
can occur in tissues or organs such as the kidneys of living organisms [
4
,
7
]. Cd poses a
great threat to the survival of aquatic animals due to its long half-life and low excretion rate
from the body. Cd enters the bloodstream from the intestines of carp and accumulates in
the kidneys over a long period of time, leading to renal dysfunction [
1
]. Cd stress disrupts
cell physiological signalling cascades, gene expression, molecular transport and metabolic
regulation in aquatic animals [
8
]. Cd exposure induced aberrant autophagy and pyroptosis
in duck kidney tubular epithelial cells [
9
]. Cd can inhibit the function of T cells and B
cells, thereby affecting the humoral immune function of aquatic animals and mediating
the development of inflammatory responses that increase the burden on the immune sys-
tem [
10
,
11
]. Furthermore, it has been demonstrated through
in vitro
experiments that Cd
can directly interfere with signalling pathways, where cell activation and differentiation
are altered, ultimately leading to cytokine production, which in turn affects the status and
function of immune cells [
11
]. Cd exposure results in a significant increase in the serum
IL-17 mRNA level [
12
]; this may be attributed to the effect of Cd on innate immune cells,
which are required for the differentiation of cytokine-producing T cells [
13
]. Therefore, the
increased accumulation of Cd in fish is causing great damage to the aquaculture industry,
food safety and public health.
Se has antioxidant, anti-inflammatory, and heavy metal antagonistic functions; en-
hances reproductive function; and promotes basal metabolism in organisms. Se affects the
immune function of the body in three ways: cellular immunity, humoral immunity and non-
specific immunity. Se can enhance the secretion of IL-1 and IL-2 by lymphocytes, stimulate
the formation of immunoglobulins, and increase the levels of IgG and IgM [
14
]. Nano-Se
is a new form of Se supplementation, and the addition of nano-Se to feed im-proves the
activity of antioxidant enzymes in the L. capito liver [
15
]. Studies have shown that low
doses of Se can promote the proliferation of hepatocytes in mice under arsenic (As) stress
while attenuating the degree of lipid peroxidation in liver and kidney tissues, indicating
that Se can antagonise arsenic toxicity [
16
–
18
]. It has been reported that Se can alleviate Cd
toxicity by forming Se-Cd complexes with Cd, thereby reducing the bioavailability of Cd
and reducing oxidative damage in different organs and tissues, such as the liver, kidneys,
bones and blood [19].
Probiotics are defined as live beneficial microorganisms that, when ingested in moder-
ation, may help the host regulate the intestinal flora. Probiotics will have beneficial effects
on the host by colonising and altering the intestinal microbial population [
20
]. Feeding
L. plantarum enhanced kidney antioxidant enzyme activity and reduced Cd toxicity in
mice under Cd stress [
21
]. Probiotics can convert inorganic Se to nano-Se through bio-
transformation, which reduces Se toxicity while increasing the biological activity of the
probiotics, making Se conversion more efficient. Shang et al. carried out a Se enrichment
test on six strains of Bacillus sphaericus and reported that the highest Se enrichment and
Se conversion efficiency were found in Bacillus subtilis, with an enrichment content of
281.813
µ
g/mL and a Se conversion rate of 56% [
22
]. Studies have shown that probiotics
have the ability to adsorb the heavy metal Cd, which can reach saturation adsorption and
very high removal efficiency within one hour [
23
,
24
]. However, there are few studies on
the mechanism of Cd removal by Se-enriched L. plantarum.
Studies have demonstrated that Se and L. plantarum have antagonistic effects on heavy
metals, reducing their accumulation, promoting the immune response and modu-lating
the inflammatory response [
17
,
25
,
26
]. However, most of these studies focused on Se or
L. plantarum alone to antagonise heavy metal toxicity, and few studies have utilised the
biotransformation of L. plantarum from sodium selenite to Se nanoparticles to antago-nise
heavy metals. Therefore, the aim of this study was to investigate the effect of Se-enriched L.
plantarum in feed on the immune regulation of L. capito and its potential role in alleviating
the adverse effects of Cd toxicity through transcriptomics.
Fishes 2024,9, 230 3 of 14
2. Materials and Methods
2.1. Drugs and Reagents
Sodium selenite (Sinopharm Group Chemical Reagent Co., Ltd., Hitachi Aerospace
Corporation, Tokyo, Japan), Cd chloride (Tianjin Tianli Chemical Reagent Co., Ltd., Tianjin,
China), RNA fixative (Dalian Meilun Biotechnology Co., Ltd., Dalian, China), MRS medium
and MRS broth culture (Qingdao Haibo, Qingdao, China) were used.
2.2. Preparation of Se-Enriched Lactic Acid Bacteria
The detailed experimental procedures used for the adsorptive transformation of
inorganic Se by L. plantarum have been described previously [
1
]. Briefly, 200
µ
L of L.
plantarum and 200
µ
g/mL sodium selenite were added to 10 mL of MRS broth and incubated
aerobically and statically for 24 h at 37
◦
C. The obtained Se-enriched L. plantarum solution
was centrifuged at 3500 r/s for 5 min, after which the supernatant was discarded, and the
Se in the solution was washed away three times. The precipitated cells obtained were dried
in an oven at 37
◦
C. Bacterial powder (0.1 g) was mixed well with concentrated nitric acid
(65% HNO
3
). The digestion reaction was carried out on a hot plate until the sample was
completely dissolved. The Se concentration was determined by an AA-6300 (Shimadzu,
Japan) atomic absorption spectrometer
2.3. Scanning Electron Microscopy Observation of Se and Morphological Distribution of Bacteria
The L. plantarum strain was incubated in MRS medium at 37
◦
C for 12 h, transferred
to 24-well plates and incubated in MRS medium containing 200 g/mL Na
2
SeO
3
at 37
◦
C
for 24 h. Then, the bacteria were fixed with glutaraldehyde at 2.5% v/v/vand left at
room temperature for 1 h before being washed three times with PBS. The bacteria were
dehydrated in a series of gradients of ethanol (30% to 100%), the ethanol was replaced with
100% tert-butanol, the bacteria were then dried and coated with gold in a vacuum freeze
dryer, and the samples were scanned using a HITACHI SU8010 emission field scanning
electron microscope (Hitachi Aerospace Corporation, Dallas, TX, USA).
2.4. Experimental Design
L. capito (76.2
±
1.1 g) was procured from a specialized aquatic fry farm (Jilin province,
China) and transferred to the laboratory. A total of 270 L. capito individuals were randomly
and equally assigned to 9 aquariums (90
×
50
×
50 cm, 30 fish/aquarium). L. capito was
randomly reared in a tempered glass fish tank with three experimental groups—control
(C), Cd and Se-enriched Cd (S1L1-Cd)—with three replicates for each group, and the
culture experiment lasted for 28 d. Cd was added to the water (0.05 mg/L), and Se and Cd
concentrations were set according to previous studies [
1
]. Feeds were supplemented with
Se-enriched L. plantarum (nano-Se level of 5 mg/kg and L. plantarum content of 10
8
CFU/kg),
and all feeds were stored at 4
◦
C until use. To maintain the activity of L. plantarum, all the
finished feeds were stored at 4
◦
C and fed within 2 d. The feeds were stored at 4
◦
C and fed
within 2 d. The water was changed once a day, half of it at a time, and the corresponding
Cd was added according to the test concentration to maintain the set Cd concentration in
the water.
