No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Synthetic peptides-based SPR biosensor evaluation towards canine Visceral leishmaniasis diagnosis: A simple and effective approach
Abstract
A vital component of surface plasmon resonance (SPR) biosensors is the recognition element. It generates the sensor selectivity towards the target biomarker and plays an important role in defining the sensor’s analytical sensitivity. In serological diagnostics, recombinant proteins (purified antigens) have presented better selectivity compared to soluble crude antigens in SPR immunosensors. However, recombinant DNA technology to obtain proteins is only explored by specialized laboratories, and commercial recombinant proteins still have a high cost. Thus, with the aim of developing a much simpler and lower-cost method, we investigated the prospect of using synthetic peptides as recognition elements for constructing an SPR biosensor. Two synthetic peptides, named PEP13 and PEP16, were tested for the serological diagnosis of Canine Visceral Leishmaniasis (CVL), an endemic neglected disease that affects humans and dogs worldwide. Between the two peptides tested, PEP13 was more sensitive when evaluating its responses against purified antibodies in buffer solution (LOD = 1.05 nmol L-1); and it also discriminated the response better when applied in diluted serum samples of infected dogs compared to diluted healthy dogs’ samples. For this reason, the PEP13 immunosensor was applied to analyze canine serum samples, precisely identifying all the positive (n = 7) and negative (n = 7) CVL cases (p = 0.00136) in less than 12 min. In brief, this study explored promising biostructures through a simple and fast methodology for serological diagnosis, addressing the suitability of synthetic peptides for use in biosensors in the urgent field of neglected diseases.
... A.X. Mendes et al. Talanta 294 (2025) 128143 BSA can also interfere with specific biomolecular interactions due to its size and surface distribution [50], and it significantly affects biosensor performance due to its passivating properties [14]. Also, BSA does not prevent fouling activity, often requiring sample dilution to lower matrix effects, which was also observed in the electrochemical-based NGF sensors. ...
Leishmaniasis remains a significant public health challenge, particularly in endemic regions with limited resources. Traditional diagnostic methods, including microscopy, culture, and serology, though widely utilized, often suffer from limitations such as variable sensitivity, time delays, and the need for specialized infrastructure. Some of these limitations have been addressed with the emergence of molecular diagnostic techniques. Quantitative PCR (q-PCR), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA) assays have improved the diagnostic sensitivity and specificity, enabling species identification and detection of asymptomatic infections. Further, nanodiagnostics and portable sequencing technologies such as the MinION™, along with lab-on-chip platforms, are revolutionizing the diagnostic landscape of leishmaniasis by offering point-of-care (POC) options for remote settings and field-based diagnosis. This review provides an in-depth analysis of these cutting-edge advances, discusses their application in resource-constrained settings, and evaluates their potential to reshape the future of leishmaniasis diagnosis and management.
Significant populations in tropical and sub-tropical locations all over the world are severely impacted by a group of neglected tropical diseases called leishmaniases. This disease is caused by roughly 20 species of the protozoan parasite from the Leishmania genus. Disease prevention strategies that include early detection, vector control, treatment of affected individuals, and vaccination are all essential. The diagnosis is critical for selecting methods of therapy, preventing transmission of the disease, and minimizing symptoms so that the affected individual can have a better quality of life. Nevertheless, the diagnostic methods do eventually have limitations, and there is no established gold standard. Some disadvantages include the existence of cross-reactions with other species, and limited sensitivity and specificity, which are mostly determined by the type of antigen used to perform the tests. A viable alternative for a more precise diagnosis is the application of recombinant antigens, which have been generated using bioinformatics approaches and have shown increased diagnostic accuracy. This approach proves valuable as it spans from epitope selection to predicting the interactions within the antibody–antigen complex through docking analysis. As a result, identifying potential new antigens using bioinformatics resources becomes an effective technique since it may result in an earlier and more accurate diagnosis. Consequently, the primary aim of this review is to conduct a comprehensive overview of the most significant in silico tools developed over time, with a focus on evaluating their efficacy and exploring their potential applications in optimizing the selection of highly specific molecules for a more effective diagnosis of leishmaniasis.
Neglected tropical diseases are those caused by infectious agents or parasites and are considered endemic in low-income populations. These diseases also have unacceptable indicators and low investment in research, drug production, and control. Tropical diseases such as leishmaniasis are some of the main causes of morbidity and mortality around the globe. Electrochemical immunosensors are promising tools for diagnostics against these diseases. One such benefit is the possibility of assisting diagnosis in isolated regions, where laboratory infrastructure is lacking. In this work, different peptides were investigated to detect antibodies against Leishmania in human and canine serum samples. The peptides evaluated (395-KKG and 395-G) have the same recognition site but differ on their solid-binding domains, which ensure affinity to spontaneously bind to either graphene oxide (GO) or graphene quantum dots (GQD). Cyclic voltammetry and differential pulse voltammetry were employed to investigate the electrochemical behavior of each assembly step and the role of each solid-binding domain coupled to its anchoring material. The graphene affinity peptide (395-G) showed better reproducibility and selectivity when coupled to GQD. Under the optimized set of experimental conditions, negative and positive human serum samples responses were distinguished based on a cut-off value of 82.5% at a 95% confidence level. The immunosensor showed selective behavior to antibodies against Mycobacterium leprae and Mycobacterium tuberculosis, which are similar antibodies and potentially sources of false positive tests. Therefore, the use of the graphene affinity peptide as a recognition site achieved outstanding performance for the detection of Leishmania antibodies.