The fish were fasted for 12 h before the end of the experiment, and six fish were
removed from each group. One study recommended a minimum of 4 to 6 fish to obtain 80%
statistical significance in biochemical/immunological parameters [
27
]. Whole blood was
collected from the tail vein of the fish for biochemical analysis. The fish were euthanised
with 300 mg/L of methane-sulfonate-222. The kidneys of the fish were collected. The
kidneys were rinsed with precooled saline and then quickly placed in liquid nitrogen for
1.5 h. The kidneys were finally stored in a freezer at
−
80
◦
C for transcriptome sequencing
and qRT-PCR. This study was approved by the Animal Care and Use Committee of Jilin
Agricultural Science and Technology University (approval code: 20221011).
Fishes 2024,9, 230 4 of 14
2.5. Blood and Serum Immunological Tests
Blood was subsequently collected. Haematological indices were determined using
an animal blood cell analyser (Mindray BC-2800Vet, Shenzhen, China) according to the
manufacturer’s instructions.
Serum creatinine (Cr), blood urea nitrogen (BUN), uric acid (UA), C3, C4, and im-
munoglobulin M (IgM) levels and lysozyme (LZM) activity were measured using an ELISA
kit (Nanjing Jianjian Bioengineering Institute, Nanjing, Jiangsu, China).
2.6. Kidney Tissue Sections
Renal histological sections were fixed in 10% neutral-buffered formalin for histological
examination. The formalin-fixed tissues were embedded in paraffin and processed using
standard paraffin techniques. Sections stained with haematoxylin and eosin were processed
according to standard protocols [
28
]. Finally, the sample sections were observed on an
Axioskop microscope (IX71. Olympus, Hamburg, Germany).
2.7. Transcriptome
Sequencing was performed by Hangzhou Lianchuan Biotechnology Co., Ltd.
(Hangzhou, China) using a NovaSeq 6000 system (Illumina, San Diego, CA, USA). The
raw data obtained were filtered to maximise the data quality. Contaminated, low-quality
and unidentified bases were removed. A window quality scan of sequencing reads was
performed. The default scanning window was 6 bp. The portion of the reads from the
beginning of the window to the end of the 3
′
window was truncated when the aver-
age quality value in the window was less than 20. FastQC software was used for data
quality control, with 90% valid data and 90% valid data for Q20 and Q30. Truncated
sequences with N contents greater than 5% were removed. FastQC was used to as-
sess sequence quality, including the number of valid reads, Q20, Q30 and GC content
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) (accessed on 18 May 2023).
The expression levels of the unigenes were determined as transcripts per million (TPM)
values. After obtaining reads for genes. Differentially expressed unigenes with statisti-
cal significance (|log2-fold change|
≥
2, p< 0.05) were screened using the R package
edgeR (3.12.1).
2.8. Gene Ontology and Enrichment Analysis
Unigenes were obtained by reassembling the transcriptome using Trinity 2.4.0. All
newly assembled gene sequences (UniGene) were compared and annotated with the NR,
GO, EggNog and KEGG databases. Biological effects of differentially expressed genes
were demonstrated using GO (http://www.geneontology.org) (accessed on 18 May 2023);
signalling pathways between differentially expressed genes were analysed using KEGG
(http://www.genome.jp/kegg/) (accessed on 18 May 2023). The GO and KEGG classes
were significantly enriched (p< 0.05).
2.9. qRT-PCR
Total RNA was extracted from the kidneys of L. capito according to the instructions
of the Simply P Total RNA Extraction Kit (Hangzhou Bozhi Science and Technology Co.,
Ltd., Hangzhou, China). cDNA was reverse transcribed using 1
µ
g of total RNA according
to the instructions of the PrimeScript™ RT kit and gDNA Eraser (Beijing Baozhi Physical
Technology Co., Ltd., Beijing, China). For quantitative real-time fluorescence PCR (qRT-
PCR), qRT-PCR was performed on a QuantStudio 6 real-time PCR system. The sequences
of primers used for gene expression analysis are shown in Table 1. The relative expression
of each gene relative to that of the internal reference gene
β
-actin was calculated according
to the 2−∆∆CT method.
Fishes 2024,9, 230 5 of 14
Table 1. Primer sequences for polymerase chain reactions.
Gene Gene Name Nucleotide Sequence
(5′–3′)Accession No.
β-Actin Beta-Actin Forward
Reverse
CATTGGAGGGCAAGTCTGGT
CCCGAGATCCAACTACGAGC NR145818.1
HSP90AB1 Heat shock protein
90ab1
Forward
Reverse
ACCACCCTGCTCTGTACTACT
TCCTGAGGGTTGGGGATGAT
HSP70 Heat shock protein 70 Forward
Reverse
GCCATGAACCCCAACAACAC
TTTCGGCTTCCCTCCATCAC AY120894.1
IL-1βInterleukin-1βForward
Reverse
ACCAGCTGGATTTGTCAGAAG
ACATACTGAATTGAACTTTG AB010701
HSPA4L Heat shock 70-kDa
protein 4-like
Forward
Reverse
AACAGGACTTGCCAAACCCA
CAAAGTTGCATCCGCCCAAA
agr2 Anterior gradient 2 Forward
Reverse
AGCACTTGTCTCCTGATGGC
TACAGGCGGTTAGCATAGCG
MT-CO1
Mitochondrially
encoded cytochrome c
oxidase I
Forward
Reverse
TTAGCTGACTCGCCACACTC
TACAATGCCAGTCAGGCCAC
MT-ND4
Mitochondrially
encoded NADH
dehydrogenase 4
Forward
Reverse
ACAAGCTCCATCTGCCTACG
GAAGCTTCAGGGGGTTTGGA
VMO1 Vitelline membrane
outer layer 1
Forward
Reverse
TGGGGTCACAGGGAAATGTG
TGAACTGAGGCGTAGCTGTG
HSPA8 Heat shock protein
family A member 8
Forward
Reverse
AGTGGACAAAAGCACTGGCA
TTAAAGGCCAGCGACTCCAA
tnfaip8l2a
Tumour necrosis factor
alpha-induced protein
8-like protein 2
Forward
Reverse
GACAACAGCGGTGAGGTTCT
AAGTCCTGTGCCACACTCAG
C3 complement
component 3
Forward
Reverse
GTACGTGGGAAAGACGCTGA
CAGCGTAAGTGCTGGTCAGA
C5 complement
component 4
Forward
Reverse
GGAGGAACACACCAGCAAGT
GCTCTCCACGAACCATGGAA
2.10. Data Analysis
The data are expressed as the mean
±
standard deviation (mean
±
SD) of each group.
Differences in means between groups were analysed using one-way analysis of variance
(ANOVA), and multiple comparisons were performed using Tukey’s method and then
tested using the data analysis software SPSS 20.0. Differences with a pvalue < 0.05 were
considered to indicate statistical significance.
3. Results
3.1. Se-Enriched Lactic Acid Bacteria
As shown in Figure 1A, the L. plantarum surface was smooth. As shown in Figure 1B,
spherical Se nanoparticles (red arrows) were visibly attached to the surface of L. plantarum.
Zhang et al. [29] also obtained similar findings.
Fishes 2024,9, 230 6 of 14
Fishes 2024, 9, x FOR PEER REVIEW 7 of 16
Figure 1. Morphology of control (A) and Se-enriched L. plantarum (B) in 200 mg/L Se was analysed
by scanning electron microscopy. Nano-selenium particles (red arrow).
3.2. Kidney Histology and Morphology
As shown in Figure 2, kidney sections from the control group (A) show normal
glomeruli, proximal tubules and distal tubules, and after Cd stress (B) show glomerular
atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial cell
detachment, and a large number of inflammatory cells infiltrating the renal interstitium.
After feeding with Se-enriched L. plantarum, pathological changes in glomerular structure
were significantly reduced, the renal tubular structure was normal, and the number of
inflammatory cells in the renal interstitium was significantly reduced.
Figure 2. Histopathological observations of the kidneys. Kidneys’ morphology in group C (A), Cd
(B) and SL-Cd (C) (kidney tissues were fixed and stained with H&E. Original magnification ×400).
G: glomerulus; D: distal tubule; P: proximal tubule; ic: inflammatory cells.
3.3. Haemocyte Parameters and Serum Immune Responses
As shown in Figure 3, Cd exposure can cause cytotoxicity, which is a decrease in fish
immune functions. In this study, the haematological indices of L. capito were determined
under Cd or Se-enriched L. plantarum treatment. As expected, Cd exposure resulted in a
significant decrease in blood RBC, HCT and WBC counts, while the S1L1-Cd group had
significantly greater RBC, HCT and WBC counts.
Figure 1. Morphology of control (A) and Se-enriched L. plantarum (B) in 200 mg/L Se was analysed
by scanning electron microscopy. Nano-selenium particles (red arrow).
3.2. Kidney Histology and Morphology
As shown in Figure 2, kidney sections from the control group (A) show normal
glomeruli, proximal tubules and distal tubules, and after Cd stress (B) show glomerular
atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial cell
detachment, and a large number of inflammatory cells infiltrating the renal interstitium.
After feeding with Se-enriched L. plantarum, pathological changes in glomerular structure
were significantly reduced, the renal tubular structure was normal, and the number of
inflammatory cells in the renal interstitium was significantly reduced.
Fishes 2024, 9, x FOR PEER REVIEW 7 of 16
Figure 1. Morphology of control (A) and Se-enriched L. plantarum (B) in 200 mg/L Se was analysed
by scanning electron microscopy. Nano-selenium particles (red arrow).
3.2. Kidney Histology and Morphology
As shown in Figure 2, kidney sections from the control group (A) show normal
glomeruli, proximal tubules and distal tubules, and after Cd stress (B) show glomerular
atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial cell
detachment, and a large number of inflammatory cells infiltrating the renal interstitium.
After feeding with Se-enriched L. plantarum, pathological changes in glomerular structure
were significantly reduced, the renal tubular structure was normal, and the number of
inflammatory cells in the renal interstitium was significantly reduced.
Figure 2. Histopathological observations of the kidneys. Kidneys’ morphology in group C (A), Cd
(B) and SL-Cd (C) (kidney tissues were fixed and stained with H&E. Original magnification ×400).
G: glomerulus; D: distal tubule; P: proximal tubule; ic: inflammatory cells.
3.3. Haemocyte Parameters and Serum Immune Responses
As shown in Figure 3, Cd exposure can cause cytotoxicity, which is a decrease in fish
immune functions. In this study, the haematological indices of L. capito were determined
under Cd or Se-enriched L. plantarum treatment. As expected, Cd exposure resulted in a
significant decrease in blood RBC, HCT and WBC counts, while the S1L1-Cd group had
significantly greater RBC, HCT and WBC counts.
Figure 2. Histopathological observations of the kidneys. Kidneys’ morphology in group C (A), Cd
(B) and SL-Cd (C) (kidney tissues were fixed and stained with H&E. Original magnification
×
400).
G: glomerulus; D: distal tubule; P: proximal tubule; ic: inflammatory cells.
3.3. Haemocyte Parameters and Serum Immune Responses
As shown in Figure 3, Cd exposure can cause cytotoxicity, which is a decrease in fish
immune functions. In this study, the haematological indices of L. capito were determined
under Cd or Se-enriched L. plantarum treatment. As expected, Cd exposure resulted in a
Fishes 2024,9, 230 7 of 14
significant decrease in blood RBC, HCT and WBC counts, while the S1L1-Cd group had
significantly greater RBC, HCT and WBC counts.
Fishes 2024, 9, x FOR PEER REVIEW 8 of 16
Figure 3. Blood and serum immune parameters of red blood cells (A) and leucocytes (B), HCT (C),
complement 3, C3 (D) complement 4, C4 (E), IgM (F), and lysozyme activity, LZM (G), of L. capito
after Cd or S1L1-Cd. Data are expressed as the mean ± S.D (n = 5). Bar graphs with different letter
superscripts, values are significantly different from each other.
The serum LZM, C3, C4 and IgM levels are nonspecific immune indicators that are
important for resisting pathogen invasion and maintaining the health of fish. In this study,
the serum levels of LZM, C3 and IgM were significantly lower in the Cd group than in the
control group. The serum levels of LZM, C3, and IgM were significantly greater in the
S1L1-Cd group than in the Cd and control groups. However, there was no significant
change in the serum level of C4, and its mechanism of action needs to be further
investigated and discussed. These results show that the addition of selenium-enriched L.
plantarum to the feed could improve the immune function of L. capito and alleviate
cadmium-induced immunosuppression.
3.4. Kidney Damage Indicators
The three indicators of blood urea nitrogen (BUN), inosine (CR), and uric acid (UA)
in serum are sensitive serological indicators of kidney injury (Figure 4). Their levels can
directly reflect kidney function. In this study, compared with those in the control group,
the serum Cr, BUN, and UA levels in the Cd group were significantly greater. Compared
with those in the Cd group, the levels of serum Cr, BUN and UA significantly decreased
in the S1L1-Cd group, but elevated compared to the control group. This result shows that
selenium-enriched L. plantarum can attenuate cadmium stress-induced renal injury.
Figure 4. Serum biochemical parameters of L. capito under Cd or S1L1-Cd. BUN (A), CR (B), and
UA (C). Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are
significant (p < 0.05), as determined by Tukey’s test.
Figure 3. Blood and serum immune parameters of red blood cells (A) and leucocytes (B), HCT (C),
complement 3, C3 (D) complement 4, C4 (E), IgM (F), and lysozyme activity, LZM (G), of L. capito
after Cd or S1L1-Cd. Data are expressed as the mean
±
S.D (n = 5). Bar graphs with different letter
superscripts, values are significantly different from each other.
The serum LZM, C3, C4 and IgM levels are nonspecific immune indicators that are
important for resisting pathogen invasion and maintaining the health of fish. In this study,
the serum levels of LZM, C3 and IgM were significantly lower in the Cd group than in the
control group. The serum levels of LZM, C3, and IgM were significantly greater in the S1L1-
Cd group than in the Cd and control groups. However, there was no significant change
in the serum level of C4, and its mechanism of action needs to be further investigated
and discussed. These results show that the addition of selenium-enriched L. plantarum to
the feed could improve the immune function of L. capito and alleviate cadmium-induced
immunosuppression.
3.4. Kidney Damage Indicators
The three indicators of blood urea nitrogen (BUN), inosine (CR), and uric acid (UA)
in serum are sensitive serological indicators of kidney injury (Figure 4). Their levels can
directly reflect kidney function. In this study, compared with those in the control group,
the serum Cr, BUN, and UA levels in the Cd group were significantly greater. Compared
with those in the Cd group, the levels of serum Cr, BUN and UA significantly decreased
in the S1L1-Cd group, but elevated compared to the control group. This result shows that
selenium-enriched L. plantarum can attenuate cadmium stress-induced renal injury.
Fishes 2024, 9, x FOR PEER REVIEW 8 of 16
Figure 3. Blood and serum immune parameters of red blood cells (A) and leucocytes (B), HCT (C),
complement 3, C3 (D) complement 4, C4 (E), IgM (F), and lysozyme activity, LZM (G), of L. capito
after Cd or S1L1-Cd. Data are expressed as the mean ± S.D (n = 5). Bar graphs with different letter
superscripts, values are significantly different from each other.