Graphical Abstract
Serological methods should meet the needs of leishmaniasis diagnosis due to their high sensitivity and specificity, economical and adaptable rapid diagnostic test format, and ease of use. Currently, the performances of serological diagnostic tests, despite improvements with recombinant proteins, vary greatly depending on the clinical form of leishmaniasis and the endemic area. Peptide-based serological tests are promising as they could compensate for antigenic variability and improve performance, independently of Leishmania species and subspecies circulating in the endemic areas. The objective of this systematic review was to inventory all studies published from 2002 to 2022 that evaluate synthetic peptides for serological diagnosis of human leishmaniases and also to highlight the performance (e.g., sensitivity and specificity) of each peptide reported in these studies. All clinical forms of leishmaniasis, visceral and tegumentary, and all Leishmania species responsible for these diseases were considered. Following PRISMA statement recommendations, 1,405 studies were identified but only 22 articles met the selection criteria and were included in this systematic review. These original research articles described 77 different peptides, of which several have promising performance for visceral or tegumentary leishmaniasis diagnosis. This review highlights the importance of and growing interest in synthetic peptides used for serological diagnosis of leishmaniases, and their performances compared to some widely used tests with recombinant proteins.
Cutaneous leishmaniasis (CL) is one of the illnesses caused by Leishmania parasite infection, which can be asymptomatic or severe according to the infecting Leishmania strain. CL is commonly diagnosed by directly detecting the parasites or their DNA in tissue samples. New diagnostic methodologies target specific proteins (biomarkers) secreted by the parasite during the infection process. However, specific bioreceptors for the in vivo or in vitro detection of these novel biomarkers are rather limited in terms of sensitivity and specificity. For this reason, we here introduce three novel peptides as bioreceptors for the highly sensitive and selective identification of acid phosphatase (sAP) and proteophosphoglycan (PPG), which have a crucial role in leishmaniasis infection. These high-affinity peptides have been designed from the conservative domains of the lectin family, holding the ability to interact with the biological target and produce the same effect than the original protein. The synthetic peptides have been characterized and the affinity and kinetic constants for their interaction with the targets (sAP and PPG) have been determined by a surface plasmon resonance biosensor. Values obtained for KD are in the nanomolar range, which is comparable to high-affinity antibodies, with the additional advantage of a high biochemical stability and simpler production. Pep2854 exhibited a high affinity for sAP (KD = 1.48 nM) while Pep2856 had a good affinity for PPG (KD 1.76 nM). This study evidences that these peptidomimetics represent a novel alternative tool to the use of high molecular weight proteins for biorecognition in the diagnostic test and biosensor devices for CL.Graphical abstract
The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH2]6 ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10⁻⁶ to 10⁻²¹ M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.
Background
The search for diagnostic biomarkers has been profiting from a growing number of high quality sequenced genomes and freely available bioinformatic tools. These can be combined with wet lab experiments for a rational search. Improved, point-of-care diagnostic tests for visceral leishmaniasis (VL), early case detection and surveillance are required. Previous investigations demonstrated the potential of IgG1 as a biomarker for monitoring clinical status in rapid diagnostic tests (RDTs), although using a crude lysate antigen (CLA) as capturing antigen. Replacing the CLA by specific antigens would lead to more robust RDTs.
Methodology
Immunoblots revealed L. donovani protein bands detected by IgG1 from VL patients. Upon confident identification of these antigens by mass spectrometry (MS), we searched for evidence of constitutive protein expression and presence of antigenic domains or high accessibility to B-cells. Selected candidates had their linear epitopes mapped with in silico algorithms. Multiple high-scoring predicted epitopes from the shortlisted proteins were screened in peptide arrays. The most promising candidate was tested in RDT prototypes using VL and nonendemic healthy control (NEHC) patient sera.
Results
Over 90% of the proteins identified from the immunoblots did not satisfy the selection criteria and were excluded from the downstream epitope mapping. Screening of predicted epitope peptides from the shortlisted proteins identified the most reactive, for which the sensitivity for IgG1 was 84% (95% CI 60—97%) with Sudanese VL sera on RDT prototypes. None of the sera from NEHCs were positive.
Conclusion
We employed in silico searches to reduce drastically the output of wet lab experiments, focusing on promising candidates containing selected protein features. By predicting epitopes in silico we screened a large number of peptides using arrays, identifying the most promising one, for which IgG1 sensitivity and specificity, with limited sample size, supported this proof of concept strategy for diagnostics discovery, which can be applied to the development of more robust IgG1 RDTs for monitoring clinical status in VL.
In recent years, large amounts of peptides have been purified and characterized from food protein hydrolysates. Many of these peptides have been demonstrated to be of potential application as health‐improving ingredients against plenty of disease conditions, such as cancer, inflammation, and cardiovascular disease. The real efficacy of functional application of these peptides depends on their stability, transport, and bioavailability in target tissues, which in turn depends on the peptides characteristics. Therefore, the characteristic‐function parameters are crucial for peptides using as functional agents. This review article intends to summarize the effects of peptide characteristics, including molecular weight, charge and hydrophobicity, on their stability, intestinal transport, and in vitro bioavailability.
Practical applications
In the near future, bioactive peptides will play important roles in the area of functional foods and pharmacy. However, the gastrointestinal digestion and transport usually restrict their bioavailability in vivo. Understanding the relationships between peptide characteristics and their digestion stability, bioavailability may provide guidance and theoretical basis for the further application of bioactive peptides.
This article reviews essential topics of canine visceral leishmaniasis (CVL) due to Leishmania infantum infection. It focuses on the current serological and molecular diagnostic methods used in epidemiological research and veterinary clinics to diagnose CVL and includes new point-of-care (POC) tests under development. The efficacy of different treatment regimens on the clinical improvement and infectiousness of dogs is also addressed. In the last section, the review provides a critical appraisal of the effectiveness of different control measures that have been implemented to curb disease transmission.