The serum LZM, C3, C4 and IgM levels are nonspecific immune indicators that are
important for resisting pathogen invasion and maintaining the health of fish. In this study,
the serum levels of LZM, C3 and IgM were significantly lower in the Cd group than in the
control group. The serum levels of LZM, C3, and IgM were significantly greater in the
S1L1-Cd group than in the Cd and control groups. However, there was no significant
change in the serum level of C4, and its mechanism of action needs to be further
investigated and discussed. These results show that the addition of selenium-enriched L.
plantarum to the feed could improve the immune function of L. capito and alleviate
cadmium-induced immunosuppression.
3.4. Kidney Damage Indicators
The three indicators of blood urea nitrogen (BUN), inosine (CR), and uric acid (UA)
in serum are sensitive serological indicators of kidney injury (Figure 4). Their levels can
directly reflect kidney function. In this study, compared with those in the control group,
the serum Cr, BUN, and UA levels in the Cd group were significantly greater. Compared
with those in the Cd group, the levels of serum Cr, BUN and UA significantly decreased
in the S1L1-Cd group, but elevated compared to the control group. This result shows that
selenium-enriched L. plantarum can attenuate cadmium stress-induced renal injury.
Figure 4. Serum biochemical parameters of L. capito under Cd or S1L1-Cd. BUN (A), CR (B), and
UA (C). Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are
significant (p < 0.05), as determined by Tukey’s test.
Figure 4. Serum biochemical parameters of L. capito under Cd or S1L1-Cd. BUN (A), CR (B), and UA
(C). Data are expressed as the mean
±
S.D. (n = 5). Values with different superscripts are significant
(p< 0.05), as determined by Tukey’s test.
3.5. Transcriptome
The quality control results of the transcriptome sequencing are shown in Table 2. The
three samples in Group C obtained 38,813,784, 42,393,916 and 42,578,024 readings, and the
Fishes 2024,9, 230 8 of 14
samples in group Cd obtained 37,924,708, 41,503,984 and 41,839,558 readings, respectively.
The 46,031,170, 42,993,436 and 39,382,828 readings were obtained for the S1L1_Cd group.
The differences in gene expression in the kidney tissues of L. capito plants treated with Cd
and L. plantarum are shown in Figure 5A. There were 488 DEGs in the control group and
the Cd group, of which 301 genes were upregulated and 187 genes were downregulated.
There were 1474 DEGs in the C and S1L1-Cd groups, of which 720 genes were upregulated
and 754 genes were downregulated. A total of 989 DEGs were expressed in the S1L1-Cd
and Cd groups; 510 genes were upregulated, and 497 genes were downregulated. A Venn
diagram can more directly show the overlap of differential gene expression. As shown in
Figure 5B, two significantly differentially expressed genes were found in all the groups. The
cluster analysis of differential gene expression is shown in Figure 5C. The two differentially
expressed genes were TRINITY_DN15244_c0_g1 (agr2) and TRINITY_DN16045_c0_g1.
Fishes 2024, 9, x FOR PEER REVIEW 9 of 16
3.5. Transcriptome
The quality control results of the transcriptome sequencing are shown in Table 2. The
three samples in Group C obtained 38,813,784, 42,393,916 and 42,578,024 readings, and the
samples in group Cd obtained 37,924,708, 41,503,984 and 41,839,558 readings,
respectively. The 46,031,170, 42,993,436 and 39,382,828 readings were obtained for the
S1L1_Cd group. The differences in gene expression in the kidney tissues of L. capito plants
treated with Cd and L. plantarum are shown in Figure 5A. There were 488 DEGs in the
control group and the Cd group, of which 301 genes were upregulated and 187 genes were
downregulated. There were 1474 DEGs in the C and S1L1-Cd groups, of which 720 genes
were upregulated and 754 genes were downregulated. A total of 989 DEGs were
expressed in the S1L1-Cd and Cd groups; 510 genes were upregulated, and 497 genes
were downregulated. A Venn diagram can more directly show the overlap of differential
gene expression. As shown in Figure 5B, two significantly differentially expressed genes
were found in all the groups. The cluster analysis of differential gene expression is shown
in Figure 5C. The two differentially expressed genes were TRINITY_DN15244_c0_g1
(agr2) and TRINITY_DN16045_c0_g1.
Figure 5. Differentially expressed genes (A), Venn diagram (B), and heatmap of the differentially
expressed genes (C) in L. capito treated with Cd and Se-enriched L. plantarum. Note: Red represents
upregulated genes, blue represents downregulated genes. C: the control group; S1L1-Cd: the S1L1-
Cd group; Cd: the Cd group; n = 3.
Figure 5. Differentially expressed genes (A), Venn diagram (B), and heatmap of the differentially
expressed genes (C) in L. capito treated with Cd and Se-enriched L. plantarum. Note: Red represents
upregulated genes, blue represents downregulated genes. C: the control group; S1L1-Cd: the S1L1-Cd
group; Cd: the Cd group; n = 3.
Table 2. Transcriptome sequencing quality control results.
Sample Raw_Reads Clean_Reads
C1 39,890,490 38,813,784
C2 43,258,692 42,393,916
C3 43,489,474 42,578,024
Cd1 39,470,924 37,924,708
Cd2 42,786,912 41,503,984
Cd3 43,699,384 41,839,558
S1L1-Cd1 47,325,678 46,031,170
S1L1-Cd2 44,356,428 42,993,436
S1L1-Cd3 40,541,038 39,382,828
Fishes 2024,9, 230 9 of 14
We used GO enrichment to analyse DEGs in L. capito plants treated with Cd- or Se-
enriched L. plantarum. DNA templates (transcriptional regulation) and signal transduction
were significantly enriched. Membranes, membrane components and cellular components
of the nucleus were significantly enriched. The molecular functions of metal ion binding,
ATP binding, and nucleotide inclusion were the most highly differentially expressed genes
(Figure 6A).
Fishes 2024, 9, x FOR PEER REVIEW 10 of 16
Table 2. Transcriptome sequencing quality control results.
Sample Raw_Reads Clean_Reads
C1 39,890,490 38,813,784
C2 43,258,692 42,393,916
C3 43,489,474 42,578,024
Cd1 39,470,924 37,924,708
Cd2 42,786,912 41,503,984
Cd3 43
,
699
,
384 41
,
839
,
558
S1L1-Cd1 47,325,678 46,031,170
S1L1-Cd2 44,356,428 42,993,436
S1L1-Cd3 40,541,038 39,382,828
We used GO enrichment to analyse DEGs in L. capito plants treated with Cd- or Se-
enriched L. plantarum. DNA templates (transcriptional regulation) and signal transduction
were significantly enriched. Membranes, membrane components and cellular
components of the nucleus were significantly enriched. The molecular functions of metal
ion binding, ATP binding, and nucleotide inclusion were the most highly differentially
expressed genes (Figure 6A).
Figure 6. GO (A) and KEGG (B) enrichment results.
The KEGG database annotates differentially expressed gene enrichment pathways.
Our results showed that the enriched pathways were as follows: environmental
information processing, cellular processes, and human diseases (Figure 6B). The kidney
tissue enrichment pathways consisted of four main categories: organismal systems,
metabolism, human diseases, genetic information processing, environmental information
processing and cellular processes. The six pathways with the greatest enrichment were
signal transduction, endocrine system, cell growth and death, cellular community
eukaryotes, signalling molecules and interaction and immune system. The 20 pathways
with the most significant enrichment in KEGG pathways were analysed. Research has
shown that Cd is closely related to signalling pathways related to kidney immune injury.
The following six of the most closely related enrichment pathways were identified:
oxidative phosphorylation, Huntington disease, retrograde endocannabinoid signalling,
natural killer cell-mediated cytotoxicity, the IL-17 signalling pathway, and leukocyte
transendothelial migration (Figure 7).
Figure 6. GO (A) and KEGG (B) enrichment results.
The KEGG database annotates differentially expressed gene enrichment pathways.
Our results showed that the enriched pathways were as follows: environmental informa-
tion processing, cellular processes, and human diseases (Figure 6B). The kidney tissue
enrichment pathways consisted of four main categories: organismal systems, metabolism,
human diseases, genetic information processing, environmental information processing
and cellular processes. The six pathways with the greatest enrichment were signal transduc-
tion, endocrine system, cell growth and death, cellular community eukaryotes, signalling
molecules and interaction and immune system. The 20 pathways with the most significant
enrichment in KEGG pathways were analysed. Research has shown that Cd is closely re-
lated to signalling pathways related to kidney immune injury. The following six of the most
closely related enrichment pathways were identified: oxidative phosphorylation, Hunting-
ton disease, retrograde endocannabinoid signalling, natural killer cell-mediated cytotoxicity,
the IL-17 signalling pathway, and leukocyte transendothelial migration (Figure 7).
Fishes 2024, 9, x FOR PEER REVIEW 11 of 16
Figure 7. Enrichment analysis of KEGG in brain transcriptome of L. capito. (A) (Cd vs. C), (B) (S1L1-
Cd vs. C).
3.6. qRT‒PCR Validation
Twelve DEGs from L. capito kidneys were randomly selected for qRT‒PCR to verify
the reliability and reproducibility of the RNA-Seq data (Figure 8). HSP90AB1, hsp70,
and HSPA4L expression levels were significantly greater in the Cd group than in the
control group, and agr2 and VMO1 expression levels were lower in the Cd group
than in the control group (Figure 8A). The results showed that the expression levels
of MT-CO1, MT-ND4, HSP90AB1, and HSPA8 in the S1L1-Cd group were
significantly greater than those in the control group, and the expression levels of
agr2, VMO1, IL1B, and tnfaip8l2a were lower than those in the control group (Figure
8B).
Figure 8. The comparison genes for RNA-Seq and qRT-PCR. X-axis represents genes and Y-axis
represents relative fold change ((A): Cd vs. C; (B): S1L1-Cd vs. C). The data of this study are
presented as mean ± SD of three parallel measurements (n = 3).
4. Discussion
Cd is a toxic heavy metal, and Cd is widely present in natural aquatic environments.
Long-term exposure to Cd or excessive Cd intake can cause serious damage to the
physiological functions of aquatic animals and oxidative stress [30]. The kidneys are the
main target organs of Cd exposure, and Cd is mainly excreted through the kidneys when
it enters the body of aquatic animals. When the Cd concentration is too high, the kidneys
are unable to efficiently excrete Cd, which leads to the accumulation of Cd in the kidneys,
thus causing kidney damage [31]. A study reported that Cd exposure can lead to severe
damage to the histological structure of the kidney in male rats and that Se can reduce Cd
accumulation and alleviate kidney damage [32]. In this study, we found that Cd stress
Figure 7. Enrichment analysis of KEGG in brain transcriptome of L. capito. (A) (Cd vs. C), (B) (S1L1-Cd
vs. C).
Fishes 2024,9, 230 10 of 14
3.6. qRT-PCR Validation
Twelve DEGs from L. capito kidneys were randomly selected for qRT-PCR to verify
the reliability and reproducibility of the RNA-Seq data (Figure 8). HSP90AB1, hsp70, and
HSPA4L expression levels were significantly greater in the Cd group than in the control
group, and agr2 and VMO1 expression levels were lower in the Cd group than in the control
group (Figure 8A). The results showed that the expression levels of MT-CO1, MT-ND4,
HSP90AB1, and HSPA8 in the S1L1-Cd group were significantly greater than those in the
control group, and the expression levels of agr2, VMO1, IL1B, and tnfaip8l2a were lower
than those in the control group (Figure 8B).
Fishes 2024, 9, x FOR PEER REVIEW 11 of 16
Figure 7. Enrichment analysis of KEGG in brain transcriptome of L. capito. (A) (Cd vs. C), (B) (S1L1-
Cd vs. C).
3.6. qRT‒PCR Validation
Twelve DEGs from L. capito kidneys were randomly selected for qRT‒PCR to verify
the reliability and reproducibility of the RNA-Seq data (Figure 8). HSP90AB1, hsp70,
and HSPA4L expression levels were significantly greater in the Cd group than in the
control group, and agr2 and VMO1 expression levels were lower in the Cd group
than in the control group (Figure 8A). The results showed that the expression levels
of MT-CO1, MT-ND4, HSP90AB1, and HSPA8 in the S1L1-Cd group were
significantly greater than those in the control group, and the expression levels of
agr2, VMO1, IL1B, and tnfaip8l2a were lower than those in the control group (Figure
8B).
Figure 8. The comparison genes for RNA-Seq and qRT-PCR. X-axis represents genes and Y-axis
represents relative fold change ((A): Cd vs. C; (B): S1L1-Cd vs. C). The data of this study are
presented as mean ± SD of three parallel measurements (n = 3).
4. Discussion
Cd is a toxic heavy metal, and Cd is widely present in natural aquatic environments.
Long-term exposure to Cd or excessive Cd intake can cause serious damage to the
physiological functions of aquatic animals and oxidative stress [30]. The kidneys are the
main target organs of Cd exposure, and Cd is mainly excreted through the kidneys when
it enters the body of aquatic animals. When the Cd concentration is too high, the kidneys
are unable to efficiently excrete Cd, which leads to the accumulation of Cd in the kidneys,
thus causing kidney damage [31]. A study reported that Cd exposure can lead to severe
damage to the histological structure of the kidney in male rats and that Se can reduce Cd
accumulation and alleviate kidney damage [32]. In this study, we found that Cd stress
Figure 8. The comparison genes for RNA-Seq and qRT-PCR. X-axis represents genes and Y-axis
represents relative fold change ((A): Cd vs. C; (B): S1L1-Cd vs. C). The data of this study are presented
as mean ±SD of three parallel measurements (n = 3).
4. Discussion
Cd is a toxic heavy metal, and Cd is widely present in natural aquatic environments.
Long-term exposure to Cd or excessive Cd intake can cause serious damage to the physi-
ological functions of aquatic animals and oxidative stress [
30
]. The kidneys are the main
target organs of Cd exposure, and Cd is mainly excreted through the kidneys when it enters
the body of aquatic animals. When the Cd concentration is too high, the kidneys are unable
to efficiently excrete Cd, which leads to the accumulation of Cd in the kidneys, thus causing
kidney damage [
31
]. A study reported that Cd exposure can lead to severe damage to the
histological structure of the kidney in male rats and that Se can reduce Cd accumulation
and alleviate kidney damage [
32
]. In this study, we found that Cd stress caused glomerular
atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial
cell detachment in renal tissues, whereas the lesions were significantly attenuated by the
addition of Se-enriched L. plantarum to the feed, which suggests that Cd exposure causes
damage to the kidney tissues of L. capito and that Se-enriched L. plantarum alleviates Cd
damage to the kidneys.