Visceral leishmaniasis (VL), caused by the Leishmania donovani complex, is a vector-borne systemic disease, with a worldwide distribution causing high morbidity and mortality in the developing world. VL patients may be asymptomatic or they may present symptoms and findings of a systemic infection. The positive predictive value of clinical diagnosis in patients with typical symptoms is usually high, but more often, the signs and symptoms are inconclusive and mistaken with other co-endemic diseases. The fact that HIV co-infections often produce atypical presentations and the heterogeneity of Leishmania species, which is common in many endemic regions, also complicate the diagnosis. Despite that, some of the parasitological methods are still considered to be the reference standard for VL diagnosis due to their specificity. The development of serological and molecular tests has further enhanced the diagnostic approach of VL. Recombinant antigens have improved the performance of serodiagnostic tests, with DAT and the rK39 antigen based immunochromatographic test being the most appropriate methods for the serological diagnosis of VL. Molecular techniques, despite the fact that their implementation is often difficult and infeasible, have become increasingly relevant due to remarkable sensitivity and specificity, and to the variability of tested samples. Quantitative polymerase chain reaction (qPCR) has been shown to be superior than conventional PCR for the differentiation between active VL and asymptomatic infections, such as for the detection of VL-HIV coinfection. This review summarizes the available methods with their applications in the diagnosis of VL, and focuses on the recent developments in VL diagnostics.
Visceral leishmaniasis is the most severe form of leishmaniasis. Worldwide, approximately 20% of zoonotic human visceral leishmaniasis is caused by Leishmania infantum, also known as Leishmania chagasi in Latin America. Current diagnostic methods are not accurate enough to identify Leishmania-infected animals and may compromise the effectiveness of disease control. Therefore, we aimed to produce and test two recombinant multiepitope proteins as a means to improve and increase accuracy in the diagnosis of canine visceral leishmaniasis (CVL).
Ten antigenic peptides were identified by CVL ELISA in previous work. In the current proposal, the coding sequences of these ten peptides were assembled into a synthetic gene. Furthermore, other twenty peptides were selected from work by our group where good B and T cell epitopes were mapped. The coding sequences of these peptides were also assembled into a synthetic gene. Both genes have been cloned and expressed in Escherichia coli, producing two multiepitope recombinant proteins, PQ10 and PQ20. These antigens have been used in CVL ELISA and were able to identify asymptomatic dogs (80%) more effectively than EIE-LVC kit, produced by Bio-Manguinhos (0%) and DPP kit (10%). Moreover, our recombinant proteins presented an early detection (before PCR) of infected dogs, with positivities ranging from 23% to 65%, depending on the phase of infection in which sera were acquired.
Our study shows that ELISA using the multiepitope proteins PQ10 and PQ20 has great potential in early CVL diagnosis. The use of these proteins in other methodologies, such as immunochromatographic tests, could be beneficial mainly for the detection of asymptomatic dogs.
Background:
Poor access to diagnosis stymies control of visceral leishmaniasis (VL). Antibody-detecting rapid diagnostic tests (RDTs) can be performed in peripheral health settings. However, there are many brands available and published reports of variable accuracy.
Methods:
Commercial VL RDTs containing bound rK39 or rKE16 antigen were evaluated using archived human sera from confirmed VL cases (n = 750) and endemic non-VL controls (n = 754) in the Indian subcontinent (ISC), Brazil, and East Africa to assess sensitivity and specificity with 95% confidence intervals. A subset of RDTs were also evaluated after 60 days' heat incubation (37°C, 45°C). Interlot and interobserver variability was assessed.
Results:
All test brands performed well against ISC panels (sensitivity range, 92.8%-100%; specificity range, 96%-100%); however, sensitivity was lower against Brazil and East African panels (61.5%-91% and 36.8%-87.2%, respectively). Specificity was consistently > 95% in Brazil and ranged between 90.8% and 98% in East Africa. Performance of some products was adversely affected by high temperatures. Agreement between lots and readers was good to excellent (κ > 0.73-0.99).
Conclusions:
Diagnostic accuracy of VL RDTs varies between the major endemic regions. Many tests performed well and showed good heat stability in the ISC; however, reduced sensitivity against Brazilian and East African panels suggests that in these regions, used alone, several RDTs are inadequate for excluding a VL diagnosis. More research is needed to assess ease of use and to compare performance using whole blood instead of serum and in patients coinfected with human immunodeficiency virus.
As part of a World Health Organization-led effort to update the empirical evidence base for the leishmaniases, national experts provided leishmaniasis case data for the last 5 years and information regarding treatment and control in their respective countries and a comprehensive literature review was conducted covering publications on leishmaniasis in 98 countries and three territories (see 'Leishmaniasis Country Profiles Text S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11, S12, S13, S14, S15, S16, S17, S18, S19, S20, S21, S22, S23, S24, S25, S26, S27, S28, S29, S30, S31, S32, S33, S34, S35, S36, S37, S38, S39, S40, S41, S42, S43, S44, S45, S46, S47, S48, S49, S50, S51, S52, S53, S54, S55, S56, S57, S58, S59, S60, S61, S62, S63, S64, S65, S66, S67, S68, S69, S70, S71, S72, S73, S74, S75, S76, S77, S78, S79, S80, S81, S82, S83, S84, S85, S86, S87, S88, S89, S90, S91, S92, S93, S94, S95, S96, S97, S98, S99, S100, S101'). Additional information was collated during meetings conducted at WHO regional level between 2007 and 2011. Two questionnaires regarding epidemiology and drug access were completed by experts and national program managers. Visceral and cutaneous leishmaniasis incidence ranges were estimated by country and epidemiological region based on reported incidence, underreporting rates if available, and the judgment of national and international experts. Based on these estimates, approximately 0.2 to 0.4 cases and 0.7 to 1.2 million VL and CL cases, respectively, occur each year. More than 90% of global VL cases occur in six countries: India, Bangladesh, Sudan, South Sudan, Ethiopia and Brazil. Cutaneous leishmaniasis is more widely distributed, with about one-third of cases occurring in each of three epidemiological regions, the Americas, the Mediterranean basin, and western Asia from the Middle East to Central Asia. The ten countries with the highest estimated case counts, Afghanistan, Algeria, Colombia, Brazil, Iran, Syria, Ethiopia, North Sudan, Costa Rica and Peru, together account for 70 to 75% of global estimated CL incidence. Mortality data were extremely sparse and generally represent hospital-based deaths only. Using an overall case-fatality rate of 10%, we reach a tentative estimate of 20,000 to 40,000 leishmaniasis deaths per year. Although the information is very poor in a number of countries, this is the first in-depth exercise to better estimate the real impact of leishmaniasis. These data should help to define control strategies and reinforce leishmaniasis advocacy.
Zoonotic visceral leishmaniasis (VL) is a severe infectious disease caused by protozoan parasites of the genus Leishmania and the domestic dogs are the main urban parasite reservoir hosts. In Brazil, indirect fluorescence antibody tests (IFAT) and indirect enzyme linked immunosorbent assay (ELISA) using promastigote extracts are widely used in epidemiological surveys. However, their sensitivity and specificity have often been compromised by the use of complex mixtures of antigens, which reduces their accuracy allowing the maintenance of infected animals that favors transmission to humans. In this context, the use of combinations of defined peptides appears favorable. Therefore, they were tested by combinations of five peptides derived from the previously described Leishmania diagnostic antigens A2, NH, LACK and K39.
Combinations of peptides derived A2, NH, LACK and K39 antigens were used in ELISA with sera from 44 human patients and 106 dogs. Improved sensitivities and specificities, close to 100%, were obtained for both sera of patients and dogs. Moreover, high sensitivity and specificity were observed even for canine sera presenting low IFAT anti-Leishmania antibody titers or from asymptomatic animals.
The use of combinations of B cell predicted synthetic peptides derived from antigens A2, NH, LACK and K39 may provide an alternative for improved sensitivities and specificities for immunodiagnostic assays of VL.
Visceral leishmaniasis is the most severe form of leishmaniasis. Approximately 20% of zoonotic human visceral leishmaniasis worldwide is caused by Leishmania infantum, which is also known as Leishmania chagasi in Latin America, and disease incidence is increasing in urban and peri-urban areas of the tropics. In this form of disease, dogs are the main reservoirs. Diagnostic methods used to identify Leishmania infected animals are not able to detect all of the infected ones, which can compromise the effectiveness of disease control. Therefore, to contribute to the improvement of diagnostic methods for canine visceral leishmaniasis (CVL), we aimed to identify and test novel antigens using high-throughput analysis.
Immunodominant proteins from L. infantum were mapped in silico to predict B cell epitopes, and the 360 predicted peptides were synthesized on cellulose membranes. Immunoassays were used to select the most reactive peptides, which were then investigated with canine sera. Next, the 10 most reactive peptides were synthesized using solid phase peptide synthesis protocol and tested using ELISA. The sensitivity and specificity of these peptides were also compared to the EIE-LVC Bio-Manguinhos kit, which is recommended by the Brazilian Ministry of Health for use in leishmaniasis control programs. The sensitivity and specificity of the selected synthesized peptides was as high as 88.70% and 95.00%, respectively, whereas the EIE-LVC kit had a sensitivity of 13.08% and 100.00% of specificity. Although the tests based on synthetic peptides were able to diagnose up to 94.80% of asymptomatic dogs with leishmaniasis, the EIE-LVC kit failed to detect the disease in any of the infected asymptomatic dogs.
Our study shows that ELISA using synthetic peptides is a technique with great potential for diagnosing CVL; furthermore, the use of these peptides in other diagnostic methodologies, such as immunochromatographic tests, could be beneficial to CVL control programs.
Sol-gel synthesized nickel oxide (NiO) film deposited onto indium tin oxide (ITO) coated glass plate has been utilized for the development of sensitive and stable DNA biosensor and demonstrated for diagnosis of visceral leishmaniasis also known as Kala-azar. Leishmania specific sensor is developed by immobilizing 23mer DNA sequence (oligonucleotide) identified from 18S rRNA gene sequences from Leishmania donovani. Characterization studies like X-Ray Diffraction and Scanning Electron Microscopy revealed the formation of nano-structured NiO, while immobilization of single strand (ss)-DNA of Leishmania was supported by UV-visible, Fourier Transform Infrared Spectroscopy and Scanning Electron Microscopy techniques. Response studies of ss-DNA/NiO/ITO bioelectrode are carried out using differential pulsed voltammetry in presence of methylene blue redox dye as a redox mediator. A linear response is obtained in the wide concentration range of 2 pg ml(-1) to 2 μg ml(-1) of complementary target genomic DNA (disease DNA) within the variation of 10% for 5 sets of studies. The observed results hold promise not only for diagnosis of Kala-azar patients but also hold enormous potential of the nano-NiO based probe for development of stable and sensitive biosensors.