A study revealed that Cd concentrations were greater than 0.1 mg/kg in the muscle,
liver and kidneys of carp (Cyprinus carpio) and catfish (Silurus glanis) from the Buško
Blato region of Bosnia and Herzegovina, and Cd accumulation reached its highest level
in the kidneys [
33
]. Cd has been shown to have toxic effects on the hepatopancreas,
cardiovascular, immune and reproductive systems [
34
,
35
]. Cd stress can lead to significant
changes in blood biochemical indices in aquatic animals. Similarly, acute Cd exposure
led to a significant reduction in blood WBC, RBC, and HCT levels in mice [
35
]. Similar
results were obtained by Simsek, where Cd-containing feeds led to anaemia in mice by
causing a reduction in erythrocyte, leukocyte, and ANAE-positive T-lymphocyte counts
as well as Hb, PCV, and MCHC values in mouse groups. In the present study, our results
also revealed a decrease in RBC, HGB and HCT, which may be due to the inhibition of
erythropoiesis induced by Cd chloride, whereas the increase in leucocytes may be a result
of enhanced immunomodulation of the organism affected by oxidative stress [36].
Serum creatinine (Cr), blood urea nitrogen (BUN), and uric acid (UA) are the main
indicators for evaluating renal function. Heavy metal exposure can lead to a significant
Fishes 2024,9, 230 11 of 14
increase in serum Cr, BUN, and UA [
37
]. Fluoride exposure was also found to cause
oxidative damage and nephropathy in mice and significantly increased urea nitrogen
(BUN), creatine and serum creatinine levels [
38
]. Studies have confirmed that Se can
attenuate hexavalent chromium [Cr(VI)]-induced renal dysfunction by lowering the serum
levels of BUN and CRE [
39
]. In the present study, long-term Cd exposure resulted in
significantly higher levels of serum Cr, BUN, and UA in L. capito, which suggests that
Cd can cause renal dysfunction. Compared with those in the Cd group, the Se-enriched
Cd group had significantly lower serum Cr, BUN, and UA levels, which suggests that
Se-enriched L. plantarum can alleviate the damage caused by Cd in the kidney to a certain
extent. Fish are lower metameric vertebrates with relatively low specific immune responses,
and the nonspecific immune system is of great importance to scleractinian fishes under
abiotic stress. Lysozyme is an important component of nonspecific immunity in fish and
is widely present in fish mucus and serum, where it activates phagocytic complements in
addition to lysing bacteria [40].
In addition, IgM is an important measure of humoral immunity and health in fish.
External oxidative stress has a significant effect on the level of immunity in fish. When
Takifugu rubripes were subjected to nitrite stress, the serum LZM and IgM levels decreased
significantly, leading to immune dysfunction and immunotoxicity [
41
]. It has also been
found that ammonia exposure results in significantly lower concentrations of C3, C4, IgM
and LZM and reduced immune function in redfin puffer [
42
]. In the present study, we found
that Cd stress resulted in a significant reduction in the levels of C3, IgM and LZM in L.
capito, whereas there was no significant change in the level of C4. Se and L. plantarum
have growth-promoting, immune-enhancing and antioxidant functions [
43
]. L. plantarum
belongs to a branch of Lactobacillus, and it has been shown that Lactobacillus has growth-
promoting, immune-enhancing and disease-resistant functions. The administration of
Lactobacillus to loaches significantly increased C3, C4, IgM and LZM levels and enhanced
humoral immunity [
44
]. In our study, the addition of Se-enriched L. plantarum to the feed
after Cd exposure increased the C3, IgM and LZM levels, suggesting that Se-enriched L.
plantarum alleviated Cd-induced immunosuppression in L. capito.
The transendothelial migration of leukocytes is the process by which leukocytes pass
through the vascular endothelium into tissues and is essential for the functioning of the
immune system because it allows leukocytes to reach damaged cells or tissues [
45
]. In
the inflammatory response, leukocyte migration across the endothelium is an important
factor. Through transendothelial migration, leukocytes can reach damaged tissues while
removing pathogens and waste products from damaged tissues, promoting tissue repair
and regeneration [
46
]. Lymphocytes are an important part of the immune system that
makes up an organism. Humoral immunity is mediated by antibodies produced by B
lymphocytes (B cells); antibodies recognise extracellular microorganisms, bind to them
(blocking host cell infection in this way) and promote phagocytosis for microbial uptake
and destruction; and T lymphocytes (T cells), the mediators of cell-mediated immunity,
destroy intracellular microorganisms [47].
IL-17 is a bridge between innate and adaptive immunity, as it is produced by adaptive
and ‘innate’ T cells and activates the gene expression program typical of the innate immune
response; IL-17 has been implicated in a variety of diseases, and IL-17 activates the nf-
κ
B
and MAPK pathways, which regulate the production of inflammatory mediators [
48
]. In
recent years, the IL-17 family has attracted much attention from a wide range of medical
researchers. One study showed that IL-17 and IL-23 levels were significantly greater in
AIH patients than in chronic hepatitis B (CHB) patients and healthy controls [
49
]. In
addition, IL-17 can promote oxidative stress-induced hepatocyte apoptosis through the
Nrf2/Keap1 signalling pathway [
50
,
51
]. In the present study, Cd exposure significantly
enriched leukocyte transendothelial migration and the IL-17, TNF and nrf-
κ
B signalling
pathways, revealing that Cd exposure promotes oxidative stress-mediated inflammatory
responses in L. capito. In contrast, the addition of Se-enriched L. plantarum to the feed
significantly reversed the changes in the expression levels of these inflammatory factors,
Fishes 2024,9, 230 12 of 14
revealing that Se-enriched L. plantarum mitigated Cd-mediated immune responses by
modulating inflammatory factors.
5. Conclusions
In conclusion, our study showed that Cd exposure causes damage to the kidneys
of L. capito. Cd exposure induced immunosuppression and further reduced immune
levels through haematological and immunological parameters. Cd regulates immune and
inflammatory responses by activating the transendothelial migration pathway of leukocytes.
KEGG pathway analysis revealed that Cd stress significantly enriched the IL-17 signalling
pathway, which is involved in the inflammatory response. In contrast, the addition of Se-
enriched L. plantarum to the feed significantly alleviated renal tissue injury. The Se-enriched
L. plantarum treatment significantly reversed the effects of Cd stress on haematological and
immunological parameters and alleviated Cd exposure-induced renal injury through the
transendothelial migratory pathway, and the IL-17 signalling pathway was involved in
the inflammatory response. Overall, the present study revealed the potential mechanism
by which Se-enriched L. plantarum alleviates Cd-induced renal pathology and provided a
theoretical basis for assessing the toxic effects of Cd in fish.
Author Contributions: Q.S.: Conceptualization, formal analysis, investigations, methodology, visu-
alization, writing—original draft. Y.P.: investigations, farming techniques, surveys. Y.Q.: farming
techniques, surveys, visualization. Z.D.: methodology, formal analysis, visualization. Y.M.: farming
techniques, visualization. Y.Z.: farming techniques, surveys, visualization. Z.Z.: farming techniques,
surveys, visualization. J.L.: formal analysis. B.M.: investigations, methodology. B.Y.: conceptualiza-
tion, formal analysis, methodology, project management, resources, supervision, writing—original
draft, writing—review and editing. All authors have read and agreed to the published version of the
manuscript.
Funding: This research was funded by the Jilin province science and technology development
planning grant program (Grant No. YDZJ202201ZYTS612) and Jilin city science and technology
innovation development plan project (Grant No. 20230103009).
Institutional Review Board Statement: The animal study protocol was approved by the Ani-
mal Care and Use Committee of Jilin Agricultural Science and Technology University (approval
code: 20221011).
Informed Consent Statement: Informed consent was obtained from all subjects involved in the study.
Data Availability Statement: Data are contained within the article.
Acknowledgments: We would like to thank the Jilin Agricultural University Aquatic Nursery Farm
(China, Jilin) for providing animal care and facilities for this research project.
Conflicts of Interest: The authors declare no conflicts of interest.
References
1.