This is an IUPAC report on the definition and classification of electrochemical biosensors. It can serve as a primer on biosensors and includes details on construction, different sensor formats and transducer types.
The Leishmania donovani complex is considered to be composed of 3 species; L. donovani, L. infantum and L. chagasi, although this classification has been challenged. Genotypic relationships within the complex were evaluated at different levels by: binding of the probe Lmet9, specific for L. chagasi and Old World Leishmania spp.; partial sequencing of a constitutive major surface protease single gene (mspC) and random amplification of polymorphic DNA (RAPD). The Old World Leishmania spp. and the L. donovani complex have a monophyletic origin. Leishmania chagasi clearly belongs to the L. donovani complex but it is indistinguishable from L. infantum, which suggests introduction of L. chagasi into the New World in recent history. Leishmania infantum/L. chagasi was identified as a monophyletic group within the L. donovani complex but L. donovani may be paraphyletic. Diversity within L. donovani is substantial and phylogeographical patterns of association were found.
This reference provides an update on current therapies to treat neglected diseases, a class of diseases that primarily affect tropical regions where investment in research and development is limited. The book starts with an introduction to neglected diseases followed by reviews of therapeutic strategies to overcome the impact of neglected diseases. This is followed by updated information for handling leprosy, dengue, lymphatic filariasis, dracunculiasis, helminthiasis, Chagas disease, neurocysticercosis, leishmaniasis, rabies, trematodiasis, buruli ulcer and trachoma in 10 focused chapters, respectively. The chapters provide information on disease mechanism, transmission and management protocols, along with scientific references. The book serves as a resource for healthcare professionals, and scholars who need a detailed understanding of these infectious diseases.
Nowadays, the biosensor-based detection system is developing rapidly in different fields because of the high selectivity of different recognition elements. A typical calibration needs univariate regression to correspond the value of analyte signal response with its concentrations. Although the emergence of the noninvasive biosensor, unexpected interfering effects from miscellaneous compounds in the sample increase the detection uncertainty of the sensors. Chemometrics play a pivotal role in extracting relevant information to detect and investigate desired compounds with improved accuracy and efficiency. This review primarily provides the advantages and disadvantages of some key bio-receptors and non-bio-receptors, also their typical detection approaches, followed by explicit attention to their progress. Then discuss different chemometrics methods, which were bridged in developing electrochemical, fluorescence, and image-based food bio-sensor in the past five years. This study offers a new prospect to engineer new biosensors in food applications integrated with suitable chemometrics for the onsite investigation of food safety.
Visceral leishmaniasis is a neglected disease caused by protozoan parasites of the genus Leishmania. The successful control of the disease depends on its accurate and early diagnosis, which is usually made by combining clinical symptoms with laboratory tests such as serological, parasitological, and molecular tests. However, early diagnosis based on serological tests may exhibit low accuracy due to lack of specificity caused by cross-reactivities with other pathogens, and sensitivity issues related, among other reasons, to disease stage, leading to misdiagnosis. In this work was investigated the use of mid-infrared spectroscopy and multivariate analysis to perform a fast, accurate, and easy canine visceral leishmaniasis diagnosis. Canine blood sera of 20 non-infected, 20 Leishmania infantum, and 8 Trypanosoma evansi infected dogs were studied. The data demonstrate that principal component analysis with machine learning algorithms achieved an overall accuracy above 85% in the diagnosis.
This article is protected by copyright. All rights reserved.
The field of capacitive biosensors has grown significantly since the last comprehensive assessment by Daniels et al. in 2007. Here we how new trends in molecular imprinting, nanotechnology and microfluidics are now being exploited and demonstrate how capacitive biosensors are on the verge of becoming clinically relevant. We also shed light on recent developments in terms of test-setup, surface chemistry and test solutions.
Leishmania parasite identification is very important in clinical studies of leishmaniasis and its diagnosis. Though there are various clinical and epidemiological approaches to identifying Leishmania infantum, due to some limitations of the traditional methods, sensitive and specific techniques are needed and are in great demand. To achieve selective and rapid detection, a sensitive signal transducer with high surface area is necessary. In this work, a new paper sensor was fabricated using silver nanoprisms electrodeposited on the GQD conductive nano-ink (Ag NPr/GQDs nano-ink). A high surface area and suitable interface for anchoring biomolecules was achieved by electrodepositing gold nanoparticles (AuNPs) functionalized with cysteamine (AuNPs-CysA) on the surface of the paper sensor altered by Ag NPr/GQDs nano-ink. To prepare a sensitive and selective bio-device for the recognition of Leishmania in human plasma specimens, a DNA-thiol probe was stabilized on the surface of the platform. Hybridization of DNA was evaluated by chronoamperometry (ChA). The engineered DNA-based paper biosensor showed high sensitivity and selectivity for the identification of Leishmania genomic DNA. Under optimum circumstances, a linear range was obtained using photographic paper from 1 μM to 1 zM and an ivory sheet from 1 nM to 1 zM. The lower limits of quantitation (LLOQ) on the photographic paper and ivory sheet were 1 zM. In addition, the designed DNA-based biosensor revealed well-defined performance in the recognition of mismatched sequences (single base, two base and three base mismatches) and selectivity.