Genchi, G.; Sinicropi, M.S.; Lauria, G.; Carocci, A.; Catalano, A. The effects of cadmium toxicity. Int. J. Environ. Res. Public Health
2020,17, 3782. [CrossRef] [PubMed]
2.
Dong, X.L.; Xu, W.; Wei, Y.Y.; Xu, Q.Y. The complete mitochondrial genome of Barbus capito (Cypriniformes, Cyprinidae).
Mitochondr Dna. 2013,24, 326–327. [CrossRef] [PubMed]
3.
Canli, M.A.Y.O.; Ay, Ö.; Kalay, M. Levels of Heavy Metals (Cd, Pb, Cu, Cr and Ni) in Tissue of Cyprinus carpio, Barbus capitoand
Chondrostoma regiumfrom the Seyhan River, Turkey. Turk. J. Zool. 1998,22, 149–158.
4.
Koca, S.; Koca, Y.B.; Yildiz, ¸S.; Gürcü, B. Genotoxic and histopathological effects of water pollution on two fish species, Barbus
capito pectoralis and Chondrostoma nasus in the Büyük Menderes River, Turkey. Biol. Trace Element. Res. 2008,122, 276–291.
[CrossRef] [PubMed]
5.
Shang, X.; Xu, W.; Zhang, Y.; Sun, Q.; Li, Z.; Geng, L.; Teng, X. Transcriptome analysis revealed the mechanism of Luciobarbus
capito (L. capito) adapting high salinity: Antioxidant capacity, heat shock proteins, immunity. Mar. Pollut. Bull. 2023,192, 115017.
[CrossRef] [PubMed]
6.
Shi, X.; Xu, W.; Che, X.; Cui, J.; Shang, X.; Teng, X.; Jia, Z. Effect of arsenic stress on the intestinal structural integrity and intestinal
flora abundance of Cyprinus carpio. Front. Microbiol. 2023,14, 1179397. [CrossRef] [PubMed]
Fishes 2024,9, 230 13 of 14
7.
Satarug, S.; Garrett, S.H.; Sens, M.A.; Sens, D.A. Cadmium, environmental exposure, and health outcomes. Environ. Health Persp.
2010,118, 182–190. [CrossRef] [PubMed]
8.
Rani, A.; Kumar, A.; Lal, A.; Pant, M. Cellular mechanisms of cadmium-induced toxicity: A review. Int. J. Environ. Heal. Res. 2014,
24, 378–399. [CrossRef]
9.
Zhang, C.; Hu, Z.; Hu, R.; Pi, S.; Wei, Z.; Wang, C.; Yang, F.; Xing, C.; Nie, G.; Hu, G. New insights into crosstalk between
pyroptosis and autophagy co-induced by molybdenum and cadmium in duck renal tubular epithelial cells. J. Hazard. Mater. 2021,
416, 126138. [CrossRef]
10. Zhang, N.; Bevan, M.J. CD8+ T cells: Foot soldiers of the immune system. Immunity 2011,35, 161–168. [CrossRef]
11.
Castellino, F.; Germain, R.N. Cooperation between CD4+ and CD8+ T cells: When, where, and how. Annu. Rev. Immunol. 2006,
24, 519–540. [CrossRef] [PubMed]
12.
Goyal, T.; Mitra, P.; Singh, P.; Sharma, S.; Purohit, P.; Sharma, P. Effect of occupational co-exposure to lead and cadmium on
selected immunomodulatory cytokines. Toxicol. Ind. Health 2022,38, 1–10. [CrossRef] [PubMed]
13.
Tucovic, D.; Aleksandrov, A.P.; Mirkov, I.; Ninkov, M.; Kulas, J.; Zolotarevski, L.; Vukojevic, V.; Mutic, J.; Tatalovic, N.;
Kataranovski, M. Oral cadmium exposure affects skin immune reactivity in rats. Ecotoxicol. Environ. Safe. 2018,164, 12–20.
[CrossRef] [PubMed]
14.
Minetti, G. Mevalonate pathway, selenoproteins, redox balance, immune system, Covid-19: Reasoning about connections. Med.
Hypotheses 2020,144, 110128. [CrossRef]
15.
Shang, X.; Xu, W.; Zhao, Z.; Luo, L.; Zhang, Q.; Li, M.; Geng, L. Effects of exposure to cadmium (Cd) and selenium-enriched
Lactobacillus plantarum in Luciobarbus capito: Bioaccumulation, antioxidant responses and intestinal microflora. COMP Biochem.
Phys. C 2022,257, 109352. [CrossRef] [PubMed]
16.
Ren, Z.; Wu, Q.; Deng, H.; Yu, Y.; Tang, W.; Deng, Y.; Deng, J. Effects of selenium on the immunotoxicity of subacute arsenic
poisoning in chickens. Biol. Trace Element. Res. 2021, 1–13. [CrossRef] [PubMed]
17.
Li, Y.; Liang, J.; Jiang, C.; Cui, J.; Hong, L.; Hao, Z.; Teng, X. Se alleviated Pb-caused neurotoxicity in chickens: SPS2-GPx1-GSH-IL-
2/IL-17-NO pathway, selenoprotein suppression, oxidative stress, and inflammatory injury. Antioxidants 2024,13, 370. [CrossRef]
[PubMed]
18.
Chen, D.; Yu, W.; Hao, Z.; Qiu, M.; Cui, J.; Tang, Y.; Liu, H. Molecular mechanism of selenium against lead-induced apoptosis in
chicken brainstem relating to heat shock protein, selenoproteins, and inflammatory cytokines. Ecotox Environ Safe. 2024,272,
116028. [CrossRef] [PubMed]
19.
Banni, M.; Chouchene, L.; Said, K.; Kerkeni, A.; Messaoudi, I. Mechanisms underlying the protective effect of zinc and selenium
against cadmium-induced oxidative stress in zebrafish Danio rerio. Biometals 2011,24, 981–992. [CrossRef]
20. Reid, G. Probiotics: Definition, scope and mechanisms of action. Best. Pract. Res. Clin. Gastroenterol. 2016,30, 17–25. [CrossRef]
21.
Zhang, Q.; Shang, X.; Geng, L.; Che, X.; Wei, H.; Tang, S.; Xu, W. Dietary Selenium-Rich Lactobacillus plantarum Alleviates
Cadmium-Induced Oxidative Stress and Inflammation in Bulatmai barbel Luciobarbus capito. Fishes 2023,8, 136. [CrossRef]
22.
Shang, X.; Sun, Q.; Yin, Y.; Zhang, Y.; Zhang, P.; Mao, Q.; Li, Y. Reducingmercury accumulation in common carp using
selenium-enriched Bacillus subtilis. Aquacult Rep. 2021,19, 100609. [CrossRef]
23.
Ibrahim, F.; Halttunen, T.; Tahvonen, R.; Salminen, S. Probiotic bacteria as potential detoxification tools: Assessing their heavy
metal binding isotherms. Can. J. Microbiol. 2006,52, 877–885. [CrossRef] [PubMed]
24.
Teemu, H.; Seppo, S.; Jussi, M.; Raija, T.; Kalle, L. Reversible surface binding of cadmium and lead by lactic acid and bifidobacteria.
Int. J. Food Microbiol. 2008,125, 170–175. [CrossRef] [PubMed]
25.
Kumar, N.; Kumar, V.; Panwar, R.; Ram, C. Efficacy of indigenous probiotic Lactobacillus strains to reduce cadmium
bioaccessibility-an in vitro digestion model. Environ. Sci. Pollut. Res. 2017,24, 1241–1250. [CrossRef]
26.