In this work, a dual detection system based on an impedimetric immunosensor was developed for the first time for the simultaneous detection of anti-Trypanosoma cruzi and anti-Leishmania infantum antibodies in human and dog serum samples. The IBMP 8.1 and rLci1A/rLci2B recombinant antigens were immobilized over the surface of dual screen-printed carbon electrodes (W1 and W2) modified with poly (4-hydroxyphenylacetic acid). Under optimized conditions, the immunosensor recognized specific interactions for anti-T. cruzi antibodies up to a dilution of 1:10,240 and for anti-L. infantum up to 1:5,120 in canine serum samples. Relative standard deviation (RSD) values of 2.8% for W1 and 3.6% for W2 were obtained for T. cruzi (W1) and L. infantum antigen (W2) samples in three different electrodes for 3 days (n = 9). The immunosensor was stored at 4 °C for 8 weeks, with activity retention of 70.2% in W1 and 78.2% in W2. The results using the recombinant proteins revealed that all antigens discriminated between negative and positive samples (p < 0.0001) in both dog and human groups, as well as no cross-reactivity could be detected among sera with other infections. With this approach, immunosensor-based diagnostic tests achieved 100% accuracy, suggesting that the antigens are eligible to enter Phase-II studies.
Leishmania donovani (a causative agent of visceral leishmaniasis) poses a serious health threat to the human population is fatal if left untreated. The life cycle of Leishmania alternates between vertebrate host and Phlebotomine fly as intermediate ones. The difficulties linked to vector (sandfly) control and the lack of an effective vaccine, the control of leishmaniasis relies mostly on chemotherapy. Unfortunately, the prevalence of parasites becoming resistant to the first‐line drug pentavalent antimonial (SbV)/sodium antimony gluconate (SAG) and some other antileishmanial drug is increasing in several parts of the world. With the alarming rise of drug resistance and other issues related to VL, there is an urgent need to focus on early detection and quick diagnosis of VL case. Therefore, we have reviewed most of the methods used in the diagnostic process of VL. Along with existing diagnostic methods, developing more effective and sensitive diagnostic methods and biomarkers is also vital for enhancing VL identification and control programs. This review gathers the comprehensive information on diagnostics methods of VL under a single umbrella that could be the prominent tools for the development of rapid, accurate and cost effective diagnostic kits for VL which can be used in field conditions.
Effective diagnosis and treatment of visceral leishmaniasis, together with the study of vectors and reservoirs, can lead to a better understanding of the parasite transmission dynamics and the development of more efficient control measures. Recent studies have applied new methodologies and biomarkers, and these have contributed to the early and rapid diagnosis of the disease; assessment of success of pharmacological treatments; efficient monitoring of immunosuppressed individuals; and to population screening for field trials of vaccine efficacy. This opinion article proposes an update to the diagnostic tools for visceral leishmaniasis and their rational and combined use to establish the real prevalence of infection or of exposure to Leishmania in endemic areas.
An alternative label-free electrochemical immunosensor for the rapid detection of Leishmania braziliensis was developed by immobilizing a peptide-based probe of the promastigote surface antigen (PSA-38S) onto electrospun polyamide-6 (PA6)/chitosan nanofibers. An increase in chitosan content in the spinning solution leads to a decrease in the diameter of the formed fibers, whereas the differential scanning calorimetry (DSC) and X-ray diffraction (XRD) data showed a decrease in crystallinity upon increasing the chitosan content in the formulation. In addition, the incorporation of chitosan into the PA6 nanofibers tends to decrease the resistance to the charge-transfer process at the electrode surface. A 40 wt% chitosan content was used for immobilization of the peptide antigen, which was characterized by scanning electron microscopy (SEM) and electrochemical impedance spectroscopy (EIS). The detection was performed by measuring the relative change in impedance before and after the anti-Leishmania braziliensis reaction by EIS. Under the optimized conditions, the relative change in impedance was proportional to the logarithmic value of PSA concentrations in the range of 2.5 to 10 pgmL-1 (r2= 0.9946) with a detection limit of 0.2 pgmL-1, which was slightly lower than that of the enzyme-linked immunosorbent assay (ELISA). Additionally, the sensor was tested against two nonspecific antibodies (T. cruzi and β-actin), whereas multivariate analysis using unsupervised pattern recognition through principal component analysis was successfully applied to identification of pattern relative to each antibody. Finally, the optimized electrochemical immunoassay can be a favorable approach for Leishmania detection tests, as it is able to differentiate negative and positive Visceral leishmaniasis human serum samples.
The phenomenon of surface plasmon resonance (SPR) through optical sensors was developed from initial studies involving excitation of surface plasmons on metallic substrates. From the beginning, these optical systems have attracted increasing interest for application in different areas, ranging from physics, chemistry, and materials science to biology. Although numerous applications have been explored, the use of SPR in the development of biosensors is by far the most prominent. This review provides a brief account of fundamental aspects related to the recent applications of SPR as a tool for the development of new clinical diagnosis methods. The applications of SPR biosensors were illustrated through recent studies published in the field of neglected tropical diseases, with an emphasis on the contributions achieved in visceral leishmaniasis. It was possible to demonstrate the real benefits and the difficulties that the SPR biosensors have encountered in this important and complex system. Finally, future trends in the use of nanomaterials for the development of SPR-based portable devices for application to neglected tropical diseases have been demonstrated.
Latin America encompasses diverse geographical, cultural and socio-economic conditions, which are reflected in the challenges for infectious disease control in the region. One of the most significant regional infectious diseases for humans and domestic dogs is leishmaniasis, occurring as visceral leishmaniasis (VL) caused by Leishmania infantum (syn. L. chagasi) transmitted by sand flies (Lutzomyia longipalpis) and with a canine reservoir, and the more common cutaneous leishmaniasis (CL) involving multiple Leishmania spp. (particularly L. braziliensis), sand fly vectors and reservoir hosts. VL is spreading within Latin America for reasons related to mass migration of human and canine populations, with incursion into novel environments (e.g. related to deforestation) coupled with a background of poverty and poor public health infrastructure. The challenges for control of VL also include: (1) the accurate identification of infected dogs (particularly subclinically infected dogs) with the current reliance on serological rather than molecular diagnostic methods, (2) controversy surrounding the ethics and efficacy of culling of seropositive dogs, (3) the limited efficacy of currently available canine vaccines and their potential to interfere with interpretation of serological testing, (4) the expense associated with distribution of insecticidal dog collars, which may prove to be the most valuable control method, and (5) the cost and therefore accessibility of licensed medical treatment for canine leishmaniasis by the general population. Resolution of these isssues will necessitate a ‘One Health’ approach to co-ordination of resources between human and veterinary healthcare.
Electrochemical impedance spectroscopy (EIS) is a powerful technique that is used for characterizing electrochemical systems. The EIS data can be correlated with many key physical properties, including rates of diffusion and reaction, and microstructural features. However, the EIS analysis is prone to the potential ambiguities in interpretation. Judicious modeling and its combination with statistics can be used to overcome these challenges and enhance the insight one can gain from EIS.
Introduction: Optical biosensors and particularly those based on nanoplasmonics technology have emerged in recent decades as a potential solution for disease diagnostics and therapy follow-up at the point-of-care. These biosensor platforms could overcome some of the challenges faced in conventional diagnosis techniques offering label-free assays with immediate results and employing small and user-friendly devices.
Areas covered: In this review, we will provide a critical overview of the recent advances in the development of nanoplasmonic biosensors for point-of-care diagnostics. We focus on those systems with demonstrated capabilities for integration in portable platforms, highlighting some of the most relevant diagnostics applications targeting proteins, nucleic acids, and cells as disease biomarkers.
Expert Commentary: Despite the attractive features of label-free nanoplasmonic sensors in terms of miniaturization and analytical robustness, the route towards an effective clinical implementation involves the integration of fully automated microfluidic systems for sample processing and analysis, and the optimization of surface biofunctionalization procedures. Additionally, the development of multiplexed sensors for high-throughput analysis and including specific neoantigens and novel biomarkers in detection panels, will provide the means for delivering a powerful analytical technology for an accurate and improved medical diagnosis.
Visceral leishmaniasis (VL) is a neglected tropical disease with dogs serving as reservoirs for one of its etiological agents, Leishmania infantum. In Brazil, VL control involves culling of seropositive dogs, among other actions. However, the most employed serological tests lack accuracy, and are not able to detect canine visceral leishmaniasis (CVL) during the early stages of infection. Early detection of CVL is highly desirable in order to shorten the contact time between the infected reservoirs and the vectors. In this study, we investigated the ability of two multiepitope proteins, PQ10 and PQ20, to detect CVL at earlier stages than currently employed methods, including ITS-1 conventional PCR. Using serum samples from naturally infected dogs, we observed that ELISA-PQ10 and ELISA-PQ20 were able to detect Leishmania infection at earlier time points as compared with kDNA PCR-RFLP in anti-IgG and anti-IgM assays. Using sera from experimentally infected dogs, we monitored seroconversion using multiepitope proteins, ELISA-crude antigen, as well as ITS-1 conventional and real-time PCR. While seroconversion was detected by ELISA-crude antigen in 16.6% of the dogs, multiepitope proteins were able to detect seroconversion in more than 80% of them. Moreover, the ability of ELISA-PQ10 and ELISA-PQ20 to detect Leishmania infection at earlier time points as compared with conventional PCR was also confirmed in experimental infection dogs’ sera. Immunofluorescence to Babesia canis and Ehrlichia canis did not show cross-reactions with ELISA-PQ10/PQ20 positive samples. Results of real-time PCR and ELISA with multiepitope proteins were very similar, with concordances between 80 and 100%. Furthermore, our findings indicated that PQ10 and PQ20 immunoassays can be related to parasite load. ELISA-PQ10 and ELISA-PQ20 are more sensitive diagnostic tools for early CVL detection as compared with other methods They could potentially be used in screening tests due to easy execution and low costs facilities.
A photoelectrochemical immunosensor for the detection of anti-Leishmania infantum antibodies based on zinc oxide and cadmium sulfide films electrodeposited on an ITO-coated glass slide (CdS/ZnO/ITO) has been proposed. The effects of light/dark conditions and the kinetics of CdS sensitizer regeneration were evaluated by scanning electrochemical microscopy in feedback mode. The platform was modified using two different peptides (PEP 13 and PEP 16) from two different proteins of high specificity and selectivity toward recognition of L. infantum antibodies, producing Peps/CdS/ZnO/ITO. This photoelectrochemical immunosensor provides a cheap and promising method of discriminating between positive and negative canine serum samples.
SPR is a real-time, label-free measurement of binding kinetics and affinity. Success of SPR biosensor is evident by the growing number of commercially available instruments. In the current review, development in plasmon resonance techniques such as SPR, SPR-imaging (microscope, spectroscope, Electrochemical Impedance), Nanoplasmonics and microfluidics, membrane proteins: receptor studies, sensors based on polarization and interferometery, PWR, SPR-MS, Signal locked SPR, FOPPR, Mid-IR SPR, trends in protein array technology and point-of-care (POC) testing over last decade are summarized. In addition, advancement over sensor configuration, mechanism and immobilization techniques are also discussed. Advantage and disadvantage of each methodology is provided along with some of the latest accomplishments.
Recognition elements, also known as target receptors, are important parts of chemical sensors and biosensors since they are responsible for the recognition of target analytes of interest. Although recent recognition elements were synthesized in the laboratory or selected in vitro, their combination with nanomaterials also aroused the interest of researchers due to improvements in the analytical performance of chemical sensors and biosensors as a consequence of the enhanced properties of such nanostructures. This review discusses recent developments in recognition elements, both classical, such as enzymes and antibodies, and recent, such as aptamers and phages, integrated into chemical sensors and biosensors the food, clinical and environmental fields.