Zhai, Q.; Liu, Y.; Wang, C.; Qu, D.; Zhao, J.; Zhang, H.; Chen, W. Lactobacillus plantarum CCFM8661 modulates bile acid
enterohepatic circulation and increases lead excretion in mice. Food Funct. 2019,10, 1455–1464. [CrossRef] [PubMed]
27.
Gagnon, M.M.; Hodson, P.V. Field studies using fish biomarkers–How many fish are enough? Mar. Pollut. Bull. 2012,64,
2871–2876. [CrossRef]
28.
Tanaka, N.; Izawa, T.; Kuwamura, M.; Higashiguchi, N.; Kezuka, C.; Kurata, O.; Yamate, J. The first case of infectious spleen and
kidney necrosis virus (ISKNV) infection in aquarium-maintained mandarin fish, S iniperca chuatsi (B asilewsky), in Japan. J. Fish.
Dis. 2014,37, 401–405. [CrossRef] [PubMed]
29.
Zhang, X.; Zhong, M.; Zhou, R.; Qin, W.; Si, Y. Se (IV) reduction and extracellular biosynthesis of Nano-Se (0) by Shewanella
oneidensis MR-1 and Shewanella putrefaciens. Process Biochem. 2023,130, 481–491. [CrossRef]
30.
McRae, N.K.; Gaw, S.; Brooks, B.W.; Glover, C.N. Oxidative stress in the galaxiid fish, Galaxias maculatus, exposed to binary
waterborne mixtures of the pro-oxidant cadmium and the anti-oxidant diclofenac. Environ. Pollt. 2019,247, 638–646. [CrossRef]
31.
Hernández-Cruz, E.Y.; Amador-Martínez, I.; Aranda-Rivera, A.K.; Cruz-Gregorio, A.; Chaverri, J.P. Renal damage induced by
cadmium and its possible therapy by mitochondrial transplantation. Chem-Biol. Interact. 2022,361, 109961. [CrossRef]
32.
Imed, M.; Fatima, H.; Abdelhamid, K. Protective effects of selenium (Se) and zinc (Zn) on cadmium (Cd) toxicity in the liver of
the rat: Effects on the oxidative stress. Ecotox Environ. Safe 2009,72, 1559–1564. [CrossRef]
33.
Has-Schön, E.; Bogut, I.; Vukovi´c, R.; Galovi´c, D.; Bogut, A.; Horvati´c, J. Distribution and age-related bioaccumulation of lead
(Pb), mercury (Hg), cadmium (Cd), and arsenic (As) in tissues of common carp (Cyprinus carpio) and European catfish (Sylurus
glanis) from the Buško Blato reservoir (Bosnia and Herzegovina). Chemosphere 2015,135, 289–296. [CrossRef] [PubMed]
Fishes 2024,9, 230 14 of 14
34.
Buha, A.; Wallace, D.; Matovic, V.; Schweitzer, A.; Oluic, B.; Micic, D.; Djordjevic, V. Cadmium exposure as a putative risk factor
for the development of pancreatic cancer: Three different lines of evidence. Biomed. Res. Int. 2017,2017, 1981837. [CrossRef]
35.
Andjelkovic, M.; Buha Djordjevic, A.; Antonijevic, E.; Antonijevic, B.; Stanic, M.; Kotur-Stevuljevic, J.; Bulat, Z. Toxic effect of
acute cadmium and lead exposure in rat blood, liver, and kidney. Int. J. Environ. Res. Public Health 2019,16, 274. [CrossRef]
36.
Remyla, S.R.; Ramesh, M.; Sajwan, K.S.; Senthil Kumar, K. Influence of zinc on cadmium induced haematological and bio-chemical
responses in a freshwater teleost fish Catla catla. Fish. Physiol. Biochem. 2008,34, 169–174. [CrossRef] [PubMed]
37.
Riaz, M.A.; Nisa, Z.U.; Mehmood, A.; Anjum, M.S.; Shahzad, K. Metal-induced nephrotoxicity to diabetic and non-diabetic Wistar
rats. Environ. Sci. Pollut. Res. 2019,26, 31111–31118. [CrossRef] [PubMed]
38.
Sharma, P.; Verma, P.K.; Sood, S.; Yousuf, R.; Raina, R. Oxidative renal damage induced by fluoride and dimethoate and its
mitigation by Zingiber officinale in Wistar rats. Research Square 2022, preprint. [CrossRef]
39.
Zhao, Y.; Zhang, H.; Hao, D.; Wang, J.; Zhu, R.; Liu, W.; Liu, C. Selenium regulates the mitogen-activated protein kinase pathway
to protect broilers from hexavalent chromium-induced kidney dysfunction and apoptosis. Ecotox Environ. Safe. 2022,239, 113629.
[CrossRef]
40. Magnadóttir, B. Innate immunity of fish (overview). Fish. Shellfish. Immun. 2006,20, 137–151. [CrossRef]
41.
Gao, X.Q.; Fei, F.; Huo, H.H.; Huang, B.; Meng, X.S.; Zhang, T.; Liu, B.L. Impact of nitrite exposure on plasma biochemical
parameters and immune-related responses in Takifugu rubripes. Aquat. Toxicol. 2020,218, 105362. [CrossRef]
42.
Jia, R.; Liu, B.L.; Han, C.; Huang, B.; Lei, J.L. Effects of ammonia exposure on stress and immune response in juvenile turbot
(Scophthalmus maximus). Aquac. Res. 2017,48, 3149–3162. [CrossRef]
43.
Yazdi, M.H.; Mahdavi, M.; Setayesh, N.; Esfandyar, M.; Shahverdi, A.R. Selenium nanoparticle-enriched Lactobacillus brevis
causes more efficient immune responses
in vivo
and reduces the liver metastasis in metastatic form of mouse breast cancer. J.
Pharm. Sci. 2013,21, 1–9. [CrossRef]
44.
Kong, Y.; Gao, C.; Du, X.; Zhao, J.; Li, M.; Shan, X.; Wang, G. Effects of single or conjoint administration of lactic acid bacteria as
potential probiotics on growth, immune response and disease resistance of snakehead fish (Channa argus). Fish. Shellfish. Immun.
2020,102, 412–421. [CrossRef]
45. Muller, W.A. Mechanisms of transendothelial migration of leukocytes. Circ. Res. 2009,105, 223–230. [CrossRef]
46.
Muller, W.A. How endothelial cells regulate transmigration of leukocytes in the inflammatory response. Am. J. Pathol. 2014,184,
886–896. [CrossRef]
47. Ferrante, A.W., Jr. The immune cells in adipose tissue. Diabetes Obes. Metab. 2013,15, 34–38. [CrossRef]
48. Gaffen, S.L. An overview of IL-17 function and signaling. Cytokine. 2008,43, 402–407. [CrossRef]
49.
Zhao, L.; Tang, Y.; You, Z.; Wang, Q.; Liang, S.; Han, X.; Ma, X. Interleukin-17 contributes to the pathogenesis of autoimmune
hepatitis through inducing hepatic interleukin-6 expression. PLoS ONE 2011,6, e18909. [CrossRef]
50.
Xu, X.; Zhang, S.; Song, X.; Hu, Q.; Pan, W. IL-17 enhances oxidative stress in hepatocytes through Nrf2/keap1 signal pathway
activation. Int. J. Clin. Exp. Patho. 2018,11, 3318.
51.
Chen, D.; Shen, F.; Liu, J.; Tang, H.; Teng, X.; Yang, F.; Liu, H. Luteolin enhanced antioxidant capability and induced pyroptosis
through NF-
κ
B/NLRP3/Caspase-1 in splenic lymphocytes exposure to ammonia. Sci. Total Environ. 2024,919, 170699. [CrossRef]
[PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