Experiments were run to determine the inherent wettability of gold by water. Measurements in pure steam at 101° gave a contact angle on gold of about 65° after 23,648 hr of continuous condensation. Radiotracer studies with oleic acid added to the refluxing water showed 0.209 monolayer on filmwise copper and 0.013-0.015 monolayer ou dropwise gold, indicating that the nonwetting behavior of gold is not caused by organic contamination. The average contact angle on freshly electropolished gold surfaces was found to be 62.6 ± 3.4°. Heating experiments in quartz apparatus showed three sources of erroneously low contact angles that could readily be present in this type of experiment: (1) inorganic contamination of the surface; (2) surface roughness; and (3) equilibrium not established with water vapor. Cumulative evidence indicates that the equilibrium contact angle of water on a clean, smooth gold surface is between 60 and 65°.
This review outlines the theoretical background of impedimetric biosensors and presents different types of impedimetric immunosensors along with the instrumental approaches that have been so far proposed in the literature for the evaluation of their performance. The electrode assemblies have been classified in four main categories with respect to the electrode material, the type of the insulating layer and the immobilization platform that have been used for their construction. Additionally, some selected works on recent developments in immunosensors, which are based on polymer degradation phenomena, magnetic nanobeads, etc. as well as strategies for the amplification of the measuring signals, are also presented.
The deleterious effect that biofouling has on sensor stability is a serious impediment to the development of long term implanted biosensors. This paper reviews the surface modification strategies currently employed to minimize membrane biofouling of in vivo sensors. Nine sensor modifications are discussed herein: hydrogels, phospholipid-based biomimicry, flow-based systems, Nafion, surfactants, naturally derived materials, covalent attachments, diamond-like carbons, and topology.
An overview is given of the preparation, formation, structure, and applications of self-assembled monolayers (SAMs) formed from alkanethiols (and derivatives of alkanethiols) on gold, silver, copper, palladium, platinum, mercury, and alloys of these metals. Emphasis is on advances made in this area over the past five years (1999-2004). First, the structure and mechanism of formation of SAMs formed by adsorption of n-alkanethiols on metals are described. Following this, the applications of SAMs where they act as nanostructures themselves, enable other nanosystems, interact with biological nanostructures, and form patterns on surfaces with critical dimensions below 100 nm are outlined. Furthermore, an attempt is made to outline what is not understood about these SAMs and which of their properties are not yet controlled. Finally, some of the important opportunities that still remain for future progress in research involving SAMs are sketched.
Over the past 5 years, more than 100 SPR biosensors for the detection of a variety of chemical and biological analytes were demonstrated. Most of these biosensors are based on prism coupling and angular or wavelength spectroscopy of surface plasmons. Commercial SPR systems have played an important role in the development of detection applications due to their increasing spread and the availability of special SPR platforms and kits dedicated to specific applications (e.g., Biacore Q for food analysis). Data collected in Tables 1-3 illustrate recent applications of SPR biosensors and achieved levels of performance. The performance figures should be compared with caution as performance of an SPR biosensor is a result of a multitude of factors (performance of optical platform, characteristics of the employed biorecognition element, suitability and degree of optimization of the immobilization method, detection format, and methodology), and thus low performance of one part of the biosensor (e.g., optical platform) can be compensated for by high performance of another component (e.g., biorecognition elements). Clearly, analytes implicated in food safety have received the most attention (Table 1). Bacterial pathogens such as E. coli and Salmonella were the most frequently targeted analytes. Detection limits below 102 bacteria/mL were reported. A great deal of research has been devoted to the development of SPR biosensors for other significant groups of analytes such as Staphylococcal enterotoxins (best demonstrated LODs < 1 ng/mL and antibiotics (best LODs < 1-10 ng/ mL depending on the substance). Several analytes have been detected also in complex food matrices. In the field of medical diagnostics (Table 2), the most attention has been paid to the development of SPR sensors for the detection of cancer markers (best LODs < 1-100 ng/mL) and antibodies (best LODs < 1-100 ng/mL). However, most of the detection experiments were performed in buffers rather than in clinical samples. The development of SPR biosensors for environmental monitoring (Table 3) has focused mainly on the detection of pesticides. The best LODs ranged from 1 to 100 pg/mL, depending on the analyte. Detection experiments were performed in buffers or real-world water samples. Conclusions: In the past, 5 years, SPR biosensor technology has made substantial advances in terms of both sensor hardware and biospecific coatings. SPR biosensors have been applied for the detection of a variety of chemical and biological analytes. We envision that the performance of SPR biosensor technology will continue to evolve and that advanced SPR sensor platforms combined with novel biospecific surfaces with high resistance to the nonspecific binding will lead to robust SPR biosensors enabling rapid, sensitive, and specific detection of chemical and biological analytes in complex samples in the field. These biosensors will benefit numerous important sectors such as medical diagnostics, environmental monitoring, and food safety and security. Abbreviations: ATR, attenuated total reflection; CCD, charge-coupled device; DNA, deoxyribonucleic acid; ELISA, enzyme-linked immunosorbent assay; LED, light-emitting diode; LOD, limit of detection; MALDI-TOF, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; RIU, refractive index unit; RNA, ribonucleic acid; scFvs, single-chain antibody fragment; SAM, self-assembled monolayer; SP, surface plasmon; SPR, surface plasmon resonance; WDM, wavelength division multiplexing.